Reprogramming Somatic Cells on Microcarriers
20240360420 ยท 2024-10-31
Inventors
- Steve Kah-Weng Oh (Singapore, SG)
- Shaul Reuveny (Singapore, SG)
- Tin Lun Lam (Singapore, SG)
- Jonathan Yuin Han Loh (Singapore, SG)
Cpc classification
C12N5/0696
CHEMISTRY; METALLURGY
C12N2760/18843
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed is a method of reprogramming somatic cells into induced pluripotent stem cells (iPSCs). Also disclosed is a method of producing, selecting, expanding, characterizing, and differentiating iPSCs. Further disclosed is a method of reprogramming somatic cells selected from the group consisting of fibroblasts IMR90, fibroblasts HFF-01, PBMC, CD3+ T cells and CD34+ hematopoietic stem cells (HSCs) into iPSCs.
Claims
1. A method of reprogramming somatic cells into induced pluripotent stem cells (iPSCs), comprising: (a) seeding the somatic cells on a plurality of microcarriers (MCs) to form cell-MC aggregates; and (b) transducing transcription factors into the somatic cells of the cell-MC aggregates; wherein step (a) and step (b) are carried out under continuous agitation.
2.-24. (canceled)
25. A method of producing, selecting, expanding, characterizing, and differentiating iPSCs, comprising: carrying out steps (a)-(b) of claim 1; (c) immobilizing the cell-MC aggregates into a hydrogel; (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; (f) characterizing the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs; and (g) differentiating the cells of the cell-MC aggregates toward functional cells.
26-34. (canceled)
35. A method of reprogramming somatic cells selected from the group consisting of fibroblasts IMR90, fibroblasts HFF-01, PBMC, CD3+ T cells and CD34+ hematopoietic stem cells (HSCs) into induced pluripotent stem cells (iPSCs), comprising: (a) seeding the somatic cells on a plurality of microcarriers (MCs) to form cell-MC aggregates; (b) transducing transcription factors into the somatic cells of the cell-MC aggregates using Sendai virus; (c) immobilizing the cell-MC aggregates into a hydrogel; (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; and (f) characterizing the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs; wherein step (a) and step (b) are carried out under continuous agitation; and wherein the transcription factors comprise Oct4, Sox2, c-Myc, and Klf4.
36. The method of claim 1, wherein the transcription factors comprise Oct4, Sox2 and Klf4, or wherein the transcription factors consist of Oct4, Sox2 and Klf4, or wherein the transcription factors comprise Oct4, Sox2 and Klf4 and exclude c-Myc.
37. The method of claim 36, wherein the transcription factors comprise Oct4, Sox2 and Klf4, and further comprise one or more of Nanog, c-Myc, and LIN28.
38. The method of claim 36, wherein the transcription factors comprise Oct4, Sox2 and Klf4 and exclude c-Myc, and further comprise one or more of Nanog and LIN28.
39. The method of claim 1, wherein the transduction is done via an agent selected from the group consisting of virus, protein, plasmids, PiggyBac, and small molecules, or wherein the transduction is done via a protein that is an Embryonic Stem Cell (ESC)-derived extract protein, or a Cell-Penetrating Peptide selected from the group consisting of a designed peptide, a natural protein-derived peptide, and a chimeric peptide, or wherein the transduction is done via a plasmid that is an expression plasmid comprising the complementary DNAs (cDNAs) of Oct3/4, Sox2, and Klf4, or wherein the transduction is done via a small molecule selected from the group consisting of Ascorbic acid, Valproic acid, and Sodium butyrate, or wherein the transduction is done via a virus selected from a group consisting of respirovirus, lentivirus, retrovirus, and adenovirus, or wherein the transduction is done via a respirovirus that is Sendai virus.
40. The method of claim 1, wherein the somatic cells are selected from the group consisting of human somatic cells, bovine somatic cells, and avian somatic cells, or wherein the somatic cells are selected from the group consisting of cells obtained from blood and/or bone marrow, cells obtained from skin biopsy and fibroblasts, or wherein the somatic cells are cells obtained from blood and/or bone marrow selected from the group consisting of T cells, erythroblasts, peripheral blood mononuclear cells (PBMCs) and hematopoietic stem cells (HSCs), or wherein the somatic cells are HSCs, or wherein the somatic cells are cells obtained from skin biopsy selected from the group consisting of human foreskin fibroblasts (HFF), human dermal fibroblasts and human keratinocytes, or wherein the somatic cells are human lung fibroblasts.
41. The method of claim 1, wherein the MCs are coated by extracellular matrix (ECM), or wherein the MCs are coated by ECM selected from the group consisting of laminin, vitronectin, fibronectin, heparan sulfate, and collagen.
42. The method of claim 1, wherein the MCs are selected from the group consisting of positively-charged polystyrene MCs, alginate-based MCs, dextran-based MCs, collagen-based MCs, gelatin-based MCs, acrylamide-based MCs, glass-based MCs, and biodegradable MCs, or wherein the MCs are biodegradable MCs selected from the group consisting of poly--caprolactone (PCL), Poly (lactic acid-co-glycolic acid) (PLGA) and Positively-charged Cytodex 1.
43. The method of claim 42, wherein the size of the MCs is 90-200 m.
44. The method of claim 1, further comprising: (c) immobilizing the cell-MC aggregates into a hydrogel; (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; and (f) characterizing the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs.
45. The method of claim 44, wherein: (i) the hydrogel is an agarose gel; (ii) the pluripotency marker in step (d) is selected from the group consisting of Tra-1-60 and Tra-1-81; (iii) the characterization in step (f) is selected from the group consisting of FACS analysis for pluripotency, evaluation of cell growth capacity, evaluation of multi-passage stability, karyotyping, and evaluation of in vitro tri-lineage differentiation; (iv) the differentiation in step (g) is via formation of Embryoid bodies (EBs)-like cell-MC aggregates; (v) the differentiation in step (g) is via formation of EBs-like cell-MC aggregates by continuous agitation; (vi) the step (e) is performed under continuous agitation; (vii) the step (e) is performed under continuous agitation in a stirred bioreactor system; (viii) the step (e) is performed under continuous agitation in a stirred bioreactor system comprising controlled dissolved oxygen, temperature, and pH; and/or (ix) the steps are integrated with an automated machine.
46. The method of claim 25, wherein: (i) the hydrogel is an agarose gel; (ii) the pluripotency marker in step (d) is selected from the group consisting of Tra-1-60 and Tra-1-81; (iii) the characterization in step (f) is selected from the group consisting of FACS analysis for pluripotency, evaluation of cell growth capacity, evaluation of multi-passage stability, karyotyping, and evaluation of in vitro tri-lineage differentiation; (iv) the differentiation in step (g) is via formation of Embryoid bodies (EBs)-like cell-MC aggregates; (v) the differentiation in step (g) is via formation of EBs-like cell-MC aggregates by continuous agitation; (vi) the step (e) is performed under continuous agitation; (vii) the step (e) is performed under continuous agitation in a stirred bioreactor system; (viii) the step (e) is performed under continuous agitation in a stirred bioreactor system comprising controlled dissolved oxygen, temperature, and pH; and/or (ix) the steps are integrated with an automated machine.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0027] The present disclosure will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DESCRIPTION OF EMBODIMENTS
[0045] The technology of generating induced pluripotent stem cells (iPSCs) holds great promise for revolutionizing regenerative medicine. The reprograming is conventionally done on monolayer cultures. However, this method results in low reprogramming efficiencies and require multistep handling which include enzymatically passaging to sub-culture the best clone for expansion and differentiation. In order to resolve these issues, the inventors have developed a microcarriers (MCs)-based reprogramming platform that offers automated, high-throughput, and large-scale production of induced pluripotent stem cells (iPSCs). The present disclosure also provides a technology for integration of reprogramming, expansion, and differentiation of iPSCs in a single platform.
[0046] A critical step for the entire process chain is the selection of high quality iPSCs clones in the culture dish. Frequently, selection is based on the morphology of the colonies analysed by phase contrast microscopy. The MCs platform being developed allow the sorting of the iPSCs colonies by size and are fully integrated into the automated production system.
