MMTV-SV40-Spy1A and Spy1A-pTRE Transgenic Mouse Models

20180146650 ยท 2018-05-31

    Inventors

    Cpc classification

    International classification

    Abstract

    In one aspect, the invention provides a transgenic non-human animal model having germ cells and somatic cells containing an endogenous MMTV-SV40-Spy1A gene sequence introduced into said animal model or an ancestor of said animal model at an embryonic stage, wherein said gene sequence comprises a mouse mammary tumor virus gene (MMTV), a functionally disrupted SV40 gene (SV40) and a human Spy1A gene. In another aspect, the present invention provides a transgenic non-human animal model whose germ cells and somatic cells contain an endogenous Spy1A-pTRE-Tight gene sequence introduced into said animal model or an ancestor of said animal model at an embryonic stage. Preferably, the Spy1A-pTRE-Tight animal model expresses the Spy1A gene and develop cancer, preferably breast cancer, when administered with tetracycline, preferably doxycycline.

    Claims

    1. A transgenic non-human animal model, the animal model being a progeny obtained from breeding first and second ancestors, wherein the first ancestor comprises respective germ cells and somatic cells having a nestin-rtTA gene sequence introduced into the genome of the first ancestor at an embryonic stage, and the second ancestor comprises respective germ cells and somatic cells having a Spy1A-pTRE-Tight gene sequence introduced into the genome of the second ancestor at an embryonic stage, the Spy1A-pTRE-Tight gene sequence comprising a human Spy1A gene.

    2. The transgenic non-human animal model of claim 1, wherein the first ancestor is female, the second ancestor is male, and the animal model comprises germ cells and somatic cells having the nestin-rtTA gene sequence and the Spy1A-pTRE-Tight gene sequence.

    3. The transgenic non-human animal model of claim 1, wherein the second ancestor is hemizygous of the Spy1A-pTRE-Tight gene sequence, and the human Spy1A gene comprises a modified human Spy1A gene of SEQ ID NO: 1 or a conservatively modified variant thereof.

    4. The transgenic non-human animal model of claim 1, wherein the Spy1A-pTRE-Tight gene sequence is introduced into the genome of the second ancestor by microinjecting a fragment sequence obtained from restriction enzyme digestion of SEQ ID NO: 18 or a conservatively modified variant thereof with XhoI and A1wNI.

    5. The transgenic non-human animal model of claim 1, wherein the nestin-rtTA gene sequence comprises a nestin promoter sequence and a reverse tetracycline transactivator (rtTA) gene sequence, the nestin promoter sequence being selected to preferentially induce transcription of the rtTA gene sequence in the brain.

    6. The transgenic non-human animal model of claim 1, wherein the animal model is selected to express the Spy1A gene and develop cancer when administered with a tetracycline.

    7. The transgenic non-human animal model of claim 6, wherein the tetracycline is doxycycline.

    8. A transgenic non-human animal model comprising germ cells and somatic cells having a plurality of gene sequences introduced into the genome of said animal model or an ancestor of said animal model at an embryonic stage, wherein a first one of said gene sequences comprises a nestin-rtTA gene sequence, and a second one of said gene sequences comprises a Spy1A-pTRE-Tight gene sequence, the Spy1A-pTRE-Tight gene sequence comprising a human Spy1A gene.

    9. The transgenic non-human animal model of claim 8, wherein the animal model is hemizygous of the Spy1A-pTRE-Tight gene sequence, and the human Spy1A gene comprises a modified human Spy1A gene of SEQ ID NO 1 or a conservatively modified variant thereof.

    10. The transgenic non-human animal model of claim 8, wherein the Spy1A-pTRE-Tight gene sequence is introduced into the genome of the animal model or the ancestor by microinjecting a fragment sequence obtained from restriction enzyme digestion of SEQ ID NO: 18 or a conservatively modified variant thereof with XhoI and A1wNI.

    11. The transgenic non-human animal model of claim 8, wherein the nestin-rtTA gene sequence comprises a nestin promoter sequence and a reverse tetracycline transactivator (rtTA) gene sequence, the nestin promoter sequence being selected to preferentially induce transcription of the rtTA gene sequence in the brain.

    12. The transgenic non-human animal model of claim 8, wherein the animal model is selected to express the Spy1A gene and develop cancer when administered with a tetracycline.

    13. The transgenic non-human animal model of claim 12, wherein the tetracycline is doxycycline.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0039] Reference may now be had to the following detailed description, taken together with the accompanying drawings in which:

    [0040] FIG. 1 shows a fusion gene fragment construct for producing a transgenic mouse according to an embodiment of the present invention.

    [0041] FIG. 2 shows identification of positive founders confirmed through PCR analysis. Positive founders are indicated by the presence of an 825 bp fragment.

