GENE THERAPY VECTOR SYSTEM AND PRODRUG GENES
20180147299 ยท 2018-05-31
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N9/78
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
C12N2740/13043
CHEMISTRY; METALLURGY
C12N2740/13022
CHEMISTRY; METALLURGY
C12N2740/10052
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2740/10032
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N9/12
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N7/00
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a replication retrovirus vector system comprising thymidine kinase (HSV-TK) gene and cytosine deaminase (CD) gene which make gene transfer to cancer cell tissue for the efficient treatment of cancer. Particularly, the HSV-TK/CD combined self-replicating retrovirus vector system of the present invention characteristically contains both HSV-TK and CD genes; has no worries about losing a therapeutic gene because recombination does not occur in this system during virus infection; and has an excellent stability, and also is able to induce cancer cell death by using the prodrug GCV or 5-FC and can apply a therapeutic gene or a prodrug thereof selectively to such cancer that shows resistance against cancer treatment using either TK or CD, so that this system of the invention can be advantageously used as a pharmaceutical composition for the treatment of cancer.
Claims
1. A replicating retrovirus vector system comprising: a first recombinant expression vector containing an MuLV Gag-Pol gene, a promoter, and a cytosine deaminase gene or thymidine kinase gene; and a second recombinant expression vector containing a virus Env gene, a promoter, and a thymidine kinase gene or a cytosine deaminase gene.
2. (canceled)
3. The replicating retrovirus vector system according to claim 1, wherein the promoter is originated from one of those cancer specific promoters selected from the group consisting of an MCMV immediate-early promoter, an EFl promoter, a HCMV immediate-early promoter, a PGK promoter, and a hTERT promoter.
4. The replicating retrovirus vector system according to claim 3, wherein the EFl promoter is a polynucleotide represented by SEQ ID NO: 34.
5. The replicating retrovirus vector system according to claim 1, wherein the virus Env gene is selected from the group consisting of those Env genes of Gibbon ape Leukemia virus (GaLV), amphotropic MuLV, xenotropic MuLV, RD114, vesicular stomatitis virus (VSV), and measles virus (MV).
6. The replicating retrovirus vector system according to claim 5, wherein the GaLV Env gene is a polynucleotide represented by SEQ ID NO: 35.
7. The replicating retrovirus vector system according to claim 1, wherein the thymidine kinase gene is a polynucleotide represented by SEQ ID NO: 15.
8. The replicating retrovirus vector system according to claim 1, wherein the cytosine deaminase gene is optimized by human codon.
9. The replicating retrovirus vector system according to claim 8, wherein the cytosine deaminase gene is a polynucleotide selected from the group consisting of a sequence represented by SEQ ID NOs: 16-31.
10. The replicating retrovirus vector system according to claim 1, wherein the thymidine kinase or cytosine deaminase gene can activate a prodrug.
11. The replicating retrovirus vector system according to claim 10, wherein the prodrug is selected from the group consisting of ganciclovir, 5-fluorocytosine, and a combination thereof.
12. The replicating retrovirus vector system according to claim 1, wherein the MuLV Gag-Pol gene is a polynucleotide having the fused nucleotide sequence comprising two sequences represented respectively by SEQ ID NO: 32 and SEQ ID NO: 33.
13. A recombinant retrovirus harboring the vector system of either claim 1.
14. A host cell transfected with the recombinant retrovirus of claim 13.
15. A pharmaceutical composition for the prevention or treatment of cancer comprising the recombinant retrovirus of claim 13 as an active ingredient.
16. The pharmaceutical composition according to claim 15, wherein the cancer is selected from the group consisting of mucous carcinoma, round cell carcinoma, locally advanced tumor, metastatic cancer, Ewing sarcoma, cancer metastasis, lymphatic metastasis, squaous cell carcinoma, esophageal squaous cell carcinoma, oral carcinoma, multiple myeloma, acute lymphoblastic leukemia, acute nonlymphoid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, effusion lymphoma, thymus lymphoma lung cancer, small cell lung cancer, cutaneous T cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, adrenal cortical carcinoma, ACTH-producing tumor, non-small cell lung cancer, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyp related to colorectal cancer formation, pancreatic cancer, liver cancer, bladder cancer, primary surface bladder tumor, invasive metastatic cell bladder carcinoma, muscle-invasive bladder cancer, prostate cancer, colon cancer, kidney cancer, hepatocarcinoma, esophageal cancer, ovarian carcinoma, uterine cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneum neoplasm, uterine cervical carcinoma, vaginal cancer, pudendum cancer, uterine cancer, follicle solid tumor, testis cancer, penis cancer, renal cell carcinoma, brain cancer, head/neck cancer, neuroblastoma, brainstem glioma, glioma, metastatic tumor cell invasion in central nervous system, osteoma, osteosarcoma, malignant melanoma, human skin keratinocyte tumor progression, squaous cell carcinoma, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilm's tumor, gallbladder cancer, trophoblastic tumor, hemangiopericytoma, and Kaposi's sarcoma.
17. A composition for gene transfer comprising the recombinant retrovirus of claim 13 for the treatment of cancer.
18. A method for preparing a replicating retrovirus vector system comprising: 1) preparing a first recombinant expression vector containing a MuLV Gag-Pol gene, a promoter, and a cytosine deaminase gene; and 2) preparing a second recombinant expression vector containing a virus Env gene, a promoter, and a thymidine kinase gene.
19. A method for preparing a replicating retrovirus vector system comprising: 1) preparing a first recombinant expression vector containing a MuLV Gag-Pol gene, a promoter, and a thymidine kinase gene; and 2) preparing a second recombinant expression vector containing an Env gene, a promoter, and a cytosine deaminase gene.
20. A method for treating cancer containing the step of administering the recombinant retrovirus of claim 13 to a subject in need.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0120] The present invention provides a replicating retrovirus vector system comprising the first recombinant expression vector containing MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector containing virus Env gene, promoter, and thymidine kinase gene.
[0121] The thymidine kinase gene herein can be a polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 15. The polynucleotide above is not only the polynucleotide encoding the amino acid sequence of thymidine kinase but also the polynucleotide having the nucleotide sequence which is actually same as the said polynucleotide and a fragment thereof. The polynucleotide which is composed of the same nucleotide sequence as the above can have at least 80%, preferably at least 90%, and more preferably at least 95% homology with the polynucleotide of the invention. As described hereinbefore, the polynucleotide of the invention can have substitution, deletion, or insertion of one or more nucleotides in the sequence, as long as the polynucleotide can encode a protein having the equal activity to the above.
[0122] The cytosine deaminase gene above can be optimized by human codon.
[0123] The term optimized by human codon herein indicates that a codon preferred by a host that designates an amino acid when DNA in the host cell is transcribed and translated is substituted with a human codon so as to increase the expression efficiency of the amino acid or the protein encoded by the nucleic acid.
[0124] The cytosine deaminase gene can be the polynucleotide selected from the group consisting of those polynucleotides respectively composed of the sequence represented by SEQ. ID. NO: 16, the sequence represented by SEQ. ID. NO: 17, the sequence represented by SEQ. ID. NO: 18, the sequence represented by SEQ. ID. NO: 19, the sequence represented by SEQ. ID. NO: 20, the sequence represented by SEQ. ID. NO: 21, the sequence represented by SEQ. ID. NO: 22, the sequence represented by SEQ. ID. NO: 23, the sequence represented by SEQ. ID. NO: 24, the sequence represented by SEQ. ID. NO: 25, the sequence represented by SEQ. ID. NO: 26, the sequence represented by SEQ. ID. NO: 27, the sequence represented by SEQ. ID. NO: 28, the sequence represented by SEQ. ID. NO: 29, the sequence represented by SEQ. ID. NO: 30, and the sequence represented by SEQ. ID. NO:31. The polynucleotide can include a variant having the same characteristics as the above.
[0125] The thymidine kinase or cytosine deaminase gene can activate a prodrug. The prodrug can be one or more drugs selected from the group consisting of ganciclovir and 5-fluorocytosine. In a preferred embodiment of the present invention, the thymidine kinase gene can activate ganciclovir, and the cytosine deaminase gene can active 5-fluorocytosine.
[0126] The said Gag gene can be the polynucleotide encoding kinds of proteins that form the retrovirus core. In the meantime, the Pol gene can be the polynucleotide encoding the retrovirus reverse transcriptase and the Env gene can be the polynucleotide encoding the retrovirus envelope glycoprotein.
[0127] The said MuLV-Gag gene is the Gag gene of murine leukemia virus, which can be the polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 32. The said MuLV-Pol gene is the Pol gene of murine leukemia virus, which can be the polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 33. The MuLV Gag-Pol gene can be the polynucleotide composed of the fusion sequence comprising the nucleotide sequence represented by SEQ. ID. NO: 32 and the nucleotide sequence represented by SEQ. ID. NO: 33.
[0128] The promoter above can be one of the promoters originated from cancer specific promoters such as MCMV immediate-early promoter, EFl promoter, HCMV immediate-early promoter, PGK promoter, and hTERT promoter. Herein, the said EFl promoter can be the polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 34.