[0047] The present disclosure describes the development of a microcarriers (MCs) platform for somatic cell reprogramming to overcome the drawbacks from conventional monolayer reprogramming approach as aforementioned.
[0048] Two MCs platform approaches can be used: (i) ReprograMC B (
[0049] Thus, in a first aspect, there is provided a method of reprogramming somatic cells into induced pluripotent stem cells (iPSCs), comprising: [0050] (a) seeding the somatic cells on a plurality of microcarriers (MCs) to form cell-MC aggregates; and [0051] (b) transducing transcription factors into the somatic cells of the cell-MC aggregates; [0052] wherein step (a) and step (b) are carried out under continuous agitation.
[0053] Cell reprogramming is the process of reverting mature, specialized cells into undifferentiated cells, such as induced pluripotent stem cells (iPSCs). It can rejuvenate somatic cells by erasing the epigenetic memories and reconstructing a new pluripotent order. The basic phases of reprogramming include: (1) transduction of reprogramming transcription factors; (2) selection of undifferentiated cell or iPSC-like colonies; (3) expansion of the selected colonies; and (4) characterization of the expanded colonies. Therefore, the term reprogramming when used in relation to cellular reprogramming as described in the present disclosure refers to the process of converting a differentiated cell (such as a somatic cell) into an undifferentiated cell. The undifferentiated cell resulting from the reprogramming may be a pluripotent cell.
[0054] The term seeding when used in relation to a cell, refers to a process of contacting a cell with a material (for example, a microcarrier) or vessel such that the cell can undergo growth and expansion. In one example, the cell can attach to the material to undergo growth and expansion. The seeding process may be achieved, for example, by using inoculating loop, inoculating needle, pipette (such as a multichannel pipette, or an automated pipetting system), or any other methods known in the art. The source of the cell for seeding can be, but is not limited to, a frozen cell, a suspension cell, or an adherent cell. The suspension cell may be any cell known in the art that are able to float freely (suspended) in a culture medium during growth and/or non-growth phases. The suspension cell may also be contacted with a material (such as a microcarrier) for growth and/or expansion. The adherent cell may be any cell known in the art that undergoes growth and/or expansion when contacted with a material (such as a microcarrier) or a surface (such as the surface of a vessel). The adherent cell may be detached from the contacting material or surface and allowed to float or suspend in the culture medium before seeding. The source of the cell may be cultured as a single-cell suspension (pure cell culture having one type of cells) or mixed suspension (with more than one type of cells) before seeding. In one example, the source of the cell is a single-cell suspension. In one example, the single-cell suspension may be prepared using suspension cells. In another example, the single-cell suspension may be prepared using adherent cells that have been detached from the contacting material or surface that the cells had previously adhered to. In one example, the cells are contacted with a vessel. The vessel can be any vessel known in the art, such as, but is not limited to, petri dish, cell culture flask, cell culture tube, or multi-well cell culture plate. In one example, the multi-well cell culture plate can be a 96-well plate, 48-well plate, 24-well plate, 12-well plate, or 6-well plate. In one example, the multi-well cell culture plate is an ultra-low attachment (ULA)-coated plate. In one example, the cells are contacted with a carrier. In one example, the carrier is a microcarrier.
[0055] The term somatic cell refers to any cell of a living organism which is not a reproductive cell or germ line cell; the germ line cell being the cells in the sexual organs that produce sperm and eggs. The somatic cell can be any somatic cell which may be obtained using standard methods known in the art, from human or other mammals. For example, the somatic cell can be, but is not limited to, fibroblast, somatic stem cell, sertoli cell, endothelial cell, neuron, pancreatic islet cell, epithelial cell, hepatocyte, hair follicle cell, keratinocyte, hematopoietic cell, melanocyte, chondrocyte, lymphocyte, erythrocyte, macrophage, monocyte, mononuclear cell, muscle cell, and combinations thereof. Somatic stem cell refers to a cell that can give rise to a family of related cells only and/or may be reprogrammed into a pluripotent cell. The somatic stem cell may include, for example, mesenchymal stem cell, neural cell, hematopoietic stem cell and skin stem cell. In one example, the somatic cells are selected from the group consisting of human somatic cells, bovine somatic cells, and avian somatic cells. In one example, the somatic cells are selected from the group consisting of cells obtained from blood and/or bone marrow, cells obtained from skin biopsy, and fibroblasts. In one example, the somatic cells are cells obtained from blood and/or bone marrow. In another example, the somatic cells are cells obtained from skin biopsy. In another example, the somatic cells are fibroblasts. In one example, the somatic cells obtained from blood and/or bone marrow are selected from the group consisting of T cells, erythroblasts, peripheral blood mononuclear cells (PBMCs) and somatic stem cells (such as hematopoietic stem cells (HSCs)). In one example, the somatic cells are hematopoietic stem cells (HSCs). HSC is a progenitor cell that can develop into all types of blood cells, including white blood cells, red blood cells, and platelets. HSCs are found in the peripheral blood, umbilical cord blood, and the bone marrow. In one example, the HSC expresses CD34. In another example, the HSC expresses CD90. In another example, the HSC expresses CD43. In another example, the HSC express CD45. In another example, the HSC expresses any combination of CD90, CD43, CD45 and CD34. In another example, the HSC expresses CD90, CD43, CD45 and CD34. In another example, the somatic cells obtained from blood and/or bone marrow are HSCs. In another example, the somatic cells obtained from skin biopsy are selected from the group consisting of human foreskin fibroblasts (HFF), human dermal fibroblasts and human keratinocytes. In another example, the fibroblasts are human lung fibroblasts. In one example, the somatic cells are adherent somatic cells. In one example, the adherent somatic cells are adherent fibroblast cells. In another example, the adherent fibroblast cells are HFF-1 cells. In another example, the adherent fibroblast cells are IMR90 cells. In one example, the somatic cells are suspension somatic cells. In another example, the suspension somatic cells are PBMCs. In another example, the suspension somatic cells are CD3+ T cells. In another example, the suspension somatic cells are CD34+ cells.
[0056] The term pluripotent cell refers to cells that can give rise to all the cell types that make up the body. Exemplary pluripotent stem cells include embryonic stem cells and iPSC. In one example, the pluripotent cell is iPSC.
[0057] The term microcarrier (MC) refers to any particulate material capable of serving as a carrier for somatic cells to support attachment, growth and/or expansion of the cells. Regardless of its shape, MC possesses high surface area which allows for the attachment, growth, and/or expansion of the cells. In one example, the MC is in the form of a bead. In one example, the MC is in the form of a disk. The MC may be spherical or non-spherical. In one example, the MC is a spherical MC. The MC may be porous or non-porous. The MC may be uncharged or charged, and charged MCs may be positively charged or negatively charged. In one example, the MCs are selected from the group consisting of positively-charged polystyrene MCs, alginate-based MCs, dextran-based MCs, collagen-based MCs, gelatin-based MCs, acrylamide-based MCs, glass-based MCs, and biodegradable MCs. In one example, the biodegradable MCs are selected from the group consisting of poly--caprolactone (PCL), Poly (lactic acid-co-glycolic acid) (PLGA) and Positively-charged Cytodex 1. In one example, the MCs are positively-charged polystyrene MCs. In one example, the MCs are coated by extracellular matrix (ECM). The coating of ECM enhances somatic cells attachment, growth and/or expansion. In one example, the ECM is selected from the group consisting of laminin, vitronectin, fibronectin, heparan sulfate, and collagen. In one example, the ECM is laminin. In one example, the ECM is Laminin521 (LN). In one example, the size of the MCs is 90-200 m. In one example, the size of the MCs is 90-190 m, or 90-180 m, or 90-170 m, or 90-160 m, or 90-150 m, or 90-140 m, or 90-130 m, or 90-120 m, or 90-110 m, or 90-100 m, or 100-190 m, or 100-180 m, or 110-170 m, or 120-160 m, or 130-150 m. In one example, the size of the MCs is about 90 m, or about 100 m, or about 110 m, or about 120 m, or about 130 m, or about 140 m, or about 150 m, or about 160 m, or about 170 m, or about 180 m, or about 190 m, or about 200 m. In one example, the size of the MCs is about 120 m. In one example, the MCs used may comprise of a single size. In another example, MCs of different sizes may also be used at the same time. For example, the MCs may comprise a mixture of two or more sizes selected from about 90 m, about 100 m, about 110 m, about 120 m, about 130 m, about 140 m, about 150 m, about 160 m, about 170 m, about 180 m, about 190 m, and about 200 m.
