Production of infectious influenza viruses

09982240 ยท 2018-05-29

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a method for producing influenza infectious viruses wherein CHO cells are infected with a seed of infectious influenza virus which has been generated by transfecting cells with an appropriate set of expression vectors. The invention also relates to a recombination cassette, and to a vector comprising said recombination cassette, that may be used in methods for producing infectious viruses, and particularly in the method according to the invention.

Claims

1. A method for producing infectious influenza viruses, wherein said method comprises the steps of: a) transfecting a mixture of cells comprising CHO cells and cells of primate origin, wherein the cells of primate origin comprise Vero cells, 293T cells, or PER.C6 cells, with a set of expression vectors to generate a seed of infectious influenza virus, and b) infecting CHO cells with said seed of infectious influenza virus.

2. The method according to claim 1, wherein the cells of step b) are CHO-K1 cells that do not express Sia2-6Gal receptors.

3. The method according to claim 1, wherein the cells of primate origin are Vero cells.

4. The method according to claim 1, wherein said set of expression vectors comprises: (a) expression vectors allowing the expression of one or more mRNAs encoding at least influenza PB1, PB2, PA, NP, M, NS, HA, and NA proteins, and (b) expression vectors allowing the expression of one or more influenza PB1, PB2, PA, NP, M, NS, HA and NA vRNAs, or the corresponding cRNAs, wherein the expression of said set of expression vectors allows (i) the formation of the ribonucleoprotein complex (RNP) containing the influenza vRNA(s), and (ii) the generation of infectious influenza viruses in the transfected cells.

5. The method according to claim 4, wherein: (i) said expression vectors allowing the expression of one or more mRNAs encoding influenza PB1, PB2, PA, NP, M, NS, HA, and NA proteins comprise four different uni directional plasmids, each plasmid containing one or more cDNAs complementary to a mRNA encoding one of the four distinct proteins selected from PB1, PB2, PA and NP influenza proteins, wherein the one or more cDNAs are under the control of a promoter that binds to RNA polymerase II, and (ii) said expression vectors allowing the expression of influenza PB1, PB2, PA, NP, M, NS, HA and NA vRNAs, or the corresponding cRNAs, comprise eight different uni directional plasmids, each plasmid containing one or more cDNAs complementary to one of the eight distinct vRNAs selected from said PB1, PB2, PA, NP, M, NS, HA and NA influenza vRNAs, or to the corresponding cRNAs, wherein the one or more cDNAs are under the control of a promoter that binds to RNA polymerase I.

6. A method for producing infectious influenza viruses, wherein said method comprises the steps of: a) transfecting cells with a set of expression vectors to generate a seed of infectious influenza virus, and b) infecting CHO cells with said seed of infectious influenza virus, wherein said set of expression vectors comprises: (aa) expression vectors allowing the expression of one or more mRNAs encoding at least influenza PB1, PB2, PA, NP, M, NS, HA, and NA proteins, and (bb) expression vectors allowing the expression of one or more influenza PB1, PB2, PA, NP, M, NS, HA and NA vRNAs, or the corresponding cRNAs, wherein the expression of said set of expression vectors allows the formation of the ribonucleoprotein complex (RNP) containing the influenza vRNA(s), and the generation of infectious influenza viruses in the transfected cells, and (i) said expression vectors allowing the expression of one or more mRNAs encoding influenza PB1, PB2, PA, NP, M, NS, HA, and NA proteins comprise four different uni directional plasmids, each plasmid containing one or more cDNAs complementary to a mRNA encoding one of the four distinct proteins selected from PB1, PB2, PA and NP influenza proteins, wherein the one or more cDNAs are under the control of a promoter that binds to RNA polymerase II, and (ii) said expression vectors allowing the expression of influenza PB1, PB2, PA, NP, M, NS, HA and NA vRNAs, or the corresponding cRNAs, comprise eight different uni directional plasmids, each plasmid containing one or more cDNAs complementary to one of the eight distinct vRNAs selected from said PB1, PB2, PA, NP, M, NS, HA and NA influenza vRNAs, or to the corresponding cRNAs, wherein the one or more cDNAs are under the control of a promoter that binds to RNA polymerase I; wherein each plasmid in paragraph (ii) has been obtained by cloning said cDNA into a vector comprising, in the 5 to 3 sense: a) a promoter that binds to RNA polymerase I, or a T7 RNA polymerase; b) a recombination cassette comprising, in the 5 to 3 sense: an inverted complementary recognition sequence for a first restriction enzyme which has its cutting site outside of its recognition sequence and produces sticky ends; a restriction site for a second restriction enzyme which has its cutting site inside of its recognition sequence; a restriction site for a third restriction enzyme which has its cutting site inside of its recognition sequence; and a recognition sequence for said first restriction enzyme which has its cutting site outside of its recognition sequence and produces sticky ends; wherein said second and third restriction enzymes are different; and c) a terminator sequence; wherein: when the promoter binds to RNA polymerase I, said terminator sequence is hepatitis delta ribozyme sequence; and when the promoter binds to T7 RNA polymerase, said terminator sequence is T7 polymerase terminator sequence.