[0129] The said Env gene can be selected from the group consisting of those Env genes of gibbon ape leukemia virus (GaLV), amphotropic MuLV, xenotropic MuLV, RD114, vesicular stomatitis virus (VSV), and measles virus (MV). The Env gene of gibbon ape leukemia virus can be the polynucleotide composed of the nucleotide sequence represented by SEQ. ID. NO: 35. The said polynucleotide can include a variant having the same characteristics as mentioned above.
[0130] In this invention, the term replicating/replicable indicates that the virus vector can self-replicate in the cells introduced with the virus genome containing a specific gene or infected with animal cells or the virus vector containing a specific gene.
[0131] In this invention, the term replicating retrovirus vector indicates the vector that produces non-lytic virus. The vector can specifically infect proliferating cells, that is cancer cells, because it can penetrate into the nucleus when the nuclear envelope is being broken, so that it can prevent an inserted foreign gene from being expressed in other normal cells. Therefore, the vector can deliver a target gene safely into cancer cells and is also replicating to increase the efficiency of gene transfer.
[0132] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene and GalV-EnV gene in order to express them separately in each vector. The inventors cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors further cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0133] Therefore, the present invention also provides a replicating retrovirus vector system comprising the first recombinant expression vector containing MuLV Gag-Pol gene, promoter, and thymidine kinase gene; and the second recombinant expression vector containing virus Env gene, promoter, and cytosine deaminase gene.
[0134] The said vector system has the characteristics explained above. For example, the thymidine kinase gene can activate the prodrug ganciclovir, and the cytosine deaminase gene can active the prodrug 5-fluorocytosine.
[0135] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them separately in each vector. The inventors cloned P2 promoter and thymidine kinase gene in the vector containing Gag and Pol genes. The inventors further cloned P2 promoter and cytosine deaminase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0136] Therefore, the present invention also provides a recombinant retrovirus containing the vector system above.
[0137] The vector system can have the characteristics mentioned above.
[0138] However, the recombinant retrovirus above can be produced from the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene. At this time, the first and the second recombinant expression vectors can be included in the recombinant retrovirus independently or together.
[0139] In a preferred embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them respectively in each vector, and cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors also cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0140] Therefore, the present invention also provides a host cell transfected with the recombinant retrovirus.
[0141] The vector system above can have the characteristics mentioned above.
[0142] The host cell herein can be selected from the group consisting of NS/0 myeloma cell, human 293T cell, CHO cell, HeLa cell, CapT cell (human amniotic fluid derived cell), COS cell, canine D17 cell, and feline PG4 cell. In a preferred embodiment of the present invention, the host cell can be human 293T.
[0143] The said transfection can be performed by one of the conventional methods well-known to those in the art, which is exemplified by lipofectamine method, microinjection, calcium phosphate precipitation, electroporation, liposome-mediated transfection, DEAE-dextran treatment, and gene bombardment. In a preferred embodiment of the present invention, the transfection was accomplished by lipofectamine method.
[0144] The transfected cells were cultured in the conventional medium generally used for animal cell culture. The medium above can be one or more media selected from the group consisting of Eagle's MEM, a-MEM, Iscove's MEM, 199 medium, CMRL 1066, RPMI 1640, F12, F10, DMEM, DMEM/F12 combined medium, Way-mouth's MB752/1, McCoy's 5A, and MCDB series media. In a preferred embodiment of the present invention, the medium was DMEM.
[0145] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them separately in each vector. The inventors cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors further cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0146] Therefore, the present invention also provides a pharmaceutical composition for the prevention or treatment of cancer comprising the recombinant retrovirus above as an active ingredient.
[0147] However, the recombinant retrovirus above can be produced from the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene. At this time, the first and the second recombinant expression vectors can be included in the recombinant retrovirus independently or together.
[0148] The retrovirus above can target the cell in the course of proliferation which is more precisely cancer cell. The cancer cell herein can include those cells originated from one of the followings; mucous carcinoma, round cell carcinoma, locally advanced tumor, metastatic cancer, Ewing sarcoma, cancer metastasis, lymphatic metastasis, squaous cell carcinoma, esophageal squaous cell carcinoma, oral carcinoma, multiple myeloma, acute lymphoblastic leukemia, acute nonlymphoid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, hairy cell leukemia, effusion lymphoma, thymus lymphoma lung cancer, small cell lung cancer, cutaneous T cell lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, adrenal cortical carcinoma, ACTH-producing tumor, non-small cell lung cancer, breast cancer, small cell carcinoma, ductal carcinoma, stomach cancer, colon cancer, colorectal cancer, polyp related to colorectal cancer formation, pancreatic cancer, liver cancer, bladder cancer, primary surface bladder tumor, invasive metastatic cell bladder carcinoma, muscle-invasive bladder cancer, prostate cancer, colon cancer, kidney cancer, hepatocarcinoma, esophageal cancer, ovarian carcinoma, uterine cervical cancer, endometrial cancer, choriocarcinoma, ovarian cancer, primary peritoneum neoplasm, uterine cervical carcinoma, vaginal cancer, pudendum cancer, uterine cancer, follicle solid tumor, testis cancer, penis cancer, renal cell carcinoma, brain cancer, head/neck cancer, neuroblastoma, brainstem glioma, glioma, metastatic tumor cell invasion in central nervous system, osteoma, osteosarcoma, malignant melanoma, human skin keratinocyte tumor progression, squaous cell carcinoma, thyroid cancer, retinoblastoma, neuroblastoma, mesothelioma, Wilm's tumor, gallbladder cancer, trophoblastic tumor, hemangiopericytoma, and Kaposi's sarcoma.
[0149] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them respectively in each vector, and cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors also cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0150] The pharmaceutical composition of the present invention preferably includes the composition of the invention, which is the active ingredient of the pharmaceutical composition, by 1095 weight % for the total weight of the pharmaceutical composition. The composition of the present invention can include, in addition to the active ingredient, one or more effective ingredients having the same or similar function to the active ingredient.
[0151] The composition of the present invention can include any generally used carrier, diluent, excipient, or a combination of at least two of those. The pharmaceutically acceptable carrier can be any carrier that is able to deliver the composition of the present invention in living body without limitation, which is exemplified by the compounds described in Merck Index, 13th ed., Merck & Co. Inc., such as saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome and a mixture comprising one or more of those components. If necessary, a general additive such as antioxidant, buffer, and bacteriostatic agent can be additionally added.
[0152] The present composition can be formulated by using generally used excipients or diluents such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactants.
[0153] The composition of the present invention can be formulated for oral administration or for parenteral administration. The formulation for oral administration is exemplified by tablets, pills, powders, granules, capsules, and troches. The solid formulations for oral administration are prepared by mixing one or more suitable excipients such as starch, calcium carbonate, sucrose, lactose, and gelatin, etc. Except for the simple excipients, lubricants, for example magnesium stearate, talc, etc, can be added. Liquid formulations for oral administrations are suspensions, solutions, emulsions and syrups, and the above-mentioned formulations can contain various excipients such as wetting agents, sweeteners, aromatics and preservatives.
[0154] Formulations for parenteral administration can include injections such as sterilized aqueous solutions, water-insoluble excipients, suspensions, and emulsions.
[0155] Water insoluble excipients and suspensions can contain propylene glycol, polyethylene glycol, vegetable oil like olive oil, injectable ester like ethylolate, etc.
[0156] Therefore, the present invention also provides a composition for gene transfer for the treatment of cancer comprising the recombinant retrovirus above.
[0157] However, the recombinant retrovirus above can be produced from the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene. At this time, the first and the second recombinant expression vectors can be included in the recombinant retrovirus independently or together.
[0158] The cancer herein can include the cancers described hereinbefore.
[0159] In this invention, the term composition for gene transfer indicates the composition that can carry a gene into a target cell.
[0160] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them respectively in each vector, and cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors also cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0161] Therefore, the present invention also provides a method for preparing a replicating retrovirus vector system comprising the following steps: 1) constructing the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and 2) constructing the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene.
[0162] The vector system above has the characteristics mentioned above. For example, the thymidine kinase gene can activate the prodrug ganciclovir and the cytosine deaminase gene can activate the prodrug 5-fluorocytosine.
[0163] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and
[0164] GalV-EnV gene in order to express them separately in each vector. The inventors cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors further cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0165] Therefore, the present invention also provides a method for preparing a replicating retrovirus vector system comprising the following steps: 1) constructing the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and thymidine kinase gene; and 2) constructing the second recombinant expression vector comprising virus Env gene, promoter, and cytosine deaminase gene.
[0166] The vector system above has the characteristics mentioned above. For example, the thymidine kinase gene can activate the prodrug ganciclovir and the cytosine deaminase gene can activate the prodrug 5-fluorocytosine.
[0167] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them separately in each vector. The inventors cloned P2 promoter and thymidine kinase gene in the vector containing Gag and Pol genes. The inventors further cloned P2 promoter and cytosine deaminase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0168] Therefore, the present invention also provides a method for treating cancer containing the step of administering the recombinant retrovirus above to a subject in need of the same.
[0169] The cancer can have the characteristics mentioned above. The subject can be mammals, and more specifically can be human. However, the recombinant retrovirus above can be produced from the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene. At this time, the first and the second recombinant expression vectors can be included in the recombinant retrovirus independently or together.