[0058] The term transduction or transfection refers to the introduction of foreign material, such as genetic material or transcription factors, into a cell. The transduction may be achieved via any methods known in the art and using any agents known in the art. In one example, the transduction is done via an agent selected from the group consisting of virus, protein, plasmids, PiggyBac, and small molecules. In one example, the protein is an Embryonic Stem Cell (ESC)-derived extract protein, or a Cell-Penetrating Peptide selected from the group consisting of a designed peptide, a natural protein-derived peptide, and a chimeric peptide. In one example, the plasmid is an expression plasmid comprising the complementary DNAs (cDNAs) of Oct3/4, Sox2, and Klf4. In one example, the small molecule is selected from the group consisting of Ascorbic acid, Valproic acid, and Sodium butyrate. In one example, the transduction is done via a virus. In one example, the virus is selected from a group consisting of respirovirus, lentivirus, retrovirus, and adenovirus. In one example, the respirovirus is Sendai virus.
[0059] In one example, the transduction is achieved using one or more transcription factors capable of affecting the activity or regulation of genes, for example, by increasing or reducing the expression of the genes that encode pluripotent markers. The transcription factors are involved, for example, in the process of converting or transcribing nucleic acids, such as from DNA into RNA. In one example, the transcription factors are proteins. The transcription factors may be selected from the group consisting of Oct3/4, Sox2, Klf4, Nanog, c-Myc, and LIN28. In one example, the transcription factors comprise Oct4, Sox2, Klf4, and c-Myc. In one example, the transcription factors comprise Oct4, Sox2 and Klf4. In one example, the transcription factors consist of Oct4, Sox2 and Klf4. In one example, the transcription factors exclude c-Myc. In one example, the transcription factors comprise Oct4, Sox2 and Klf4 and exclude c-Myc. In one example, the transcription factors further comprise one or more of Nanog, c-Myc, and LIN28. In one example, the transcription factors further comprise one or more of Nanog and LIN28.
[0060] Agitation is important in transduction on MCs. Agitation is applied throughout the whole transduction process, before and after the transduction. The mixing of the microcarriers by agitation allows the transducing agent to enter the cells more effectively to reprogram them. In one example, the transducing agent is a virus. In one example, the mixing of the microcarriers by agitation allows the viruses to get into the cells more effectively to reprogram them. In one example, the reprogrammed cells are firmly attached onto the laminin coated beads which stabilize their growth. In one example, the agitation is a continuous agitation. The agitation may be achieved by using any method, machine or apparatus that is known in the art. The agitation may be performed at a speed that allows optimum mixing of the microcarriers. In one example, the agitation is performed at 50-125 revolutions per minute (rpm). In one example, the agitation is performed at 50-75 rpm, or 50-80 rpm, or 50-90 rpm, 50-100 rpm, or 50-110 rpm, or 50-125 rpm, or 60-75 rpm, or 60-80 rpm, or 60-90 rpm, or 60-100 rpm, or 60-110 rpm, or 60-125 rpm, or 75-90 rpm, or 75-100 rpm, or 75-110 rpm, or 75-125 rpm, or 80-90 rpm, or 80-100 rpm, or 80-110 rpm, or 80-125 rpm, or 90-100 rpm, or 90-110 rpm, or 90-125 rpm, or 100-110 rpm, or 110-125 rpm. In one example, the agitation is performed at 75-110 rpm. In one example, the agitation is performed at 100-110 rpm. In one example, the agitation is performed at about 50 rpm, or about 60 rpm, or about 75 rpm, or about 80 rpm, or about 90 rpm, or about 100 rpm, or about 110 rpm, or about 125 rpm. In one example, the agitation is performed at about 75 rpm.
[0061] In one example, the agitation occurs in a stirred bioreactor system. In contrast to monolayer approach, MCs, which has increased cell surface area, leads to an increased yield of cells which has the ability to grow in bioreactor conditions at any stage. This means that the whole reprogramming process, from transduction to iPSC expansion, has the potential to be performed in stirred bioreactor systems, with controlled dissolved oxygen, temperature, and pH. A controllable culture environment enables control of the reproducibility and repeatability of the reprogramming run. In one example, the stirred bioreactor system comprises controlled conditions of dissolved oxygen, temperature, and pH. For example, hypoxia is known to enhance the efficiency of reprogramming; therefore performing the reprogramming process in stirred bioreactor systems enables control of the dissolved oxygen to a level (such as 5% oxygen) to improve efficiency of reprogramming.
[0062] The method of the first aspect described herein may further comprise: [0063] (c) immobilizing the cell-MC aggregates into a hydrogel; [0064] (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; [0065] (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; and [0066] (f) characterising the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs.
[0067] The progression of the reprogramming can be monitored by immobilizing the cell-MC aggregates as described in step (c) of the method disclosed herein. The term immobilize in the present disclosure refers to fixing the cell or cell-MC aggregates onto a carrier to restrict its mobility. The process of immobilization can be achieved with any methods known in the art. Examples of immobilization methods may include, but are not limited to, the use of materials such as hydrogels, which may include agarose, temperature-sensitive hydrogel and other types of hydrogels known in the art. The agarose may have high melting point or low melting point. In one example, the agarose is a low melting point agarose. In one example, the hydrogel used for immobilizing the cell-MC aggregate is an agarose gel. In one example, the hydrogel used for immobilizing the cell-MC aggregate is a 0.5% (w/v) agarose gel. In one example, the hydrogel used for immobilizing the cell-MC aggregate is a 0.5% (w/v) low melting point agarose gel. The temperature-sensitive hydrogel may be, for example, a thermoreversible hydrogel (such as thermoreversible gelation polymer (TGP)). In one example, the hydrogel used for immobilizing the cell-MC aggregate is a temperature-sensitive hydrogel. In one example, the hydrogel used for immobilizing the cell-MC aggregate is a thermoreversible hydrogel. In one example, the hydrogel used for immobilizing the cell-MC aggregate is a TGP. Immobilization of the cell-MC aggregates into hydrogel (such as 0.5% (w/v) agarose gel) enables easy monitoring the progression of cell growth. Moreover, in situ staining for the expression of pluripotent markers, such as Tra-1-60, in hydrogel culture allows easy identifying, scoring, selecting, and picking of iPSCs-like cell-MC aggregates. After immobilization, the cell-MC aggregates can be visualized using any known method known in the art. In one example, the plates containing the cell-MC aggregates can be simply visualized by microscopic observation (real-time video recording can also be used) to monitor the progression of the reprogramming.
[0068] After immobilization, cell-MC aggregates that show fast cell growth or express pluripotency markers are selected as described in step (d) of the method disclosed herein.
[0069] The term fast cell growth in the method described herein means that the size of cell-MC aggregate increases faster than other cell-MC aggregates in the same sample within a certain period, usually within 7 days. In one example, the size of cell-MC aggregate increases faster within 1 day, or 2 days, or 3 days, or 4 days, or 5 days, or 6 days, or 7 days. In one example, the size of cell-MC aggregate increases faster within 7 days. The increase in size of the fast-growing cell-MC aggregate compared to the size of the initial cell-MC aggregate is at least 2 times, or at least 3 times, or at least 4 times, or at least 5 times, or at least 6 times, or at least 7 times, or at least 8 times, or at least 9 times, or at least 10 times. In one example, the increase in size of the fast-growing cell-MC aggregate compared to the size of the initial cell-MC aggregate is at least 2 times. In one example, the increase in size of the fast-growing cell MC aggregate is at least 2 times and occurs within 7 days. In one example, there is no upper limit on the increase in size of the fast-growing cell-MC aggregate compared to the size of the initial cell-MC aggregate.
[0070] Pluripotent markers are molecular markers, such as mRNA and cell surface antigen or protein, that may be used to determine the pluripotent status of cells. The pluripotency markers can be, but is not limited to Tra-1-60, Oct4, SSEA-4, Tra-1-81, and mAb84. In one example, the pluripotency marker is selected from the group consisting of Tra-1-60 and Tra-1-81. In one example, the pluripotent marker is Tra-1-60. In one example, the pluripotency markers are Tra-1-60, Oct4 and SSEA-4.