7. The method according to claim 6, wherein said vector comprises sequence SEQ ID NO: 1.

8. The method of claim 4, wherein said set of expression vectors comprises eight different bidirectional plasmids, each plasmid containing a cDNA complementary to one of the eight distinct vRNAs selected from said PB1, PB2, PA, NP, M, NS, HA and NA influenza vRNAs under the control of two promoters, wherein said first promoter binds to polymerase I and said second promoter binds to polymerase II.

9. The method of claim 1, wherein the infectious influenza viruses produced are reassortant infectious type A or type B influenza viruses, wherein the genetic material comprises a combination of the genetic material of at least two donor viruses, wherein one of the donor viruses is A/Puerto Rico/8/34 (H1N1) (A/PR/8/34), B/Lee/40 or B/Panama/45/90.

10. The method according to claim 1, wherein the infectious influenza viruses produced are chimeric viruses that contain a chimeric influenza HA and/or NA vRNAs, wherein the chimeric influenza HA vRNA and/or NA vRNAs comprise one or more domains of a HA vRNA or one or more domains of a NA vRNA from a clinical isolate of influenza virus and one or more domains of a HA vRNA or one or more domains of a NA vRNA from another donor virus, wherein at least one domain of the HA vRNA from said clinical isolate of influenza virus is complementary to the region of a mRNA encoding the antigenic ectodomain of HA, and at least one domain of the NA vRNA from said clinical isolate of influenza virus is complementary to the region of a mRNA encoding the antigenic ectodomain of NA from said clinical isolate of influenza virus.

11. The method according to claim 1, wherein said method is entirely performed in a serum-free medium or in animal component-free conditions.

12. A method of preparing an influenza vaccine composition, which method comprises: a) producing influenza viruses by a method according to claim 1; b) harvesting the infectious influenza viruses after multiplication in CHO cells, c) purifying the harvested infectious influenza virus, d) optionally inactivating the purified virus, and e) mixing the purified virus with a pharmaceutically acceptable carrier.

13. A method of preparing an influenza vaccine composition, which method comprises: a) producing influenza viruses by transfecting cells with a set of expression vectors to generate a seed of infectious influenza virus, and infecting CHO cells with said seed of infectious influenza virus; b) harvesting the infectious influenza viruses after multiplication in CHO cells, c) purifying the harvested infectious influenza virus, d) optionally inactivating the purified virus, and e) mixing the purified virus with a pharmaceutically acceptable carrier, wherein at least one of the expression vectors comprises, in the 5 to 3 sense: a promoter that binds to RNA polymerase I, or to T7 RNA polymerase; a recombination cassette comprising, in the 5 to 3 sense: an inverted complementary recognition sequence for a first restriction enzyme which has its cutting site outside of its recognition sequence and produces sticky ends; a restriction site for a second restriction enzyme which has its cutting site inside of its recognition sequence; a restriction site for a third restriction enzyme which has its cutting site inside of its recognition sequence; and a recognition sequence for said first restriction enzyme which has its cutting site outside of its recognition sequence and produces sticky ends; wherein said second and third restriction enzymes are different; and a terminator sequence; wherein: when the promoter binds to RNA polymerase I, said terminator sequence is hepatitis delta ribozyme sequence, when the promoter binds to T7 RNA polymerase, said terminator sequence is T7 polymerase terminator sequence.

14. The method of claim 3, wherein the CHO cells of step a) are CHO-K1 cells, and a mixture of Vero cells and CHO-K1 cells is transfected.

15. The method of claim 1, wherein the CHO cells of step a) are CHO-K1 cells.

Description

FIGURES

(1) FIG. 1: Illustration of the streamlined scheme for rapid generation of recombinant influenza viruses that could be used as vaccine reassortants. pSP-flu corresponds to the universal vector consisting of the sequence SEQ ID NO: 10.

(2) FIG. 2: Cloning strategy using Universal pSP-flu plasmid. The location of kanamycine resistance gene is shown in blank, POL 1 promoter and ribozyme are shown in dark. The plasmid was linearized with Bbsl, and mixed with the viral cDNA containing 17 nucleotides from the promoter and the ribozyme at the ends, before transformation of competent E. Coli. The cDNA recombined into circular plasmid within the regions of terminal complementarity to introduce virus genome segments between POL I promoter and ribozyme. SEQ ID NOs for the sequences in FIG. 2 are as follows: TGGGCCGCCGGGTTATTGTCTTCGCGGCCGCCCTGCAGGGAAGACGGCCGGC ATGGTCCCAG (SEQ ID NO: 30); ACCCGGCGGCCCAATAACAGAAGCGCCGGCGGGACGTCCCTTCTGCCGGCCG TACCAGGGTC (SEQ ID NO: 31); TGGGCCGCCGG (SEQ ID NO: 32); ACCCGGCGGCCCAAT (SEQ ID NO: 33); GTTATTGTCTTCGTCTTCGCGGCCGCCCTGCAGGGAAGACGG (SEQ ID NO: 34); AACAGAAGCGCCGGCGGGACGTCCCTTCTGCCGGCC (SEQ ID NO: 35); CCGGCATGGTCCCAG (SEQ ID NO: 36); GTACCAGGGTC (SEQ ID NO: 37); TGGGCCGCCGGGTTATT (SEQ ID NO: 38); ACCCGGCGGCCCAATAA (SEQ ID NO: 39); GGCCGGCATGGTCCCAG (SEQ ID NO: 40); CCGGCCGTACCAGGGTC (SEQ ID NO: 41).

