SELECTION AND USE OF COLD-TOLERANT BACILLUS STRAINS AS BIOLOGICAL PHYTOSTIMULATORS

Abstract

The invention relates to a biological product for increasing the yield of crop plants. The invention can be used in agriculture, horticulture and plant protection. The product for stimulating the growth of crop plants is characterized by containing a cold-tolerant Bacillus strain.

Claims

1. A method of stimulating the growth of cultivated plants, comprising treating said plants with a cold-tolerant Bacillus strain.

2. The method according to claim 1, wherein the cold-tolerant Bacillus strain comprises a cold-tolerant strain of the Bacillus atrophaeus or Bacillus simplex species.

3. The method according to claim 1, wherein the cold-tolerant Bacillus strain comprises a cold-tolerant strain Bacillus atrophaeus ABI02A1 DSM 32019, ABI03 DSM 32285, or ABI05DSM 29418, or a mixture thereof.

4. The method according to claim 1, wherein the cold-tolerant Bacillus strain comprises a cold-tolerant strain Bacillus simplex ABI02S1 DSM 32020 or ABI12 DSM 32283, or a mixture thereof.

5. The method according to claim 1, wherein the cold-tolerant Bacillus strain comprises a cold-tolerant Bacillus strain comprising Bacillus atrophaeus ABI02A1 DSM 32019, ABI03 DSM 32285, or ABI05 DSM 29418, or a mixture thereof; and a cold-tolerant Bacillus strain comprising Bacillus simplex ABI02S1 DSM 32020 or ABI12 DSM 32283, or a mixture thereof.

6. The method according to claim 1, wherein the cold-tolerant Bacillus strain is formulated as a fluid spore suspension.

7. The method according to claim 1, wherein said treating comprises treating seeds during planting or treating seeds after planting.

8. The method according to claim 1, wherein the cold-tolerant Bacillus strain is formulated as a dry preparation (dry stain).

9. The method according to claim 1, wherein the cold-tolerant Bacillus strain further comprises humic acid.

10. The method according to claim 1, further comprising a mesophile plant growth promoting bacteria of the Bacillales group.

11. The method according to claim 1, further comprising a plant growth promoting fungus Trichoderma sp.

12. The method according to claim 6, wherein the fluid spore suspension comprises at least 210.sup.9 spores/ml.

13. The method according to claim 6, wherein the fluid spore suspension comprises at least 110.sup.10 spores/ml.

14. The method according to claim 7, wherein said treating is by pour administration or by spray administration.

15. The method according to claim 8, wherein the formulation comprises at least 510.sup.9 spores/ml.

16. The method according to claim 8, wherein the formulation comprises at least 210.sup.10 spores/ml.

17. The method according to claim 10, wherein said mesophile plant growth promoting bacteria of the Bacillales group comprises a Bacillus bacteria or a Paenibacillus bacteria.

18. The method according to claim 17, wherein said Bacillus bacteria comprises a Bacillus amyloliquefaciens ssp. plantarum.

Description

ILLUSTRATIVE EMBODIMENTS

Example 1: Isolation of Potential Cold-Tolerant Bacteria

[0012] Cold-tolerant bacillus strains were isolated e.g. from the uplands of the Autonomous Province of Tibet and the Alpine foothills, height 1,400 m. The Tibetan mountainous region lies at an average altitude of 4,000 m and has an annual average temperature of 10 C. Typical for this region are the large differences in temperature between day and night. The samples were either removed directly from plant roots or from the adhered earth:

[0013] 2.5 g sample material were re-suspended in 25 g of distilled water for 2 h under continuous shaking. To kill vegetative cells, the suspension was then incubated for an hour at 80 C. 10 ml of the suspension were added to 40 ml of a mineral-salt medium and incubated for one week at 20 C. until under microscopic monitoring, rod-shaped cells emerged. Then, the suspension was diluted to 10.sup.1 to 10.sup.5 and plated on minimal agar. The plates were incubated at 20 C. and the colonies formed were separated on nutrient agar or LB agar.

