ENZYMATIC TRANSPHOSPHORYLATION OF SUGAR SUBSTRATES
20180148753 ยท 2018-05-31
Inventors
- Vaidotas Navickas (Mannheim, DE)
- Kai-Uwe Baldenius (Mannheim, DE)
- Michael Breuer (Darmstadt, DE)
- Patricia Wildberger (Wiener Neudorf, AT)
- Martin Pfeiffer (Graz, AT)
- Bernd Nidetzky (Graz, AT)
Cpc classification
C12P19/26
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to methods of producing sugar phosphates by enzymatic transphosphorylation, wherein the phosphoryl transfer from phosphate donor substrates to sugar substrates is catalyzed by an enzyme having alpha-glucose-1-phosphatase activity. Furthermore, the present invention relates to a biocatalyst having sucrose phosphorylase as well as alpha-glucose-1-phosphatase activity and its use. The production of an enzyme having alpha-glucose-1-phosphatase activity and its use in the transphosphorylation of sugar substrates is also presented herein.
Claims
1.-9. (canceled)
10. A method of producing one or more sugar phosphates by enzymatic transphosphorylation comprising: (i) providing one or more sugar substrates selected from the group consisting of aldoses and ketoses, (ii) providing one or more phosphate donor substrates selected from the group consisting of phosphorylated carbohydrates, (iii) providing an alpha-glucose-1-phosphatase or an enzyme having alpha-glucose-1-phosphatase activity, (iv) incubating the one or more sugar substrates provided in step (i) and the one or more phosphate donor substrates provided in step (ii) with the alpha-glucose-1-phosphatase or, respectively, the enzyme having alpha-glucose-1-phosphatase activity provided in step (iii) under conditions which allow transphosphorylation to obtain one or more sugar phosphates, (v) optionally, purifying the one or more sugar phosphates obtained in step (iv).
11. The method according to claim 10, wherein the one or more sugar substrate is selected from the group consisting of glucose, glucosamine, N-acetyl glucosamine, fructose, galactose, fucose, mannose, sorbose, xylose, arabinose, xylitol, arabitol, rhamnose and N-acetyl neuraminic acid.
12. The method according to claim 10, wherein the one or more phosphate donor substrate is selected from the group consisting of alpha-glucose-1-phosphate, glucose-6-phosphate, fructose-6-phosphate and fructose-1-phosphate.
13. The method according to claim 10, wherein the phosphate donor substrate or one of the phosphate donor substrates provided in step (ii) is alpha-glucose-1-phosphate.
14. The method according to claim 13 wherein step (ii) comprises an enzymatic conversion of sucrose to D-fructose and alpha-D-glucose-1-phosphate by a sucrose phosphorylase or an enzyme having sucrose phosphorylase activity in the presence of phosphate or one or more sources of phosphate.
15. The method according to claim 14, wherein step (ii) and step (iv) and, optionally, step (iii) are carried out simultaneously.
16. The method according to claim 14, wherein the method is performed in the presence of a biocatalyst, having sucrose phosphorylase activity and alpha-glucose-1-phosphatase activity and/or comprising a sucrose phosphorylase and an alpha-glucose-1-phosphatase.
17. The method according to claim 10, wherein step (iii) comprises the expression of an alpha-glucose-1-phosphatase or an enzyme having alpha-glucose-1-phosphatase activity by a host cell.
18. The method according to claim 17, wherein the alpha-glucose-1-phosphatase or the enzyme having alpha-glucose-1-phosphatase activity, respectively, is expressed as a recombinant fusion protein comprising a tag suitable for isolation of the alpha-glucose-1-phosphatase or the enzyme having alpha-glucose-1-phosphatase activity.
Description
DESCRIPTION OF THE FIGURES
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
CHEMICALS AND REAGENTS
[0060] Unless stated, all chemicals were of highest purity from Sigma-Aldrich (Vienna, Austria) or Roth (Karlsruhe, Germany). GeneJET genomic DNA purification kit was from Thermo Fisher Scientific (Waltham, USA). Oligonucleotides were from Sigma-Aldrich. DNA sequencing was performed at LGC Genomics (Berlin, Germany). Electrocompetent E. coli Origami B (DE3) cells were from Novagen (Merck KgaA, Darmstadt, Germany). H.sub.2.sup.18O (97% isotopic purity) was from Sigma-Aldrich. The sodium salts of -Glc 1-P, Glc 6-P, Fru 6-P, and pyrophosphate were from Sigma-Aldrich. The barium salt of Fru 1-P was also from Sigma-Aldrich. Phytate (sodium salt) was from Roth. The potassium salt of -Glc 1-P (27) was from Prof. Tom Desmet (Ghent University, Belgium). N,O-bis(trimethylsilyl)trifluoroacetamide with 1% trimethylchlorosilane (BSTFA/1% TMCS) and pyridine were from Sigma-Aldrich. Purified preparations of sucrose phosphorylase from Leuconostoc mesenteroides (SPase) (51) and mannitol 1-phosphate dehydrogenase from Aspergillus fumigatus (52) were obtained by reported procedures.
Example 1: Enzyme Preparation and Characterization
[0061] -Glc 1-P phosphatase is the agp gene product, and the enzyme is located to the E. coli periplasm (44). Crystal structure of the enzyme complex with glucosyl phosphate ligand reveals a two-domain protein topology typical of members of the high-molecular-weight histidine acid phosphatase family (45). The protein fold comprises a discrete -helical domain next to a a/13 domain and a catalytic center located in a deep cleft between the two domains (45). The -Glc 1-P phosphatase structure exhibits 3 disulfide bridges between Cys.sup.94 and Cys.sup.125, Cys.sup.189 and Cys.sup.195, as well as Cys.sup.384 and Cys.sup.392 (45). The active site contains a highly conserved histidine (His.sup.18) that is thought to function as catalytic nucleophile. Asp.sup.290 is the likely general acid-base catalyst, and the phosphomonoester group of -Glc 1-P is held tightly in place through a cluster of positively charged residues (Arg.sup.17, Arg.sup.21, Arg.sup.94, His.sup.289) (45). The proposed catalytic reaction of -Glc 1-P phosphatase follows a double displacement-like mechanism via a covalent phospho-histidine intermediate, as shown in
[0062] Molecular Cloning, Expression and Purification of Glc 1-P Phosphatase.
