Selective gene therapy expression system
09981049 ยท 2018-05-29
Assignee
Inventors
Cpc classification
A61K48/0058
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
A61K38/465
HUMAN NECESSITIES
C12N2750/14132
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
C12N2830/008
CHEMISTRY; METALLURGY
A61K48/0075
HUMAN NECESSITIES
A61K48/0066
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
The present invention relates to an expression system for systemic administration comprising a sequence encoding a protein, said expression system allowing: the expression at a therapeutically acceptable level of the protein in the target tissues including skeletal muscles and/or the peripheral nervous tissue; and the expression at toxically acceptable level of the protein in tissues other than the target tissues, especially in the heart.
Claims
1. An expression vector for systemic administration comprising: a nucleic acid sequence encoding a myotubularin polypeptide consisting of the amino acid sequence as set forth in SEQ ID NO: 1, 2, or 3, and at least one additional sequence comprising: (a) a target sequence of an miRNA expressed in the heart, wherein the target sequence consists of the sequence as set forth in SEQ ID NO: 10, or (b) a promoter sequence that regulates the expression of the nucleic acid sequence encoding the myotubularin in the heart, and wherein the promoter sequence consists of the nucleic acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13.
2. The expression vector of claim 1, wherein the myotubularin polypeptide consists of the amino acid sequence as set forth in SEQ ID NO: 1.
3. The expression vector of claim 1, wherein the at least one additional sequence consists of the sequence as set forth in SEQ ID NO: 10.
4. The expression vector of claim 1, wherein the at least one additional sequence consists of the nucleic acid sequence as set forth in SEQ ID NO: 12 or SEQ ID NO: 13.
5. A pharmaceutical composition comprising the expression vector of claim 1.
6. A pharmaceutical composition comprising the expression vector of claim 1, and a pharmaceutically acceptable carrier.
7. The expression vector of claim 3, comprises a desmin promoter, wherein the desmin promoter consists of the nucleic acid sequence as set forth in SEQ ID NO: 11.
8. The expression vector of claim 1, wherein the vector is a viral vector.
9. The expression vector of claim 8, wherein the viral vector is an adeno-associated viral vector (AAV).
10. The expression vector of claim 9, wherein the adeno-associated viral vector is AAV8 or AAV9.
Description
EXPERIMENTAL EXAMPLES
(1) The invention and the advantages resulting from it will be better understood with the examples of realisation given below and with the help of the figures annexed. However, these are not exhaustive.
(2) The present invention is illustrated in connection with the myotubularin (MTM1) and calpain 3 (CAPN3) gene. However, the strategy described can be applied to any transgene encoding a protein of interest in the skeletal muscles whose cardiac toxicity is demonstrated.
(3)
(4) A/ Mtm1 expression cassette, devoid of target sequences for miRNA-208a;
(5) B/ expression cassette containing 1, 2 or 4 target sequences for miRNA-208a (box) at 3 of the Mtm1 gene.
(6)
(7)
(8) Top: distribution of the vector in skeletal muscles (tibialis anterior=TA; quadriceps=QUA; triceps=TRI) and in the heart of a wild mouse (WT), 1 month after the intravenous administration of vectors (vg/diploid genome).
(9) Bottom: level of MTM1 protein in skeletal muscles and the heart of a wild mouse (WT), one month after administration of the vectors. The values indicate the multiplication rate in relation to the endogenous levels. As controls, mice were injected with either PBS or empty AAV8 vector (AAV-MCS).
(10)
(11)
(12) A/ Histological analysis of the heart muscle after injection of PBS or the vectors AAV2/9-desm-CAPN3 (pdes.C3), AAV2/9-pC3-CAPN3 (pC3.C3), AAV2/9-pmiR206-CAPN3 (p206.C3) and Sirius red staining (top, scale=500 m) or Hematoxylin Phloxine Saffron (HPS) (bottom, scale=100 m).
(13) B/ Evaluation of the vector DNA level by qPCR in the heart of WT wild mice after injection.
(14) C/ Evaluation of the CAPN3 mRNA level by qPCR in the heart of WT wild mice after injection. The line H corresponds to the CAPN3 endogenous mRNA level in the heart of WT wild mice.