[0014] The taxonomic classification of the isolates was achieved by determining their 16S rRNA sequence, and with strains from the related group of subtilis through their gyrA and cheA sequence. The isolation of the chromosome DNA of exponentially growing bacillus cells, DNA amplification and sequencing was conducted in accordance with Idriss et al. 2002. Here, the following primers were used to amplify the DNA sequences using polymerase chain reaction (PCR):

TABLE-US-00002 pRB1601: 5GGATCCTAATACATGCAAGTCGAGCGG pRB1602: 5GGATCCACGTATTACCGCGGCTGCTGGC gyrFW: 5CAGTCAGGAAATGCGTACGTC gyrRV: 5CAAGGTAATGCTCCAGGCATT cheAFW: 5GAAACGGAKAYATGGMAGTBACMTCARACTGGCTG cheARV: 5TGCTCRAGACGCCCGCGGWCAATGACAAGCTCTTC

[0015] An overview of the isolates obtained and their taxonomic classification on the basis of their 16S rRNA sequence is shown in Table 2.

TABLE-US-00003 TABLE 2 DNA sequences of cold-adapted bacillus isolates from the Tibetan uplands and the Alpine foothills (altitude 1,400 m) Similarity with Strain Place of isolation 16SrRNA PGP.sup.1 Growth ABI02S1 Grass roots, B. simplex + 04-45 C. Sejila Mountain, 338/358 (94%) Nyingtri, Tibet (pRB1601) B. simplex 403/464 (87%) (pRB1602) ABI02A1 Grass roots, B. atropheus + 10-45 C. Nyingtri, Tibet 450/458 (98%) (pRB1601) B. atrophaeus 572/590 (97%) (gyrFW) B. atrophaeus 733/757 (97%) (gyrREV) ABI02P1 Namtso Lake, B. pumilus + 10-50 C. Lhasa, Tibet 457/468 (98%) (pRB1602) ABI03 Grass roots, B. atropheus + 10-45 C. Alpine foothills, 446/465 (96%) height 1,400 m (pRB1601) 474/475 (99%) B. atrophaeus 608/625 (97%) (gyrFW) (pRB1602) ABI05 Grass roots, Bacillus atrophaeus + 10-45 C. Alpine foothills, 450/458 (98%) height 1,400 m (pRB1601) 447/478 (94%) (pRB1601) ABI12 Grass roots, B. simplex + 04-45 C. Alpine foothills, 450/472 (95%) height 1,400 m (pRB1601) 461/472 (98%) (pRB1602) .sup.1PGP = plant growth promoting effect.

Example 2: Growth Characteristic of Cold-Tolerant Bacteria

[0016] The growth attempts were conducted in LB medium at different temperatures. Table 2 provides an overview of the growth behaviour of the cold-tolerant strains. The upper growth limit of B. simplex ABI02S1 and ABI12, and B. atrophaeus ABI02A1 ABI03 and ABI05 was 45 C., while B. pumilus ABI02P1 also grows at 50 C. B. atrophaeus and the mesophile B. amyloliquefaciens subsp. plantarum FZB42 were cultivated at 20 C. and 25. At these temperatures, the cold-tolerant B. atrophaeus strain had a faster growth rate than FZB42 (FIG. 1).

[0017] B. atrophaeus ABI02A1 was cultivated at different temperatures between 20 and 50 C. (FIG. 1). The growth optimum was determined at 33-35 C. At 30 C., a slight deceleration of growth speed was registered. Below 30 C., this effect was reinforced (25 C. and 20 C.). At 40 C., growth was significantly delayed. At 50 C., a lysis of the cells was also observed (FIG. 2). The results confirm that in the case of B. atrophaeus ABI02A1, this is a mesophile, but also cold-tolerant strain, which despite a growth optimum of 33-35 C. also grows well at low temperatures.

[0018] The physiologipal properties of the cold-tolerant Bacillus atrophaeus and Bacillus simplex strains are described in examples 3 and 4 below.