[0063] E. coli BL21-Gold (DE3) cells were grown overnight at 30 C. in Lennox-medium. The cells were centrifuged at 20,000 g and 4 C. for 30 min. Pellet was used for preparation of genomic DNA. The gene encoding Glc 1-P phosphatase was amplified by a PCR that used Phusion DNA polymerase (Thermo Fisher Scientific, Waltham, USA) in combination with oligonucleotide primers 1 (SEQ ID NO 1) and 2 (SEQ ID NO 2) (Table 1). PCR consisted of a pre-heating, step at 98 C. for 5 min, followed by 30 reaction cycles of denaturation at 98 C. for 30 s, annealing at 70 C. for 30 s, and elongation at 72 C. for 1.5 min. The final extension step was carried out at 72 C. for 5 min. The presence of an N-terminal, 66 bp long signal sequence was predicted using SignalIP-4.1 at the Center of Biological Sequence Analysis (http://www.cbs.dtu.dk/services/SignalP-4.1/). To remove the N-terminal signal sequence, to add an N-terminal Strep-tag, and to also extend the gene end with overlapping regions to the vector, a PCR was performed in which oligonucleotide primers 3 (SEQ ID NO 3) and 4 (SEQ ID NO 4) were used (Table 1). To extend the gene start with overlapping regions to the vector, a PCR with primers 5 (SEQ ID NO 5) and 3 (SEQ ID NO 3) was performed. The final amplification product was treated by DpnI to digest the parental template. The final construct was cloned into the linearized MS470_dsbC vector via Gibson assembly. Sequenced plasmid vectors harboring the structural gene were transformed into E. coli Origami B cells.
[0064] Recipient E. coli strains were cultivated in 1-L baffled shake flasks at 37 C. and 110 rpm using Lennox-medium containing 0.115 mg/mL ampicillin. When OD.sub.600 had reached 0.8, temperature was decreased to 18 C. prior to induction with isopropyl--D-thiogalactopyranoside (0.01 mM). After 20 h, cells were centrifuged at 4 C. and 4,420 g for 30 min (Sorvall RC-5B Refrigerated Superspeed centrifuge; Du Pont Instruments, Newtown, USA). The pellet was resuspended in 50 mM Mes, pH 7.0, pH 7.0, and frozen at 20 C. Thawed cell suspension was passed twice through a French pressure cell press (American Instruments, Silver Springs, USA) at 150 bar, and cell debris was removed by centrifugation at 4 C., 20,000 g for 30 min.
[0065] Glc 1-P phosphatase was isolated from the crude extract using a Strep-Tactin Sepharose column (IBA, Gottingen, Germany), using a general protocol described elsewhere (51). Pooled fractions containing Glc 1-P phosphatase were loaded on a Fracto-gel EMD-DEAE column (Merck, Darmstadt, Germany) and purified according to standard protocol. Buffer exchange to 50 mM Mes, pH 7.0 (Glc 1-P phosphatase) was performed using Amicon Ultra-15 Centrifugal Filter Units (Millipore, Billerica, USA). Note: Unless mentioned, all further experiments were done in 50 mM Mes buffer, pH 7.0. Purification was monitored by SDS-PAGE; protein bands were visualized by silver staining.
TABLE-US-00001 TABLE1 Oligonucleotideprimersusedfor molecularcloningofaGlc1-Pphosphatase. Primer Sequence(5 .fwdarw. 3) Primer1 ATGAACAAAACGCTAATCACC(SEQIDNO1) Primer2 TTATTTCACCGCTTCATTCAAC(SEQIDNO2) Primer3 ATGGCTAGCTGGAGCCACCCGCAGTTCGAAAAAATC GAAGGGCGCCAAACCGTACCGGAAGGCTATCAGC (SEQIDNO3) Primer4 CATCCGCCAAAACAGCCAAGCTTATTATTTCACCGC TTCATTC(SEQIDNO4) Primer5 GTTTAACTTTAAGAAGGAGATATACATATGGCTAGC TGGAGCCACC(SEQIDNO5)
CD Spectroscopy.
[0066] Far-UV CD spectra of Glc 1-P phosphatase (0.4 mg/mL) were recorded at 25 C. on a Jasco J715 spectro-polarimeter (JASCO Inst., Gross-Umstadt, Germany). CD spectra were collected in the wavelength range 190-260 nm at a scan speed of 100 nm/min using a bandwidth of 2.0 nm and a response time of 1.0 s. All spectra were recorded in a 0.01 cm cuvette. For each sample, 10 spectra were recorded, averaged, and buffer signal subtracted. CD spectra were evaluated by using Dichroweb (54) with reference database No. 4.
[0067] A far-UV circular dichroism (CD) spectrum from solution of -Glc 1-P phosphatase us shown in
TABLE-US-00002 TABLE 2 Relative content of secondary structural elements in Glc 1-P phosphatase obtained from the CD spectra and from the crystal structure (in parenthesis). Secondary Glc 1-P phosphatase structure [%] Alpha helices 51 (39) Beta strands 22 (14) Turns 11 (47) Unordered 16
Mass Spectrometry.
[0068] For sample preparation, purified Glc 1-P phosphatase (5 g) was incubated with 20 mM iodoacetamide (IAA) solution for 30 min at 37 C. and digested with modified trypsin (Promega, Madison, USA) (55), and/or with 0.5 g chyrnotrypsin (Roche Applied Sciences, Penzberg, Germany) in 50 mM ammonium bicarbonate and 10 mM CaCl.sub.2. For MS analysis, digests were acidified to 0.1% formic acid and separated by nano-HPLC (Dionex Ultimate 3000) equipped with a -precolumn (C18, 5 m, 100 , 50.3 mm) and a Acclaim PepMap RSLC nanocolumn (C18, 2 m, 100 , 1500.075 mm) (all Thermo Fisher Scientific). About 0.5 g of digested protein were injected and concentrated on the enrichment column for 2 min at a flow rate of 20 L/min with 0.5% trifluoroacetic acid as isocratic solvent. Separation was carried out on the nanocolumn at a flow rate of 300 nL/min using the following gradient, where solvent A is 0.05% trifluoroacetic acid in water and solvent B is 0.05% trifluoroacetic acid in 80% acetonitrile: 0-2 min: 4% B; 2-70 min: 4-28% B; 70-94 min: 28-50% B, 94-96 min: 50-95% B; 96-116 min: 95% B; 116-116.1 min: 95-4% B; 116.1-140 min: re-equilibration at 4% B. The sample was ionized in the nanospray source equipped with stainless steel emitters (ES528, Thermo Fisher Scientific) and analyzed in a Orbitrap velos mass spectrometer (Thermo Fisher Scientific) operated in positive ion mode, applying alternating full scan MS (m/z 400 to 2000) in the ion cyclotron and MS/MS by higher-energy collisional dissociation of the 20 most intense peaks with dynamic exclusion enabled. The LC-MS/MS data were analyzed by searching a database containing the protein sequences of Glc 1-P phosphatase and known background proteins with Mascot 2.3 (MatrixScience, London, UK). Search criteria were charge 2+ or 3+, precursor mass error 0.05 Da, and product mass error 0.7 Da, and carbamidomethylation, oxidation on methionine, 2H on cysteine (disulfide) as variable modifications. A maximum false discovery rate of 0.05 using decoy database search, an ion score cut off of 20 and a minimum of 2 identified peptides were chosen as protein identification criteria.
[0069] Liquid chromatography-tandem mass spectrometry was applied to the determination of disulfide bond(s) in the as-isolated preparation of recombinant -Glc 1-P phosphatase. Protein digests with trypsin or chymotrypsin were resolved to 62% overall sequence coverage, 214 peptides, 37 unique peptides, and a Mascot score of 6046 (
Assays.