    [0042] FIG. 3 shows GAPDH (100 bp) control for the identification of positive founders as shown in FIG. 2.

    [0043] FIG. 4 shows identification of SDM-derived mutant Flag-Spy1A-pLXSN constructs upon detecting of a 977 bp fragment following EcoRI digestion of isolated plasmid DNA from each colony: colony 1.1 (lane 1); colony 1.2 (lane 2); colony 1.3 (lane 3); colony 2.1 (lane 4); colony 2.2 (lane 5); and colony 2.3 (lane 6). The pLXSN vector backbone was estimated at 7.0 kb, and the Spy1A insert was estimated at 1.0 kb (997 bp).

    [0044] FIG. 5 shows EcoRI digestion of the MMTV-SV40-Spy1A transgenic vector releasing the flag-Spy1A coding sequence from the remaining vector backbone. EcoRI digestion of the resultant transgene DNC produced a 977 bp fragment as expected and confirmed successful cloning. The pMMTV-SV40 backbone was estimated at 6.0 kb and the flag-tagged Spy1A insert was estimated at 1.0 kb (997 bp).

    [0045] FIG. 6 shows digestion of MMTV-SV40-Spy1A prior to microinjection.

    [0046] FIG. 7 shows detection of a single copy of MMTV-SV40-Spy1A DNA utilizing PCR genotyping methods. Transgene DNA was successfully detected using 8% PAGE in order to verify the success of using the M023/M023 primer set for detection of the Spy1A transgene in tail clip samples. PCR amplification of MMTV-SV40-Spy1A vector DNA (lane 2) using M022/M023 primers produced an 825 bp amplicon, identical to the positive MMTV vector control (+MMTV, lane 1) as expected.

    [0047] FIG. 8 shows successful transmission of transgene from founder to offspring using primer pair M022 (SEQ ID NO: 2)/M023 (SEQ ID NO: 4) resulting in a 825 bp fragment.

    [0048] FIG. 9 shows confirmation of germline transmission of transgene using primer pair A933 (SEQ ID NO: 3)/M023 (SEQ ID NO: 4) resulting in a 197 bp fragment.

    [0049] FIG. 10 shows a Spy1-pTRE vector map according to an embodiment of the present invention.

    [0050] FIG. 11 shows a restriction digest of XhoI and A1wNI for isolating a portion of the vector illustrated FIG. 10 for a subsequent microinjection step according to an embodiment of the present invention.

    [0051] FIG. 12 shows identification of Spy1-pTRE founder mice via PCR analysis in the presence of a 536 bp band. The number labels correspond to mouse tag numbers belonging to each tail sample screened, and the label vector corresponds to the Spy1-pTRE transgenic vector used as a positive control.

    [0052] FIG. 13 shows confirmation of successful germline transmission of Spy1-pTRE transgene according to an embodiment of the present invention. The number labels correspond to mouse tag numbers belonging to each tail sample screened, and the label vector corresponds to the Spy1-pTRE transgenic vector used as a positive control.

    [0053] FIG. 14 shows a Flag-Spy1A-pTRE Tight vector map according to an embodiment of the present invention. Primers, Spy1 and pTRE promoter are outlined.

    [0054] FIG. 15 shows a linearized map of a Flag-Spy1A-pTRE Tight vector indicating the locations of promoter, Spy1 and primers.

    [0055] FIG. 16 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 0.5 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to pTRE vector control (447 bp); and the lanes G correspond to GAPDH (about 100 bp).

    [0056] FIG. 17 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 1 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to pTRE vector control (447 bp); and the lanes G correspond to GAPDH (about 100 bp). The band of correct size is outlined under the lane 3P.

    [0057] FIG. 18 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 2 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to pTRE vector control (447 bp); and the lanes G correspond to GAPDH (about 100 bp). The band of correct size is outlined under the lane 3P.

    [0058] FIG. 19 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 3 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to pTRE vector control (447 bp); and the lanes G correspond to GAPDH (about 100 bp). The band of correct size is outlined under the lane 3P.

    [0059] FIG. 20 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 0.5 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to a maxi-prepped pTRE vector control with a higher concentration; and the lanes G correspond to GAPDH. The band of correct size is outlined under the lane 3P.

    [0060] FIG. 21 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 1 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to a maxi-prepped pTRE vector control with a higher concentration; and the lanes G correspond to GAPDH. The band of correct size is outlined under the lanes 1P and 3P.

    [0061] FIG. 22 shows a 4.25% polyacrylamide gel image of Spy1-pTRE DNA samples 1, 2 and 3 amplified with PCR using the primer combination A548/A549 with 2 second exposure time. The lane L corresponds to a ladder; the lanes 1P, 2P and 3P correspond to samples 1, 2 and 3, respectively; the lane CP corresponds to a maxi-prepped pTRE vector control with a higher concentration; and the lanes G correspond to GAPDH. The band of correct size is outlined under the lanes 1P and 3P.