(15) D/ Analysis of serum enzymes. The alanine aminotransferase tests (ALT) were carried out on sera of WT mice treated with pC3.C3 to the left, or p206.C3 to the right. The standard deviation and mean (SEM) for each condition are indicated by a circle and a vertical bar, respectively.
(16)
(17) A/ Histological analysis of the heart muscle, 35 days after injection of PBS or identical doses of the vectors AAV2/9-desm-CAPN3 (pdes.C3) or AAV2/9-desmin-CAPN3-miR208aT (pdes.C3-T) and Sirius red staining (top, scale=500 m) or HPS (bottom, scale=100 m).
(18) B/ Evaluation of the vector DNA level by qPCR in the heart of WT wild mice after injection (top) and the mRNA level of CAPN3 transgene (bottom). The line H corresponds to the CAPN3 endogenous mRNA level in the heart of WT wild mice.
(19) C/ Analysis of the expression of calpain 3 by Western blot in the skeletal muscle and heart of WT mice injected with PBS or the vectors AAV2/9-desmin-CAPN3 (pdes.C3) or AAV2/9-desm-CAPN3-miR208aT (pdes.C3-T). The entire protein is indicated by an arrow and its cleavage products (60, 58 and 55 kDa) by a hook.
(20) D/ Quantification of mRNA levels of miR-208a (miR208a), HOP (Hop) and connexin 40 (Cnx40) in the heart of WT mice injected with AAV2/9-desmin-CAPN3 (pdes.C3) or AAV2/9 desmin-CAPN3-miR208aT (pdes.C3-T). The quantity of RNA in the pdes.C3-T condition is given as a percentage of the RNA level in the pdes.C3 condition.
(21)
(22) A/ Transverse sections of the TA muscles of C3KO mice were stained with the HPS, 4 months after injection either with PBS or vectors (1.210.sup.13 vg/kg) AAV2/9-desmin-CAPN3-miR208aT (pdes.C3-T), AAV2/9-PC3-CAPN3-miR208aT (pC3.C3-T), AAV2/9-pmiR206-CAPN3-miR208aT (P206.C3-T). Scale=100 m.
(23) B/ Number of centronuclear fibres (CNF/mm.sup.2) measured in the stained sections with the HPS in TA (left) and PSO (right) muscles of C3KO mice injected either with PBS or vectors (1.210.sup.13 vg/kg) AAV2/9-desmin-CAPN3-miR208aT (pdes.C3-T) AAV2/9-PC3-CAPN3-miR208aT (pC3.C3-T), AAV2/9-pmiR206-CAPN3-miR208aT (p206.C3-T). A difference with a P value<0.05 is indicated by an asterisk. TA: tibialis anterior; PSO: Psoas muscle.
I) MATERIAL AND METHODS
(24) 1) Generation of Recombinant AAV Vectors:
(25) The vector rAAV-Des-Mtm1 was constructed by cloning the open reading frame of the murine Mtm1 gene (SEQ ID NO: 14) downstream of the human desmin promoter (SEQ ID NO: 11) in a vector serotype 2 AAV. Target sequences (1, 2 or 4 sequences, miRHT1, miRTH2 and miRHT4 respectively) of the miRNA-208a of 22 pb (SEQ ID NO: 10), each separated by DNA spacers, have been added in the 3UTR region of the Mtm1 cDNA. An empty vector (rAAV-Des-MCS) was also generated as a control. Recombinant viral particles of serotype 8 (AAV8) were obtained using a tri-transfection protocol of the HEK 293 cells as described previously (15). The vector titres are expressed in terms of viral genomes per ml (vg/ml).
(26) Similarly, the vector rAAV-desm-CAPN3 (or AAV-desmin-CAPN3 or AAV-pDes-CAPN3) was constructed using the cDNA of human calpain 3 (SEQ ID NO: 8) under the control of the human desmin promoter (SEQ ID NO: 11). RAAV-PC3-CAPN3 and rAAV-pmiR206-CAPN3 vectors were obtained by replacing this promoter by the promoter region of the human calpain 3 (SEQ ID NO: 12) or that of the miARN206 (SEQ ID NO: 13), respectively. The vectors AAV-desm-CAPN3-miR208aT, AAV-PC3-CAPN3-miR208aT and AAV-pmiR206-CAPN3-miR208aT were obtained by adding 2 target sequences for the miARN208a (SEQ ID NO: 9) in tandem (miR208aT), at 3 of the calpain gene 3. Recombinant viral particles of serotype 1 (AAV1), 8 (AAV8) and/or 9 (AAV9) were produced.