Example 3: Physiological Properties of Bacillus atrophaeus

[0019]

TABLE-US-00004 TABLE 3 Physiological properties of Bacillus atrophaeus ABI02A1, ABI03 and ABI05 The use of sugars Glucose + Saccharose + Lactose Maltose Fructose + Voges Proskauer + Exoenzyme formation Lipase (tributyrin) + Amylase (starch) + Protease (casein) + Keratinase (keratin) Cellulase (cellulose) Egg yoke test (lecithinase) Pigment formation + Inhibition by antibiotics (flake test) CM5 chloramphenicol + KM5 kanamycin +++ ERI erythromycin ++ Li25 lincomycin + AP100 ampicillin ++ RIF 25** rifampicin +++ SPEC 100 spectinomycin ++ Bleo1 bleomycin +

[0020] In contrast to B. amyloliquefaciens subsp. plantarum FZB42, Bacillus atrophaeus ABI02A1, ABI03 and ABI05 also grow at 10 C. At 20 C. and 25 C., ABI02A1 also has a higher growth speed than FZB42 (FIG. 2). In the agar diffusion test, ABI02A1, ABI03 and ABI05 inhibit Bacillus subtilis, Bacillus megaterium, and the phytopathogens Erwinia amylovora, Xanthomonas oryzae, Fusarium oxysporum, Rhizoctonia solani and Sclerotinia scierotiorum.

Example 4: Physiological Properties of Bacillus simplex

[0021] B. simplex ABI02S1 and ABI12 have the following physiological properties (Table 4).

TABLE-US-00005 TABLE 4 Physiological properties of ABI02S1 and ABI12 Cell form Rod, 0.9-1.0 3.0->4.0 m Endospores Ellipsoid Spore parent cell Not swollen Use of citric acid + Use of propionic acid Catalase + Nitrate reductase (NO.sub.2 from NO.sub.3) + Phenylalanin desaminase Arginin dihydrolase Indole formation Anaerobic growth Voges Proskauer (acetone formation) pH in Voges Proskauer medium 6.2 Lecithinase (egg yoke reaction) Growth at 50 C. Growth at 45 C. (+) Growth at 40 C. + Growth at pH 5.7 Growth at 2% NaCl + Growth at 5% NaCl Growth at 7% NaCl Growth at 10% NaCl Acid formation of D-glucose + Acid formation of L-arabinose + Acid formation of D-xylose + Acid formation of D-mannite + Acid formation of D-fructose + Gas of D-glucose Hydrolysis of starch + Hydrolysis of gelatine + Hydrolysis of casein + Hydrolysis of Tween 80 + Hydrolysis of aesculin (+)

[0022] The physiological properties largely confirm the assignment to Bacillus simplex, but are not typical for Bacillus simplex for all features. The analysis of the cellular fatty acids shows a typical profile for the bacillus type.

[0023] B. simplex ABI02S1 and ABI12 grow in LB medium at 10 C., a temperature at which B. amyloliquefaciens FZB42 can no longer grow. In further experiments, it was shown that these two B. simplex strains can also grow at a temperature of 4 C. The growth maximum was 45 C.

[0024] In the agar diffusion test, B. simplex had a suppressive effect on the pathogenic funghi Rhizoctonia solani and Fusarium oxysporum, and on Xanthomonas otyzae.

Example 5: Fermentation of Bacillus atrophaeus ABI02A1 and the Production of a Spore Suspension

[0025] For example, a description is given here for the production of a spore suspension for B. atrophaeus ABI02A1. The fermentation of B. atrophaeus was conducted in a conventional stirring fermenter with a base volume of 1.4 l medium under the following conditions:

[0026] Medium: Full medium with organic N and C source: Soya flour or maize steeping liquor, low fat milk powder, yeast extract, salts

[0027] Sterilisation of the medium: 20 mins. at 121 C.

[0028] Template anti-foam agent: 200 ml

[0029] Stirrer speed: 700 RPM.

[0030] Fermentation temperature: 33 C.

[0031] Ventilation: 0.7 l/min (40% O.sub.2 saturation)

[0032] pH: with NaOH set to 6.9

[0033] After 16 h, a maximum cell density of 110.sup.10 cells/ml was achieved. The culture was continued in order to achieve the most complete possible sporing of the vegetative cells. After 40 h, a spore titer of 310.sup.9 was achieved. The spores were centrifuged out and transferred to 10% of the original medium volume, under addition of propandiol (final concentration: 5%).