    [0062] FIG. 23 shows a bar graph illustrating the results from a qRT PCR analysis test for Spy1 overexpression in the mammary glands of a MMTV-Spy1 mouse in accordance with a preferred embodiment of the invention, and which shows log 10 expression of Spy1 as the Y axis compared to GAPDH.

    [0063] FIG. 24 shows a DMBA treatment plan for a MMTV-Spy1 mouse and its pair matched littermates, and which indicates age at beginning and end treatment.

    [0064] FIG. 25 shows a bar graph depicting the percentage of MMTV-Spy1 and control mice (Y axis) that developed all tumour types, mammary tumours, and ovarian tumours.

    [0065] FIG. 26 shows a line graph depicting the percentage of tumour free mice (Y axis) at the indicated ages in weeks (X axis).

    [0066] FIG. 27 shows a bar graph depicting the percentage of MMTV-Spy1 and pair matched littermates (F1 cnt1) developing hepatocellular carcinoma 1 year of age and older.

    [0067] FIG. 28 shows a bar graph illustrating the results from a qRT PCR conducted on liver tissue collected from MMTV-Spy1 mice and their pair matched littermates, and which illustrates Spy1 expression on a log 10 scale as compared to GAPDH.

    [0068] FIG. 29 shows a bar graph illustrating the results from a qRT PCR confirming Spy1 overexpression upon delivery of doxycycline to a MTB-Spy1 mouse generated by crossing a Spy1-pTRE mouse with a MMTV-rtTA mouse.

    [0069] FIG. 30 shows a breeding scheme for a male Spy1-pTRE mouse in accordance with a preferred embodiment of the present invention and a female MMTV-rtTA mouse, and which illustrates possibly genotypes of the resulting progenies.

    [0070] FIG. 31 shows a bar graph illustrating the results from a qRT PCR confirming elevated Spy1 expression upon delivery of doxycycline to a MTB-Spy1 progeny mouse generated by crossing a male Spy1-pTRE parent mouse with a female MMTV-rtTA parent mouse.

    [0071] FIG. 32 shows a bar graph illustrating the results from a qRT PCR confirming elevated Spy1 expression upon delivery of doxycycline to a MTB-Spy1 progeny mouse generated by crossing a male Spy1-pTRE parent mouse with a female MMTV-rtTA parent mouse, when compared to the Spy1 expression of the parent mice.

    [0072] FIG. 33 shows a bar graph illustrating the results from a qRT PCR confirming elevated Spy1 expression in the mammary glands of a female MTB-Spy1 progeny mouse upon delivery of doxycycline thereto, and which is generated by crossing a male Spy1-pTRE parent mouse with a female MMTV-rtTA parent mouse.

    [0073] FIG. 34 shows a breeding scheme for a Spy1-pTRE mouse in accordance with a preferred embodiment of the present invention and a nestin-rtTA mouse, and which illustrates the intended genotype of the resulting progenies, or namely the NTA-spy1 progeny mouse.

    [0074] FIG. 35 shows agarose gel images of PCR-amplified samples from a number of progenies produced by the breeding scheme shown in FIG. 34, with the upper agarose gel image showing bands of 425 base pairs indicative of the transgenic Spy1-pTRE portion and the lower agarose gel image showing bands of 450 base pairs indicated of the transgenic nestin-rtTA portion, where the gel images were used to identify the intended NTA-Spy1 progenies.

    [0075] FIG. 36 shows a bar graph illustrating the results from a qRT-PCR experiment performed with a wild type mouse, a founder nestin-rtTA mouse, a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and which shows respective levels of Spy1 in the mouse brain following doxycycline induction.

    [0076] FIG. 37 shows a bar graph quantitatively illustrating the results from a Western blot normalized to GAPDH, and which are presented as the means.d. for a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34.

    [0077] FIG. 38 shows on the left side images of the brain cells from a nine-week-old founder Spy1-pTRE mouse (upper three images) and a nine-week-old NTA-Spy1 progeny mouse (lower three images) obtained from the breeding scheme shown in FIG. 34, and which were obtained with 4,6-diamidino-2-phenylindole (DAPI) staining (left images), 5-bromo-2-deoxyuridine detection (center images) and Proliferating cell nuclear antigen (PCNA) detection (right images). On the right side, FIG. 38 shows a bar graph quantitatively illustrating the results from the BrdU and PCNA images shown in FIG. 38 for the nine-week-old founder Spy1-pTRE mouse and the nine-week-old NTA-Spy1 progeny mouse.

    [0078] FIG. 39 shows a bar graph illustrating percent ratios (y-axis) of the numbers of differentiated cells to the total numbers of cells at different time points (x-axis) after incubation or stimulation of primary cells derived from a founder nestin-rtTA mouse, a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34 in a 2% Fetal Bovine Serum (FBS) medium.