[0071] The selected cell-MC aggregates that show fast cell growth or express the pluripotent markers are then expanded by adding fresh MCs as described in step (e) of the method disclosed herein. The term expansion refers to a process of increasing the number of cells or increasing the cell population. The process of expansion can be achieved by any method known in the art. For example, the process of expansion can be achieved by subculturing. In one example, the expansion of the selected cell-MC aggregates is achieved by sub-culturing. In one example, the sub-culturing involves the transferring of the cell-MC aggregates from the 96-well plate to a 12-well plate and then to a 6-well plate. In one example, subsequent expansion of the picked Tra-1-60.sup.+ iPSC-MC can be straightforwardly carried out by sub-culturing the Tra-1-60.sup.+ iPSC-MC aggregates from 96-well plate to 12-well plate, then 6-well plate. In one example, no enzymatic dissociation procedure is involved for sub-culturing and monitoring. In one example, fresh MCs are added from each cell-MC aggregate sub-culturing process.
[0072] The term fresh MCs refers to new MCs which have not been used in any way. In one example, the term fresh MCs refers to new MCs coated with ECM. In one example, the term fresh MCs refers to new MCs coated with ECM selected from the group consisting of laminin, vitronectin, fibronectin, heparan sulfate and collagen. In one example, the term fresh MCs refers to new laminin-coated MCs. In one example, the term fresh MCs refers to new Laminin521 (LN)-coated MCs.
[0073] The expanded cell-MC aggregates are then characterized to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs as described in step (f) of the method disclosed herein. The characterization of the cell-MC aggregates can be, but is not limited to, morphological, expression of pluripotent genes or markers, FACS analysis of pluripotency, evaluation of cell growth capacity, karyotyping, in vitro tri-lineage differentiation and any other types of cell characterization known in the art. In one example, the characterization of the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs is selected from the group consisting of FACS analysis for pluripotency, evaluation of cell growth capacity, evaluation of multi-passage stability, karyotyping, and evaluation of in vitro tri-lineage differentiation. In one example, the karyotypic is performed using a G-banding assay. In one example, characterization of the cell-MC aggregates can be done simply by sampling some of the aggregates from the well, no trypsinization is needed.
[0074] All the procedures can be integrated with an automated machine for a more high-throughput production, expansion, and differentiation system of iPSCs. In one example, the steps of the method described herein are integrated with an automated machine. The automated machine may include, but is not limited to, ClonePix from Molecular Devices and ALS CellCelector platform. In one example, the automated machine is ClonePix System from Molecular Devices. In one example, the automated machine is ClonePix FL from Molecular Devices.
[0075] In a second aspect, there is provided a method of producing, selecting, expanding, characterizing, and differentiating iPSCs, comprising: [0076] carrying out steps (a)-(b) of the first aspect; [0077] (c) immobilizing the cell-MC aggregates into a hydrogel; [0078] (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; [0079] (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; [0080] (f) characterising the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs; and [0081] (g) differentiating the cells of the cell-MC aggregates toward functional cells.
[0082] The selected, expanded and characterized cells of the cell-MC aggregates may be further differentiated towards functional cells as described in step (g) of the method disclosed herein. The differentiation may be achieved by any methods or protocols known in the art. The term functional cells refers to any type of differentiated cells in the body. For example, the differentiated cells can be, but not limited to, cardiomyocytes, neural progenitor cells, neurons, erythroblasts, HSC cells, retinal pigment epithelium, photoreceptors, beta-islet, T cells and NK cells. In one example, the differentiated cells are selected from the group consisting of cardiomyocytes, erythroblasts and HSCs. In one example, the cardiomyocytes are cTnT+ cells. In one example, the erythroblasts are DRAQ5+ cells. In one example, the HSC cells are CD34+/CD43+ cells or CD32+/CD45+ cells. In one example, the differentiation of cells of the cell-MC aggregates towards functional cells is via the formation of Embryoid bodies (EBs)-like cell-MC aggregates. In one example, the formation of EBs-like cell-MC aggregates is facilitated by continuous agitation. In one example, the formation of EBs-like cell-MC aggregates is facilitated by centrifugation. The term Embryoid bodies (EB) refers to aggregates of pluripotent cells that are induced to differentiate. Therefore, EBs-like aggregates refer to aggregates of pluripotent cells. However, they are not being induced for differentiation, but still maintain their pluripotency. In one example, the Embryoid Bodies (EBs)-likes cell-MC aggregates can be directly subjected to differentiation without any trypsinization. In one example, the differentiation of the EBs-likes cell-MC aggregates is done by simply changing the iPSCs growth medium to appropriate differentiation medium.
[0083] In a third aspect, there is provided a method of reprogramming somatic cells selected from the group consisting of fibroblasts IMR90, fibroblasts HFF-01, PBMC, CD3+ T cells and CD34+ hematopoietic stem cells (HSCs) into induced pluripotent stem cells (iPSCs), comprising: [0084] (a) seeding the somatic cells on a plurality of microcarriers (MCs) to form cell-MC aggregates; [0085] (b) transducing transcription factors into the somatic cells of the cell-MC aggregates using Sendai virus; [0086] (c) immobilizing the cell-MC aggregates into a hydrogel; [0087] (d) selecting the cell-MC aggregates showing fast cell growth or expressing pluripotency markers; [0088] (e) expanding the selected cell-MC aggregates by adding fresh MCs to the selected cell-MC aggregates; and [0089] (f) characterising the cell-MC aggregates to determine whether the somatic cells on the MCs have been reprogrammed to iPSCs;
wherein step (a) and step (b) are carried out under continuous agitation; and
wherein the transcription factors comprise Oct4, Sox2, c-Myc, and Klf4.
[0090] As used herein, the term about, in the context of concentrations of components of the formulations, typically means +/5% of the stated value, more typically +/4% of the stated value, more typically +/3% of the stated value, more typically, +/2% of the stated value, even more typically +/1% of the stated value, and even more typically +/0.5% of the stated value.
[0091] Throughout this disclosure, certain embodiments may be disclosed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosed ranges. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0092] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0093] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0094] Other embodiments are within the following claims and non-limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
EXAMPLES
[0095] Non-limiting examples of the disclosure will be further described in greater detail by reference to specific Examples, which should not be construed as in any way limiting the scope of the disclosure.
Materials and Methods
Cell Culture
[0096] Human fibroblast lines HFF-01 (ATCC SCRC-1041) and IMR-90 (ATCCCCL-186) were propagated using -MEM media containing 10% Fetal Bovine Serum (FBS) and 1% Penicillin-Streptomycin (PS) (designated as 10) in a 37 C. 5% CO.sub.2 humidified incubator. Passage 2-5 was used for reprogramming. Single cell suspension was generated by using 0.05% trypsin/0.025% EDTA (ThermoFisher Scientific).
[0097] Human frozen PBMCs were purchased from ATCC (PCS-800-011) and were cultured in PBMC medium consisting of StemPro-34 serum-free medium supplemented with stem cell factor (SCF, 100 ng/mL), flt-3 Ligand (Flt-3L; 100 ng/ml), interleukin (IL)-3 (20 ng/ml), and IL-6 (10 ng/ml; all from Peprotech) for 4 days at 37 C. in 5% CO.sub.2 incubator for cell recovery. CD3+ T-cells were isolated from the cultured PBMCs by using EasySep Human T-cells isolation kit (StemCell Technologies), according to the manufacturer's instruction. Isolated CD3+ T-cells were cultured in X-VIVO 10 medium (Lonza) supplemented with IL-2 (50IU per 106 cells; Peprotech) for 4 days at 37 C. in 5% CO.sub.2 incubator. CD34+ cells from PBMC were isolated using CD34 MicroBead Kit (Miltenyi Biotech) according to the manufacturer's protocol. Isolated CD34+ cells were expanded in StemSpanII Serum-Free Expansion Medium (SFEM) (StemCell Technologies), supplemented with Flt3, SCF, TPO (300 ng/ml each), IL-6 (100 ng/ml) and IL-3 (10 ng/ml) (all from Peprotech), for 4 days at 37 C. in 5% CO.sub.2 incubator.