EXAMPLE

(3) 1. Materials and Methods

(4) 1.1. Cells

(5) Suspension of CHOK1 cells (ATCC Number:CCL-61) were cultivated in 125 mL shaker flasks (Thermo Scientific) in Ex-Cell CD CHO fusion medium (SIGMA-ALDRICH, St Quentin Fallavier, FR) supplemented with 4 mM L-glutamine (Gibco) under agitation. Adherent MDCK cells (CCL-34) and Vero cells (ATCC Number: CCL-81) were cultivated in tissue culture flasks (Becton Dickinson) in DMEM (Gibco) supplemented with 10% FBS (Thermo Scientific) or in VP-SFM (Gibco) supplemented with 0.1% povidone K30 (Sanofi Pasteur) respectively. CEP cells were collected from 10-day-old specific pathogen free (SPF) chicken embryos (Valo Biomedia, Osterholz-Scharmbeck, GE) and cultivated in tissue culture flasks (Becton Dickinson) in DMEMF12+Glutamax I (HAM) (Gibco) supplemented with 5% FBS (Thermo Scientific). All cell cultures were maintained at 37 C. in an atmosphere of 95% air and 5% CO.sub.2.

(6) 1.2. Receptor Analysis

(7) Analysis of Sia2-3Gal and Sia2-6Gal residue expression on the surface of different cell types was performed using digoxigenin glycan differentiation kit (Roche, Mannhein, Ga.). Two million cells were washed twice in PBS 1 (Eurobio, Courtaboeuf, FR) and once in a buffer containing 0.05 M Tris-HCl, 0.15 M NaCl, 1 mM MgCl2, 1 mM MnCl2 and 1 mM CaCl2, pH 7.5. Cells were incubated for 1 h at room temperature with digoxigenin-labeled lectins Sambucus nigra Agglutinin (SNA) (1/1000) specific for Sia2-6Gal residues, or Maackia amurensis Agglutinin (MAA) (1/300) specific for Sia2-3Gal. Control cells were incubated without lectins. The cells were washed twice in TBS (0.05 M Tris-HCl, 0.15 M NaCl, pH 7.5) and treated with 1/40 anti-digoxigenin-fluorescein Fab Fragment (Roche) for 1 h at room temperature (in the dark). After two washes in PBS 1 (Eurobio), the cells were analyzed for green fluorescence intensity on Guava capillary cytometer.

(8) 1.3. Viruses

(9) Influenza B/Brisbane/60/08 viruses and reassortant vaccine viruses A/New Caledonia/20/99 (H1N1) IVR116, A/Vietnam/1194/04 (H5N1) rg14 and A/California/07/09 (H1N1) X179A were obtained from the NIBSC (Hertfordshire, UK). Viruses were propagated in embryonated hens' eggs (Valo Biomedia) and harvested from infected allantoic fluids.

(10) 1.4. Virus Infection

(11) Cells were seeded in 6-well plates (Corning, N.Y., US), 4 h before infection, at a density of 1.610.sup.5 cells/cm.sup.2 in the serum-free culture medium appropriate for each cell type, and in a final volume of 1 ml. Infections were performed at various multiplicities of infection (MOI) for 1 h at 35 C. Serum-free culture medium appropriate for each cell type, without serum, (2 ml) containing porcine trypsin (SIGMA-ALDRICH) was added and cells were incubated for 4 days at 35 C. in 8% CO.sub.2.

(12) 1.5. Hemagglutination Assay

(13) The HA assay was performed by serially diluting 50 l of culture supernatants 2-fold with PBS 1 (Gibco) in V-bottom plates (Corning). Subsequently, 50 l of 0.5% chicken red blood cells (Sanofi Pasteur, Alba-la-Romaine, FR) were added to each well. The plates were incubated for 1 h at 4 C. and the hemagglutination or the absence of hemagglutination was determined visually for each well.

(14) 1.6. TCID.sub.50 Assay

(15) MDCK cells were seeded in 96 well plates (Corning) at a density of 2.710.sup.6 cells/cm.sup.2 in DMEM (Gibco) supplemented with 1 g/ml porcine trypsin (SIGMA-ALDRICH). Cells were infected with 50 l of 1:10 serial viral dilutions and incubated for 4 days, at 35 C. Supernatants from these cultures were then tested in a hemagglutination assay. TCID50 titers were calculated according to the statistical method of Spearman-Karber (David John Finney, 1952, Statistical method in biological assay, Hafner editor).

(16) 1.7. Transfection Efficiency

(17) Two millions of cells were centrifuged for 10 min at 200g, resuspended in 100 l of cGMP (current good manufacturing practices) solution V (Lonza, Basel, CH) at room temperature and 10 g of pGFP (Sanofi Pasteur) plasmid were added. Nucleoporation was performed with a Nucleofector (Lonza) using different programs. Cells were incubated in 6 well plates (Corning) in the medium optimal for each cell type for 24 h at 37 C., 5% CO.sub.2. The cells were analyzed for green fluorescence intensity on Guava capillary cytometer (Millipore, Bellerica, Mass., US).