    [0079] FIG. 40 shows a bar graph illustrating the results from a neurosphere formation assay over serial passages using a founder nestin-rtTA mouse, a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and which are presented as the means.d. (where *p<0.05, **p<0.001 and ***p<0.0001).

    [0080] FIG. 41 shows on the left side bar graphs illustrating the results (which are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001) from a cell pair assay performed with cells obtained from a founder Spy1-pTRE mouse (upper bar graph) and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34 (lower bar graph), and which were cultured in Matrigel, and on the right side, FIG. 42 shows images of numb protein distribution in mitotic pairs, and which were used to assess modes of division.

    [0081] FIG. 42 shows on the left side images of brain sections derived from a founder nestin-rtTA mouse (upper image) and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34 (lower image), and which were stained with 4,6-diamidino-2-phenylindole (DAPI) and further stained for Proliferating cell nuclear antigens (PCNA). On the right side, FIG. 42 shows bar graphs quantitatively illustrating the average numbers of PCNA+ cells as detected from the brain sections.

    [0082] FIG. 43 shows a bar graph illustrating the results of a differentiation assay using a 2% Fetal Bovine Serum (FBS) medium with aging cells derived from a founder nestin-rtTA mouse, a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and which depicts percent ratios (y-axis) of the numbers of differentiated cells to the total numbers of cells at different time points (x-axis), and which are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    [0083] FIG. 44 shows a bar graph illustrating the results from a colony formation assay performed in soft agar with cells obtained from a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, where the cells were infected with pBABE puro H-RAS V12 (RAS) or control (pEIZ), and the numbers of colonies were assessed after three weeks. The results are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    [0084] FIG. 45 shows a bar graph illustrating the results of a CellTiter-Glo 3D cell viability assay performed with tumorospheres derived from cells obtained from a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and which were treated or infected with pBABE puro H-RAS V12 (RAS) in Matrigel, and the tumorospheres were treated with erlotinib, NU2058, temozolomide (TMZ) or a combination thereof for 48 hours. The results are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    [0085] FIG. 46 shows on the left side a bar graph demonstrating p53 knockdown in neurospheres obtained from a founder nestin-rtTA mouse, a founder Spy1-pTRE mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and on the right side a bar graph illustrating the results of a caspase 3/7 assay performed on neurospheres obtained from the NTA-Spy1 progeny mouse exposes to 150 M temozolomide (TMZ) with or without p53 knockdown. The results are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    [0086] FIG. 47 shows on the left side an image of the cortical plate from a founder nestin-rtTA mouse (left) with Nissl staining and a bar graph (right) quantitatively illustrating the number of Nissl+ cells, and on the right side the same of the cortical plate from the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34. The results are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    [0087] FIG. 48 shows on the top a schematic of an object-recognition task performed with a control mouse and the NTA-Spy1 progeny mouse obtained from the breeding scheme shown in FIG. 34, and on the bottom a bar graph quantitatively illustrating the preference of the mice for the novel object (n=12). The results are presented as the means.d., where *p<0.05, **p<0.001 and ***p<0.0001.

    DETAILED DESCRIPTION OF THE INVENTION

    [0088] The gene fragment construct MMTV-SV40-Spy1A (SEQ ID NO: 5)_for the development of a transgenic mouse according to a preferred embodiment of the present invention is shown in FIG. 1. The construct was micro injected at roughly 4.7 kb into 357 fertilized embryos from superovulated female mice and transplanted into pseudo pregnant CD-1 female mice. This resulted in 43 pups being born of which 13 tested positively for the MMTV-SV40-Spy1A as confirmed in the PCR analysis shown in FIGS. 2 and 3.

    [0089] To prepare the MMTV-SV40-Spy1A construct, Flag-Spy1A-pLXSN containing the complete coding sequence of the human Spy1A gene conjugated to a flag tag was provided. Site-directed mutagenesis (SDM) was utilized to create a second EcoRI site positioned near the terminal region of the human Spy1A coding sequence (SEQ ID NO: 1) in Flag-Spy1A-pLXSN for efficient removal of the intrinsic poly-A tail.