(27) 2) In Vivo Experiments:
(28) The mice were treated according to the French and European legislation regarding animal testing. In this study, WT C57Bl/6 wild mice (Charles River Laboratories) and a mouse strain constitutively inactivated for myotubularin (knockout) KO-Mtm1, also called BS53d4-129pas, were used. For calpain 3, the C3KO murine model, described by Laure et al. (Febs J., 2010, 277: 4322-4337), was used.
(29) Recombinant vectors, as per the indicated doses were injected into the tail vein of the mice as indicated (aged 3 weeks to 2 months). An equivalent volume of saline buffer (PBS) was administered as a control. The clinical status and animal weight were monitored weekly for WT animals and three times per week for the mutant mice. The mice were sacrificed at the indicated times.
(30) 3) Western Blot:
(31) Muscles frozen in isopentane were cut in cross-sections of 30 m and lysed on ice in a buffer containing 150 mM NaCl, 10 mM Tris HCl (pH 7.4), 1 mM EGTA, 1 mM EDTA, 100 mM sodium fluoride, 4 mM sodium pyrophosphate, 2 mM sodium orthovanadate, 1% Triton X100 and 0.5% IGEPAL supplemented with a complete cocktail of protease inhibitors (Roche). The muscle extracts were incubated for 1 h and centrifuged at 4 C. at 12,000g for 30 min. The protein concentrations in the supernatant were determined using the Bio-Rad protein assay kit. Proteins were subjected to migration to SDS-PAGE and, after transfer to a nitrocellulose membrane, incubated with polyclonal antibodies directed against the myotubularin (p2348 [15]) and GAPDH (#MAB374, Millipore). The protein bands were viewed by infrared fluorescence using the Odyssey Imaging System (LICOR Biotechnology Inc.) and quantified using the program Odyssey Infrared Imaging System Software (software application, version 1.2, 2003).
(32) For detection of calpain 3, a similar protocol was used:
(33) The muscles were homogenized by FastPrep using the lysis buffer according to [20 mM Tris (pH 7.5), 150 mM NaCl, 2 mM EGTA, 0.1% Triton X-100, 2 mM E64 (Sigma)] and protease inhibitors (Complete Mini protease inhibitor cocktail; Roche Applied Science, 25 l per mg of tissue). The samples were treated with 250 U/100 l of Benzonase (Calbiochem) for 30 min at 4 C. to digest the DNA. The muscle lysates were mixed with the load buffer [NuPage LDS (Invitrogen), TNT 3M (Sigma)], denatured for 10 minutes at 70 C. and centrifuged briefly. The supernatants were separated by polyacrylamide gel NuPAGE Bis-Tris in 4-12% gradient (Invitrogen). After the transfer, the membranes were hybridised with antibodies against calpain 3 (mouse monoclonal antibody, Novocastra NCL-CALP-12A2, 1/200 dilution), at 4 C. overnight or at room temperature for 2-3 hours. Finally, the membranes were incubated with IRDye in order to be revealed on the Odyssey infrared scanner (LI-COR Biosciences, Lincoln, Nebr., USA).