[0170] The recombinant retrovirus of the present invention can be administered via oral administration or parenteral administration according to the purpose of the administration and parenteral administration pathway can be selected from the group consisting of skin external application, intraperitoneal injection, intrarectal administration, hypodermic injection, intravenous injection, intramuscular injection, or intrathoracic injection.
[0171] The recombinant retrovirus of the present invention is preferably administered at an effective dose which can be determined by considering types of disease, severity of disease, drug activity, drug sensitivity, administration period, administration pathway, discharge rate, treatment period, and other drugs co-treated, etc. The composition of the present invention can be administered alone or together with other drugs. If co-treatment is needed, the administration could be performed stepwise or simultaneously.
[0172] However, to obtain a preferred effect, the concentration of the active ingredient in the composition of the present invention is 0.00110,000 mg/kg, and more preferably 0.15 g/kg. The composition can be administered once a day or a few times a day.
[0173] In one embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them respectively in each vector, and cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors also cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
[0174] In addition, the present invention provides a use of the retrovirus above for the production of a drug for the prevention or treatment of cancer.
[0175] The cancer can have the characteristics mentioned above. The recombinant retrovirus above can be produced from the first recombinant expression vector comprising MuLV Gag-Pol gene, promoter, and cytosine deaminase gene; and the second recombinant expression vector comprising virus Env gene, promoter, and thymidine kinase gene. At this time, the first and the second recombinant expression vectors can be included in the recombinant retrovirus independently or together.
[0176] In another embodiment of the present invention, the inventors separated MuLV-Gag gene and MuLV-Pol gene, and GalV-EnV gene in order to express them respectively in each vector, and cloned P2 promoter and cytosine deaminase gene in the vector containing Gag and Pol genes. The inventors also cloned P2 promoter and thymidine kinase gene in the vector containing Env gene, leading to the construction of the replicating retrovirus vector (see
EXAMPLES
[0177] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.
<Example 1> Construction of Replicating Retrovirus Vector System Containing Herpes Simplex Virus Thymidine Kinase Gene Alone
<1-1> Virus Vector Construction
[0178] In the conventional RRV vector, gag, pol, and MuLV-env genes are synthesized as one genome. Herein, the inventors induced the expression of gag-pol and MuLV-env separately in independent vectors. The env gene has been replaced with the GaLV (Gibbon ape Leukemia virus) env gene which has affinity to primates infection. The HSV-TK gene was cloned in gag-pol vector or GalV-env vector. A fluorescent gene was cross-cloned in each vector as a target marker, leading to the construction of the vector system.
[0179] Overall, the virus vector was constructed in the same method ing
[0180] 1. spRRVe-P1-TK vector: spRRVe-P1-mcs vector having a multi-cloning site under promoter 1 (P1; MCMV immediate-early promoter) was digested with the restriction enzyme PmeI and then treated with CIAP (alkaline phosphatase, Calf intestinal). pSXLC-TK vector (Sugimoto et al., 1994, Bio/Technology 12, 694-698) was digested with the restriction enzymes NcoI and XhoI, and then TK gene was collected. The collected TK gene was treated with T4 DNA polymerase to make blunt end. spRRVe-P1-mcs vector was digested with the restriction enzymes BamHI and SalI, and then treated with CIAP. After collecting, cloning was performed. As a result, spRRVe-P1-TK vector was constructed (
[0181] 2. sRRVgp-P1-RFP vector: sRRVgp vector (Korean Patent Publication No. 10-1381064) containing EcoRI cleavage site in between pol and 3-LTR was digested with the restriction enzyme EcoRI, which was treated with CIAP. Lenti-P1-REP (monomer) vector (Chungnam National University, Korea) constructed by the present inventors was digested with the restriction enzymes PpuMI and NcoI and then P1-REP gene was collected. The collected P1-RFP gene was cloned in sRRVgp vector by using T4 DNA polymerase, leading to the construction of the vector (
[0182] 3. sRRVgp-P1-TK vector: sRRVgp vector was digested with EcoRI and then treated with CIAP. A PCR product containing EcoRI, PmeI, and P1 promoter (EcoRI-P1-PmeI-EcoRI) was cloned in the vector sRRVgp, leading to the construction of sRRVgp-P1 vector. The vector was digested with the restriction enzyme PmeI, which was then treated with CIAP. TK gene was amplified so as to contain EcoRI cleavage site by using spRRVe-P1-TK vector (Chungnam National University, Korea) constructed by the present inventors as a template with the primer HSV-TK-EcoRI-F (5-CGGAATTCATGGCTTCGTACCCCGGCCA-3, SEQ. ID. NO: 1) and the primer HSV-TK-EcoRI-R (5-GCGAATTCTCAGTAGCCTCCCCCATCTC-3, SEQ. ID. NO: 2). The amplified gene was collected and digested with EcoRI, followed by cloning in sRRVgp-P1 vector (
[0183] 4. spRRVe-P1-GFP vector: In order to clone GaLV-env gene in between gag gene and GFP gene of the retrovirus vector Retro-MCMV-GFP (MFG-mCMV-GFP, Korean Patent Publication No. 10-1381064) expressing GFP, Retro-P1-GFP vector (Chungnam National University, Korea) constructed by the present inventors was digested with the restriction enzyme PmeI. GaLV-env gene was amplified so as to contain PmlI cleavage site by using MYK-GaLV vector (Chungnam National University, Korea) constructed by the present inventors as a template with the primer GaLV-PmlI-F (5-CGGCACGTGATGGTATTGCTGCCTGGG-3, SEQ. ID. NO: 3) and the primer GaLV-PmlI-R (5-GCCCACGTGTTAAAGGTTACCTTCGTT-3, SEQ. ID. NO: 4). The amplified gene was collected and digested with PmlI, followed by cloning in Retro-P1-GFP vector (
<1-2> Virus Production
[0184] To produce virus with the vector constructed in Example <1-1>, spRRVe-P1-TK vector and sRRVgp-P1-RFP vector were combined together (spRRVe-P1-TK/sRRVgp-P1-RFP) and sRRVgp-P1-TK vector and spRRVe-P1-GFP vector were combined (sRRVgp-P1-TK/spRRVe-P1-GFP) together.
[0185] Overall, one day before the transfection, 293T cells were plated in a 6-well plate at the density of 610.sup.5 cells/well. On the next day, the medium was replaced with FBS and antibiotics free 0.8 ml DMEM. The plate was placed in a cell culture incubator. In the meantime, DMEM was loaded in two 1.5 ml tubes (100 l/tube) in order to prepare the solution for transfection. One tube contained 1 g of RRV (spRRVe-P1-TK/sRRVgp-P1-RFP or sRRVgp-P1-TK/spRRVe-P1-GFP) DNA and 5 l of PLUS reagent (Invitrogen), and the other tube contained 3 l of lipofectamine (Invitrogen). The tubes stood at room temperature for 15 minutes after well mixing for 10 seconds. The solution containing lipofectamine was poured into the tube containing PLUS reagent, and mixed well for 10 seconds. The tube stood at room temperature for 20 minutes. The mixed solution comprising RRV DNA, PLUS reagent, and lipofectamine was loaded in the cell culture plate 208 l/well slowly drop by drop, followed by culture for 4 hours. 4 hours later, the medium was discarded and DMEM supplemented with 3% FBS was loaded therein carefully not to make the cells fall off, followed by culture for 48 hours. 48 hours later, supernatant was obtained and filtered with 0.45 m syringe filter. 30 ml of the filtrate was purified by using 15 ml centricon that can purify 100 kDa protein. To increase the purity, the obtained solution was filtered twice with 15 ml D-PBS, followed by 10-fold concentration. The solution was divided by 50 l and stored in 80 C. deep freezer.
<1-3> Titration of the Produced Virus
[0186] Titer of the virus produced in Example <1-2> was measured by flow cytometry and qPCR.
[0187] Overall, one day before the virus infection, glioma cells (U87MG) were inoculated in a 6-well plate. On the next day, the virus 10-fold concentrated and separated was serially diluted in fresh medium (1, 10, 50, 100, and 500) but mostly by 10. 1 ml of the diluted virus was added with 4 g/10 of polybrene. The cell number was counted. Then, glioma cells were infected with the virus. 48 hours later, 50 uM of azidothymidine, the virus reverse transcription inhibitor, was added thereto, followed by reaction for 24 hours to inhibit the proliferation of the virus. GFP expression was quantified by flow cytometry and the titer was calculated by the following mathematical formula 1.
TU/ml=(cell number before infectionGFP ratio(%))/dilution ratio[Mathematical Formula 1]
[0188] However, the real-time PCR was performed by using a retrovirus titration set (Cat. #6166, Takara, Japan) according to the manufacturer's instruction to calculate the titer of the produced virus.