[0070] Specific activity of -Glc 1-P phosphatase was determined at 37 C. and pH 7.0 using 20 mM Glc 1-P as substrate. Reaction was started by addition of -Glc 1-P phosphatase (0.1 M), and release of free phosphate was measured over 75 min. Inorganic phosphate was determined colorimetrically at 850 nm (56).
[0071] -Glc 1-P and Glc 6-P were measured in a coupled enzymatic system with phosphoglucomutase and Glc 6-P dehydrogenase (57). Fru 6-P was measured using an assay with mannitol 1-phosphate dehydrogenase (52). Fru 1-P was measured indirectly from the phosphate mass balance for substrate consumed ([Glc 1-P]) and products formed (equation 1), or directly using HPAEC-PAD (see later).
[Glc 1-P]=[Fru 1-P]+[Glc 6-P]+[Fru 6-P]+[phosphate](1)
[0072] The total protein concentration was measured using Roti-Quant assay referenced against BSA (58).
Phosphatase Kinetics.
[0073] Hydrolysis reactions were carried out at an initial substrate concentration of 20 mM. The different substrates used are summarized in Table 3. Reactions were started by addition of enzyme (-Glc 1-P phosphatase, 0.1 M), and incubations continued for up to 150 min at 37 C. and a thermomixer agitation rate of 650 rpm. Samples were taken in 15 min intervals, heat-treated (99 C., 5 min), and centrifuged at 20,000 g for 5 min. The release of phosphate was measured, and the initial rate V (mM min.sup.1) was determined from the linear relationship between phosphate concentration and time. Apparent turnover frequencies (k.sub.cat.sub._.sub.app; s.sup.1) were calculated with equation 2, where [E] is the molar enzyme concentration, determined from the protein concentration assuming a molecular mass of 45 kDa for Glc 1-P phosphatase.
k.sub.cat.sub._.sub.app=V/[E](2)
TABLE-US-00003 TABLE 3 Apparent turnover frequencies for hydrolysis of phosphorylated sugars. The S.D. for k.sub.cat.sub.
Example 2: Mechanistic Studies
Inorganic Phosphate-Water Medium .SUP.18.O Exchange During, Hydrolysis, of Glc 1-P.
[0074] All reaction mixtures were prepared from H.sub.2.sup.18O (97%) to give a final .sup.18O isotopic purity of the water solvent of 90%. Phosphatase reactions were done using 2.0 mM Glc 1-P as the substrate. The standard Mes and Hepes buffers were used. Phosphorylase reaction was done in 50 mM Mes buffer, pH 7.0, using 1.0 mM Glc 1-P. Reactions were started by adding enzyme (0.1 M, sucrose phosphorylase: 14 M) to substrate solution at 37 C. Incubations proceeded for 2 h using agitation at 650 rpm in an Eppendorf thermomixer. Reactions were stopped by heating (99 C., 5 min). Control reactions were carried out in exactly the same way using normal H.sub.2.sup.16O instead of H.sub.2.sup.18O. Conversion of Glc 1-P substrate was 90% or higher in each sample.
[0075] Incorporation of .sup.18O-label into phosphate was analyzed by GC-MS. Samples were dried in a SpeedVac for 3 h and derivatized with BSTFA/1% TMCS, in pyridine (1:2, by volume). Analysis was performed using a Trace DSQ Single Quadrupole GC-MS instrument (Thermo Scientific). The following GC parameters were used: injection volume, 1 L; injector temperature, 250 C.; carrier gas, He; carrier gas flow, 1 mL/min; column, HP-5MS (60 m, ID 0.250 mm, film thickness 0.25 m) from Agilent (Waldbronn, Germany). The temperature gradient was as follows: starting temperature, 110 C. for 4 min; ramp to 300 C. at a heating rate of 20 C./min; final hold time, 10 min. The MS was operated in EI mode (source temperature: 280 C.) and the detected mass range was 50-700 m/z. The extracted ion chromatograms of m/z 299 and m/z 301 were integrated using the Xcalibur 1.4 software (Thermo Scientific).
Mechanistic Characterization of -Glc 1-P Hydrolysis Using .SUP.18.O Labeling.
[0076] In the proposed catalytic reaction of -Glc 1-P phosphatase the O1-P bond of substrate is cleaved, and that water (from solvent) attacks a phospho-enzyme intermediate in the dephosphorylation step of the overall hydrolytic conversion of -Glc 1-P (
Example 3: Phosphoryl Transfer Studies
Phosphoryl Transfer Studies.
[0077] Reactions were performed as described above (Phosphatase kinetics) using 20 mM -Glc 1-P as the donor substrate. Fru (100, 200, 400 or 600 mM) or Glc (200 mM) was used as the acceptor substrate. Samples taken at certain times were analyzed for phosphate, Glc 1-P, and Glc 6-P. When Fru was the acceptor, Fru 1-P and Fru 6-P were additionally measured in each sample. Sampling was done to allow for determination of initial rates, but the full reaction time course was also recorded. Relevant k.sub.cat.sub._.sub.app values for substrate consumption, phosphate release, and phosphoryl transfer were obtained from the corresponding V values using equation 2. Internal consistency of the data was always checked by mass balance. pH dependence of phosphoryl transfer. Reactions (0.1 M enzyme) contained 20 mM of each Glc 1-P and Fru, and k.sub.cat.sub._.sub.app was determined from V for consumption of Glc 1-P or formation of Fru 1-P. The pH range analyzed was 4.0-8.0. A 50 mM Mes buffer was used, except at pH 6.0 where 50 mM Mes and 20 mM sodium acetate were used, and at pH 8.0 where 50 mM Mes and 50 mM Tes were used. Buffer pH values were adjusted at 37 C. and controlled before and after recording each enzyme-catalyzed reaction. Sampling and analyses were as described above.
[0078] For data analysis by non-linear least-squares regression, SigmaPlot 2004 version 9.0 was used. Equation 3 describes a pH dependence where activity (expressed as logarithmic k.sub.cat.sub._.sub.app) is constant at low pH and decreases above pK.sub.B. C is the pH-independent value of k.sub.cat.sub._.sub.app at the optimum state of protonation, K is the proton dissociation constant and [H.sup.+] is the proton concentration.
log(k.sub.cat.sub._.sub.app)=log(C/(1+K/[H.sup.+]))(3)
High Performance Anion Exchange Chromatography with Pulsed Amperometric Detection (HPAEC-PAD).
[0079] Selected samples were analyzed on a Dionex BioLC system (Dionex Corporation, Sunnyvale, USA) equipped with a CarboPac PA10 column (4250 mm) and an Amino Trap guard column (450 mm) thermostated at 30 C. Glc, Fru, Glc 1-P, Glc 6-P, Fru 1-P and Fru 6-P were detected with an ED50A electrochemical detector using a gold working electrode and a silver/silver chloride reference electrode, applying the predefined waveform for carbohydrates. Elution was carried out at a flow rate of 0.9 mL/min with the following method: isocratic flow of 52 mM NaOH for 20 min, followed by a linear gradient from 100 mM NaOAc to 400 mM NaOAc, applied within 25 min in an isocratic background of 100 mM NaOH. The column was washed for 5 min with 52 mM NaOH. Under the conditions applied, Glc eluted after 10.2 min, Fru after 11.8 min, Glc 1-P after 30.3 min, Glc 6-P after 36.6 min, Fru 1-P after 37.2 min and Fru 6-P after 39.1 min.