Example 6: Promotion of Germination of Maize Seeds Through Cold-Tolerant Bacillae

[0034] 10 ml of a bacillus spore suspension were mixed with 30 ml 1% carboxymethyl celluluse (CMC), which served as an adhesive for improved adhesion of the spores to the maize surface. The final concentration of the bacillus spores in the suspension was 1107, 1106, 1105, 1104 cfu/ml. The maize seeds were surface-disinfected with 75% ethanol, 5% NaClO for 5 mins., before they were treated with the different dilutions of the bacillus spore suspension for 5 mins. In each case, 310 seeds of a spore concentration were laid out in a petri dish with damp filter paper. The germination rate was determined after a week of dark incubation at 30 C. As a control, maize grains were used which had been treated with a sterile nutrient medium+CMC.

[0035] A clear increase in germination speed was determined with the application of B. simplex and B. atrophaeus (FIG. 4).

Example 7: Growth Experiments with Arabidopsis thaliana

[0036] The roots of a 6-day-old Arabidopsis thaliana seedling were incubated for 5 mins. in a spore suspension (10.sup.5 spores/mil) of cold-adapted bacillae. For comparison, a treatment with a spore suspension of FZB42, which is known for its growth-promoting effect, was conducted. Then, the treated seedlings were transferred to Murashige-Skoog (MS) agar (1%). The quadratic plates (1212 cm) were closed with parafilm and kept for three weeks at 23 C. (8/16 light-dark rhythm). Then, the fresh weight of the Arabidopsis plants was determined. Cold-tolerant members of the types Bacillus simplex, Bacillus atrophaeus and Bacillus pumilus showed a clear phytostimulatory effect (FIG. 5, FIG. 6).

Example 8: Potted Test with Potato Plants in a Greenhouse

[0037] The test was conducted at the test facility for potato research, Agro Nord, D-18190 Gro-Lsewitz as a potted test from 11.07.-11.10. 2011. The tubers of the potato test plant, of type Burana, was infested with symptoms of a Rhizoctonia solani attack (black scurf, pocks). The tubers were stained before planting with a diluted spore suspension of the bacillus formulae. The planting was conducted after the tubers had dried. The potatoes were harvested three months after planting. The rating of the potato plants and tubers showed a reduction of the Rhizoctonia infestation compared to the control of 40-45% with the variants treated with Bacillus pumilus ABI02P1 and Bacillus simplex ABI02S1. At the same time, a yield increase of 95% (ABI02P1) and 57% (ABI02S1) was achieved (FIG. 7). The results achieved with the use of the cold-tolerant strains are thus comparable with the results achieved with the use of FZB42. Here, it should be taken into account that the test was conducted in the summer and early autumn, when the average daytime temperatures are by no mewls optimal for the use of cold-tolerant bacteria.

Example 9: Field Test, Potatoes with B. pumilus and B. simplex

[0038] See the example below for information on the test procedure. The staining of the potato tubers with the mesophile, plant growth promoting bacterium FZB42 led to an increased yield compared to the untreated control of 14% (quantity used: 1 l spore suspension/ha). The increase in yield through staining with the cold-tolerant Bacillus pumilus ABI02P1 (quantity used: 1 l spore suspension/ha) was 6% compared to the untreated control. No increase in yield was achieved with the use of a spore suspension of the cold-tolerant Bacillus simplex ABI02S1 (FIG. 8). When interpreting the results, it should be taken into account that the test was conducted from May to September, when the average daytime temperatures are by no means optimal for the use of cold-tolerant bacteria.

Example 10: Field Test: The Use of Bacillus atrophaeus (ABI02A1) Leads to an Increase in Yield with Potatoes

[0039] The field test was conducted by Agro Nord, Prstelle fr Kartoffelforschung, 18190 Gro Lsewitz, in Sanitz (Mecklenburg-West Pomerania). Preceding crop: maize. Soil type/number IS/35, fertilisation: 140 kg N. The potato type Verdi (medium-late-late) was used. The spore suspension was applied using injection (lot injection PL1, nozzle type: Flat jet nozzles TJ 800 15). Here, the spore suspensions used (210.sup.13 spores/I) were diluted in 300 l of water before use. The staining was conducted on 05.05. 2013 in the storage building. Following successful drying of the tubers, they were planted on 06.05.2013 at a soil temperature of 15.8 C.