[0189] As a result, as shown in Table 1,
TABLE-US-00001 TABLE 1 Virus titer to glioma cells GFP ratio (%) in the glioma cells infected with spRRVe-P1-TK/sRRVgp-P1-RFP 10X 50X 100X 500X dilution dilution dilution dilution 1 time 16.7 8.3 4.7 1.2 2 times 17.5 8.6 4.7 0.4 3 times 17.9 8.2 4.3 0.8 Average 17.36 8.36 4.56 0.8 TU/ml 2.66 10.sup.7 6.41 10.sup.7 7.00 10.sup.7 6.13 10.sup.7
<1-4> Investigation of Recombination in the Replicating Retrovirus Vector
[0190] There is a high chance of recombination in the replicating retrovirus vector designed for gene therapy because the size of genomic RNA is increased due to the inserted foreign gene and the non-homologous nucleotide sequence added thereto. Therefore, in order to construct a stable and efficient replicating retrovirus vector for gene therapy, it is important to trace the chance of recombination in the course of construction and if any it is important to measure the level of recombination. To investigate the stability of the vector constructed in Example <1-1>, the following experiment was performed.
[0191] Overall, the glioma cells sub-cultured on the previous day were infected with 10.sup.6 TU spRRVe-P1-TK/sRRVgp-P1-RFP or 10.sup.6 TU sRRVgp-P1-TK/spRRVe-P1-GFP for three days. The supernatant was used to infect the U-87MG cells newly sub-cultured on the previous day 8 times stepwise at 3 days intervals. The resultant infected cells were named p1 (passage 1)p8 (passage 8). RFP or GFP expressed in each phase cells was observed under fluorescent microscope.
[0192] Therefore, PCR was performed with the genomic DNA extracted from the same phase cells using the Env vector and gag-pol vector specific primers, MuLV4194F (5-AGCAAGCTATTGGCCACTG-3, SEQ. ID. NO: 5), GaLV (1624)F(5-GACTCAGTCAGCAAGTTAGAG-3, SEQ. ID. NO: 6), and MFGSaclR (5-CAATCGGAGGACTGGCGCCCCGAGTGA-3, SEQ. ID. NO: 7), followed by confirmation of the gene amplification as expected. To the PCR reaction tube were loaded 100 ng of genomic DNA, 1 reaction buffer, 0.25 mM dNTP, 0.2 pmol of the forward primer, 0.2 pmol of the reverse primer, and 0.2 unit Taq polymerase and lastly sterilized distilled water was added to make the final volume 20 l. PCR was performed according to the following conditions as listed in Table 1. The amplified DNA was loaded on 1% agarose gel, followed by analysis.
TABLE-US-00002 TABLE 2 PCR condition Step Temp. Time Cycle Denaturation 94 C. 3 min. 1 Polymerization 94 C. 30 sec. 28 60 C. 30 sec. 72 C. 2 min. 30 sec. Extension 72 C. 7 min. 1
[0193] As a result, as shown in
<1-5> Analysis of the Recombination Pattern of spRRVe-P1-TK Vector
[0194] After PCR with the genomic DNA of the combined spRRVe-P1-TK/sRRVgp-P1-RFP in Example <1-4>, the PCR product obtained from p4 phase recombinant band (*) of spRRVe-P1-TK vector, which was smaller than expected, was collected and cloned in pGEM-T vector for gene analysis.
[0195] As a result, as shown in
<Example 2> Construction of Replicating Retrovirus Vector System Using Cytosine Deaminase Gene Alone
<2-1> Virus Vector Construction
[0196] Since recombination did not occurred when TK gene was located in sRRVgp-P1 vector in Example <1-4>, another suicidal gene CD now being used in the clinical field as a treatment tool was inserted in spRRVe-P1 vector, leading to the construction of another vector system.
[0197] Overall, the virus vector was constructed as follows.
[0198] 1. spRRVe-P1-yCD vector: pcDNA-yCD vector (Korea Cancer Center Hospital, provided by Dr. Lee) was digested with the restriction enzymes XhoI and HindIII. Then, yCD (SEQ. ID. NO: 16) was collected. The vector spRRVe-P1-MCS(Chungnam National University, Korea) constructed by the present inventors was digested with the restriction enzyme PmeI, where the yCD gene was cloned (
[0199] 2. sRRVgp-P1-RFP vector: This vector was constructed by the same manner as described in Example <1-1> (
<2-2> Virus Production
[0200] To produce virus with the vector constructed in Example <2-1>, spRRVe-P1-yCD vector and sRRVgp-P1-RFP vector were combined together (spRRVe-P1-yCD/sRRVgp-P1-RFP), which was used to produce virus by the same manner as described in Example <1-2>.
<2-3> Investigation of Recombination in the Replicating Retrovirus Vector
[0201] The investigation was performed by the same manner and with the same conditions as described in Example <1-4> except that the infection with spRRVe-P1-yCD/sRRVgp-P1-RFP virus was performed 5 times stepwise at 3 days intervals to investigate the stability of the vector constructed in Example <2-1> and polymerization was induced at 72 C. for 90 seconds.
[0202] As a result, as shown in
<2-4> Analysis of the Recombination Pattern of spRRVe-P1-yCD Vector
[0203] After PCR with the genomic DNA of the combined spRRVe-P1-yCD/sRRVgp-P1-RFP in Example <2-3>, the PCR product obtained from p4 phase recombinant band (*) of spRRVe-P1-yCD vector, which was smaller than expected, was collected and cloned in pGEM-T vector. 12 clones were analyzed thereafter.
[0204] As a result, as shown in
<Example 3> Construction of Replicating Retrovirus Vector System Containing Both Cytosine Deaminase Gene and Thymidine Kinase Gene
<3-1> Virus Production
[0205] Virus was produced with the combined vector spRRVe-P1-yCD/sRRVgp-P1-TK by the same manner as described in Example <1-2> (
<3-2> Investigation of Recombination in the Replicating Retrovirus Vector
[0206] The investigation was performed by the same manner under the same conditions as described in Example <1-4> except that the infection with spRRVe-P1-yCD/sRRVgp-P1-TK was performed 5 times stepwise at 3 days intervals to investigate the stability of the vector used in Example<3-1>.
[0207] As a result, as shown in
<3-3> Analysis of the Recombination Pattern of spRRVe-P1-yCD Vector
[0208] After PCR with the genomic DNA of the combined spRRVe-P1-yCD/sRRVgp-P1-TK in Example <3-2>, the PCR product obtained from p4 phase recombinant band (*) of spRRVe-P1-yCD vector, which was smaller than expected, was collected and cloned in pGEM-T vector. Then, 10 clones proceeded to gene analysis.
[0209] As a result, as shown in
<3-4> Analysis of the Recombination Pattern of sRRVgp-P1-TK Vector
[0210] After PCR with the genomic DNA of the combined spRRVe-P1-yCD/sRRVgp-P1-TK in Example <3-2>, the PCR product obtained from p1 phase recombinant band (*) of sRRVgp-P1-TK vector, which was smaller than expected, was recovered and cloned in pGEM-T vector. Then, 20 clones proceeded to gene analysis.
[0211] As a result, as shown in
<3-5> Investigation of Drug Sensitivity of spRRVe-P1-yCD/sRRVgp-P1-TK Virus
[0212] The drug sensitivity against ganciclovir (GCV) and 5-fluorocytosine (5-FC) of the virus spRRVe-P1-yCD/sRRVgp-P1-TK produced in Example <3-1> was investigated.
[0213] Overall, 293T cells were co-transfected with spRRVe-P1-yCD/sRRVgp-P1-TK by using PLUS reagent (Invitrogen) and lipofectamine (Invitrogen). 2 days later, the supernatant was obtained. The U-87MG cells sub-cultured on the previous day in a 6-well plate at the density of 1.510.sup.3 cells/well were added with 8 l/ml of polybrene, followed by infection with the virus for 8 hours. 5 days after the infection (post-infection 5 d), the supernatant was obtained. The U-87MG cells sub-cultured on the previous day in a 6-well plate at the density of 1.510.sup.3 cells/well were infected with the supernatant (p1). The infection was continued serially until p4 phase. The cells of each phase were treated with trypsin-EDTA to prepare single cells. The prepared single cells were distributed in a 12-well plate at the density of 1.510.sup.3 cells/well. From the next day of the sub-culture, the cells were treated with 30 l/ml of GCV and 1 mM 5-FC for 5 days or 8 days, followed by investigation of cell death.
[0214] As a result, as shown in
<Example 4> Construction of spRRVe-P1-CDa, spRRVe-P1-CDb, and spRRVe-P1-CDc Virus Vector Systems
<4-1> Virus Vector Construction
[0215] Recombination in spRRVe-P1-yCD vector mainly occurred in between GaLV Env gene and P1 promoter and in between 3-LTR and yCD gene, according to the investigation performed in Example <3-3>. So, the vector system was constructed by eliminating unnecessary nucleotide sequence for virus synthesis.
[0216] Overall, the virus vector was constructed with same method.