(18) 1.8. Plasmid DNA

(19) The 12 plasmids for the rescue of infectious A/PR/8/34 (H1N1) virus have previously been described by Fodor et al, 1999, J Virol, 73(11):9679-9682. The same methodology was applied with some modifications as mentioned below.

(20) The coding regions of PB2, PB1, PA and NP proteins from A/WSN/33 (H1N1) (WSN) virus were cloned into the pVAX1 plasmid (Life technology, Cergy Pontoise, FR) between the CMV promoter and the bovine growth hormone polyadenylation (BGH-polyA) sites. The pVAX1 plasmid (Life technology) was modified for viral RNA expression. Briefly, a DNA fragment, corresponding to human POL 1 promoter and hepatitis delta ribozyme sequences separated by a linker containing BbsI site for linearization, NotI and SbfI sites, was cloned into the pVAX1 plasmid and the CMV promoter and BGH-polyA site were removed. The resulting plasmid was named Universal pSP-flu.

(21) Viral RNA was extracted from infected allantoic fluid with QIAamp viral RNA mini kit (Qiagen, Courtaboeuf, FR) and the genomic cDNAs complementary to vRNAs were obtained with a Superscript III one-step RT-PCR system (Life technology) using one pair of primers containing 17 nucleotides from hepatitis delta ribozyme (5-ctgggaccatgccggcc) (SEQ ID NO:11) and 17 nucleotides and from POL 1 promoter (5-tgggccgccgggttatt) (SEQ ID NO:12) respectively.

(22) The temperature cycle parameters were 47 C. for 60 min, 94 C. for 2 min and then 40 cycles (94 C. for 15 sec, 60 C. for 30 sec and 72 C. for 2 min) and 72 C. for 5 min. Each fragment was subsequently purified with GenElute Gel extraction kit (SIGMA-ALDRICH) and cloned into the Universal pSP-flu plasmid, previously linearized by BbsI (New England Biolabs, Ipswich, Mass., US), by homologous recombination using a In Fusion HD PCR cloning kit (Clontech, Takara Bio, Saint Germain en Laye, FR). Endotoxin free plasmid DNA preparations were generated using a Nucleobond Maxi EF kit (Macherey Nagel, Dren, GE).

(23) 1.9. Reverse Genetics

(24) One million Vero and one million CHOK1 cells were mixed and centrifuged for 10 min at 200g and resuspended in 100 l of solution V (Lonza) at room temperature. A mixture of 1 g of each of the 8 vRNA expression plasmids and 0.5 g of each of the 4 protein expression plasmids was added to the cells and nucleofection was performed with the nucleofector (Lonza) using the U-023 program. Cells were incubated in 6 well plates into Ex-cell CD CHO fusion medium (SIGMA-ALDRICH) supplemented with 4 mM L-Glutamine (Gibco). After 2 h of incubation at 37 C., 5% CO.sub.2, 2 million CHOK1 cells were added in the same medium supplemented with recombinant trypsin (TryLE Select) (Gibco) and incubated on a rotating platform at 35 C., 8% CO.sub.2.

(25) 1.10. Inhibition Hemagglutination Assay (IHA)

(26) A serum specific for the HA of A/California/07/09 (H1N1) virus, purchased from the National Institute for Biological Standards and Control (NIBSC), was treated with Receptor Destroying Enzyme from Vibrio Cholera (RDE, Sigma, 10 mU/mL) for 18 h at 37 C. The RDE was inactivated at 56 C. for 1 h. The RDE-treated serum was then incubated with 5% turkey Red Blood Cells (RBC) during 2 hours at 4 C. and centrifuged for 10 min at 2000 rpm. Serial dilutions of the treated Serum was then incubated with 4HAU of the virus to be tested for 1 h at room temperature and then with 0.25% chicken RBC for 1 h at 4 C. The IHA titer is determined by the highest dilution of the serum that inhibits the hemagglutination of RBC mediated by the virus.

(27) 2. Results

(28) 2.1. Cell Growth

(29) MDCK, CHO-K1, Vero, and CEP cells were assessed first for their ability to sustain growth in the most appropriate medium for each cell type either in suspension for CHO-K1 or as adherent for the other cell types. The population doubling level (pdl) was determined for each cell type by estimating the duration necessary for one generation. As seen in Table 1, MDCK and CHO-K1 presented a shorter pdl (23 and 18 h respectively) compared to Vero (38 h), and CEP cells (48 h). It is important to note that CHO-K1 and Vero cell lines were cultivated without serum.

(30) TABLE-US-00002 TABLE 1 Population doubling level (pdl) of MDCK, CHO-K1, Vero, and CEP cells. Cell type Population doubling (hours) S.D. MDCK 23.03 3.5 CHO-K1 18.0 2.6 Vero 38.4 5.1 CEP 47.66 0.5

(31) Growth studies were performed over 6 days at 37 C. and population doubling level (pdl) was calculated by estimating the time necessary for one generation. It is calculated from the ratio T/N, wherein T is the duration of the cell culture and N is the number of cell generations calculated from the following equation Cf=Ci2.sup.N, wherein Ci and Cf are the initial and final cell concentrations respectively. Values represent the average and standard deviation (S.D.) of three independent experiments.