[0040] Climatic conditions: The month of May was too warm by 1.2 C., and too damp by 42.5 mm (79%). These were good emergence conditions for the potatoes. The month of June generally matched the average values recorded for a period of many years. However, precipitation primarily occurred in the form of heavy rain (13th=26 mm; 20th=14.3 mm; 25th=13.5 mm) approx. 74% of the precipitation total for the month. The only significant precipitation in July occurred on 3rd July with 28.4 mm; it was followed by a very long dry period, which continued until the end of August combined with too high temperatures.

[0041] The test was influenced by the occurrence of the phytopathogen, ground level fungus Rhizoctonia solani. Rhizoctonia solani J. G. Khn is the amorphous form of Thanatephorus cucumeris (A. B. Frank) Donk (teleomorph), a basidiomycete from the Agaricales family. It leads to yield losses (loss of emergence, necroses on stalks and stolons, many small or misshapen tubers) and quality losses (potato pocks, dry core symptoms). The antagonistic effect of B. atrophaeus, FZB42 and the chemical fungicide Monceren Pro was determined (FIG. 10).

[0042] The use of a spore suspension (210.sup.10 cfu/ml) of Bacillus atrophaeus (ABI02A1) in a concentration of 1.0 l/ha leads to a reduction in disease symptoms of black scurf (dry core) and an increase in yield of 10%. Thus the effect of this organic phytostimulator corresponds to that of the chemical fungicide Monceren Pro (concentration: 1.5 l/ha).

Example 11: Field Test: Confirmation: The Use of Bacillus atrophaeus (ABI02A1) Leads to an Increased Yield for Potatoes and a Reduced Infestation of Rhizoctonia solani (Kuerzinger 2014)

[0043] In a second test series (Krzinger 2014), the results of example 10 were confirmed. The effect of B. atrophaeus ABI02A1 spore suspensions was comparable with that of the chemical fungicide Monceren (FIG. 12 and FIG. 13).

LEGEND FOR THE FIGURES

[0044] FIG. 1: Comparison of the growth of B. atrophaeus ABI02A1 and the mesophile strain FZB42 at 20 C. Viand 25 C.

[0045] FIG. 2: Growth of B. atrophaeus ABI02A1 at different temperatures. The growth optimum was determined at 33-35 C.

[0046] FIG. 3: Phase contrast: Bacillus simplex ABI02S1. The distal, oval endospores are clearly visible in the non-swollen spore parent cells.

[0047] FIG. 4: Improved germination of Zea mays following incubation with B. simplex ABI02A1 (bottom row) compared to the control.

[0048] FIG. 5: Growth stimulation (in g fresh weight) of rabidopsis thaliana through spore suspensions of cold-tolerant Bacillus strains. In comparison: The effect of B. amyloliquefaciens FZB42. Control: without inoculation of Bacillus spores. The columns show the average value of three independent tests.

[0049] FIG. 6: Stimulation of root growth of Arabidopsis thaliana by B. atrophaeus ABI02A1 (upper left), and B. simplex ABI02S1 (upper right). CK=Control without inoculation with bacteria

[0050] FIG. 7: Potted test with potato plants (Kurzinger GmbH 2011). Comparison of the tuber yield with untreated control. Application of 1 l spore suspension per ha of FZB42 and B. pumilus ABI02P1. The spore suspension of B. simplex ABI02S1 showed a lower concentration by a factor of 5, and was applied in a correspondingly higher quantity (5 l/ha) to the potato plants.

[0051] FIG. 8: Application of B. pumilus ABI02P1 (1 L/ha) and B. simplex ABI02S1 to potato plants. Single application through staining with the spore suspension (FZB42 and Bacillus pumilus ABI02P1: 210.sup.10 cfu/ml, Bacillus simplex ABI02S1: 410.sup.9 cfu/ml) before planting)

[0052] FIG. 9: Randomised location map: 1 (control, no addition), 2 chemical fungicide (Monceren Pro) 1.5 l/ha), 3 FZB42 (0.5 l/ha), 4 FZB42 (1.0 l/ha), 5 FZB42 (20.5 I/ha), 8 ABI02A (1 l/ha). For each variant, four repetitions were conducted. The lot size was as follows: 6.90 m3.00 m=20.70 m.sup.2, space between rows: 75 cm, space between tubers in the row: 30 cm. Staining of the tubers in the storage building: 0.5.2013, date planted: 06.05.2013, emergence date: 02.06. 2013, harvest: 30.08.2013, treatment: 07. 10. 2013.