[0217] 1. spRRVe-P1-CDa vector: Overlap PCR was performed to construct the vector using spRRVe-P1-yCD vector as a template with the primers spRRVe-CDa-F (5-GAAGGTAACCTTTAATTCAATAACAGGAAAG-3, SEQ. ID. NO: 8) and spRRVe-CDa-R (5-CTTTCCTGTTATTGAATTAAAGGTTACCTTC-3, SEQ. ID. NO: 9) (
[0218] 2. spRRVe-P1-CDb vector: Overlap PCR was performed to construct the vector using spRRVe-P1-CD vector as a template with the primers spRRVe-CDb-F (5-GAAGATATTGGTGAGTAGCTATAAAATAAAAGATTTT-3, SEQ. ID. NO: 10) and spRRVe-CDb-R (5-AAAATCTTTTATTTTATAGCTACTCACCAATATCTTC-3, SEQ. ID. NO: 11) (
[0219] 3. spRRVe-P1-CDc vector: Overlap PCR was performed to construct the vector using spRRVe-P1-CD vector as a template with the primers spRRVe-CDc-F (5-ACCACCGTAGAACGCAATGGTGACAGGGGGAAT-3, SEQ. ID. NO: 12) and spRRVe-CDc-R (5-ATTCCCCCTGTCACCATTGCGTTCTACGGTGGT-3, SEQ. ID. NO: 13)(
<4-2> Virus Production
[0220] Virus was produced with the combined vectors spRRVe-P1-CDa, spRRVe-P1-CDb or spRRVe-P1-CDc vector, and sRRVgp-P1-RFP vector; and spRRVe-P1-CDa, spRRVe-P1-CDb or spRRVe-P1-CDc vector, and sRRVgp-P1-TK vector constructed in Example <4-1> by the same manner as described in Example <1-2>.
<4-3> Investigation of Recombination in the Vectors spRRVe-P1-CDa, spRRVe-P1-CDb, and spRRVe-P1-CDc
[0221] The recombination in the vector was investigated by the same manner as described in Example <2-3> except that 6 kinds of viruses produced in Example <4-2> were used to infect the cells in order to investigate the stability of the vector constructed in Example <4-1>.
[0222] As a result, as shown in
<4-4> Analysis of the Recombination Pattern of spRRVe-P1-CDa Vector
[0223] After PCR with the genomic DNA of the combined vectors spRRVe-P1-CDa/sRRVgp-P1-RFP and spRRVe-P1-CDa/sRRVgp-P1-TK in Example <4-3>, the PCR product obtained from phase p2 and p3 recombinant bands (*) of spRRVe-P1-CDa vector, which was smaller than expected, was collected and cloned in pGEM-T vector. Then, 24 clones proceeded to gene analysis.
[0224] As a result, as shown in
<Example 5> Identification of CD Gene Optimized by Human Codon
[0225] The yCD gene used in Example 2Example 4 demonstrated recombination therein in the course of infection and also showed a low drug sensitivity against 5-FC. To overcome these disadvantages, 8 kinds of CD genes (CD2CD9) optimized by human codon were identified.
[0226] Overall, CD2 was developed from CD by codon optimization at Tocagen, which was used as the positive control. CD3 was the gene produced by optimizing 12 codons that were not optimized by human codon in CD2 gene. CD4 was the gene where 32 sites showing recombination of spRRVe-P1-yCD, spRRVe-P1-CDa, spRRVe-P1-CDb, and spRRVe-P1-CDc vector were all mutated. Therefore, 5 kinds of CD genes, CD5CD9, were the genes in which yeast CD was optimized by human codon. The 8 kinds of CD genes above were synthesized by Cosmogen Co., Ltd. The sequences of the CD2CD9 genes are as shown in table 3.
TABLE-US-00003 TABLE3 SequencesofCDgenesoptimizedbyhumancodon Hom- ology Hom- to ology yCD to nu- yCD cleo- pro- tide tein se- se- Sequencesofgenesoptimized quence quence byhumancodon (%) (%) CD2 ATGGTGACCGGCGGCATGGCCTCCAAGTGGGAT 79 98 (SEQ. CAAAAGGGCATGGATATCGCTTACGAGGAGGCC ID. CTGCTGGGCTACAAGGAGGGCGGCGTGCCTATC NO: GGCGGCTGTCTGATCAACAACAAGGACGGCAGT 17) GTGCTGGGCAGGGGCCACAACATGAGGTTCCAG AAGGGCTCCGCCACCCTGCACGGCGAGATCTCC ACCCTGGAGAACTGTGGCAGGCTGGAGGGCAAG GTGTACAAGGACACCACCCTGTACACCACCCTG TCCCCTTGTGACATGTGTACCGGCGCTATCATC ATGTACGGCATCCCTAGGTGTGTGATCGGCGAG AACGTGAACTTCAAGTCCAAGGGCGAGAAGTAC CTGCAAACCAGGGGCCACGAGGTGGTGGTTGTT GACGATGAGAGGTGTAAGAAGCTGATGAAGCAG TTCATCGACGAGAGGCCTCAGGACTGGTTCGAG GATATCGGCGAGTAA CD3 ATGGTGACCGGCGGCATGGCCTCCAAGTGGGAC 76 98 (SEQ. CAAAAGGGCATGGATATCGCTTACGAGGAGGCC ID. CTGCTGGGCTACAAGGAGGGCGGCGTGCCCATC NO: GGCGGCTGCCTGATCAACAACAAGGACGGCAGC 18) GTGCTGGGCAGGGGCCACAACATGAGGTTCCAG AAGGGCTCCGCCACCCTGCACGGCGAGATCTCC ACCCTGGAGAACTGCGGCAGGCTGGAGGGCAAG GTGTACAAGGACACCACCCTGTACACCACCCTG TCCCCTTGTGACATGTGCACCGGCGCTATCATC ATGTACGGCATCCCTAGGTGCGTGATCGGCGAG AACGTGAACTTCAAGTCCAAGGGCGAGAAGTAC CTGCAGACCAGGGGCCACGAGGTGGTGGTGGTG GACGACGAGAGGTGCAAGAAGCTGATGAAGCAG TTCATCGACGAGAGGCCCCAGGACTGGTTCGAG GACATCGGCGAGTAA CD4 ATGGTGACAGGGGGAATGGCAAGCAAGTGGGAT 95 100 (SEQ. CAGAAGGGTATGGACATTGCCTATGAGGAGGCG ID. GCCTTAGGTTACAAAGAGGGTGGTGTTCCTATT NO: GGCGGATGTCTTATCAATAACAAAGACGGAAGT 19) GTTCTCGGTCGTGGTCACAACATGAGATTTCAA AAGGGATCCGCCACACTACATGGTGAGATCTCC ACTTTGGAGAACTGCGGCAGGCTGGAAGGCAAG GTGTACAAAGATACCACTCTGTACACCACCCTG TCTCCATGCGACATGTGTACAGGTGCCATCATC ATGTATGGTATTCCACGCTGTGTTGTCGGTGAG AACGTTAATTTCAAAAGTAAGGGCGAGAAATAC TTGCAAACCAGGGGCCACGAGGTGGTGGTTGTT GACGATGAGAGGTGTAAAAAGATCATGAAACAA TTTATCGATGAAAGACCTCAGGACTGGTTCGAG GACATCGGCGAGTAA CD5 ATGGTGACTGGCGGCATGGCATCCAAGTGGGAC 77 100 (SEQ. CAGAAGGGGATGGACATAGCATATGAAGAGGCC ID. GCGTTGGGATATAAGGAGGGCGGTGTACCAATC NO: GGGGGCTGCCTCATTAACAATAAAGATGGCTCC 20) GTTCTGGGTCGCGGCCACAACATGAGGTTTCAG AAGGGCAGTGCGACGCTCCACGGAGAAATCAGC ACACTGGAAAATTGTGGGCGATTGGAGGGGAAA GTGTATAAGGATACAACTCTCTACACCACTCTC AGCCCCTGCGATATGTGCACAGGCGCAATCATA ATGTACGGCATTCCCCGATGCGTGGTGGGGGAG AACGTGAACTTCAAGAGCAAAGGAGAGAAATAT CTTCAGACCAGAGGACACGAAGTAGTGGTGGTG GATGATGAACGCTGCAAGAAAATCATGAAACAG TTTATAGATGAACGACCACAAGACTGGTTCGAG GATATCGGCGAATAG CD6 ATGGTTACTGGAGGGATGGCCAGTAAATGGGAC 77 100 (SEQ. CAGAAGGGTATGGATATTGCATACGAGGAGGCC ID. GCTTTGGGATACAAGGAGGGGGGTGTCCCTATA NO: GGCGGTTGCCTGATCAATAATAAAGACGGCTCT 21) GTCTTGGGAAGAGGACACAATATGCGCTTTCAG AAGGGAAGCGCCACCCTGCATGGAGAGATCTCT ACCCTCGAAAATTGCGGAAGGCTCGAAGGCAAA GTTTACAAAGATACCACCCTCTACACAACGCTG TCCCCCTGTGATATGTGCACCGGTGCCATTATC ATGTATGGCATCCCACGCTGCGTTGTAGGAGAG AATGTAAACTTCAAATCCAAGGGAGAGAAGTAT CTCCAGACCCGAGGGCACGAAGTTGTGGTGGTG GACGATGAAAGGTGTAAGAAGATCATGAAGCAG TTCATAGATGAGCGGCCTCAGGACTGGTTCGAG GATATTGGCGAATGA CD7 ATGGTAACTGGTGGCATGGCCTCAAAGTGGGAT 79 100 (SEQ. CAGAAAGGAATGGACATCGCTTACGAGGAGGCC ID. GCACTGGGCTATAAGGAGGGCGGCGTCCCTATA NO: GGCGGTTGCCTGATTAACAATAAAGACGGCTCA 22) GTGCTGGGAAGGGGGCACAACATGAGATTTCAG AAAGGCAGCGCAACTCTGCACGGCGAAATCTCC ACTCTGGAGAACTGCGGGCGGCTGGAGGGAAAG GTTTATAAAGATACTACCTTGTATACAACTCTG TCCCCCTGCGATATGTGCACCGGCGCCATCATA ATGTACGGAATACCCAGGTGCGTGGTGGGAGAG AACGTGAATTTTAAGTCAAAAGGTGAGAAGTAC CTGCAGACTCGCGGCCATGAGGTGGTTGTTGTT GACGATGAAAGGTGCAAGAAGATTATGAAGCAG TTCATTGATGAAAGACCCCAGGACTGGTTTGAG GATATCGGAGAGTAG CD8 ATGGTTACTGGGGGAATGGCATCTAAGTGGGAT 79 100 (SEQ. CAGAAAGGTATGGACATCGCTTATGAAGAGGCT ID. GCTCTCGGCTACAAAGAGGGTGGAGTGCCTATC NO: GGAGGGTGCCTGATCAACAACAAGGACGGCAGT 23) GTGCTGGGGAGGGGCCACAATATGAGGTTCCAA AAAGGCTCCGCCACTCTCCACGGGGAAATTAGT ACCCTCGAGAATTGCGGACGATTGGAAGGGAAG GTGTACAAGGATACAACACTGTACACCACCCTG TCACCCTGTGATATGTGCACAGGCGCCATTATC ATGTACGGAATCCCTAGATGTGTCGTGGGGGAG AATGTAAACTTCAAAAGTAAGGGGGAGAAATAT CTCCAGACCCGGGGGCACGAAGTCGTCGTTGTG GACGATGAACGGTGTAAGAAGATCATGAAGCAG TTTATCGATGAGAGGCCCCAGGACTGGTTCGAA GACATCGGGGAATAA CD9 ATGGTTACAGGGGGAATGGCAAGTAAATGGGAT 78 100 (SEQ. CAAAAAGGGATGGATATAGCCTATGAGGAAGCG ID. GCGCTGGGCTATAAAGAGGGAGGGGTGCCGATA NO: GGTGGCTGTCTTATTAATAACAAAGACGGGAGT 24) GTGTTGGGCAGAGGCCACAATATGCGATTTCAA AAAGGGTCCGCGACATTGCACGGAGAGATCAGC ACCCTGGAGAATTGCGGAAGGTTGGAGGGAAAA GTGTATAAGGACACCACCCTCTATACCACACTG TCTCCATGTGATATGTGTACCGGTGCCATCATA ATGTACGGGATTCCTCGCTGCGTAGTGGGAGAG AATGTTAACTTTAAAAGCAAGGGAGAGAAGTAT TTGCAAACCCGGGGCCACGAAGTGGTGGTGGTG GACGACGAGCGATGTAAGAAAATCATGAAGCAA TTTATCGATGAGCGGCCTCAAGATTGGTTCGAA GATATCGGCGAGTGA