(34) 4) PCR:
(35) 4-1Myotubularin:
(36) The isolation of DNA from the muscles was performed using the Gentra Puregene Tissue Kit (Qiagen), in accordance with the manufacturer's instructions. The total DNA concentration was determined using a ND-8000 Nanodrop spectrophotometer (Nanodrop Technologies, France), and 80 ng of DNA for each sample was used as matrix for the PCR in real time. The Taqman real-time PCR was performed on each sample for both a part of the skeleton common to the rAAV2/X vector to identify copies of the viral genome, and the murine gene of the titin, to standardise the number of murine genomes present in each sample. The primers used for amplification of the rAAV vectors were: 5-CTCCATCACTAGGGGTTCCTTG-3 (forward; SEQ ID NO: 15), 5-GTAGATAAGTAGCATGGC-3 (reverse; SEQ ID NO: 16). The MGB probes were double-labelled (FAM-NFQ): 5-TAGTTAATGATTAACCC-3 (probe; SEQ ID NO: 17). Primers and a probe used for the titin were: 5-AAAACGAGCAGTGACGTGAGC-3 (forward; SEQ ID NO: 18), 5-TTCAGTCATGCTGCTAGCGC-3 (reverse; SEQ ID NO: 19), and 5-TGCACGGAAGCGTCTCGTCTCAGTC-3 (probe; SEQ ID NO: 20) (Applied Biosystem). The amplifications of the titin were performed using 80 ng of DNA diluted in an Absolute QPCR ROX Mix (Thermo Fischer Scientific), 0.1 M of Taqman probes and 0.2 M of primers (forward and reverse), in a final volume of 25 M. The cycle conditions consisted of: an activation step for the Thermo-Start DNA polymerase at 95 C. for 15 min, followed by 40 two-step cycles, 15 seconds of denaturation at 95 C. and 60 seconds of hybridisation and extension at 60 C. The amplification of the rAAVs was performed using 0.1 M of Taqman probes, 0.3 M of reverse primer and 0.05 M of forward primer in a final volume of 25 l. The cycle conditions consisted of: an activation step for the Thermo-Start DNA polymerase at 95 C. for 15 min, followed by 40 two-step cycles, 15 seconds of denaturation at 95 C. and 60 seconds of hybridisation and extension at 54 C. The PCR was performed on a 7900 HT thermocycler (Applied Biosystem). A standard dilution series of a plasmid containing the sequences of a rAAV skeleton and the titin was used in each PCR plate in real time as control of the number of copies. All samples and controls were duplicated. The data are expressed as number of copies of the viral genome per diploid genome.
(37) 4-2Calpain 3:
(38) The muscles were extracted using the Trizol method (Invitrogen). During extraction, a sample fraction was preserved for DNA extraction for quantification by quantitative PCR. The total RNA was extracted from the remaining extract treated with the DNA-Free kit (Ambion) to remove residual DNA.
(39) For quantification of the expression of endogenous microRNAs, a total of 20 ng RNA were subjected to a reverse transcription using the reverse transcription TaqMan MicroRNA kit (Applied Biosystems) and analysed by the microRNA ID511 Taqman assay for miR-208a (Applied Biosystems). The standardisation of the samples was carried out with the expression of snoRNA202 with test ID1232 (Applied Biosystems).
(40) For the amplification of mRNAs of the endogenous or transgenic calpain 3, one g of RNA was reverse transcribed using random hexamers and oligodT and the cDNA Verso kit (Abgene) or RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas). The real-time PCR was performed using the TaqMant method applying the ABI PRISM 7700 (Applied Biosystems) system and the Absolute QPCR Rox Mix solution (ABgene) with the help of the primer pairs (.f and .r) and Taqman probe (.p) below: for the quantification of transgenic calpain: CAPN3sfr.f (SEQ ID NO: 21) 5_CGCCTCCAAGGCCCGT_3; CAPN3sfr.r (SEQ ID NO: 22) 5_GGCGGAAGCGCTGGCT_3; MGBTUCAPN3.p (SEQ ID NO: 23) 5_CTACATCAACATGAGAGAGGT_3; for quantification of human calpain: CAPN3.f (SEQ ID NO: 24) 5_CGCCTCCAAGGCCAGG_3, CAPN3.r (SEQ ID NO: 25) 5_GGCGGAAGCGCTGGGA_3 et CAPN3.p (SEQ ID NO: 26) 5_TACATCAACATGCGGGAGGT_3. A serial dilution of a control RNA was used in each experiment and treated with the experimental samples to avoid the variability in the efficiency of the cDNA preparation and the PCR in order to be able to compare the different experiments. This RNA was prepared by an in vitro transcription reaction from a plasmid carrying a cDNA calpain 3 mutated and amplifiable by all the pairs of primers.
(41) The analysis of the expression of the connexin 40 and HOP was performed using the TaqMan Gene Expression tests (Applied Biosystens) given below: for Cnx40; Gja-5 [Mus Musculus]: Mm00433619_s1 and hop: HOP homeobox [Mus musculus]: Mm00558630_m1. The qRT-PCR results are expressed in arbitrary units related to the expression of the ubiquitous ribosomal phosphoprotein acid murine gene (P0 G1: 15029771; MH181PO.F (SEQ ID NO: 27): 5_CTCCAAGCAGATGCAGCAGA_3/M267PO.R (SEQ ID NO: 28): 5_ACCATGATGCGCAAGGCTAT_3/M225PO.p (SEQ ID NO: 29): 5 <<_CCGTGGTGCTGATGGGCAAGAA_3).