(32) 2.2. Influenza Receptor

(33) During infection, avian viruses as well as the egg-adapted human virus variants mainly bind to Sia2-3Gal linkage, whereas clinical isolates directly isolated from human preferentially bind to Sia2-6Gal linkage (Suzuki et al, 2011, Adv Exp Med Biol, 705:443-452).

(34) To detect the two types of influenza virus receptors on the surface of different cell types, the MAA lectin (specific for Sia2-3Gal linkage) and the SNA lectin (specific for Sia2-6Gal linkage) were used. The cells were incubated for 1 h at room temperature with digoxigenin-labeled lectins Sambucus nigra agglutinin (SNA) (specific for Sia2-6Gal) or Maackia amurensis agglutinin (MAA) (specific for Sia2-3Gal). Cells were then incubated with anti-digoxigenin-fluorescein Fab fragment and analyzed for fluorescence intensity using the Guava capillary cytometry system. Values displayed in table 2 represent the average and standard deviation (S.D.) of three independent experiments.

(35) MAA and SNA bound strongly to the surface of Vero and MDCK cells (more than 80% of cells) meaning that the two receptors (Sia2-3Gal and Sia2-6Gal) were expressed on MDCK and Vero cells (Table 2). Moreover, MAA bound to 73% of CEP cells whereas SNA only bound to 23% of CEP cells indicating that a high number of CEP cells expressed Sia2-3Gal receptor but a low number expressed Sia2-6Gal. The avian origin of CEP cells could explain why they expressed much more avian receptors than human receptors. CHO-K1 cells do not express Sia2-6Gal receptor, and only weakly Sia2-3Gal receptor.

(36) TABLE-US-00003 TABLE 2 Influenza virus receptors on MDCK, CHO-K1, Vero, and CEP cells were analyzed using a digoxigenin glycan differentiation kit. Type of Percentages of living cells Cell type lectin bound by lectins (%) S.D. MDCK MAA 93.3 3.0 SNA 96.4 3.8 CHO-K1 MAA 31.4 3.0 SNA 0.0 0.0 Vero MAA 87.2 20.2 SNA 83.3 11.1 CEP MAA 63.3 7.4 SNA 22.8 12.4

(37) 2.3. Virus Production

(38) Allantoic fluids of influenza viruses were directly put into contact with the cell line to be tested without prior adaptation. Two influenza A reassortants viruses (A/New/Caledonia/20/99 (H1N1) IVR116, and A/Vietnam/1194/04 (H5N1) rg14) and one influenza B virus (B/Brisbane/60/08 lineage B/Victoria/2/87) were tested. Various MOI (10.sup.1, 10.sup.2 and 10.sup.3) and porcine trypsin concentrations (0, 1, 2, 5 and 8 g/mL) were used. Results obtained with an MOI of 10.sup.1 and the most appropriate trypsin concentration after 3 days of infection for type A influenza viruses and after 4 days of infection for type B influenza virus are displayed for each cell type (see Tables 3 and 4).

(39) TABLE-US-00004 TABLE 3 Infections of MDCK, CHO-K1, Vero, and CEP cells with influenza A viruses. A/New Trypsin Caledonia/20/99 A/Vietnam/1194/04 Cell type concentration (H1N1) (H5N1) MDCK 1 g/ml 6.4* 3 CHO-K1 2 g/ml 7.4 3.1 Vero 2 g/ml 6.7 2.9 CEP 2 g/ml 4.4 3.1 *expressed as log.sub.10 TCID.sub.50/ml

(40) TABLE-US-00005 TABLE 4 Infections of MDCK, CHO-K1 and Vero cells with influenza B viruses. Viral titer (log.sub.10 TCID.sub.50/ml) Cell type B/Brisbane/60/08 MDCK 5 CHO-K1 4.3 Vero 4.9

(41) A/New Caledonia/20/99 (H1N1) IVR116 and A/Vietnam/1194/04 (H5N1) rg14 reassortants grew on the four cell types tested without the need of prior adaptation. Moreover, the best production of A/New Caledonia/20/99 (H1N1) IVR116 reassortant viruses was observed on CHO-K1 cells that produced the highest viral titers (>10.sup.7 TCID50). The production of A/Vietnam/1194/04 (H5N1) rg14 reassortant virus was closely the same on all cell types (approximately 10.sup.3 TCID50/mL).

(42) With respect to the production of infectious type B viruses, as shown in Table 4, B/Brisbane/60/08 virus replicated well in the three cell lines without the need of prior adaptation.