Materials
[0098] CytoTune-iPS 2.0 Sendai virus Reprogramming kit was purchased from ThermoFisher Scientific. The Sendai virus encodes the four transcription factors: Oct4, Sox2, Klf4 (KOS) and c-Myc. The calculated volumes of each of the three SeV vectors (KOS, c-Myc, and Klf4) were added to the cells using a Multiplicity of Infection (MOI) of 5:5:3, respectively.
[0099] Solohill Plastic Plus (PP+) microcarriers was purchased from Sartorius. Laminin521 (LN) was bought from Biolamina. Chemically synthesized thermoreversible hydrogel (TGP) was obtained from Mebiol Inc.
Preparation of LN521-Coated MCs and Plates
[0100] Prior to the start of the experiment, Solohill PP+ MCs were prepared according to the manufacturer's instructions, including sterilization. MCs were coated with Laminin521 (LN; Biolamina) as previously described (Lam, Li et al. 2015). Briefly, MC coating was prepared by adding 20 g pf LN521 in 22.5 mg of Solohill PP+ in PBS at 4 C. overnight under rotation. The coated MCs was then designated as LN-coated MCs. Plates were coated at 0.5 g LN521 per cm.sup.2 according to manufacturer's instructions.
Sendai Virus (SeV) Reprogramming
[0101]
Reprogramming by Conventional Method in Monolayer Cultures (MNL)
[0102] Adherent HFF-1 and IMR90 fibroblasts: Transduction was done by adding 4 g polybrene (Sigma-Aldrich) and SeV vectors encoding the 4 transcription factors (Oct4, Sox2, Klf4, and c-Myc) or 3 transcription factors (Oct4, Sox2, and Klf4) to 310.sup.5 cells and maintained in a well of a 6-well tissue culture plate containing 1 ml of 10 medium. Following overnight incubation (Day 1 post-transduction), the spent medium (with SeV) was replaced with fresh 10 medium every other day for a week. Seven days after transduction (Day 7), the cells were trypsinized and plated onto a separate well in a 6-well tissue LN-coated plate. On the next day, spent medium was replaced with Essential 8 medium (E8; ThermoFisher Scientific). Medium was changed daily. Colonies with an iPSC-like appearance were thereafter manually isolated based on morphology and cultured as iPSCs on LN-coated plate with 5 ml of mTeSR 1 medium (mT; StemCell Technologies).
[0103] Suspension PBMC, CD3+ T-cells and CD34+ cells: Suspended 510.sup.5 PBMC, CD3+ T-cells or CD34+ cells were plated per well of a 24-well ULA plate in 300 l of their corresponding cell growth medium. Subsequently, the SeV vectors encoding 4 transcription factors were added and the plates were placed in a CO.sub.2 incubator overnight. Following the overnight incubation (Day 1 post-transduction), the spent medium (with SeV) was removed by centrifugation and replaced with fresh corresponding cell growth medium. Plates were placed in a CO.sub.2 incubator for 2 days. Thereafter, the cultures were treated as described above for adherent cells.
Reprogramming by Novel ReprograMC Approach in Microcarrier Cultures (MC): ReprograMC A and ReprograMC B (FIG. 1(B))
[0104] ReprograMC A (Method A,
[0105] ReprograMC B (Method B,
Live-Cell Immunofluorescence Staining of Tra-1-60 Positive Cells on MC in Hydrogel
[0106] Live-staining with StainAlive Tra-1-60 (DyLight488; Stemgent) was used to identify the onset of Tra-1-60 expression, a marker associated with pluripotency. Briefly, fresh mT media containing 5 g of StainAlive Tra-1-60 antibody was added to the hydrogel culture and incubated for 30 minutes in a 37 C. 5% CO.sub.2 incubator. After two washes with fresh warm mT medium, the Tra-1-60-stained cells in the hydrogel were analyzed using ClonePix System (Molecular Devices).
Selection and Expansion of Tra-1-60 Positive Cell-MC
[0107] Following live stains with StainAlive Tra-1-60 antibody, the positively stained cell-MC (green color) were identified and marked for picking using ClonePix System. The marked cell-MC were picked accordingly and transferred into a separate well of a 96-well ULA plate (with 200 l mT and 0.5 mg LN-coated MCs) under a stereomicroscope using 200 l pipette tips (tips were changed after each pick to avoid cross-contamination of cells). The 96-well ULA plate was then incubated in a 37 C. 5% CO.sub.2 incubator for 7 days under static conditions. On day 7, live-staining with StainAlive Tra-1-60 was performed again in the 96-well ULA plate to identify the growing pluripotent cell on MCs (in aggregates) under a fluorescence microscope. The growing and Tra-1-60+ cell-MC aggregates were selected (size increase at least 2 times that of the initial aggregate) and transferred into a separate well of a 12-well ULA plate (with 3 ml mT and 8 mg LN-coated MCs), using 1 ml pipette tips to avoid breaking down the cell-MC aggregates. The 12-well ULA plate was then incubated in a 37 C. 5% CO.sub.2 incubator for another 7 days under static conditions. After 7-days incubation, fast-growing cell-MC aggregates (size increase at least 2 times of initial aggregate plated in the 12-well ULA plate) were selected and transferred into a separate well of 6-well ULA plate (with 5 ml mT and 20 mg LN-coated MCs), using 1 ml pipette tips. The cell aggregates should break down into smaller aggregates gently by the 1 ml pipette tips. The 6-well ULA plate with cell-MC aggregates was then incubated in a 37 C. 5% CO.sub.2 incubator for another 7 days under agitation (100-110 rpm). The expanded cell-MC aggregates (MC-iPSCs) were then harvested for characterization.
Transduction and Reprogramming Efficiency
[0108] Transduction efficiency was evaluated by the expression of enhanced green fluorescent protein (GFP) using Hoechst 33342 (ThermoFisher Scientific) and propidium iodide (PI; ThermoFisher Scientific) by an image cytometry, NucleoCounter NC-3000 (ChemoMetec) according to the manufacturer's instruction. Briefly, cells were transduced with CytoTune-EmGFP Sendai Fluorescence Reporter (ThermoFisher Scientific) by MNL and ReprograMC approaches as above mentioned. After 24 hours of transduction, cells were collected and stained with 10 g/ml Hoechst 33342 for 15 minutes. PI (10 g/ml) was then added prior to loading into the Nucleocounter. Images acquired from the NucleoCounter were then quantified by the NucleoView software. In the software, cells were located using Hoechst 33342 and non-viable cells were stained with PI. The percentage of GFP expressing live cells was then calculated by the software.
[0109] Reprogramming efficiency was calculated as the number of emerging Tra-1-60+ iPSCs colonies (MNL method) or aggregates (MC methods) at Day 14 per starting cell number (Day 0).
Time Course Gene Expression Analysis
[0110] Gene expression by real-time polymerase chain reaction (RT-qPCR) was measured at multiple time points during cellular reprogramming. A set of known genes related to cellular reprogramming were examined, which included Thy1, Snail1, Snail2, CD44, Alp, -catenin, Nanog, Lin28A, Sall4, E-cadherin, EpCAM, Oct3/4, Sox2, Dppa4, Klf4, GADPH, Nodal, GDF3 and DNMT3B. Briefly, RNA was extracted from cells at different time points after transduction (days 1, 2, 3, 4, 7, 14, 21, and 28) using an RNA extraction kit (RNeasy Mini Kit; Qiagen) in accordance with the manufacturer's instructions. The RNA was reverse transcribed into cDNA using Superscript II Reverse Transcriptase (ThermoFisher Scientific). The cDNA was mixed with Power SYBR Green PCR Master Mix (ThermoFisher Scientific) and 200 nM of the specific primers of the genes listed in Table 1. The reaction was carried out on an Applied Biosystems QuantStudio 3 Real-Time PCR System using the following cycling conditions: 50 C. for 2 minutes, 95 C. for 10 minutes, following by 40 cycles of 95 C. for 15 second and 60 C. for 1 minute. Fold change of each gene was referenced against the same gene prior to reprogramming (day 0).