(42) 5) Histology:
(43) Cross cryosections (8 m thickness) of the cardiac, hepatic or skeletal muscles were stained with hematoxylin eosin (HE), sirius red or Hematoxylin Phloxine Saffron (HFS) using standard protocols.
(44) The sections were mounted with the Eukitt medium (LABONORD). The digital images were captured using a CCD camera (Sony). The morphometric analyses of the skeletal muscles to define the number of centronuclear fibres (CNF/mm.sup.2) were performed using the Histolab software (Microvision, Evry).
(45) 6) Measurement of ALT Activity:
(46) Blood samples were collected without coagulation. After centrifugation (8000 g, 10 min, 4 C.), the sera were analysed using the VITROS DT60 device (Ortho Clinical Diagnostics, UK) using the Vitros ALT DT slides cassettes for the determination of the alanine aminotransferase (ALT) rate.
II) RESULTS
(47) AMyotubularin
(48) 1) Cardiac Toxicity of the Construction AAV-pDES-Mtm1:
(49) The beneficial effect of a single intramuscular injection of the myotubularin (Mtm1) gene under the control of the CMV promoter in a vector AAV2/1 was known from the paper Buj-Bello et al. [15]
(50) A gene therapy approach by systemic route in Mtm1 knockout mice was attempted and it has been shown that administration of an AAV8 vector (rAAV-Des-Mtm1) expressing myotubularin under the control of human desmin promoter (
(51) However, following systemic administration of the vector AAV8-DES-Mtm1 in Mtm1 KO mice, it was observed that the level of myotubularin protein was very high in the heart compared to the skeletal muscles (results not shown). In addition, the presence of inflammatory infiltrates and fibrosis in the heart of XLMTM mice treated with AAV at different times following the viral injection (
(52) 2) Developments of Expression Systems without Cardiac Toxicity
(53) Given the difficulty to predict the biodistribution and transgene expression from a vector AAV8 after systemic administration, particularly in humans, new vectors carrying regulatory sequences increasing the muscle specificity have been developed in order to avoid potential side effects affecting the heart.
(54) Three viral constructs (rAAV-Des-Mtm1-miRHT1; rAAV-Des-Mtm1-miRHT2 and rAAV-Des-MTM1-miRHT4) were developed, as shown in
(55) 3) Muscle and Heart Production of MTM1 after Injection in a WT Mouse
(56) In order to select the expression vector that is most suitable for MTM1, a single dose of 310.sup.13 viral genomes (vg)/kg of these vectors was administered in the tail vein of wild-type mice aged 3 weeks. An empty vector (AAV-Des-MCS) and PBS (Phosphate Buffered Saline) were used as internal controls.
(57) The vector distribution and protein level in myotubularin in the heart and in different skeletal muscles (anterior tibial=TA; quadriceps=QUA, triceps=TRI) were assessed 1 month after the injection. Western blot results showed that these vectors are able to decrease the level of myotubularin produced from vectors specifically in the heart. In addition, a single target sequence of the miRNA208a is sufficient to reduce expression in this tissue (
(58) TABLE-US-00001 TABLE 1 Semi-quantitative quantification of the MTM1 protein in the skeletal muscles and the heart, one month after the delivery of a vector in a WT mouse. PBS Mtm1 miRHT1 miRHT2 miRHT4 Skeletal TA 1 50 70 100 30 muscles QUA 1 45 45 50 15 TRI 1 20 17 30 10 Heart 1 >90 1.6 1.1 0.7
(59) 4) Validation of the Vector Construction after Injecting an Mtm1 Mutated Mouse
(60) Based on previous results, the construct rAAV-Des-Mtm1-miRHT1 was selected for further experiments. WT wild mice mutated in the MTM1 gene (KO for Knock Out) received 310.sup.13 vg/kg of AAV-Des-Mtm1, rAAV-Des-Mtm1-miRHT1 and rAAV-Des-MCS, respectively, or PBS at the age of 3 weeks, and were clinically monitored for 1 month.