NMR Spectroscopic Measurements.
[0080] For sample preparation, 20 mM Glc 1-P and 200 mM Fru were incubated with 0.1 M Glc 1-P phosphatase at 37 C. for 75 min. The reaction was stopped by heating (99 C., 5 min). After centrifugation at 20,000 g for 5 min, the supernatant was applied on a DEAE FF column (GE Healthcare, Little Chalfont, U.K.), pre-equilibrated with deionized water. Unbound, non-charged monosaccharides were removed by washing with deionized water. Elution of phosphorylated reaction products was accomplished by using 50 mM NaCl. Fractions containing the phosphorylated product were pooled and concentrated by lyophilisation, prior to NMR analysis.
[0081] For NMR analysis, the isolated compound was dissolved in D.sub.2O (5 mg in 0.7 mL) and transferred into 5 mm high precision NMR sample tubes. Measurements were performed on a Bruker DRX-400 at 400.13 MHz (.sup.1H) using the Topspin 1.3 software. 1D .sup.1H NMR spectra were recorded by acquisition of 64 k data points and Fourier transformation resulting in spectra with a range of 14 ppm. To determine the 2D COSY, TOCSY, and NOESY spectra 128 experiments with 2048 data points each were recorded and Fourier transformed to 2D-spectra with a range of 10 ppm. Measurement temperature was 298 K+/0.05 K and external acetone was used as shift reference standard (.sub.H 2.225).
Isolated Compounds.
[0082] -D-fructopyranose 1-phosphate-.sup.1H NMR (D.sub.2O): =3.99 (1H, m, H-6a), 3.93 (1H, m, H-3), 3.84 (1H, m, H-4*), 3.82 (1H, m, H-1b), 3.81 (1H, m, H-1a), 3.77 (1H, m, H-5*), 3.65 (1H, m, H-6b); .sup.13C NMR (D.sub.2O): =96.3 (s, C-2), 71.9 (d, C-3), 71.8 (d, C-4*), 70.5 (d, C-5*), 68.6 (t, C-6), 66.2 (t, C-1); .sup.31P NMR (D.sub.2O): 8=5.5 (RO-POH.sub.2.sup.); other isomers regarding anomeric form and pyrano/furano form are present in negligible concentrations; [*] shifts are not unequivocally assignable.
Molecular Docking Studies.
[0083] AutoDock 4.2 as implemented in Yasara V 11.11.21 was used for enzyme-ligand docking. The AMBER03 force field and the default parameters provided by the standard docking macro were used, except that the number of runs was increased to 50. The structure of Glc 1-P phosphatase (His.sup.18.fwdarw.Ala mutant; pdb entry 1nt4) was used as macromolecule in molecular docking experiments that employed Glc 1-P or Glc 6-P, each as di- or mono-anion, as the ligand. 3D coordinates of the ligands were generated from SMILES strings using Chimera (http://www.cgl.ucsf.edu/chimera). Docking was performed with Asp.sup.290 protonated or unprotonated. The ligand was placed flexible into the enzyme active site that was covered completely by the applied search space of 151010 . Docking poses were evaluated by their associated free energy and mechanistic plausibility. PyMOL (http://www.pymol.org) was used for visualization.
Phospho-Donor Substrate Utilization by Glc 1-P Phosphatase in Hydrolysis.
[0084] A series of phosphorylated sugars were tested as substrates for hydrolysis by phosphatase. Apparent turnover frequencies (k.sub.cat.sub._.sub.app) determined at 20 mM substrate concentration were summarized in Table 3. The enzyme exhibited high selectivity for hydrolyzing -Glc 1-Pas compared to -Glc 1-P, which was completely inactive towards Glc 1-P phosphatase. Phospho-sugars harboring the phosphomonoester group at a primary hydroxyl (Glc 6-P; Fru 6-P; D-fructose 1-phosphate, Fru 1-P) were utilized with high activity, the respective k.sub.cat.sub._.sub.app being comparable within a 2-fold range to the k.sub.cat.sub._.sub.app for conversion of -Glc 1-P. Pyrophosphate and phytate (myo-inositol hexakisphosphate) were also examined as enzyme substrates, and reactions were performed at pH 7.0 and pH 4.5 (50 mM sodium acetate). Pyrophosphate was not hydrolyzed which is interesting because it is an excellent substrate for many acid phosphatases (39, 63). -Glc 1-P phosphatase was weakly active with phytate, but only at the low pH of 4.5 where the phytate is no longer strongly complexed with metal ions (64).
Phosphorylation of Different Sugar Substrates.
[0085] Phosphorylation of different acceptors catalyzed by -Glc 1-P phosphatase using -Glc 6-P as donor substrate were performed in 50 mM Mes pH 7.0 supplemented with 20 mM -Glc 6-P and 200 mM of the respective acceptors. The product formation in dependence of time is shown in
Enzymatic Transphosphorylation: Glc 1-P Phosphatase Catalyzes Efficient Phosphoryl Transfer from Glc 1-P to the 6-Hydroxyl of an External Glc Acceptor.
[0086] During time-course studies of hydrolysis of Glc 1-P (20 mM) by Glc 1-P phosphatase, in a late phase of the reaction (70% substrate conversion), the molar concentration of phosphate released did not match up exactly (10%) to the -Glc 1-P consumed. Analysis of the reaction mixture by HP anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) revealed the presence of a new phosphorylated sugar, which was found to co-elute with an authentic Glc 6-P standard. The presence of Glc 6-P in the reaction sample was confirmed unambiguously using an enzymatic assay based on selective NAD.sup.+ dependent oxidation of Glc 6-P by Glc 6-P dehydrogenase. The amount of Glc 6-P formed accounted precisely for the phosphate missing in the balance with Glc 1-P converted. The synthesis of Glc 6-P during conversion of Glc 1-P was suggested to have resulted from an enzymatic transphosphorylation reaction in which Glc 1-P was the donor, and the Glc formed in prior hydrolysis was the acceptor. Mechanistically, the substrate's phosphoryl group would be transferred to the catalytic His.sup.18 of the enzyme, and dephosphorylation of Glc 1-P phosphatase could then occur by reaction with water (hydrolysis) or Glc (phosphoryl transfer). Because phosphoryl transfer would take place in competition with hydrolysis, the Glc concentration is decisive for efficient utilization of Glc 1-P for synthesis of Glc 6-P.
[0087] The enzymatic conversion of Glc 1-P (20 mM) was therefore repeated with 200 mM Glc added as external phosphoryl acceptor at reaction start.
Synthesis of Fru 1-P by enzymatic transphosphorylation from Glc 1-P.