TABLE-US-00001 TABLE1 Listofprimersetsofgenesused,whicharecommonlyexpressedduringthe phasesofreprogramming. SEQIDNO SequenceName PrimerSequence(5-3) 1 Thy1ForwardPrimer GAAGGTCCTCTACTTATCCGCC 2 Thy1ReversePrimer TGATGCCCTCACACTTGACCAG 3 Snail1ForwardPrimer TGCCCTCAAGATGCACATCCGA 4 Snail1ReversePrimer GGGACAGGAGAAGGGCTTCTC 5 Snail2ForwardPrimer ATCTGCGGCAAGGCGTTTTCCA 6 Snail2ReversePrimer GAGCCCTCAGATTTGACCTGTC 7 CD44ForwardPrimer CCAGAAGGAACAGTGGTTTGGC 8 CD44ReversePrimer ACTGTCCTCTGGGCTTGGTGTT 9 AlpForwardPrimer CCTGATGGAGATGACAGAGGCT 10 AlpReversePrimer TCAGTGAGTGCCTGGTAAGCCA 11 beta-cateninForwardPrimer CACAAGCAGAGTGCTGAAGGTG 12 beta-cateninReversePrimer GATTCCTGAGAGTCCAAAGACAG 13 NanogForwardPrimer CTCCAACATCCTGAACCTCAGC 14 NanogReversePrimer CGTCACACCATTGCTATTCTTCG 15 Lin28AForwardPrimer CCAGTGGATGTCTTTGTGCACC 16 Lin28AReversePrimer GTGACACGGATGGATTCCAGAC 17 Sall4ForwardPrimer GAAACCACATCCTTCCAGGCAC 18 Sall4ReversePrimer GATAAACGTGGAAGGGAGACTG 19 E-cadherinForwardPrimer CCTCCTGAAAAGAGAGTGGAAG 20 E-cadherinReversePrimer TGGCAGTGTCTCTCCAAATCCG 21 EpCAMForwardPrimer GCCAGTGTACTTCAGTTGGTGC 22 EpCAMReversePrimer CCCTTCAGGTTTTGCTCTTCTCC 23 OCT3/4ForwardPrimer CCTGAAGCAGAAGAGGATCACC 24 OCT3/4ReversePrimer AAAGCGGCAGATGGTCGTTTGG 25 SOX2ForwardPrimer GCTACAGCATGATGCAGGACCA 26 SOX2ReversePrimer TCTGCGAGCTGGTCATGGAGTT 27 Dppa4ForwardPrimer CTCCACAGAGAAGTCGAGGGAA 28 Dppa4ReversePrimer GGTTGTCAGTGTGCTCTGCCTT 29 Klf4ForwardPrimer CATCTCAAGGCACACCTGCGAA 30 Klf4ReversePrimer TCGGTCGCATTTTTGGCACTGG 31 GAPDHForwardPrimer GTCTCCTCTGACTTCAACAGCG 32 GAPDHReversePrimer ACCACCCTGTTGCTGTAGCCAA 33 NodalForwardPrimer TGGCGTACATGCTGAGCCTCTA 34 NodalReversePrimer CCTCTTGTTGGCTCAGGAAGGA 35 GDF3ForwardPrimer GTCTCCCGAGACTTATGCTACG 36 GDF3ReversePrimer AGTAGAGGAGCTTCTGCAGGCA 37 DNMT3BForwardPrimer TAACAACGGCAAAGACCGAGGG 38 DNMT3BReversePrimer TCCTGCCACAAGACAAACAGCC
Characterization of Reprogrammed MC-iPSCs
Flow Cytometry
[0111] Flow cytometry analysis was performed with the extracellular antigen Tra-1-60 (Millipore), intracellular transcription factor Oct4 (R&D Systems) and stage-specific embryonic antigen-4 (SSEA-4; ThermoFisher Scientific). Briefly, MC-iPSCs cells were first trypsinized from MCs with TrypLE Express to form a single-cell suspension and then filtered through a 40-m sieve (BD Biosciences) to remove cell debris and microcarriers. For MNL-iPSCs, a single-cell suspension was obtained from monolayer culture using TrypLE Express. Thereafter, all samples were fixed and permeabilized with a Fix and Perm Cell Permeabilization reagent kit (ThermoFisher Scientific) according to the manufacturer's instructions. During the 15-minute permeabilization step, mouse primary antibodies Tra-1-60 (1:50), Oct-4 (1:20), and SSEA-4 (1:100) were incubated together with the kit's Reagent B. Cells were subsequently washed with 1% BSA/PBS, followed by 15-minute incubation in the dark with a 1:500 dilution of FITC-conjugated goat anti-mouse antibody (DAKO). Finally, cells were washed and resuspended in 1% BSA/PBS for analysis on a NovoCyte Flow Cytometer (ACEA biosciences). Results were analyzed with FlowJo software (Tree Star), with gating selected at the point of intersection between the marker and isotype control.
Spontaneous in Vitro Differentiation
[0112] Spontaneous in vitro differentiation and embryonic bodies (EBs) formation was carried out to determine whether MC-iPSC cells cultured on MCs retain their ability to differentiate into the three germ layers. Briefly, MC-iPSC aggregates were cultured as EBs for 7 days in differentiation medium [Knockout DMEM (Gibco) with 15% FBS (Gibco)] on non-adherent dishes and subsequently re-plated on 0.1% gelatinized plates for another 14 days.
[0113] Immunostaining was carried out to identify the three germ layers, with -smooth muscle actin, SMA (Sigma), -III tubulin (Millipore), and -fetoprotein, AFP (Sigma), as previously described (Lam, Li et al. 2015). Briefly, the differentiated cells were fixed with 4% paraformaldehyde for 15 minutes and blocked for 2 hours in PBS containing 0.1% Triton X-100, 10% goat serum, and 1% BSA. Cells were then probed with primary antibodies SMA (1:400), -III tubulin (1:1000), and AFP (1:250) for 1 hour and secondary FITC-conjugated antibody for another 2 hours at room temperature in dark. A fluorescent mounting medium with DAPI (Vectashield) was added to cover the cells. Following 1-hour incubation the cells were visualized with Axiovert 200M fluorescence microscope (Carl Zeiss).
[0114] The expression of three germ layers markers is analyzed by RT-qPCR. Briefly, RNA was extracted from undifferentiated and differentiated MC-iPSCs. The RNA was then reverse transcribed into cDNA and subsequently mixed with Power SYBR Green PCR Master Mix and 200 nM of the specific primers of the following genes, OCT-4, AFP, GATA6, Hand1, Nkx2.5, PAX6, SOX1, and GAPDH (housekeeping gene), as previously described (Chen, Chen et al. 2011). The PCR reaction was carried out using the following cycling conditions: 50 C. for 2 minutes, 95 C. for 10 minutes, following by 40 cycles of 95 C. for 15 second and 60 C. for 1 minute. Fold change of each gene was referenced against the same gene prior to differentiation of MC-iPSCs.
Karyotype Analysis
[0115] To assess chromosomal stability of the MC-iPSCs clones, karyotyping of all clones by G-banding assay at passage 10 (using bromodeoxyuridine/colcemid) was performed by the cytogenetics lab in Singapore General Hospital.
Cardiac Differentiation
[0116] Cardiac differentiation using a Wnt differentiation protocol was previously described (Lam, Chen et al. 2014). Briefly, aggregates (used as EBs) of 110.sup.6 MC-iPSCs on MCs were cultivated in RPMI+B27 medium without insulin (IN) supplemented with 12 M GSK3 inhibitor CHIR99021 (CHIR) (Selleckchem) and 0.6 mM of L-ascorbic acid 2-phosphate (AA) (Sigma-Aldrich, USA), followed by cultivation in RPMI+B27+IN supplemented with 2.5 M tankyrase inhibitor IWR-1 (Selleckchem, USA). Beating MC-iPSCs harvested on day 14-15 were trypsinized into single cells and subsequently subjected to flow cytometry analysis for the quantification of the expression of Troponin T (cTnT) as described above.