(61) All mutant mice that received AAV8-Des-Mtm1-miRHT1 survived until the end of the study, with a growth curve similar to that of KO mice treated with AAV8-Des-Mtm1 showing that the inclusion of the miRHT1 sequence does not affect the therapeutic efficacy of the transgene (
(62) The histology of the heart of WT and KO mice was analysed one month after treatment, with hematoxylin-eosin and Sirius red staining. Fibrotic areas were observed in the heart of 7 KO mice out of 9 treated with 9-AAV8-Des-Mtm1, but not in the KO mice treated with AAV8-Des-Mtm1-miRHT1 (n=10). The administration of the vector AAV8-Des-Mtm1 did not cause fibrosis in WT animals 1 month after injection (n=8).
(63) In conclusion, these results indicate that the inclusion of a single target sequence of miARN208a is sufficient to reduce the cardiac toxicity of an AAV8-Des-Mtm1 construct.
(64) Similar experiments were conducted with regard to calpain 3 (CAPN3):
(65) BCalpain 3
(66) The paper Bartoli et al. (Molecular Therapy, 2006, Vol. 13, No. 2, 250-259) indicates a beneficial effect and non-toxicity of AAV type of constructs carrying the calpain 3 gene under the control of muscle-specific promoters, after intramuscular or local administration. However, the experiments carried out in connection with the invention have revealed toxicity in such constructs after systemic administration:
(67) 1) Cardiac Toxicity of AAV-desm-CAPN3 Constructs:
(68) The condition of WT mice was monitored, following intravenous injection of different constructs, and is presented in Table 2 below:
(69) TABLE-US-00002 TABLE 2 Consequences of intravenous injections of different AAVs at different doses Dose Number of Histological appearance of Serotype (vg/kg) deaths the heart after 35 days AAV9 4.0 10.sup.11 0/3 fibrosis 1.0 10.sup.12 0/9 fibrosis 1.6 10.sup.13 5/7 fibrosis 4.3 10.sup.13 2/6 fibrosis AAV8 7.0 10.sup.12 2/4 fibrosis AAV1 1.6 10.sup.13 0/3 fibrosis
(70) For all tested AAVs, a destruction of heart tissue is observed in case of systemic administration, excluding the use for therapeutic purposes of these gene expression systems.
(71) 2) Reduction of Cardiac Toxicity of the Constructs AAV-desm-CAPN3 by Replacing the Promoter:
(72) Two vectors were constructed by exchanging the desmin promoter with that of CAPN3(AAV2/9-pC3-CAPN3) or miR-206 (AAV2/9-pmiR206-CAPN3). After viral preparation of vectors, the in vivo consequences of the changes introduced by intravenous injection (610.sup.12 vg/kg) were analysed in C57BL/6 mice (WT) aged 2 months.
(73) 35 days after injection, no cardiac fibrosis was observed in mice treated with the vectors AAV2/9-pC3-CAPN3 and AAV2/9-pmiR206-CAPN3, unlike the mice injected with AAV2/9-desm-CAPN3 (
(74) Finally, the promoters CAPN3 and miR-206 reduce the cardiac toxicity of the transgene CAPN3 without causing liver toxicity.
(75) 3) Reduction of the Cardiac Toxicity of the AAV-desm-CAPN3 Constructs by Addition of Two Target Sequences of miR208a:
(76) Two target sequences of MiARN208a (SEQ ID NO: 10) were cloned in tandem in a miR208aT cassette. This was then inserted into the 3UTR area of the construct AAV2/9-desm-CAPN3 to produce the construct AAV2/9-desm-CAPN3-miR208aT.
(77) After injecting a dose of 610.sup.12 vg/kg, no cardiac fibrosis was observed in the treated mice, unlike the mice injected with AAV2/9-desm-CAPN3 (
(78) 4) Combination of Two Strategies:
(79) New vectors were constructed by combining the promoters CAPN3 and miR-206 and 2 copies of the target sequence of miR-208a: AAV2/9-pC3-CAPN3-miR208aT and AAV2/9-pmiR206-CAPN3-miR208aT. C3KO mice (knockout for calpain 3) received an injection of 1.210.sup.13 vg/kg of these vectors.
(80) As previously observed in the wild mice, none of the three vectors (AAV2/9-desm-CAPN3-miR208aT, AAV2/9-pC3-CAPN3-miR208aT and AAV2/9-pmiR206-CAPN3-miR208aT) proved to be toxic for the heart, 3 months after the injection (results not shown).