[0053] FIG. 10: Reduction in disease symptoms (black scurf) following application of chemical fungicides (Monoceren Pro) and organic stimulators. The use of ABI02A Bacillus atrophaeus (1.0 l/ha) leads to a considerable reduction in disease symptoms.

[0054] FIG. 11: The use of Monoceren (chemical fungicide) and spore suspensions of FZB42 and ABI02A1 (Bacillus atrophaeus) among potatoes of type Verdi (Sanitz, Krzinger 2013) leads to an increase in yield (%). Quantities used: 1.0=1.0 kg/ha.

[0055] FIG. 12: The application of Bacillus atrophaeus ABI02A1 leads to a considerable increase in yield, which can be compared to that of the chemical fungicide Monoceren. With the mesophile strain FZB42, a somewhat higher yield increase was achieved. Quantities of fungicides used: 1.5 l/ha (Monceren), 0.5 1.0 l/ha and 20.5 l/ha with spore suspensions of FZB42 and ABI02A1.

[0056] FIG. 13: At the same time, the infestation of sclerotia (Rhizoctonia solani) was reduced with the application of Bacillus atrophaeus ABI02A1 compared to the untreated control. Illustration of all infestation classes (% sclerotia infestation) with the use of Monoceren, FZB42 and B. atrophaeus. B. atrophaeus leads to a reduction in sclerotia infestation compared to the untreated control. Infestation classes: 0, <1, 1.1-5, 5.1-10, 10.1-15 and >15.