Erythroblast Differentiation
[0117] Erythroblast differentiation was done using a BMP4-based protocol (Sivalingam, Chen et al. 2018). Briefly, aggregates (used as EBs) of MC-iPSCs (110.sup.6 cells/mL) were cultivated in 5 ml of StemLine II Hematopoietic Stem Cell Expansion medium (SL2; Sigma-Aldrich) supplemented with BMP4 (R&D system), VEGF (Peprotech), Activin A (StemCell Technologies) and CHIR for 1 day under agitation (75 rpm). On day 2, CHIR was removed by adding fresh SL2 with BMP4, VEGF, Activin A, and -estradiol. On day 3 of differentiation, a single-cell suspension was harvested from the cell-MC aggregates using 1 TrypLE Express as described above. Single cells (2.5105 cells/ml) were then replated in SL2 supplemented with BMP4, VEGF, bFGF, SCF, IGF2 (StemCell Technologies), TPO (Peprotech), Heparin (Sigma), 3-isobutyl-1-methylxamthine (IBMX; Sigma) and -estradiol for hematopoietic induction, with medium changes every alternative day. On day 11, cells were harvested and analyzed for the expression of DRAQ5 (Deep Red Anthraquinone 5) by flow cytometry.
HSC Differentiation
[0118] HSC differentiation, using BMP4 based protocol has previously been described (Sivalingam, Chen et al. 2018), which is similar to the aforementioned erythroblasts differentiation protocol with minor modification. Briefly, differentiation was initiated in MC cultures by media change to SL2 supplemented with BMP4, VEGF, Activin A, and CHIR. Thereafter, daily medium changes to SL2 supplemented with different cytokines were carried out as described in Sivalingam's report. On day 3 of differentiation, single cells were derived from the cell-MC aggregates following treatment with TrypLE Express followed by straining the MC through 40 m cell strainers. Single cells in suspension were seeded in SL2 supplemented with BMP4, VEGF, bFGF, SCF, IGF2, TPO, Heparin, 3-isobutyl-1-methylxamthine and -estradiol for hematopoietic induction until Day 11. HSC differentiation was evaluated by the percentage of CD34+/CD43+ and CD34+/CD45+ cells.
Statistical Analysis
[0119] Unless otherwise specified, all statistical data is the result of 3 independent experimental repeats, in which numbers were collected independently at the conclusion of the experiment. All data are expressed as the meanSEM using the statistical software GraphPad Prism, version 4.1. Statistical significance was determined from at least 3 independent experiments. Comparisons of two data sets were statistically analyzed with Student's t-test. Multiple comparisons between more than three groups were performed using analysis of variance with one-way ANOVA multiple comparison tests. A p-value is shown when the difference between compared groups is significant, with p<0.01, p<0.001, p<0.001, and p<0.0001 considered levels of statistically significant differences.
Results
Example 1: Common Technique for iPSCs Reprogramming
[0120] The inventors had used human lung fibroblast IMR90 cells as example for conventional reprogramming approach on monolayer (MNL) cultures (
[0121] To confirm the pluripotency of the picked colonies, cells were trypsinized and replated on 0.1% (w/v) gelatinized plates for immunocytochemistry staining of surface marker Tra-1-60 (
Example 2: iPSC Generation by Conventional Method in MNL Cultures
[0122] Adherent fibroblasts HFF-01, IMR90, suspension PBMC, CD3+ T-cells and CD34+ cells were transduced with Sendai virus reprogramming factors using the conventional MNL method following the manufacturer's instructions (ThermoFisher Scientific), except for LN521 being used as an adhesive substrate rather than vitronectin. iPSC-like colonies (designated as MNL-iPSCs) began appearing at day 12 post-transduction. Reprogramming efficiencies of HFF-01, IMR90, PBMC, CD3+ T cells, and CD34+ cells were 0.040.02%, 0.030.001%, 0.020.004%, 0.020.0001%, and 0.0150.008%, respectively, as calculated by the number of Tra-1-60+ colonies obtained on day 14 per initial cell seeding (Table 2 &
TABLE-US-00002 TABLE 2 Summary table of transduction efficiency, reprogramming efficiency, and number of Tra-1-60+ clones per well emerged at day 14 after reprogramming. The reprogramming efficiency was calculated by dividing the number of resulting Tra-1-60+ clones at day 14 by the number of input cells and multiplying by 100%. Mean SEM. (n = 3). Transduction efficiency (%) Reprogramming efficiency (%) No. of Tra-1-60+ cells/well MC MC MC Method Method Method Method Method Method MNL A B MNL A B MNL A B HFF-01 33.4 6.3 52.7 1.7 68.4 4.6 0.04 0.02 0.84 0.1 0.97 0.003 40 4 220 10 331 30 IMR90 33.7 1.3 53.1 1.6 65.5 1.7 0.03 0.001 0.59 0.1 0.61 0.04 34 1 157 11 201 25 PBMC 59.1 5.9 N.A. 60.7 1.4 0.02 0.004 N.A. 0.97 0.1 36 2 N.A. 293 31 CD3+ 48.5 5.5 N.A. 60.5 1.4 0.02 0.001 N.A. 0.85 0.05 30 7 N.A. 257 22 T cells CD34+ 46.9 2.9 N.A. 52.9 2.6 0.015 0.008 N.A. 0.50 0.1 20 8 N.A. 131 16 cells 3F- 36.9 1.9 N.A. 69.4 6.0 0.0009 0.004 N.A. 0.15 0.03 3 1 N.A. 77 16 HFF01
[0123] Four MNL-iPSC colonies randomly isolated (
[0124] However, this is an inefficient process taking an average of 6-8 weeks before a limited number of colonies are established, and cell generation is sufficient for characterization. Technical limitations abound, such as time-consuming passaging by enzymatic cell dissociation and the difficulty of testing the differentiation efficiency in EBs culture in the mid-phase of cell line development. To overcome these challenges, the inventors had set out to design a more efficient reprogramming platform using MCs, named ReprograMC.
Example 3: MCs Based iPSCs Reprogramming (ReprogaMC)
[0125] Since somatic cells reprogramming and the subsequent verification of iPSCs pluripotency are laborious, manual processes, this is a limit to the scale and reproducibility of this process. A MCs platform for iPSCs reprogramming enabling automated, high-throughput conversion of somatic cells into iPSCs and their differentiation with minimal manual intervention is developed (
[0126] After transduction of the HFF-01, IMR90 fibroblasts, PBMC, CD3+ T-cells, and CD34+HSCs by Sendai virus expressing reprogramming factors, the transduced cells were seeded on MCs (laminin-521 coated MCs) allowing the process of reprogramming to take place (
[0127] Transduced HFF-01, IMR90, PBMC, CD3+ T-cells, and CD34+HSCs-MC (cell-MC) aggregates of the MCs cultures were then immobilized in 0.5% (w/v) agarose gel for easy aggregates monitoring, screening, and picking. After 7 days cultures, immunocytochemistry staining of surface marker Tra-1-60 was used to identify the pluripotency of all cell-MC aggregates in the hydrogel (for examples, IMR90:
[0128] After expansion on 6-well plates, samples of iPSCs-like cell-MC clones were subjected to characterization.