[0088] When Fru (200 mM) was added to conversions of -Glc 1-P (20 mM) by -Glc 1-P phosphatase, there was the interesting effect that compared to the control reaction performed in the absence of Fru the -Glc 1-P consumption rate was enhanced about 3-fold (k.sub.cat.sub._.sub.app=137 s.sup.1) whereas the phosphate release rate was decreased about 2-fold at the same time (k.sub.cat.sub._.sub.app=18 s.sup.1). Therefore, this provided clear indication that phosphoryl transfer from Glc 1-P to an acceptor other than water, likely Fru, constituted the major route of phosphoryl donor substrate utilization under the conditions used. Using analysis by HPAEC-PAD, formation of new sugar phosphate products was confirmed. Comparison of k.sub.cat.sub._.sub.app under hydrolysis-only and phosphoryl transfer conditions revealed that -Glc 1-P phosphatase was somehow activated in the presence of external acceptor. In the proposed scenario of enzymatic transphosphorylation where an otherwise hydrolyzed phospho-enzyme intermediate is intercepted by acceptor, enhancement of k.sub.cat.sub._.sub.app in the presence of Fru is possible when enzyme dephosphorylation is a slow step of the overall hydrolysis process, and is accelerated by the reaction with Fru. Consistent with this notion, it was shown that k.sub.cat.sub._.sub.app (-Glc 1-P) increased about 5-fold in hyperbolic dependence of the Fru concentration (100-600 mM; Table 4), approaching a calculated maximum value of 254 s.sup.1 at saturating concentrations of the phosphoryl acceptor (
TABLE-US-00004 TABLE 4 Kinetic analysis of transphosphorylation by Glc 1-P phosphatase analyzed at different Fru concentrations. The S.D. for k.sub.cat.sub.
[0089] A complete time course of conversion of -Glc 1-P in the presence of 200 mM Fru is shown in
[0090] Identity of Fru 1-P was further confirmed through 1D and 2D NMR analysis of the product 1c) mixture. Fru 1-P was present in four different anomeric forms, whereby the -D-fructopyranose 1-phosphate had highest abundance (80%). For this anomer, the proton signals of H-1a&b resonated as separated signal group in an ABX at 3.82 ppm and 3.81 ppm with a .sup.J.sub.H-P heteronuclear coupling to the phosphate group. All other proton signals belonged to spin system, as detected in the TOCSY spectrum. The proton signals of the methylene group in position 6 were present at 3.99 and 3.65 ppm, both showing .sup.3J.sub.H-H couplings to H-5, which resonated at 3.77 ppm. Further coupling of H-5 to H-4 (3.84 ppm) and consecutively of H-4 to H-3 (3.95) were also visible in COSY spectra. The large shift difference between signals of H-6a and H-6b indicated the anomeric form. Furthermore, NMR data of the enzymatically synthesized Fru 1-P were in exact agreement with reference spectra recorded from commercial Fru 1-P. The NMR data combined with evidence from HPAEC-PAD analysis and enzymatic assays confirmed Fru 6-P and Glc 6-P to be transphosphorylation products next to Fru 1-P.
Binding of Glc 1-P and Glc 6-P by Glc 1-P Phosphatase Analyzed by Molecular Docking.
[0091] The x-ray crystal structure of -Glc 1-P phosphatase having the catalytic His.sup.18 substituted by Ala contains a bound ligand reported to be -Glc 1-P (45). However, the phospho-sugar represented by the atomic coordinates of the enzyme-ligand complex is clearly -Glc 1-P, not -Glc 1-P. An experimental electron density map was not released with the protein structure and cannot therefore be used for clarification. Docking studies were performed in which -Glc 1-P was placed flexible into the substrate binding pocket of the enzyme (pdb entry 1 nt4). Binding of singly or doubly negatively charged -Glc 1-P was examined, and the putative catalytic acid-base Asp.sup.290 was analyzed protonated or unprotonated. The best-fit docking poses received under the different conditions were independent of the charge state of -Glc 1-P and Asp.sup.290. -Glc 1-P is accommodated in an elongated conformation with the phosphoryl group placed anti relative to the glucosyl moiety. The substrate's glycosidic oxygen 01 is brought into a position that would allow protonated Asp.sup.290 to provide Brnsted catalytic assistance to O1-P bond fission and thus to the departure of the Glc leaving group. Asp.sup.290 could adopt an analogous catalytic role during hydrolysis of -Glc 1-P, even though the distance between the catalytic enzyme and the reactive substrate groups is substantially larger (3.4 ) than in the -Glc 1-P docking pose (2.9 ). 3-Glc 1-P is not a substrate of -Glc 1-P phosphatase (Table 3), and the binding mode of -Glc 1-P in the protein crystal structure may actually be non-productive for catalysis to O1-P bond cleavage. Evidence from the docking analysis indicates that substrate binding recognition by -Glc 1-P phosphatase is mainly through numerous strong interactions with the phosphoryl group whereas the glucosyl moiety of -Glc 1-P is bound only weakly by comparison. The docking experiments resulted in up to 6 docking poses of similar calculated free energies. The different docking poses had the phosphoryl group bound similarly, but featured variation in the alignment of the glucosyl moiety. Size and topology of the binding pocket appear adequate for accommodation of different sugar structures in multiple orientations, as shown for binding of Glc 6-P compared to binding of -Glc 1-P, thus explaining the relaxed donor and acceptor substrate specificity of the enzyme. It is not practical to examine transphosphorylation compared to hydrolysis reaction selectivity using molecular docking.
Molecular and Kinetic Properties of Glc 1-P Phosphatase Underlying the Enzyme's Remarkable Transphosphorylation Activity.
[0092] -Glc 1-P phosphatase catalyzed hydrolysis of different sugar phosphates with relaxed specificity for the structure of the leaving group (Glc, Fru) and for the position of the phosphoryl group on the sugar moiety (-Glc 1-P, Glc 6-P). In a comparison of the a and 3-anomers of Glc 1-P, however, the enzyme discriminated strongly against hydrolysis of 3-Glc 1-P. Docking analysis carried out on the x-ray crystal structure of -Glc 1-P phosphatase suggested a molecular basis for the anomeric selectivity of the enzyme. It also provided interpretation of the broad donor and acceptor substrate specificity of -Glc 1-P phosphatase.
[0093] Incorporation of .sup.18O label from H.sub.2.sup.18O solvent into the phosphate released during hydrolysis of Glc 1-P by Glc 1-P phosphatase supports enzymatic reactions through nucleophilic substitution at the phosphorus. According to mechanistic proposals for histidine acid phosphatases (
Synthetic Use of Transphosphorylation from Glc 1-P.