    TABLE-US-00001 GAATTCGCGGCCGCGTCGACCTGCGACGGAGCCTTGACCGCCGTTGCCCGGCCCTCTCCC GCGCAGCCCCGGGGTTCCGCAGGAATATTGGGAAACCAAAATGAGGCACAATCAGATGTG TTGTGAGACACCACCTACTGTCACTGTTTATGTAAAATCAGGGTCAAATAGATCACATCA GCCTAAAAAGCCCATTAGTCTGAAGCGTCCTATTTGTAAAGATAATTGGCAAGCATTTGA AAAAAATACACATAATAACAACAAATCTAAACGCCCCAAAGGACCTTGTCTGGTTATACA GCGTCAGGATATGACTGCTTTCTTTAAATTATTTGATGACGATTTAATTCAAGATTTCTT GTGGATGGACTGCTGCTGTAAAATTGCAGACAAGTATCTTTTGGCTATGACCTTTGTTTA TTTCAAGAGGGCTAAATTTACTATAAGTGAGCATACCAGGATAAATTTCTTTATTGCTCT GTATCTGGCTAATACAGTTGAAGAAGATGAAGAAGAAACCAAGTACGAAATTTTTCCATG GGCTTTAGGGAAAAACTGGAGAAAATTGTTCCCTAATTTCTTAAAGTTAAGGGAGCAGCT CTGGGATAGAATTGACTATAGGGCTATTGTAAGCAGGCGATGTTGTGAGGAGGTTATGGC CATTGCACCAACCCATTATATCTGGCAAAGAGAACGTTCTGTTCATCACAGTGGAGCTGT CAGAAACTACAACAGAGATGAAGTTCAGCTGCCCCGGGGACCTAGTGCCACACCAGTAGA TTGTTCACTCTGTGGTAAAAAAAGAAGATATGTTAGACTGGGATTGTCTTCATCATCATC TTTATCCAGTCATACAGCAGGGGTGACAGAAAAACATTCTCAGGACTCATACAACTCACT GTCAATGGACATAATAGGTGATCCTTCTCAAGCTTATACTGGTTCTGAAGGTATGATATA GTAATA C TGCCAGAATTAGATTTATGCATGTTGTTTACTGAGCTCTAGTCAGTCCTTTCTGGCGGGG ATACATAATAATTTATATACTCCAACAATATGAGTTAAATTAATCTTGAAACTTTCTCCC CTTTCAGTTACTTTTTGTCTTGTGTCCATATTTGTTTTGTGGTGACCCACCTAAACAGAT TTTTAATGTGACCTATGTTAAGTTGAAAACTAATGCACCATAAGCCTCAGTATTTTAAGA GCCTGAATCATTTTTTTGAAATGTTTATTTTATTCAAAAGGGTTTCAAGAAGAAAATAAA TTTACTTGTAATCTCAAAAAAAAAAAAAAAAAAAAAA

    [0090] SDM primers A424 and A425 (SEQ ID NOs: 6 and 7) were designed to flank the vector region targeted for mutation. SDM reactions were performed with the following components: Flag-Spy1A-pLXSN vector DNA (10-100 ng); 0.3 mM dNTP mix (Cat. No. DD0057, Biobasic Inc., Ontario, Canada); 1pfx buffer and 1 l pfx polymerase (Cat. No. 11708-013, Invitrogen, Canada); 1 mM MgSO.sub.4; 1 M each of A424 forward and A425 reverse primers (SEQ ID NOs: 6 and 7); filter-sterilize nuclease free water up to 50.0 l. Cycling conditions for SDM include (1) 2 minutes at 94 C., (2) 25 cycles of 94 C. for 15 seconds, 55 C. for 30 seconds and 68 C. for 5 seconds, and (3) 68 C. for 10 minutes. SDM reaction products were DpnI digested for 2 hours at 37 C. (Cat. No. ER1701, Fermentas, Burlington, Ontario, Canada), and subsequently transformed utilizing TOP10 E. coli and plated onto 100 mg/ml Ampicillin plates. Select colonies were screened for EcoRI insertion and were identified upon detection of a 977 bp fragment following EcoRI digestion (for 20 minutes at 37 C. (Cat. No. FD0274, Fermentas)) of isolated plasmid DNA from each colony (using QIAprep Spin Miniprep Kit (Cat. No. 27104, Qiagen, Mississauga, Ontario, Canada) as shown in FIG. 4. Successful EcoRI insertion was confirmed through sequencing for two colonies in particular, Is.1 and IIs.3, utilizing A210 and A211 sequencing primers (SEQ ID NOs: 8 and 9). Purified vector DNA from Colony IIs.3 was subjected to EcoRI digestion (Cat. No. ER0271, Fermentas), and produced two fragments at 7.0 kb (vector backbone) and 1.0 kb (Spy1A gene insert). Digestion products were separated, and the appropriate 1.0 kb fragment was gel extracted using the EZ-10 Spin Column DNA Gel Extraction Kit (Cat. No. BS354, Biobasic Inc.) and purified.