(81) In contrast, a histological and morphological examination of skeletal muscles of C3KO mice aged 4 weeks and injected with these vectors has shown a positive effect of the expression of calpain 3 on the pathological signs of the murine model. The anterior tibialis (TA) muscles injected with these vectors showed improved histological features compared to those injected with PBS (
(82) In conclusion, these results indicate that the expression of calpain 3 in skeletal muscles transduced with these recombinant vectors can correct the pathological signs of a mouse deficient in calpain 3, without presenting cardiac toxicity.
BIBLIOGRAPHY
(83) 1. Jungbluth H, Wallgren-Pettersson C, Laporte J (2008) Centronuclear (myotubular) myopathy. Orphanet J Rare Dis 3: 26. 2. Wallgren-Pettersson C, Clarke A, Samson F, Fardeau M, Dubowitz V, et al. (1995) The myotubular myopathies: differential diagnosis of the X linked recessive, autosomal dominant, and autosomal recessive forms and present state of DNA studies. J Med Genet 32: 673-679. 3. Herman G, Finegold M, Zhao W, de Gouyon B, Metzenberg A (1999) Medical complications in longterm survivors with X-linked myotubular myopathy. J Pediatr 134: 206-214. 4. Bevilacqua J, Bitoun M, Biancalana V, Oldfors A, Stoltenburg G, et al. (2009) Necklace fibers, a new histological marker of late-onset MTM1-related centronuclear myopathy. Acta Neuropathol 117: 283-291. 5. Fardeau M (1992) Congenital myopathies. In: Detchant MFLWo, editor. Skeletal muscle pathology. Edinburgh: Churchill Livingstone. pp. 1488-1531. 6. Laporte J, Hu L J, Kretz C, Mandel J L, Kioschis P, et al. (1996) A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat Genet 13: 175-182. 7. Dowling J J, Vreede A P, Low S E, Gibbs E M, Kuwada J Y, et al. (2009) Loss of myotubularin function results in T-tubule disorganization in zebrafish and human myotubular myopathy. PLoS Genet 5:e1000372. 8. Buj-Bello A, Laugel V, Messaddeq N, Zahreddine H, Laporte J, et al. (2002) The lipid phosphatase myotubularin is essential for skeletal muscle maintenance but not for myogenesis in mice. Proc Natl Acad Sci USA 99: 15060-15065. 9. Pierson C R, Dulin-Smith A N, Durban A N, Marshall M L, Marshall J T, et al. (2012) Modeling the human MTM1 p.R69C mutation in murine Mtm1 results in exon 4 skipping and a less severe myotubular myopathy phenotype. Hum Mol Genet 21: 811-825. 10. Beggs A H, Bohm J, Snead E, Kozlowski M, Maurer M, et al. (2010) MTM1 mutation associated with X-linked myotubular myopathy in Labrador Retrievers. Proc Natl Acad Sci USA 107: 14697-14702. 11. Al-Qusairi L, Weiss N, Toussaint A, Berbey C, Messaddeq N, et al. (2009) T-tubule disorganization and defective excitation-contraction coupling in muscle fibers lacking myotubularin lipid phosphatase. Proc Natl Acad Sci USA 106: 18763-18768. 12. Hnia K, Tronchere H, Tomczak K K, Amoasii L, Schultz P, et al. (2011) Myotubularin controls desmin intermediate filament architecture and mitochondrial dynamics in human and mouse skeletal muscle. J Clin Invest 121: 70-85. 13. Dowling J J, Joubert R, Low S E, Durban A N, Messaddeq N, et al. (2012) Myotubular myopathy and the neuromuscular junction: a novel therapeutic approach from mouse models. Dis Model Mech. 14. Lawlor M W, Alexander M S, Viola M G, Meng H, Joubert R, et al. (2012) Myotubularin-deficient myoblasts display increased apoptosis, delayed proliferation, and poor cell engraftment. Am J Pathol 181: advanced online. 15. Buj-Bello A, Fougerousse F, Schwab Y, Messaddeq N, Spehner D, et al. (2008) AAV-mediated intramuscular delivery of myotubularin corrects the myotubular myopathy phenotype in targeted murine muscle and suggests a function in plasma membrane homeostasis. Hum Mol Genet 17: 2132-2143.