[0094] Fru 1-P is a high-value metabolite that is difficult to synthesize chemically (68). Biocatalytic synthetic routes to Fru 1-P are aldolase (EC 4.1.2.13)-catalyzed carbon-carbon coupling between glyceraldehyde and dihydroxyacetone phosphate (69), or 1-phosphorylation of Fru from ATP by keto-hexokinase (EC 2.7.1.3) (62, 63). Transphosphorylation from -Glc 1-P presents an interesting alternative that offers the advantage of a convenient and cheap phosphoryl donor substrate compared with ATP or dihydroxyacetone phosphate. Moreover, -Glc 1-P phosphatase showed excellent turnover frequency (100 s.sup.1; Table 4) for transphosphorylation between Glc 1-P and Fru. By employing Fru at 600 mM, utilization of Glc 1-P as donor substrate for transphosphorylation was almost complete in a sense that substrate hydrolysis was prevented effectively (10%; see
[0095] Following the early discovery of phosphoryltransferase activity in certain phosphatases (36), recent work has demonstrated the synthetic usefulness of biocatalytic transphosphorylation reactions in the preparation of different sugar phosphates. Bacterial phosphatases from the class-A nonspecific acid phosphatase family were mostly used, and Shigella flexneri (37, 73), Salmonella enterica (73) and Morgenella morganii (74) were prominent sources of the enzyme. A key paper of Wever and colleagues showed phosphorylation of a series of aldohexose, aldopentose, and ketohexose acceptors from a pyrophosphate donor substrate using acid phosphatase from S. flexneri (37). Using donor and acceptor at 100 mM each, the yield of phosphorylated product was typically 15% or lower, except for the 6-phosphates of Glc and 5-thio-D-glucose that were obtained in substantially higher yields. Interestingly, Fru was a rather poor acceptor substrate for the Shigella phosphatase (5% phosphorylation yield), suggesting useful complementarity in the acceptor substrate specificities of -Glc 1-P phosphatase and the previously used transphosphorylation catalyst. Moreover, whereas the nonspecific acid phosphatases were used at pH 4.0, -Glc 1-P phosphatase can also be applied in the neutral pH range. Using aldohexose acceptors (e.g. Glc, D-mannose, D-galactose), it was shown by van Herk et al. (37) that the maximum concentration of phosphorylated product obtained from 100 mM pyrophosphate was strongly dependent on the acceptor concentration used; and that it went through a distinct kinetic optimum due to the pronounced effect of secondary hydrolysis at extended reaction times. Glc 6-P was an exception and it was obtained as a kinetically stable transphosphorylation product. Problems with secondary hydrolysis were not encountered during Glc 1-P phosphatase-catalyzed phosphorylations of Fru. However, Glc 6-P was hydrolyzed. Finally, even though pyrophosphate is generally viewed as a highly expedient phosphoryl donor substrate for enzymatic transphosphorylations, it must not be overlooked that even in the absence of hydrolysis, the pyrophosphate conversion results in the release of inorganic phosphate, which can inhibit the phosphatase (40). The use of -Glc 1-P in combination with a dedicated -Glc 1-P phosphatase might help minimizing the effect of product inhibition by phosphate in phosphatase-catalyzed transphosphorylation reactions. The enzyme from E. coli -Glc 1-P phosphatase is a powerful biocatalyst for this type of transformation.
Example 4: Phosphylation Using a Phosphorylase-Phosphatase Biocatalyst
[0096] Simultaneous and sequential two-step transformations as shown in
[0097] Acceptor substrates phosphorylated by glucose-1-phosphatase are shown in
[0098] NMR data show that aldose sugars give -configured glycosyl-phosphate products, except D-glucosamine which is phosphorylated at the 6-OH. L-Sorbose is phosphorylated at the 1-OH, D-fructose gives predominantly the 1-phosphate product, even though some 6-phosphate is also synthesized. Sugar alcohols are likely phosphorylated at primary OH, but product identity was not determined in these cases.
[0099]
[0100] One-pot, two-step cascade reaction operated in simultaneous reaction mode and One-pot, two-step cascade reaction operated in sequential mode were performed. For the One-pot, two-step reactions operated in simultaneous mode, substrates (100 mM sucrose, 100 mM phosphate*, 800 mM D-mannose) and enzymes (1.3 M SPase, 0.1 M G1Pase) are added simultaneous in the beginning. In sequential mode, in the first step, sucrose and phosphate (200 mM each) is converted to D-glucose 1-phosphate and D-fructose catalysed by SPase (1.3 M SPase) and in the second step, G1Pase (0.1 M) converts D-glucose 1-phosphate and D-mannose (final concentration: 800 mM) to D-mannose 1-phosphate and by-products. The results are shown in
REFERENCES
[0101] 1. Dzeja P P, Terzic A. 2003. Phosphotransfer networks and cellular energetics. J. Exp. Biol. 206:2039-2047. [0102] 2. Berg J M, Tymoczko J L, Stryer L. 2002. Biochemistry, 5th ed. W H Freeman, New York, USA. [0103] 3. Wunschiers R. 2012. Carbohydrate metabolism and citrate cycle, p. 37-58. In Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, 2nd ed. John Wiley & Sons, Inc., Hoboken, USA. [0104] 4. Knowles J R. 1980. Enzyme-catalyzed phosphoryl transfer reactions. Annu. Rev. Biochem. 49:877-919. [0105] 5. Lassila J K, Zalatan J G, Herschlag D. 2011. Biological phosphoryl-transfer reactions: understanding mechanism and catalysis. Annu. Rev. Biochem. 80:669-702. [0106] 6. Frey P A, Hedgeman A D. Phosphotransfer and nucleotidyltransfer, p. 476-546. In Enzymatic reaction mechanisms. Oxford University Press, Oxford, IJK. [0107] 7. Allen K N, Dunaway-Mariano D. 2004. Phosphoryl group transfer: evolution of a catalytic scaffold. Trends Biochem. Sci. 29:495-503. [0108] 8. Granot D, Kelly G, Stein O, David-Schwartz R. 2014. Substantial roles of hexokinase and fructokinase in the effects of sugars on plant physiology and development. J. Exp. Bot. 65:809-819. [0109] 9. Agius L. 2008. Glucokinase and molecular aspects of liver glycogen metabolism. Biochem. J. 414:1-18. [0110] 10. Kawai S, Mukai T, Mori S, Mikami B, Murata K. 2005. Hypothesis: structures, evolution, and ancestor of glucose kinases in the hexokinase family. J. Biosci. Bioeng. 99:320-330. [0111] 11. Wilson J E. 2003. Isozymes of mammalian hexokinase: structure, subcellular localization and metabolic function. J. Exp. Biol. 206:2049-2057. [0112] 12. Kornberg H L. 2001. Routes for fructose utilization by Escherichia coli. J. Mol. Microbiol. Biotechnol. 