(43) 2.4. Virus Production through the Rescue of Infectious Influenza Viruses by Reverse Genetics Methods

(44) 2.4.1. Ability of the Cell Lines to be Transfected

(45) It is also important to test the capacity of the different cell types to produce viruses after transfection by a set of expression vectors able to generate infectious influenza viruses. In a first step it is important to test the ability of these different cell types to be transfected, and in particular to be transfected with material that does not involve the use of raw material of animal origin. The nucleoporation technology provided by Amaxa (Amaxa, Lonza technology) that targets the nucleus was used for the transfection of the cells, A green fluorescent protein (GFP) expression plasmid was used to assess the capacity of the different cell lines to be transfected. Cells were resuspended in V solution, incubated with pGFP plasmid and nucleoporated with the nucleofector. Different programs (U-023, A-024, V-001, T-030, L-005) were tested. Cells were then incubated for one day at 37 C. and percentage of green fluorescent cells was analysed by Guava cytometry. The Mean percentage of GFP expressing cells and standard deviation calculated from 3. Independent experiments with the optimal transfection program are displayed in Table 5.

(46) TABLE-US-00006 TABLE 5 MDCK, CHO-K1, Vero, and CEP cells susceptibility to nucleoporation. Nucleoporation % of living cells Cell type program expressing GFP S.D. MDCK A-024 71.2 26.9 CHO-K1 U-023 74.4 15.1 Vero V-001 70.9 3.4 CEP V-001 96.4 2.3

(47) More than 70% of the cells expressed the GFP which means that all the cell lines tested are transfectable by nucleoporation.

(48) 2.4.2. Optimization of the Influenza cDNA Cloning Step

(49) To be efficient, the flu vaccine, which usually contains the antigenic material derived from two type A viruses and one type B virus, must be updated every year depending on the new circulating viruses that appear and are responsible for seasonal flu or pandemic flu. Importantly, the HA and NA antigenic material must be updated so that it corresponds to that of the new circulating virus. To perform reverse genetics the HA and NA encoding genes must be cloned in the vRNA expression plasmid under the control of a POL I promoter every year or when a new circulating virus has been characterized. The other vRNA plasmids encoding the internal A/PR/8/34 vRNA and the protein expression plasmids are usually constructed only once. As the cloning step in the vRNA expression plasmid could be very tricky when reverse genetics is done on unknown HA and NA genes, a universal reverse genetics plasmid that could be used for the cloning by recombination of any influenza segments from type A and B viruses was developed. But the strict requirement for precise initiation and termination of the vRNA transcripts dramatically limits the choice of recombination regions. Thus, a new recombination cassette, not specific for the influenza genome, comprising the last 17 nucleotides of the POL 1 promoter and the first 17 nucleotides of the hepatitis delta ribozyme was used. Furthermore, 28 nucleotides, comprising BbsI to linearize the circular plasmid, NotI and SbfI sites to exclude empty plasmid were incorporated between the POL 1 promoter and the hepatitis delta ribozyme. The resulting plasmid, named Universal pSP-flu is relatively small (2202pb) and contained a kanamycin resistance gene (FIG. 2). To prepare influenza cDNA for cloning, vRNAs were reverse transcribed into cDNAs containing the recombination ends, and were cloned between the POL 1 promoter and the ribozyme. Using this improved RNA production plasmid, several genes from influenza A and B viruses were cloned by homologous recombination. The proportion of positive clones was greater than 90% for easy cloning and 30% for tough cloning with an average of 150 clones per cloning experiment.

(50) The universal pSP-flu plasmid so developed presents several improvements for easy and rapid influenza genome cloning. The recombinant cassette can be used to clone every influenza RNA fragments from type A and B virus. Secondly, as it is difficult to be sure that linearized vectors were free of empty plasmids that generate background colonies, Universal pSP-flu plasmid contains three enzymatic sites (BbsI, SbfI and NotI) that can be used to remove any residual empty plasmids after the cloning step. Linearization with BbsI enzyme, containing a cleavage point outside of the recognition site, generated cohesive ends and enabled the recircularization of plasmid.

(51) 2.4.3. Rescue of Influenza Viruses

(52) The CHO-K1 and Vero cell lines based on their good growth properties were tested for their ability to rescue infectious influenza virus by reverse genetics.

(53) Porcine trypsin generally used to rescue influenza virus by reverse genetics was replaced by a highly purified and animal origin-free enzyme (TrypLE Select) from Gibco. In a first experiment, the rescue of reassortant viruses containing HA and NA vRNA from A/WSN/33 (H1N1) virus and the six remaining viral genes (PB1, PB2, PA, NP, M and NS) from A/PR/8/34 (H1N1) virus was performed by nucleoporation of the twelve plasmids (4 plasmids allowing the expression of PB1, PB2, NA and NP mRNA under the control of human POL II promoter and 8 plasmids allowing the expression of the 8 vRNAs under the control of human POL I promoter) into Vero and/or CHO-K1. No viral particles were obtained after transfection of Vero or CHO-K1 cells alone but, when Vero cells were mixed with CHO-K1 cells, viruses were detected by hemagglutination assay in the supernatants of the cell mixture as soon as 2 days after transfection.

(54) Furthermore it was easy to visualize signs of an infection in the mixture of nucleoporated Vero/CHO-K1. Indeed, after a four days culture, the cells transfected without plasmids were clearly individualized whereas the cells transfected with the twelve plasmids and shedding viral particles in the supernatant were aggregated. Various influenza virus reassortant viruses were rescued very rapidly using this technique containing the internal backbone (PB1, PB2, PA, NP, M and NS) of the A/PR/8/34 (H1N1) virus and expressing the HA and NA proteins from different influenza viruses such as A/WSN/33 (H1N1), A/PR/8/34 (H1N1), A/NC/20/99 (H1N1) IVR116, A/Solomon Island/03/06 (H1N1) IVR145, A/Vietnam/1194/04 (H5N1) rg14, A/Brisbane/10/07 IVR-147 (H3N2), A/Uruguay/716/07 (H3N2) X175C, and AN/Wisconsin/67/05 (H3N2) X161b.