<Example 6> Construction of spRRVe-P1-CDs Virus Vector System
<6-1> Virus Vector Construction
[0227] A vector system was constructed with the CD gene optimized by human codon identified in Example 5.
[0228] Particularly, the virus vector was constructed as follows;
[0229] 1. spRRVe-P1-CD2 vector: spRRVe-P1-RFF vector was digested with the restriction enzymes BamHI and ClaI and CD2 gene was cloned where RFP was eliminated (
[0230] 2. spRRVe-P1-CD3 vector: spRRVe-P1-RFP vector was digested with the restriction enzymes BamHI and ClaI and CD3 gene was cloned where RFP was eliminated (
[0231] 3. spRRVe-P1-CD4 vector: spRRVe-P1-RFP vector was digested with the restriction enzyme HpaI and CD4 gene was cloned where RFP was eliminated (
[0232] 4. spRRVe-P1-CD5 vector: spRRVe-P1-mcs vector containing multi-cloning site under P1 region of spRRVe-P1 vector was constructed and digested with the restriction enzymes MluI and SalI, and CD5 gene was cloned therein (
[0233] 5. spRRVe-P1-CD6 vector: spRRVe-P1-mcs vector containing multi-cloning site under P1 region of spRRVe-P1 vector was constructed and digested with the restriction enzymes MluI and SalI, and CD6 gene was cloned therein (
[0234] 6. spRRVe-P1-CD7 vector: spRRVe-P1-mcs vector containing multi-cloning site under P1 region of spRRVe-P1 vector was constructed and digested with the restriction enzymes MluI and SalI, and CD7 gene was cloned therein (
[0235] 7. spRRVe-P1-CD8 vector: spRRVe-P1-mcs vector containing multi-cloning site under P1 region of spRRVe-P1 vector was constructed and digested with the restriction enzymes MluI and SalI, and CD8 gene was cloned therein (
[0236] 8. spRRVe-P1-CD9 vector: spRRVe-P1-mcs vector containing multi-cloning site under P1 region of spRRVe-P1 vector was constructed and digested with the restriction enzymes MluI and SalI, and CD9 gene was cloned therein (
<6-2> Virus Production
[0237] Virus was produced with the vectors spRRVe-P1-yCD, spRRVe-P1-CD2, spRRVe-P1-CD3, spRRVe-P1-CD4, spRRVe-P1-CD5, spRRVe-P1-CD6, spRRVe-P1-CD7, and spRRVe-P1-CD8 or the combined vector spRRVe-P1-CD9 and sRRVgp-P1-TK constructed in Example <6-1> by the same manner as described in Example <1-2>.
<6-3> Investigation of Drug Sensitivity of spRRVe-P1-CDs/sRRVgp-P1-TK Virus
[0238] The drug sensitivity of the virus produced in Example <6-2> against GCV and 5-FC was investigated by the same manner as described in Example <3-5> except that the virus produced in Example <6-2> was co-transfected.
[0239] As a result, as shown in
<6-4> Investigation of Recombination in spRRVe-P1-CDs
[0240] The stability of the vector used for the virus production in Example <6-2> was investigated by the same manner and under the same conditions as described in Example <1-4> except that the virus produced in Example<6-2> was infected 4 times stepwise at 3 days intervals and the polymerization was induced at 72 C. for 3 minutes and 20 seconds for which the primer GaLV (488)F (5-GGCTAGAATCCCTATATGTA-3, SEQ. ID. NO: 10) was used.
[0241] As a result, as shown in
<6-5> Analysis of the Recombination Pattern of sprrve-P1-CDs
[0242] PCR products of p2 and p3 of spRRVe-P1-CD6 and spRRVe-P1-CD8 vector which had demonstrated excellent drug sensitivity against 5-FC in Example <6-3> were recovered (collected). The PCR products were cloned in pGEM-T vector. Then, 24 clones proceed to gene analysis.
[0243] As a result, as shown in
<Example 7> Construction of spRRVe-P2-CDs Virus Vector System
<7-1> Virus Vector Construction
[0244] It was confirmed from <Example 1><Example 6> that the recombination in spRRV-P1 vector mainly occurred in P1 promoter region. This seemed because of the repeated nucleotide sequence of P1 promoter. So, P1 was replaced with P2 gene control region, leading to the construction of another vector system.
[0245] Overall, p1 promoter (MCMV immediate-early promoter) region was eliminated from each spRRVe-P1-CDs and p2 promoter (EFl promoter) without repeated nucleotide sequence was cloned therein, leading to the construction of the vectors spRRVe-P2-yCD and spRRVe-P2-CDs. At this time, CD4 gene demonstrating a weak drug sensitivity was excluded (
<7-2> Virus Production
[0246] Virus was produced with the vectors spRRVe-P2-yCD, spRRVe-P2-CD2, spRRVe-P2-CD3, spRRVe-P2-CD5, spRRVe-P2-CD6, spRRVe-P2-CD7, and spRRVe-P2-CD8 or the combined vector spRRVe-P2-CD9 and sRRVgp-P1-TK constructed in Example <7-1> by the same manner as described in Example<1-2>.
<7-3> Investigation of Drug Sensitivity of spRRVe-P2-yCD/sRRVgp-P1-TK and spRRVe-P2-CDs/sRRVgp-P1-TK
[0247] The drug sensitivity of the virus produced in Example <7-2> against GCV and 5-FC was investigated by the same manner as described in Example <3-5> except that the virus produced in Example <7-2> was co-transfected to infect stepwise from p1 to p9 and cell death was observed after treating GCV and 5-FC for 9 or 12 days, respectively.
[0248] As a result, as shown in
<7-4> Investigation of Recombination in spRRVe-P2-yCD/sRRVgp-P1-TK and spRRVe-P2-CDs/sRRVgp-P1-TK
[0249] The stability of the vector constructed in Example<7-1> was investigated by the same manner and under the same conditions as described in Example <6-4> except that 8 kinds of viruses produced in Example <7-2> were used for the infection.
[0250] As a result, as shown in
<7-5> Analysis of the Recombination Pattern of sRRVgp-P1-TK
[0251] After PCR with the genomic DNA of the combined vectors spRRVe-P2-yCD/sRRVgp-P1-TK and spRRVe-P2-CDs/sRRVgp-P1-TK in Example <7-4>, the PCR product obtained from phase p3 and p4 recombinant bands of sRRVgp-P1-TK vector, which was smaller than expected, was recovered, followed by gene analysis.