3:355-359. [0113] 13. Luley-Goedl C, Nidetzky B. 2010. Carbohydrate synthesis by disaccharide phosphorylases: reactions, catalytic mechanisms and application in the glycosciences. Biotechnol. J. 5:1324-1338. [0114] 14. Nakai H, Kitaoka M, Svensson B, Ohtsubo K. 2013. Recent development of phosphorylases possessing large potential for oligosaccharide synthesis. Curr. Opin. Chem. Biol. 17:301-309. [0115] 15. Westheimer F H. 1987. Why nature chose phosphates. Science 235:1173-1178. [0116] 16. Kamerlin S C L, Sharma P K, Prasad R B, Warshel A. 2013. Why nature really chose phosphate. Q. Rev. Biophys. 46:1-132. [0117] 17. Morrow J R, Amyes T L, Richard J P. 2008. Phosphate binding energy and catalysis by small and large molecules. Acc. Chem. Res. 41:539-548. [0118] 18. Nagano N, Orengo C A, Thornton J M. 2002. One fold with many functions: the evolutionary relationships between TIM barrel families based on their sequences, structures and functions. J. Mol. Biol. 321:741-765. [0119] 19. Klimacek M, Krahulec S, Sauer U, Nidetzky B. 2010. Limitations in xylose-fermenting Saccharomyces cerevisiae, made evident through comprehensive metabolite profiling and thermodynamic analysis. Appl. Environ. Microbiol. 76:7566-7574. [0120] 20. Zhang G-F, Sadhukhan S, Tochtrop G P, Brunengraber H. 2011. Metabolomics, pathway regulation, and pathway discovery. J. Biol. Chem. 286:23631-23635. [0121] 21. Bscher J M, Czernik D, Ewald J C, Sauer U, Zamboni N. 2009. Cross-platform comparison of methods for quantitative metabolomics of primary metabolism. Anal. Chem. 81:2135-2143. [0122] 22. McCloskey D, Palsson B, Feist A M. 2013. Basic and applied uses of genome-scale metabolic network reconstructions of Escherichia coli. Mol. Syst. Biol. 9:661. [0123] 23. Auriol D, Lefevre F, Nalin R, Redziniak G. April 2011. Cosmetic and pharmaceutical composition comprising N-acetylglucosamine-6-phosphate. US 20130012475. [0124] 24. Auriol D, Nalin R, Lefevre F, Ginolhac A, Guembecker D D, Zago C. November 2008. Method for preparing C-6 phosphorylated D-aldohexoses and C-6 phosphorylated D-aldohexose derivatives. EP 2150620. [0125] 25. Shin W-J, Kim B-Y, Bang W-G. 2007. Optimization of ascorbic acid-2-phosphate production from ascorbic acid using resting cell of Brevundimonas diminuta. J. Microbiol. Biotechnol. 17:769-773. [0126] 26. Goedl C, Schwarz A, Minani A, Nidetzky B. 2007. Recombinant sucrose phosphorylase from Leuconostoc mesenteroides: characterization, kinetic studies of transglucosylation, and application of immobilised enzyme for production of -D-glucose 1-phosphate. J. Biotechnol. 129:77-86. [0127] 27. Van der Borght J, Desmet T, Soetaert W. 2010. Enzymatic production of -D-glucose-1-phosphate from trehalose. J. Biotechnol. 5:986-993. [0128] 28. De Groeve M R M, De Baere M, Hoflack L, Desmet T, Vandamme E J, Soetaert W. 2009. Creating lactose phosphorylase enzymes by directed evolution of cellobiose phosphorylase. Protein Eng. Des. Sel. 22:393-399. [0129] 29. Lange C F, Kohn P. 1961. Substrate specificity of hexokinases. J. Biol. Chem. 236:1-5. [0130] 30. Nishimasu H, Fushinobu S, Shoun H, Wakagi T. 2006. Identification and characterization of an ATP-dependent hexokinase with broad substrate specificity from the hyperthermophilic archaeon Sulfolobus tokodaii. J. Bacteriol. 188:2014-2019. [0131] 31. Nishimoto M, Kitaoka M. 2007. Identification of N-acetylhexosamine 1-kinase in the complete lacto-N-biose I/galacto-N-biose metabolic pathway in Bifidobacterium longum. Appl. Environ. Microbiol. 73:6444-6449. [0132] 32. Cai L, Guan W, Kitaoka M, Shen J, Xia C, Chen W, Wang P G. 2009. A chemoenzymatic route to N-acetylglucosamine-1-phosphate analogues: substrate specificity investigations of N-acetylhexosamine 1-kinase. Chem. Commun. 2944-2946. [0133] 33. Chen M, Chen L, Zou Y, Xue M, Liang M, Jin L, Guan W, Shen J, Wang W, Wang L, Liu J, Wang P G. 2011. Wide sugar substrate specificity of galactokinase from Streptococcus pneumoniae TIGR4. Carbohydr. Res. 346:2421-2425. [0134] 34. Zhao H, van der Donk W A. 2003. Regeneration of cofactors for use in biocatalysis, Curr. Opin. Biotechnol. 14:583-589. [0135] 35. Berke W, Schz H J, Wandrey C, Morr M, Denda G, Kula M R. 1988. Continuous regeneration of ATP in enzyme membrane reactor for enzymatic syntheses. Biotechnol. Bioeng. 32:130-139. [0136] 36. Wilson I B, Dayan J, Cyr K. 1964. Some properties of alkaline phosphatase from Escherichia coli: transphosphorylation. J. Biol. Chem. 239:4182-4185. [0137] 37. Van Herk T, Hartog A F, van der Burg A M, Wever R. 2005. Regioselective phosphorylation of carbohydrates and various alcohols by bacterial acid phosphatases; probing the substrate specificity of the enzyme from Shigella flexneri. Adv. Synth. Catal. 347:1155-1162. [0138] 38. Babich L, Hartog A F, van der Horst M A, Wever R. 2012. Continuous-flow reactor-based enzymatic synthesis of phosphorylated compounds on a large scale. Eur. J. Chem. 18:6604-6609. [0139] 39. Babich L, Hartog A F, van Hemert L J, Rutjes F P, Wever R. 2012. Synthesis of carbohydrates in a continuous flow reactor by immobilized phosphatase and aldolase. ChemSusChem 5:2348-53. [0140] 40. Fernley H N, Walker P G. 1967. Studies on alkaline phosphatase-inhibition by phosphate derivatives and substrate specificity. Biochem. J. 104:1011-1018. [0141] 41. O'Brien P J, Herschlag D. 2002. Alkaline phosphatase revisited: hydrolysis of alkyl phosphates. Biochemistry 41:3207-3225. [0142] 42. Goedl C, Sawangwan T, Wildberger P, Nidetzky B. 2010. Sucrose phosphorylase: a powerful transglucosylation catalyst for synthesis of -D-glucosides as industrial fine chemicals. Biocatal. Biotransformation 28:10-21. [0143] 43. Renirie R, Pukin A, van Lagen B, Franssen M C R. 2010. Regio- and stereoselective glucosylation of diols by sucrose phosphorylase using sucrose or glucose 1-phosphate as glucosyl donor. J. Mol. Catal. B Enzym. 67:219-224. [0144] 44. Pradel E, Marck C, Boquet P L. 1990. Nucleotide sequence and transcriptional analysis of the Escherichia coli agp gene encoding periplasmic acid glucose-1-phosphatase. J. Bacteriol. 