    [0091] EcoRI digestion of 2 mg of MMTV-SV40-TRPS-1 vector DNA ensued for 1 hour at 37, followed by the immediate removal of terminal phosphate groups from digested ends utilizing incubation with calf intestinal alkaline phosphatase (Cat. No. EF0341, Fermentas) for 30 minutes at 37. Phosphatase treatment was necessary in order to prevent the re-ligation of linearized vector DNA termini. Consequently, reaction products were separated, followed by gel purification of the resultant 6.0 kb fragment (MMTV-SV40 backbone) using the EZ-10 Spin Column DNA Gel Extraction Kit. Ligation of the Spy1A gene insert into the MMTV-SV40 backbone was conducted using T4 DNA ligase (Cat. No. EL0017, Fermentas), and ligation reactions were subsequently transformed utilizing TOP10 E. coli and plated onto 100 mg/ml Ampicillin plates. Select colonies were screened for EcoRI insertion and were identified upon detection of a 977 bp fragment following EcoRI digestion of isolated plasmid DNA from each colony as shown in FIG. 5. Successful cloning of the Spy1A coding sequence into the MMTV-SV40 vector backbone was confirmed through sequencing. Sequencing primers A252, A253, A254, A255, A256, A257, A258 and A259 (SEQ ID NOs: 10 to 16) were utilized in order to verify the intactness of all transgenic vector components.

    [0092] The resultant transgenic vector was designated as MMTV-SV40-Spy1A and contains an untranslated portion of the Ha-ras gene, in addition to an SV40 polyadenylation site. Bacterial sequences such as those found in vector backbones have been noted to inhibit successful incorporation of transgenic DNA into the mouse blastocyst genome. Thus, XhoI/SpeI double digestion (Cat. Nos. ER0691 and ER1251, Fermentas) of purified vector DNA (30 mg per tube) ensued, and resulted in the production of two fragments: 4.7 kb (MMTV-SV40-Spy1A transgene) and 2.9 kb (remaining backbone) as shown in FIG. 6. Two vials of XhoI/SpeI digested transgenic DNA were made available for microinjection into mouse blastocysts for subsequent creation of the first MMTV-SV40-Spy1A transgenic mouse model known to date. Transgene detection of a single copy of MMTV-SV40-Spy1A DNA was tested utilizing the PCR conditions outlined for M022 and M023 genotyping primers (SEQ ID NOs: 2 and 4) as shown in FIG. 7.

    [0093] The resulting transgene fragment was sent to the University of Western Ontario Transgenic Facility to undergo pronuclear injections. Tail samples from the resulting litters were received and DNA was extracted using the Qiagen Puregene Core Kit A for mouse tails. Transgene detection was accomplished using two sets of primers with two unique forward primers (M022 (SEQ ID NO: 2) and A933 (SEQ ID NO: 3)) and one reverse primer (M023 (SEQ ID NO: 4)). PCR cycling conditions consisted of (1) denaturation at 94 C. for 3 min, (2) denaturation at 94 C. for 1 min, annealing at 55 C. for 2 min, elongation at 72 C. for 1 min and (3) a final elongation step at 72 C. for 3 min. Each 25 uL PCR reaction was made using UBI HP Taq DNA polymerase (HPTAQ-01) and contained a final concentration of 2 ng/uL of pure genomic DNA, 1 buffer, 2 mM MgSO.sub.4, 0.2 mM dNTP, 0.5 mM forward primer, 0.5 mM reverse primer and 0.025 U/uL Taq polymerase. Additionally, a final volume of 1% and 4% DMSO was added for primer pairs M022 (SEQ ID NO: 2)/M023 (SEQ ID NO: 4) and A933 (SEQ ID NO: 3)/M023 (SEQ ID NO: 4) respectively. PCR amplification resulted in an 825 bp and 197 bp amplicon for primers M022 (SEQ ID NO: 2)/M023 (SEQ ID NO: 4) and A933 (SEQ ID NO: 3)/M023 (SEQ ID NO: 4) respectively as shown in FIGS. 8 and 9, respectively.

    [0094] Expression levels of Spy1A was tested in the inguinal mammary glands of 6 week old MMTV-Spy1A mice and their negative littermates via qRT PCR analysis to ensure Spy1A was being overexpressed in the mammary gland of this mouse model system. Spy1A was found to be significantly overexpressed in the mammary glands of MMTV-Spy1A mice as compared to their control littermates (FIG. 23). To test for increased susceptibility to mammary tumourigenesis. MMTV-Spy1A mice and their negative littermates were treated with 1 mg of 7,12-dimethylbenzanthracene (DMBA) once a week for 6 consecutive weeks beginning at 8 weeks of age via oral gavage. Treatment plan indicating age during treatment and at end of study is illustrated in FIG. 24. Mice were monitored on a weekly basis for the development of mammary tumours via palpitation. MMTV-Spy1A mice were found to develop significantly more mammary tumours than their control littermates (FIG. 25). Additionally, MMTV-Spy1A mice developed tumours earlier than their control littermates (FIG. 26).