[0252] As a result, as shown in
<Example 8> Construction of sRRVgp-P2-TK Virus Vector System
<8-1> Virus Vector Construction
[0253] As a result of Example 7, frequency of recombination in spRRVe-P2-CDs was lower than in the vector using P1 control region. However, gene loss was still observed in P1 control region in sRRVgp-P1-TK vector. The present inventors constructed sRRVgp-P2-TK vector system by replacing P1 promoter region with P2 promoter region.
[0254] Overall, PCR was performed to attach EcoRI, NotI, and PmeI restriction enzyme sequences to P2 promoter (EcoRI-P2-NotI-PmeI-EcoRI). The PCR product was digested with EcoRI, and inserted under Pol gene of sRRVgp vector (Chungnam National University, Korea) constructed by the present inventors, leading to the construction of sRRVgp-P2 vector. HSV-TK gene was amplified by PCR so as to contain NotI and PmeI restriction enzyme sequences (NotI-HSV TK-PmeI). Then, the PCR product was digested with NotI and PmeI, followed by cloning in under P2 gene. As a result, the vector sRRVgp-P2-TK was constructed (
<8-2> Virus Production
[0255] Virus was produced with the vector spRRVe-P2-CD2, the recombination free vectors spRRVe-P2-CD6 and spRRVe-P2-CD7 or the combined vector spRRVe-P2-CD8 and sRRVgp-P2-TK by the same manner as described in Example <1-2>.
<8-3> Investigation of Drug Sensitivity of spRRVe-P2-CDs/sRRVgp-P2-TK
[0256] The drug sensitivity of the virus produced in Example <8-2> against GCV and 5-FC was investigated by the same manner as described in Example <3-5> except that the virus produced in Example <8-2> was co-transfected to infect stepwise from p1 to p11 and cell death was observed after treating GCV and 5-FC for 5 or 7 days.
[0257] As a result, as shown in
<8-4> Investigation of Recombination in spRRVe-P2-CDs/sRRVgp-P2-TK
[0258] The stability of the vector constructed in Example<8-1> was investigated by the same manner and under the same conditions as described in Example <6-4> except that 4 kinds of viruses produced in Example <8-2> were infected 7 times stepwise at 3 days intervals.
[0259] As a result, as shown in
<8-5> Analysis of the Recombination Pattern of spRRVe-P2-CD6 and spRRVe-P2-CD8
[0260] PCR products of p7 of spRRVe-P2-CD6 and spRRVe-P2-CD8 confirmed to have recombination in Example <8-4> were collected. The PCR products were cloned in pGEM-T vector. Then, 19 clones proceed to gene analysis.
[0261] As a result, as shown in
<Example 9> Additional Identification of 7 Kinds of CD Genes Optimized by Human Codon
[0262] In the examples above, CD6, CD7, and CD8 genes confirmed to have excellent drug sensitivity, compared to yCD gene, were identified. To secure CD gene that has maximized drug dependent cell killing activity, the present inventors additionally identified 7 other CD genes (CD10CD16) optimized by human codon.
[0263] 7 kinds of CD genes, CD10CD16, were the genes in which yeast CD was optimized by human codon. The 7 kinds of CD genes above were synthesized by Cosmogen Co., Ltd. The sequences of the CD10CD16 genes are as shown in table 4.
TABLE-US-00004 TABLE4 SequencesofCDgenesoptimizedbyhumancodon Hom- ology Hom- to ology yCD to nu- yCD cleo- pro- tide tein se- se- Sequencesofgenesoptimizedby quence quence humancodon (%) (%) CD10 ATGGTAACCGGAGGTATGGCATCCAAGTGGGAC 80 100 (SEQ. CAAAAAGGAATGGACATAGCATATGAAGAAGCA ID. GCCCTGGGCTACAAGGAGGGAGGGGTTCCGATT NO: GGCGGTTGTCTTATAAATAATAAAGACGGTAGT 25) GTTCTTGGCAGGGGTCACAACATGAGATTCCAA AAGGGGAGTGCTACACTTCACGGCGAAATAAGC ACCTTGGAAAACTGTGGTAGACTTGAGGGAAAA GTGTACAAGGACACGACCCTTTATACGACGCTG TCCCCTTGTGATATGTGCACCGGCGCTATCATC ATGTATGGAATACCACGATGCGTAGTGGGAGAG AATGTTAATTTCAAGAGTAAGGGCGAGAAGTAC CTTCAGACCAGGGGGCACGAGGTAGTAGTAGTT GACGATGAGCGATGCAAGAAGATTATGAAACAA TTCATTGACGAGAGGCCGCAGGATTGGTTTGAA GACATCGGCGAATAG CD11 ATGGTGACAGGGGGTATGGCAAGCAAATGGGAT 78 100 (SEQ. CAGAAGGGTATGGACATCGCATACGAGGAGGCG ID. GCCTTGGGCTATAAGGAAGGCGGCGTACCTATA NO: GGGGGGTGCCTTATTAACAATAAGGACGGGAGC 26) GTCCTGGGCAGAGGTCACAACATGAGGTTCCAA AAGGGTTCAGCAACCCTGCATGGCGAAATAAGC ACCCTTGAGAATTGTGGGAGGTTGGAGGGTAAG GTGTACAAGGATACCACGCTTTATACCACCTTG AGTCCTTGCGACATGTGCACAGGCGCTATAATC ATGTATGGAATACCGCGCTGTGTTGTAGGAGAA AATGTAAACTTCAAGAGTAAAGGAGAAAAATAC TTGCAAACGCGGGGACACGAAGTGGTAGTTGTC GATGATGAGCGGTGCAAAAAAATCATGAAGCAG TTCATTGACGAACGCCCCCAAGACTGGTTCGAA GACATTGGGGAGTAG CD12 ATGGTAACGGGTGGGATGGCTAGCAAGTGGGAC 79 100 (SEQ. CAGAAAGGCATGGATATAGCGTATGAAGAAGCG ID. GCGTTGGGTTACAAAGAGGGCGGCGTTCCCATC NO: GGTGGCTGCCTTATCAATAATAAAGACGGCTCC 27) GTCCTTGGCCGGGGACACAATATGCGCTTCCAA AAGGGCAGCGCCACACTTCACGGTGAGATCTCC ACGCTGGAGAATTGTGGGCGACTTGAGGGGAAA GTCTACAAGGACACAACTTTGTACACAACACTT AGCCCGTGCGATATGTGTACGGGAGCCATAATC ATGTACGGCATCCCGCGCTGCGTGGTAGGAGAG AACGTAAATTTTAAGTCAAAAGGAGAAAAATAT CTTCAGACCAGGGGCCACGAGGTGGTTGTCGTG GACGACGAGAGATGTAAAAAGATCATGAAACAG TTTATTGATGAAAGACCACAGGATTGGTTTGAG GACATCGGTGAGTAG CD13 ATGGTTACAGGAGGTATGGCTTCAAAGTGGGAT 78 100 (SEQ. CAAAAAGGGATGGACATCGCCTATGAAGAAGCA ID. GCGTTGGGATACAAAGAAGGGGGGGTTCCCATA NO: GGAGGTTGCCTTATCAACAATAAAGATGGAAGC 28) GTTCTTGGGCGAGGGCACAATATGAGATTTCAA AAAGGTTCAGCCACTCTCCATGGAGAAATTTCA ACTCTCGAAAACTGTGGTCGCCTTGAGGGCAAG GTTTATAAGGATACCACCCTCTACACTACCCTG TCACCCTGCGACATGTGTACAGGTGCAATTATA ATGTACGGAATCCCTCGGTGTGTGGTGGGGGAG AACGTGAATTTTAAGTCCAAAGGTGAAAAATAT CTCCAAACTCGCGGGCATGAAGTCGTCGTTGTT GATGATGAGAGGTGTAAAAAGATTATGAAACAA TTCATAGACGAGAGGCCACAGGATTGGTTTGAG GACATAGGGGAGTAG CD14 ATGGTGACTGGGGGTATGGCTTCCAAATGGGAT 76 100 (SEQ. CAGAAAGGAATGGATATAGCATACGAAGAAGCA ID. GCTCTCGGGTACAAAGAGGGTGGAGTACCCATT NO: GGGGGATGCCTCATCAACAACAAGGATGGGAGT 29) GTCCTTGGGCGAGGTCACAATATGCGATTCCAG AAGGGGAGCGCGACGCTCCACGGGGAGATAAGT ACGCTGGAGAACTGCGGGAGGCTTGAAGGCAAG GTCTACAAAGATACCACACTCTACACGACCCTC AGCCCTTGCGACATGTGTACGGGTGCGATCATC ATGTATGGAATACCGCGATGCGTAGTAGGAGAG AACGTGAACTTCAAGTCCAAAGGCGAAAAGTAT CTCCAGACGCGCGGCCACGAAGTGGTAGTGGTA GACGACGAAAGGTGCAAGAAGATAATGAAGCAG TTTATCGACGAGAGGCCTCAGGACTGGTTCGAG GATATTGGCGAGTAG CD15 ATGGTTACTGGCGGCATGGCTTCTAAGTGGGAT 77 100 (SEQ. CAGAAGGGCATGGATATAGCCTATGAAGAAGCA ID. GCACTGGGATACAAAGAGGGAGGGGTACCAATT NO: GGGGGATGTCTGATTAATAACAAAGACGGAAGT 30) GTACTCGGTCGCGGGCATAATATGAGATTCCAA AAAGGCTCTGCAACGTTGCACGGCGAAATCAGC ACGCTCGAAAATTGCGGGAGGCTGGAGGGAAAG GTTTACAAGGATACCACTCTCTATACCACACTG TCACCATGTGATATGTGTACGGGGGCTATAATA ATGTATGGAATCCCCCGCTGCGTCGTGGGCGAA AACGTCAACTTTAAGTCTAAGGGGGAAAAGTAT TTGCAAACGCGCGGTCATGAGGTCGTTGTAGTC GATGACGAGAGATGCAAAAAAATAATGAAGCAG TTTATTGACGAGAGACCTCAGGACTGGTTCGAA GACATCGGGGAGTAG CD16 ATGGTGACAGGAGGAATGGCCAGCAAGTGGGAT 78 100 (SEQ. CAGAAGGGAATGGATATTGCCTACGAGGAGGCC ID. GCCCTGGGCTACAAGGAGGGGGGCGTGCCAATT NO: GGCGGATGTCTGATTAACAACAAGGATGGGAGC 31) GTGCTGGGAAGAGGACACAACATGAGATTTCAG AAGGGAAGCGCAACCTTGCACGGAGAAATTAGC ACCCTTGAGAACTGCGGGCGGCTTGAAGGCAAG GTCTATAAAGACACTACACTTTATACTACCTTG TCTCCATGTGATATGTGTACAGGCGCCATTATT ATGTACGGAATTCCTAGATGCGTCGTGGGAGAG AACGTGAACTTTAAGAGCAAGGGAGAGAAGTAC CTGCAGACAAGAGGACACGAGGTGGTGGTGGTG GATGATGAGAGATGTAAGAAGATCATGAAGCAG TTCATCGATGAGAGGCCCCAGGATTGGTTTGAG GACATCGGCGAGTGA
<Example 10> Construction of spRRVe-P2-CDs Virus Vector System
<10-1> Virus Vector Construction
[0264] The CD genes optimized by human codon, newly identified in <Example 9>, were cloned in spRRVe-P2 vector, resulting in the construction of the vectors spRRVe-P2-CDs.