172:802-807. [0145] 45. Lee D C, Cottrill M A, Forsberg C W, Jia Z. 2003. Functional insights revealed by the crystal structures of Escherichia coli glucose-1-phosphatase. J. Biol. Chem. 278:31412-31418. [0146] 46. Kuznetsova E, Proudfoot M, Gonzalez C F, Brown G, Omeichenko M V, Borozan I, Carmel L, Wolf Y I, Mori H, Savchenko A V, Arrowsmith C H, Koonin E V, Edwards A M, Yakunin A F. 2006. Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family. J. Biol. Chem. 281:36149-36161. [0147] 47. Burroughs A M, Allen K N, Dunaway-Mariano D, Aravind L. 2006. Evolutionary genomics of the HAD superfamily: understanding the structural adaptations and catalytic diversity in a superfamily of phosphoesterases and allied enzymes. J. Mol. Biol. 361:1003-1034. [0148] 48. Collet J F, Stroobant V, Pirard M, Delpierre G, Van Schaftingen I E. 1998. A new class of phosphotransferases phosphorylated on an aspartate residue in an amino-terminal DXDX(T/V) motif. J. Biol. Chem. 273:14107-14112. [0149] 49. Lahiri S D, Zhang G, Dunaway-Mariano D, Allen K N. 2006. Diversification of function in the haloacid dehalogenase enzyme superfamily: The role of the cap domain in hydrolytic phosphoruscarbon bond cleavage. Bioorganic Chem. 34:394-409. [0150] 50. Morals M C, Zhang W, Baker A S, Zhang G, Dunaway-Mariano D, Allen K N. 2000. The crystal structure of Bacillus cereus phosphonoacetaldehyde hydrolase: insight into catalysis of phosphorus bond cleavage and catalytic diversification within the HAD enzyme superfamily. Biochemistry 39:10385-10396. [0151] 51. Wildberger P, Todea A, Nidetzky B. 2012. Probing enzyme-substrate interactions at the catalytic subsite of Leuconostoc mesenteroides sucrose phosphorylase with site-directed mutagenesis: the roles of Asp49 and Arg395. Biocatal Biotransformation 30:326-337. [0152] 52. Krahulec S, Armao G C, Weber H, Klimacek M, Nidetzky B. 2008. Characterization of recombinant Aspergillus fumigatus mannitol-1-phosphate 5-dehydrogenase and its application for the stereoselective synthesis of protio and deuterio forms of D-mannitol 1-phosphate. Carbohydr. Res. 343:1414-1423. [0153] 53. Gibson D G, Young L, Chuang R Y, Venter J C, Hutchison C A, Smith H O. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6:343-345. [0154] 54. Whitmore L, Wallace B A. 2008. Protein secondary structure analyses from circular dichroism spectroscopy: methods and reference databases. Biopolymers 89:392-400. [0155] 55. Shevchenko A, Wilm M, Vorm O, Mann M. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:850-858. [0156] 56. Saheki S, Takeda A, Shimazu T. 1985. Assay of inorganic phosphate in the mild pH range, suitable for measurement of glycogen phosphorylase activity. Anal. Biochem. 148:277-281. [0157] 57. Eis C, Nidetzky B. 1999. Characterization of trehalose phosphorylase from Schizophyllum commune. Biochem. J. 341:385-393. [0158] 58. Bradford M M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254. [0159] 59. Jia Z, Cottrill M, Pal G P, Lee D, Sung M, Forsberg C W, Phillips J P. 2001. Purification, crystallization and preliminary X-ray analysis of the Escherichia coli glucose-1-phosphatase. Acta Crystallogr. Sect. D 57:314-316. [0160] 60. Cottrill M A, Golovan S P, Phillips J P, Forsberg C W. 2002. Inositol phosphatase activity of the Escherichia coli agp-encoded acid glucose-1-phosphatase. Can. J. Microbiol. 48:801-809. [0161] 61. Kietzmann M, Schwab H, Pichler H, Ivancic M, May O, Luiten R G M. July 2011. Preparation of an esterase. WO 2009004093. [0162] 62. Graff G, Krick T P, Walseth T F, Goldberg N D. 1980. The use of [.sup.18O.sub.4]phosphoric acid in the quantitation of phosphate by gas-liquid chromatography-mass spectrometry analysis. Anal. Biochem. 107:324-331. [0163] 63. Pradines A, Klaebe A, Perie J, Paul F, Monsan P. 1991. Large-scale enzymatic synthesis of glycerol 1-phosphate. Enzyme Microb. Technol. 13:19-23. [0164] 64. Oh B-C, Choi W-C, Park S, Kim Y-., Oh T-K. 2004. Biochemical properties and substrate specificities of alkaline and histidine acid phytases. Appl. Microbiol. Biotechnol. 63:362-372. [0165] 65. Ray W J Jr, Roscelli G A. 1964. A kinetic stuy of the phosphoglucomutase pathway. J. Biol. Chem. 239:1228-1236. [0166] 66. Mitchell D B, Vogel K, Weimann B J, Pasamontes L, van Loon APGM. 1997. The phytase subfamily of histidine acid phosphatases: isolation of genes for two novel phytases from the fungi Aspergillus terreus and Myceliophthora thermophila. Microbiology 143:245-252. [0167] 67. Tomschy A, Brugger R, Lehmann M, Svendsen A, Vogel K, Kostrewa D, Lassen S F, Burger D, Kronenberger A, van Loon APGM, Pasamontes L, Wyss M. 2002. Engineering of phytase for improved activity at low pH. Appl. Environ. Microbiol. 68:1907-1913. [0168] 68. Pogell B M. 1953. A new synthesis of fructose-1-phosphate with phosphorus pentoxide. J. Biol. Chem. 201:645-649. [0169] 69. Fessner W-D, Sinerius G, Schneider A, Dreyer M, Schulz G E, Badia J, Aguilar J. 1991. Diastereoselective enzymatic aldol additions: L-rhamnulose and L-fuculose 1-phosphate aldolases from E. coli. Angew. Chem. Int. Ed, Engl. 30:555-558. [0170] 70. Lefebvre M J, Gonzalez N S, Pontis H G. 1964. Anion-exchange chromatography of sugar phosphates with triethylammonium borate. J. Chromatogr. 15:495-500. [0171] 71. Smits H P, Cohen A, Buttler T, Nielsen J, Olsson L. 1998. Cleanup and analysis of sugar phosphates in biological extracts by using solid-phase extraction and ani-on-exchange chromatography with pulsed amperometric detection. Anal. Biochem. 261:36-42. [0172] 72. Lu Z, Dunaway-Mariano D, Allen K N. 2005. HAD superfamily phosphotransferase substrate diversification: structure and function analysis of HAD subclass IIB sugar phosphatase BT4131. Biochemistry 44:8684-8696. [0173] 73. Tanaka N, Hasan Z, Hartog A F, van Herk T, Wever R, Sanders R J. 2003. Phosphorylation and dephosphorylation of polyhydroxy compounds by class A bacterial acid phosphatases. Org. Biomol. Chem. 1:2833-2839. [0174] 74. Mihara Y, Utagawa T, Yamada H, Asano Y. 2001. Acid phosphatase/phosphotransferases from enteric bacteria. J. Biosci. Bioeng. 92:50-54. [0175] 75. Koerner TAW, Voll R J, Cary L W, Younathan E S. 1980. Carbon-13 nuclear magnetic resonance studies and anomeric composition of ketohexose phosphates in solution. Biochemistry 19:2795-2801. [0176] 76. Lu Z, Dunaway-Mariano D, Allen K N. 2008. The catalytic scaffold of the haloalkanoic acid dehalogenase enzyme superfamily acts as a mold for the trigonal bipyramidal transition state. Proc. Natl. Acad. Sci. 105:5687-5692.