(55) Results obtained were highly reproducible from one experiment to another and most of the time optimal titers were obtained five days after transfection. For example, a reassortant virus containing the HA and NA from A/Vietnam/1194/04 (H5N1) rg14 was produced in the cell culture supernatant with a titer as high as 128 HAU/50 l after transfection of a mixture of Vero/CHOK1 using three different nucleoporation programs (U-023, U-027, F-014). Other reassortant viruses containing the HA and NA from the A/H1N1 or A/H3N2 viruses cited above reached similar titers (up to 256-512 HAU/50 l) five days after transfection. The corresponding TCID50 titers varied between 4 and 7 log10 TCID50/ml.

(56) An improved reverse genetics system is described in this study using two cell lines, namely Vero and CHO-K1 that are suitable to be used for human vaccine production. As shown by the viral infection study, several A/H1N1 and A/H5N1 viruses or reassortant viruses were easily recovered using the mixture of Vero/CHO-K1 cells. In the same way A/H3N2 viruses were also rescued demonstrating that this system can be used for the production of reassortant of any pandemic and seasonal viruses. Viruses can be recovered directly from the Vero/CHO-K1 supernatant and titrated by HAU assay as soon as two days after transfection. When the virus shall be produced at an industrial scale, for instance in the frame of a human or veterinary vaccine production, the supernatant can be used as a seed to further infect a stock of CHO-K1 cells

(57) Furthermore as it was shown in the examples, the generation of infectious influenza viruses by reverse genetics using a mixture of Vero and CHO-K1, or the production of virus by direct infection of CHO-K1 cells with an infectious viral seed does not require the use of serum and/or biological material of animal origin. The infectious influenza viruses such produced are therefore more secure since the possible contamination by adventitious agents like viruses, mycoplasma and prions no longer exists. Furthermore the lack of serum in the media used during tranfection and/or infection steps facilitates the purification process and makes easier the flu vaccine manufacturing. To our knowledge it is the first time that a totally animal free process to rescue influenza virus by reverse genetics is described.

(58) 3. Production of Chimeric Influenza Viruses by Reverse Genetics

(59) 3.1. Construction of HA and NA Chimeric Genes

(60) The chimeric constructs were assembled first in silico using the software Vector NTI. The HA chimeric gene A/California/07/09-A/PR/8/34 (H1N1) contains the non-coding regions (NCR), the signal peptide (SP), the HA2 domain, the transmembrane (TM) domain and the Cyto domain of the the A/PR/8/34 (H1N1) virus and the HA1 domain from the A/California/07/09 (H1N1) virus.

(61) The NA chimeric gene A/California/07/09-A/PR/8/34 (H1N1) contains the non-coding regions (NCR), the transmembrane (TM) domain, the Cyto domain and the stalk of the A/PR/8/34 (H1N1) virus, and the ectodomain from the A/California/07/09 (H1N1) virus.

(62) Once these sequences have been determined, the corresponding HA and HA chimeric genes were synthesized and cloned in the Universal pSP-flu plasmid.

(63) 3.2. Production of the Chimeric Influenza Virus by Reverse Genetics

(64) Production of the chimeric influenza viruses by reverse genetics was performed as described hereabove, i.e. by using four plasmids for expression of the viral proteins PB1, PB2, PA and NA, and eight plasmids for expression of the vRNAs PB1, PB2, PA, NP, NS, M, chimeric HA and chimeric NA which were introduced into the mixture of CHO-K1/Vero cells by nucleoporation as mentioned earlier. The produced viruses are bi-chimeric since they contain two chimeric genes. They contain the PB2, PA, NP, NS, and M genes from the A/PR/8/34 (H1N1) virus, the PB1 gene from the A/California/07/09 (H1N1) virus, the HA chimeric gene A/California/07/09-A/PR/8/34 (H1N1) and the NA chimeric gene A/California/07/09-A/PR/8/34 (H1N1). The A/NC/20/99 (H1N1) virus was used as positive control for each reverse genetics experiment.

(65) In a first experiment the trypsin concentration to be used was determined. Among the trypsin concentrations tested (1 to 6 USP/ml), only the trypsin concentrations of 3 and 4 USP/ml allow the production of chimeric influenza viruses (Table 6). In the subsequent experiments it was shown that a, concentration of 4 USP/ml is slightly better than 3 USP/ml since the hemagglutinin titer was slightly higher (64 HAU/50 l compared to 32 HAU/50 l).