LIST OF REFERENCES

[0057] Abd El-Rahman, Fritze, D., Cathrin Sproer, C., Claus, D. 2002. Two novel psychrotolerant species, Bacillus psychrotolerans sp. nov. and Bacillus psychrodurans sp. nov., which contain ornithine in their cell walls. Int. J. Syst. Evol. Microbiol. 52, 2127-2133 [0058] Bai, Y., D'Aoust, F., Smith, D. L., Driscoll, B. T. 2002. Isolation of plant-growth-promoting Bacillus strains from soybean root nodules. Can. J. Microbiol. 48, 230-238 (2002) [0059] Barka, A. E., Nowk, J., Clement, C. 2006. Enhancement of chilling resistance of inoculated grapevine plantlets with plant growth promoting rhizobacteria Burkholderia phytofermans strain PsJN. Appl Environ Microbiol 72:7246-7252 [0060] Benhamou, N, Kloepper, J. W., Quadt-Hallman, A., Tuzun, S. 1996. Induction of defense-related ultrastructural modifications in pea root tissues inoculated with endophytic bacteria. Plant Physiol. 112, 919-929 [0061] Borriss, R. 2011. Use of plant-associated Bacillus strains as biofertilizers and biocontrol agents, In: Maheshwari D K (ed). Bacteria in agrobiology: plant growth responses. Springer, Germany, pp 41-76 [0062] Chan, W. Y., Dietel, K., Lapa, S. et al. 2013. Draft Genome Sequence of Bacillus atrophaeus UCMB-5137, a Plant Growth-Promoting Rhizobacterium. Genome Announcement 1, e00233-13 [0063] Erturk, Y., Cakmakci, R., Omur Duyar, O., Turan, M. 2011. The Effects of Plant Growth Promotion Rhizobacteria on Vegetative Growth and Leaf Nutrient Contents of Hazelnut Seedlings (Turkish hazelnut cv, Tombul and Sivri). Int. J. Soil Science, 6, 188-198. [0064] Feller, G. & Gerday C. 2003. Psychrophilic enzymes: hot topics in cold adaptation. Nature Reviews Microbiology 1, 200-208 [0065] Gulati, A., Vys, P., Rai, P., Kasana, R. C. 2009. Plant growth promoting and rhizosphere-competent Acinetobacter rhizosphaerae strain BIHB 723 from the cold deserts of the Himalayas. Curr. Microbiol. 58, 371-377 [0066] Handelsman, J., Raffel, S., Mester, E. H. et al. 1990. Biological control of damping-off of alfalfa seedlings with Bacillus-cereus UW85. Appl. Env. Microbiol. 56, 713-718 [0067] Katiyar, V., Goel, R. 2003. Solubilization of inorganic phosphate and plant growth promotion by cold tolerant mutants of Pseudomonas fluorescens. Microbiol Res 158, 163-168 [0068] Idriss, E. E., Makarewicz, O., Farouk, A. et al. 2002. Extracellular phytase activity of Bacillus amyloliquefaciens FZB45 contributes to its plant-growth-promoting effect. Microbiology 148, 2097-2109. [0069] Kaushik, R., Saxena, A. K., Tilak, K. V. B. R. 2002. Can Azospirillum strains capable of growing at a suboptimal temperature perform better in field-grown-wheat rhizosphere. Biol Fertil Soils 35, 92-95 [0070] Karlidag, H., Esitken, A., Yildrim, E. et al. 2010. Effects of plant growth promoting bacteria on yield, growth, leaf water content, membrane permeability, and ionic composition of strawberry under saline conditions. J. Plant Nutr. 34, 34-45 [0071] Krishnamurti, S., Ruckmani, A., Pukall, R., Chakrabarti, T. 2010. Psychrobacillus gen. nov. and proposal for reclassification of Bacillus insolitus Larkin & Stokes, 1967, [0072] B. psychrotolerans Abd-El Rahman et al., 2002 and B. psychrodurans Abd-El Rahman et al., 2002 as Psychrobacillus insolitus comb. nov., Psychrobacillus psychrotolerans comb. nov. and Psychrobacillus psychrodurans comb. nov. Syst. Appl. Microbiol. 33, 367-373 [0073] Kumar, P. K., Joshi, P., Bisht, J. K. et al. 2011. Cold-Tolerant Agriculturally Important Microorganisms. In: Plant Growth and Health Promoting Bacteria. Microbiology Monographs. Volume 18, 2011, pp 273-296. [0074] Lpez-Bucio, J., Campos-Cuevas, J. C., Hernndez-Caldern, E. et al. 2007. Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin- and ethylene-independent signaling mechanism in Arabidopsis thaliana. Mol. Plant Microbe Interact. 20, 207-217 [0075] Mishra, P. K., Bisht, S. C., Bisht, J. K., Bhatt, J. C. 2012. Cold-tolerant PGPRs as bioinoculants for stress management. In: Maheshwari D K (ed). Bacteria in agrobiology: Stress Management, DOI 10.1007/978-3-642-23465-1_6, # Springer-Verlag Berlin Heidelberg [0076] Nakamura, L. K. 1989. Taxonomic relationship of black-pigmented Bacillus subtilis strains and a proposal for Bacillus atrophaeus sp. nov. Int. J. Syst. Bacteriol. 39, 295-300. [0077] Prevost D, Drouin P, Laberge S, et al. 2003. Cold-adapted rhizobia for nitrogen fixation in temperate regions. Can. J. Bot. 81, 1153-1161 [0078] Schwartz, A. R., Ortiz, I., Maymon, M. et al. 2013. Bacillus simplexA little known PGPB with anti-fungal activity-alters pea legume root architecture and nodule morphology when coinculated with Rhizobium leguminosarum bv. viciae. Agronomy 3, 595-620 [0079] Selvakumar, G., Kundu, S., Joshi, P. et al. 2008a. Characterization of a cold-tolerant plant growth-promoting bacterium Pantoea dispersa 1A isolated from a sub-alpine soil in the North Western Indian Himalayas. World J. Microbiol. Biotechnol. 24, 955-960 [0080] Selvakumar, G., Mohan, M., Kundu, S. et al. 2008b. Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Lett. Appl. Microbiol. 46:171-175 [0081] Zhang, H., Prithiviraj, B., Charles, T. C. et al. 2003. Low temperature tolerant Bradyrhizobium japonicum strains allowing improved nodulation and nitrogen fixation of soybean in a short season (cool spring) area. Eur. J. Agron. 19, 205-213