    [0095] When collecting male MMTV-Spy1 mice over the age of 1 year, it was noted there was an increased incidence of liver carcinogenesis in the MMTV-Spy1 mice as compared to their negative control littermates (FIG. 27). Liver tissue was collected from MMTV-Spy1 male mice 1 year of age and older along with pair matched littermate controls and the liver tissue was subjected to qRT PCR analysis to determine Spy1 expression in the liver. Spy1 was found to be significantly overexpressed in MMTV-Spy1 male mice as compared to littermate controls (FIG. 28).

    [0096] In accordance with another preferred embodiment of the present invention, the fusion gene fragment construct Flag-Spy1A-pTRE-Tight (SEQ ID NO: 18) as illustrated in FIGS. 10, 14 and 15 were prepared. In particular, a Caspase3-pTRE-Tight vector was digested with EcoRI and PvuII to remove Caspase3. A 20 bp linker was then added to close the vector. Site directed mutagenesis was performed on a Flag-Spy1A-pLXSN vector to create an EcoRI restriction enzyme site to enable extraction of Flag-Spy1A from the vector. EcoRI digestion was subsequently performed to remove Flag-Spy1A from the Flag-Spy1A-pLXSN vector. The Flag-Spy1A fragment was then ligated into the pTRE-Tight vector.

    [0097] Successful preparation of DNA fusion gene fragment construct samples were confirmed by PCR amplification with the primer combination A548/A549 (SEQ ID NOs: 19 and 20) and polyacrylamide gel (as shown in FIGS. 16 to 22) as well as DNA sequencing. The bands of correct size are outlined under the lanes 1P and/or 3P in FIGS. 17 to 22. All tested PCR samples were confirmed by DNA sequencing.

    [0098] In a separate study, for amplification the fusion gene fragment construct was also subject to PCT with the forward and reverse primers of SEQ ID NOs: 21 to 23 in a 25 L reaction having: 12.5 L New England Biolabs Master Mix; 1 L of 10 M forward primer (SEQ ID NO: 21); 1 L of 10 M reverse primer (SEQ ID NOs: 22 and 23); and 100 ng of DNA. The PCR program was set for 95 C. for 2 minutes and 30 seconds; 40 cycles of i) 95 C. for 30 seconds, ii) 60 C. for 45 seconds and iii) 72 C. for 1 minute and 30 seconds; and 72 C. for 10 minutes.

    [0099] The Spy1-pTRE plasmid were restriction digested using XhoI and A1wNI to isolate a portion for subsequent microinjection into a fertilized embryo from a superovulated female mouse. The digested portion was confirmed by gel electrophoresis as shown in FIG. 11. The digested portion was microinjected into fertilized embryos from superovulated female mice and transplanted into pseudo pregnant CD-1 female mice. Some resulting pups tested positive as confirmed and shown in FIG. 12. Successful germline transmission of the Spy1-pTRE transgene was confirmed as shown in FIG. 13.

    [0100] The mice having the Spy1-pTRE gene sequence was fed doxycycline to activate expression of Spy1A. Development of cancer including breast cancer was experimentally confirmed.

    [0101] In a separate study, selected Spy1A-pTRE mice found to lack inducible overexpression of Spy1A were nevertheless found to be suitable for preparing overexpressing progenies. In a controlled study, selected Spy1-pTRE mice found to be without inducible overexpression of Spy1A were preferably crossed with MMTV-rtTA mice to generated a MTB-Spy1 mouse model. It has been appreciated that such animal model may permit inducible overexpression of Spy1A preferably after administration of doxycycline to their diet in the form of food pellets. Indeed, expression of Spy1 was induced by administering 2 mg/mL of doxycycline at 5 weeks of age. Mammary glands were collected at 6 weeks of age from MTB-Spy1, Spy1-pTRE and MMTV-rtTA mice for qRT analysis to test for increased expression of Spy1 in the MTB-Spy1 mouse as compared to the selected control Spy1-pTRE and MMTV-rtTA mice. Spy1 was found to be overexpressed in the MTB-Spy1 mouse, indicating this model system is functioning correctly (FIG. 29).

    [0102] In an additional study, a male Spy1-pTRE mouse in accordance with a preferred embodiment of the present invention was crossed with a female MMTV-rtTA mouse received from a collaborator, and which is described in Edward J. Funther et al. A novel doxycycline-inducible system for the transgenic analysis of mammary gland biology. The FASEB Journal. 16.3 (2002): 283-292, the entire contents of which are hereby incorporated by reference. The female MMTV-rtTA mouse included the mouse mammary tumor virus gene (MMTV) and a reverse tetracycline transactivator (rtTA), such that the MMTV promotor portion drives the expression of rtTA (Tet-On). As illustrated in FIG. 29, four different genotypes were expected from the crossing, or namely a wild type progeny mouse, a Spy1-pTRE progeny mouse, an MMTV-rtTA progeny mouse and the intended MTB-Spy1 progeny mouse, the latter of which includes the transgenic elements from both parent mice. It has been appreciated that the intended MTB-Spy1 progeny mouse may permit for an inducible Tet-On system for expression of the Spy1 gene in the presence of a tetracycline, or preferably doxycycline, and as activated by the rtTA protein. As seen in FIGS. 31 to 33, qRT-PCR analysis confirmed that upon exposure to doxycycline, a MTB-Spy1 progeny female mouse showed elevated Spy1 expression in the mammary glands when compared to a control mouse, and the parent MMTV-rtTA and Spy1A-pTRE mice.