(66) TABLE-US-00007 TABLE 6 Determination of the trypsin concentration necessary to obtain the chimeric A/California/07/09-A/PR/8/34 (H1N1) influenza virus by reverse genetics. HAU/50 l Reverse genetics experiments Day(s) after Trypsin nucleoporation N.sup.o Viruses potentially produced (USP/ml) D + 5 D + 6 D + 7 1 A/NC/20/99 (H1N1) reassortant 2 128 128 64 2 chimeric A/California/07/09- 1 <1 <1 <1 3 A/PR/8/34 (H1N1) 2 <1 <1 <1 4 3 2 16 32 5 4 4 32 64 6 5 <1 <1 <1 7 6 <1 <1 <1

(67) The production of chimeric reassortant A/California/07/09-A/PR/8/34 (H1N1) was reproducible. The chimeric virus was detectable in the cell culture supernatant from the fifth day post-nucleoporation and optimally produced at the eighth or ninth day post-nucleoporation.

(68) Mono-chimeric viruses containing either a chimeric HA gene or a chimeric NA gene were also successfully produced by reverse genetics using the chimeric HA A/California/07/09-A/PR/8/34 (H1N1) gene and the NA gene from the A/PR/8/34 (H1N1) virus or the chimeric NA A/California/07/09-A/PR/8/34 (H1N1) gene and the HA gene from the A/PR/8/34 (H1N1) virus.

(69) 3.3. Assessment of the HA Protein Antigenicity Produced by the Chimeric Virus

(70) To verify that the use of a HA chimeric gene did not alter the antigenicity of the HA protein expressed by the chimeric virus, we compared the titers obtained in the inhibtion hemagglutination assay as described in 1.10 using as tested virus either the reassortant A/California/07/09 (H1N1) virus or the bi-chimeric virus as obtained in 3.2. The higher the titers in the inhibition hemagglutination assay, the stronger was the recognition of the HA antigen by the antibody. The IHA titers obtained with the two virus tested were higher than 10240 which means that the antigenicity of the HA protein expressed by the bi-chimeric virus is well conserved and very similar or identical to that of A/California/07/09 (H1N1) reassortant.

(71) 4. Comparison of the Production of Reassortant Influenza Virus in Two Mixtures of Cells: Vero/CEF and Vero/CHO-K1 Cells

(72) One million Vero cells were resuspended in solution V (Lonza) at room temperature. A mixture of 1 g of each of the 6 vRNA expression plasmids expressing the vRNA of PB1, PB2, PA, NP, M and NS of the A/PR/8/34 (H1N1) virus, 1 g of each of the 2 vRNA expression plasmids expressing the vRNA of NA and HA of the A/Vietnam/1203/04 (H5N1) virus, and 0.5 g of each of the 4 protein expression plasmids expressing the mRNA of PB1, PB2, PA, NP of the A/PR/8/34 (H1N1) virus was added to the cells and nucleofection was performed with the nucleofector (Lonza) using the V-001 program. Cells were incubated in 6 well plates into 1.5 ml of DMEM-F12 medium (Gibco). After 2 h of incubation at 37 C., 5% CO.sub.2, one million CEF (Chicken embryo fibroblasts) cells were added in the same medium supplemented with porcine trypsin (Sigma) and incubated on a rotating platform at 35 C., 8% CO.sub.2 At regular intervals, 100 l of supernatant culture were collected in order to evaluate the viral titer with a hemagglutination assay. The results of the hemagglutination assay are presented in the Table 7 below.

(73) Five hundred thousand Vero and five hundred thousand CHO-K1 cells were mixed and were resuspended in solution V (Lonza) at room temperature. A mixture of 1 g of each of the 6 vRNA expression plasmids expressing the vRNA of PB1, PB2, PA, NP, M and NS of the A/PR/8/34 (H1N1) virus, 1 g of each of the 2 vRNA expression plasmids expressing the vRNA of NA and HA of the A/Vietnam/1203/04 (H5N1) virus, and 0.5 g of each of the 4 protein expression plasmids expressing the mRNA of PB1, PB2, PA, NP of the A/PR/8/34 (H1N1) virus was added to the cells and nucleofection was performed with the nucleofector (Lonza) using the U-023 program. Cells were incubated in 6 well plates into Ex-cell CD CHO fusion medium (SIGMA-ALDRICH) supplemented with 4 mM L-Glutamine (Gibco). After 3 h of incubation at 37 C., 5% CO.sub.2, one million CHOK1 cells were added in the same medium supplemented with porcine trypsin (Sigma) and incubated on a rotating platform at 35 C., 8% CO.sub.2 (the final concentration of trypsin being then at 2 g/ml). At regular intervals, 100 l of supernatant culture were collected in order to evaluate the viral titer with a hemagglutination assay. The results of the hemagglutination assay are presented in the Table 7 below.

(74) TABLE-US-00008 TABLE 7 Viral titer of the culture supernatant (UHA/50 l). D4 D5 D6 D7 D12 Vero/CEF <1 <1 4 32 128 Vero/CHO 32 512 64 NT NT D: Day after transfection. NT: Not tested.

(75) The results show that Vero/CHO-K1 cell system allows the production of reassortant influenza virus only four days after transfection whereas it necessitates at least 7 days for producing the same amount of reassortant influenza virus using the Vero/CEF system. The Vero/CHO-K1 cell system also allows producing a high amount of reassortant virus (512 UHA/50 l). Thus the results demontrates that the Vero/CHO-K1 cell system is more efficient than the Vero/CEF cell system for producing reassortant influenza virus.