<10-2> Virus Production
[0265] Virus was produced by the same manner as described in Example <1-2> by using the combination of 7 kinds of spRRVe-P2-CDs constructed in Example <10-1> and sRRVgp-P2-TK vector.
<10-3> Investigation of Drug Sensitivity of spRRVe-P2-CDs/sRRVgp-P2-TK
[0266] The drug sensitivity of the virus produced in Example <10-2> against GCV and 5-FC was investigated by the same manner as described in Example <3-5> except that the virus produced in Example <10-2> was co-transfected to infect stepwise from p1 to p5 and cell death was observed after treating GCV and 5-FC for 6 or 8 days, respectively.
[0267] As a result, as shown in
<Example 11> Construction of spRRVe-P2-TK, sRRVgp-P2-CD2, sRRVgp-P2-CD6, sRRVgp-P2-CD7, and sRRVgp-P2-CD8 Virus Vector System
<11-1> Virus Vector Construction
[0268] As serial infection phases were extended in Example<8-4>, even the vector containing P2 promoter, spRRVe-P2-CDs, displayed recombination action. To improve this problem, the combined vector, spRRVe-P2-TK/sRRVgp-P2-CDs, was prepared to construct a virus vector system.
[0269] Overall, the virus vector was constructed with same method.
[0270] 1. spRRVe-P2-TK vector: PCR was performed using TK gene as a template with the primers HSV-TK-BamHI-F (5-CGGGATCCATGGCTTCGTACCCCTGCCAT-3, SEQ. ID. NO: 11) and HSV-TK-SalI-R (5-CGGTCGACTCAGTTAGCCTCCCCCATCTC-3, SEQ. ID. NO: 12). The PCR product was digested with the restriction enzymes BamHI and SalI, and then cloned in BamHI-SalI site of spRRVe-P2-mcs vector, leading to the construction of spRRVe-P2-TK vector (SEQ. ID. NO: 13) (
[0271] 2. sRRVgp-P2-yCD vector: PCR was performed using yCD gene as a template with the primers CD-NotI-F (5-CGGCGGCCGCATGGTGACAGGGGGAATGGC-3, SEQ. ID. NO: 36) and CD-PmeI-R (5-CGGTTTAAACCTACTCACCAATATCTTCAAA-3, SEQ. ID. NO: 37). The PCR product was digested with the restriction enzymes NotI and PmeI, and then cloned in NotI-PmeI site of sRRVgp-P2 vector, leading to the construction of sRRVgp-P2-yCD vector.
[0272] 3. sRRVgp-P2-CD2 vector: PCR was performed using CD2 gene as a template with the primers CD2-NotI-F (5-CGGCGGCCGCATGGTGACCGGCGGCATGGC-3, SEQ. ID. NO: 38) and CD2-PmeI-R (5-CGGTTTAAACTTACTCGCCGATATCCTCGA-3, SEQ. ID. NO: 39). The PCR product was digested with the restriction enzymes NotI and PmeI, and then cloned in NotI-PmeI site of sRRVgp-P2 vector, leading to the construction of sRRVgp-P2-CD2 vector.
[0273] 4. sRRVgp-P2-CD6 vector: PCR was performed using CD6 gene as a template with the primers CD6-NotI-F (5-CGGCGGCCGCATGGTTACTGGAGGGATGGC-3, SEQ. ID. NO: 40) and CD6-PmeI-R (5-CGGTTTAAACTCATTCGCCAATATCCTCGA-3, SEQ. ID. NO: 41). The PCR product was digested with the restriction enzymes NotI and PmeI, and then cloned in NotI-PmeI site of sRRVgp-P2 vector, leading to the construction of sRRVgp-P2-CD6 vector (SEQ. ID. NO: 14) (
[0274] 5. sRRVgp-P2-CD7 vector: PCR was performed using CD7 gene as a template with the primers CD7-NotI-F (5-CGGCGGCCGCATGGTAACTGGTGGCATGGC-3, SEQ. ID. NO: 42) and CD7-PmeI-R (5-CGGTTTAAACCTACTCTCCGATATCCTCAA-3, SEQ. ID. NO: 43). The PCR product was digested with the restriction enzymes NotI and PmeI, and then cloned in NotI-PmeI site of sRRVgp-P2 vector, leading to the construction of sRRVgp-P2-CD7 vector.
[0275] 6. sRRVgp-P2-CD8 vector: PCR was performed using CD8 gene as a template with the primers CD8-NotI-F (5-CGGCGGCCGCATGGTTACTGGGGGAATGG-3, SEQ. ID. NO: 44) and CD8-PmeI-R (5-CGGTTTAAACTTATTCCCCGATGTCTTCGA-3, SEQ. ID. NO: 45). The PCR product was digested with the restriction enzymes NotI and PmeI, and then cloned in NotI-PmeI site of sRRVgp-P2 vector, leading to the construction of sRRVgp-P2-CD8 vector.
<11-2> Virus Production
[0276] Virus was produced by the same manner as described in Example <1-2> by using the combination of the vectors such as sRRVgp-P2-yCD, sRRVgp-P2-CD2, sRRVgp-P2-CD6, sRRVgp-P2-CD7, or sRRVgp-P2-CD8 constructed in Example<11-1> and spRRVe-P2-TK vector.
<11-3> Investigation of Recombination in spRRVe-P2-TK/sRRVgp-P2-CD (2,6,7,8)
[0277] The stability of the vectors constructed in Example<11-1> was investigated by the same manner and under the same conditions as described in Example <1-4> except that spRRVe-P2-TK/sRRVgp-P2-CD (2,6,7,8) were infected 7 times stepwise at 3 days intervals and polymerization was induced at 72 C. for 3 minutes.
[0278] As a result, as shown in
<11-4> Analysis of the Recombination Pattern of spRRVe-P2-TK/sRRVgp-P2-CDs
[0279] After PCR with the genomic DNA of the combined vectors spRRVe-P2-TK/sRRVgp-P2-yCD, spRRVe-P2-TK/sRRVgp-P2-CD2, spRRVe-P2-TK/sRRVgp-P2-CD6, spRRVe-P2-TK/sRRVgp-P2-CD7, and spRRVe-P2-TK/sRRVgp-P2-CD8 in Example <11-3>, the PCR products obtained from phase p6 and p7 of spRRVe-P2-TK, sRRVgp-P2-yCD, and sRRVgp-P2-CD (2,6,7,8) vectors were recovered, followed by gene analysis.
[0280] As a result, as shown in
<11-5> Investigation of Drug Sensitivity of spRRVe-P2-TK/sRRVgp-P2-CDs
[0281] The drug sensitivity of the virus produced in Example <11-2> against GCV and 5-FC was investigated by the same manner as described in Example <3-5> except that the virus produced in Example <11-2> was co-transfected to infect stepwise from p1 to p9 and cell death was observed after treating GCV and 5-FC for 8 or 12 days, respetively.
[0282] As a result, as shown in