    [0103] In a further additional study, a Spy1-pTRE mouse in accordance with a preferred embodiment of the present invention was crossed with a nestin-rtTA mouse described in Takayuki Mitsuhashi et al. Overexpression of p27.sup.Kip1 lengthens the G.sub.1 phase in a mouse model that targets inducible gene expression to central nervous system progenitor cells. PNAS. 98.11 (2001): 6435-6440, the entire contents of which are hereby incorporated by reference. The nestin-rtTA mouse included a nestin intron II enhancer/promoter and a reverse tetracycline transactivator (rtTA), such that the nestin enhancer/promotor portion drives the expression of rtTA (Tet-On). Four different genotypes were expected from the crossing, or namely a wild type progeny mouse, a Spy1-pTRE progeny mouse, a nestin-rtTA progeny mouse and the intended NTA-Spy1 progeny mouse, the latter of which includes the transgenic elements from both parent or founder mice, as shown in FIG. 34. The presence of the Spy1-pTRE and nestin-rtTA transgenes was respectively confirmed with an agarose gel bands at 425 and 450 base pairs (see FIG. 35), and the NTA-Spy1 progeny mouse expressed Spy1 upon doxycycline induction, as shown in FIG. 36. Furthermore, in references to the founder Spy1-pTRE and/or nestin-rtTA mice, the NTA-Spy1 progeny mouse was characterized as shown in FIGS. 37 to 42, with respect to for example brain cell differentiation, proliferation and depletion, as well as enhanced susceptibility to oncogenic transformation, increased drug resistance and learning/memory defects (see FIGS. 43 to 48). It has thus been appreciated that the NTA-Spy1 progeny mouse may permit for an inducible Tet-On system for expression of the Spy1 gene in the presence of a tetracycline, or preferably doxycycline, and as activated by the rtTA protein, most preferentially in the brain.

    [0104] The applicant has appreciated that the present invention provides various advantages and applications, and which include without restriction a transgenic non-human animal model whose somatic cells contain at least one copy of a MMTV-Spy1A transgene causing the animal model to develop cancer.

    [0105] In yet another aspect, the present invention provides a transgenic non-human animal model all of whose germ cells and somatic cells contain an exogenous MMTV-SV40-Spy1A gene sequence introduced into said mammal, or an ancestor of said mammal, at an embryonic stage wherein said gene sequence comprises a mouse mammary tumor virus gene (MMTV), a functionally disrupted SV40 gene (SV40) and a modified human Spy1A gene of SEQ ID NO: 1.

    [0106] Other applications of the invention include without restriction: [0107] Methods of screening drugs/vaccines/or other vehicles developed for the prevention of the development of cancer; [0108] The study environmental factors and their effects on the development of cancer; [0109] The study cancer initiated at various stages of the animals development; [0110] Methods of screening drugs candidates and their anti-carcinogenic; [0111] Methods of screening drugs/vaccines/or other vehicles developed for the prevention of the development of cancer; [0112] The study environmental factors and their effects on the development of cancer; and [0113] The study of cancer namely breast cancer based on a novel expression of Spy1A initiated within a model animal by feeding the animal doxycycline.

    [0114] Additional applications of the invention include, without restriction: [0115] 1. Expression of Spy1A within one or more tissues of the model animal is activated by the animal model ingesting doxycycline (Dox). [0116] 2. The expression of Spy1A results in the tissues of the animal model results in the development of cancer namely breast cancer within that model animal. [0117] 3. A transgenic non-human animal model in this case being a mouse incorporates the condition and promoter response of claim 1 and 2. [0118] 4. The mouse animal model is able to pass this condition expressed in claim 1 and 2 along to subsequent generations when cross with a mouse not having this condition. [0119] 5. The transgenic non-human animal of claim 1, can be said animal selected from the group consisting of mice, rats, monkeys, sheep, and rabbits. [0120] 6. Analysis of animal model DNA is able to confirm that transgenic condition exists in said animal model. [0121] 7. Transgenic animal model may be used to: [0122] a. Study cancer [0123] b. Study cancer initiated at various stages of the animals development [0124] c. Method of screening drugs candidates and there anti-carcinogenic [0125] d. Method of screening drugs/vaccines/or other vehicles developed for the prevention of the development of cancer. [0126] e. Study environmental factors and their effects on the development of cancer