Example 4: Characterization of MC-iPSCs
[0129] Following ReprograMC reprogramming, 60 MC-iPSCs from 5 somatic origin: HFF-01, IMR90, PBMC, CD3+ T-cells, and CD34+ cells (12 clones of each source) were further characterized. The cells were analyzed for expression of Oct4, Tra-1-60, and SSEA-4 (
[0130] It is noteworthy that variation in gene expression levels between different samples and cell sources were observed during analysis of expression of differentiation-associated genes. For instance, all IMR90-derived MC-iPSCs expressed more germ layer markers (
[0131] To further confirm the development potential of the MC-iPSCs, a fraction of 12 HFF-01-derived MC-iPSCs and 12 IMR90-derived MC-iPSCs suspension cultures was collected and transferred to differentiation medium for cardiomyocyte differentiation following the published protocol (Lam, Chen et al. 2014). It is worth noting that although all the differentiated HFF-01-derived MC-iPSCs and IMR90-derived MC-iPSCs examined were positive for expression of the cardiomyocyte marker cTnT, both cells sources have 4 clones that exhibited lower levels of cTnT (<30%) than other aggregates (60%) (
[0132] The inventors had also compared the erythroblast differentiation potential of the 12 HFF-01-derived iPSCs and 12 IMR90-derived iPSCs following the published blood differentiation protocols (Sivalingam, Chen et al. 2018). Erythroblasts clones were functional and has oxygen carrying ability (data not shown). Although all could differentiate to erythroblasts, the erythroid potential varied between clones with 2 expressing DRAQ5 (a marker of erythroblast) to a high degree (>80%;
[0133] The inventors had also proceeded to evaluate hematopoietic progenitor cells differentiation of IMR90, T-cells, and CD34+HSC-derived iPSC-MC clones. Cells on MC were differentiated into T-Bra+ primitive streak/mesoderm (>90%) on day 1 of differentiation (
Example 5: Reprogramming by ReprograMC Approach Enhances Transduction and Reprogramming Efficiencies
[0134] Two agitated ReprograMC approaches were explored (
[0135] ReprograMC A: The inventors had attempted to reprogram HFF-01 and IMR90 fibroblasts which were initially attached and spread on the surface of MCs for 2 days in agitated cultures (
[0136] ReprograMC B: The inventors attempted to transduce cells in suspension prior to adding MCs. About 33130 Tra-1-60+ cell-MC per well were obtained with HFF-01 by day 14 using ReprograMC B (Table 2). Transduction efficiency of ReprograMC B68.44.6% was comparable to ReprograMC A52.71.7%; p=0.05. Reprogramming efficiency of ReprograMC B0.970.003% was comparable to ReprograMC A0.830.1%; p=0.05 (
[0137] After successfully reprogramming fibroblasts into a pluripotent state using ReprograMC B. the inventors attempted to reprogram suspension blood cells (PBMC, CD3+ T-cells, and CD34+ cells) into iPSCs. As above, free suspension cells were first transduced with SeV under agitation (100-110 rpm) for 1 day followed by seeding on MCs. By day 14, 29331 Tra-1-60+ cell-MC per well were obtained from PBMC, 25722 from CD3+ T cells, and 13116 from CD34+ cells, while the MNL method only gave rise to roughly 20 to 36 Tra-1-60+ colonies per well from the blood cells within the same period (Table 2). This demonstrated that ReprograMC B exhibits higher reprogramming efficiencies when compared with the MNL method (PBMC: ReprograMC B0.970.1% vs MNL0.020.004%; CD3+ T-cells: ReprograMC B0.850.05% vs MNL0.020.001%; CD34+ cells: ReprograMC B0.500.1% vs MNL0.0150.008%; overall p<0.00001,
[0138] ReprograMC A differs from ReprograMC B in that it requires the growth of the cells on MCs 2 days prior to transduction.
Example 6: MCs Promote iPSC Generation by Facilitating Gene Activation Early in Reprogramming
[0139] To understand the effect of agitated MC cultures on reprogramming progression, the inventors had performed qPCR studies on genes commonly expressed during the phases of reprogramming using cells harvested at discrete stages of reprogramming (days 0, 1, 2, 3, 4, 5, 7, 14 and 21) from both MNL and ReprograMC A & B cultures. The qPCR results for all reprogramming approaches correlate well with the known sequential molecular events in human fibroblasts: (1) Initiation phase: downregulation of the fibroblast-specific surface markers (such as Thy1 and CD44), coupled with a loss of mesenchymal cell signature (such as Snail1/2), and particularly induction of the signal transducer -catenin and Alkaline Phosphatase (Alp) (
[0140] Interestingly, the inventors had found that the ReprograMC A culture accelerated the early expression of -catenin on day 1, at least 2 days earlier than was observed in the MNL method (
[0141] In summary, the inventors have demonstrated the agitated MC-based platform, ReprograMC, for the generation of iPSCs from fibroblasts and blood cells that shows higher reprogramming efficiency compared to traditional MNL methods. The inventors had confirmed MC-iPSC clones exhibited high levels of pluripotency and maintained their differentiation potential for all three germ layers as well as the differentiation to cardiomyocytes and blood lineages.
Example 7: Expedited Derivation of 3F-MC-iPSCs (OKS) in ReprograMC Cultures
[0142] The inventors had tested ReprograMC B reprogramming with three factors: Oct4, Sox2, and Klf4 (c-Myc being eliminated) using MNL culture reprogramming as control. In comparison, while reprogramming efficiency was 0.970.003% with 4 factors, efficiency was 0.150.03% with 3 factors (
[0143] Twelve clones originated from 3 factors transduction were analyzed for expression of Oct4, Tra-1-60, and mAb84 (
Discussion
[0144] MC cultures are favorable for maintaining stem cell proliferation and differentiation, and are characterized by a high surface-to-volume ratio which allows for high density cell culture. Utilizing the full potential of MC cultures could help simplify the process of deriving and expanding iPSCs for therapeutic applications, offering a robust and scalable suspension platform for large-scale generation of clinical grade iPSCs.
[0145] The inventors had examined whether MC cultures provide a selective advantage to enhance iPSC reprogramming and selected for iPSC with efficient differentiation abilities. The inventors had demonstrated that suspension MC cultures with agitation significantly improved the reprogramming efficiency from both human adherent and suspension somatic cells. The resulting MC-iPSCs possess pluripotency and robust differentiation characteristics and display a normal karyotype. By applying this approach to somatic fibroblasts, as well as peripheral blood mononuclear cell (PBMC), CD3+ T-cells, and CD34+ hematopoietic progenitor cells, hundreds of fully reprogrammed iPSCs can be derived, providing 50-fold more clones/candidate iPSCs than conventional adherent culture methods. The resulting microcarrier-derived iPSCs (MC-iPSCs) resemble embryonic stem cells in their in vitro characteristics, including gene expression and differentiation potential. This MC reprogramming approach has the added potential to enhance other areas of iPSC research such as CRISPR edited clone selection.
[0146] The inventors had also investigated if iPSC with c-Myc elimination could still be derived at high efficiency on the MC platform.
[0147] Using a conventional monolayer process includes multiple steps of cell expansion, dissociation, phenotype evaluation, banking and finally differentiation towards target functional cells. Reprogramming cells from only a few samples from a single patient requires a full-time dedicated expert over a costly 2-3-month period. Recently, scientists have attempted to develop more efficient systems that allow for high-throughput generation of iPSCs for industrial or clinical use. However, these still rely on conventional monolayer reprogramming and selection, and are thus relatively slow, inefficient and with high demands for space and manpower. Overcoming these challenges will rapidly push the iPSC field towards safer and more scalable reprogramming methods.
[0148] In the present disclosure, the inventors have utilized an agitated MC suspension platform, ReprograMC, using 5 sources of human adherent and suspension somatic cells, to enhance the reprogramming efficiency by approximately 20- to 50-fold compared to conventional static MNL platforms (
Differential Expression of Reprogramming Related Genes Among Different Approaches
[0149] In order to reveal the main impact of agitated MC culture on reprogramming, the inventors had compared a set of known genes found in literature commonly associated with the three phases of reprogramming: initiation, maturation, and stabilization, between the static MNL culture and the agitated MC culture (Methods A and B).
[0150]
[0151] Notably, the higher expression of -catenin could also activate the canonical Wnt signaling pathway. The effects of Wnt/-catenin signaling activity on different stages of reprogramming has previously been reported with activation of Wnt signaling during the initiation phase leading to a significant improvement in reprogramming efficiency. There is evidence to suggest that mechanical stress could induce cellular reprogramming through the Wnt/-catenin signaling pathway. This may also explain the higher reprogramming efficiency without c-Myc in the agitated MC culture versus MNL approaches (
[0152] The rapid induction of Nanog, Lin28A, and Sall4 in ReprograMC cultures on day 4 (
Reprogramming of Single Cell Suspension Further Increases iPSC Generation Efficiency
[0153] Overall, the two agitated MC approaches (ReprograMC A and ReprograMC B) showed no notable differences in gene expression patterns. In human cells, the activation of E-cadherin and EpCAM, indicators of the onset of mesenchymal-to-epithelial transition (MET), only occurred at the stages of maturation of reprogramming (beyond the first 3 days of the initiation phase), where the cells acquired pluripotency with endogenous Oct4 activation.
[0154] Importantly, the inventors had demonstrated the ReprograMC approach can produce iPSCs with high differentiation potential forming all three germ layers and further demonstrated the formation of functional cardiomyocytes and erythroblasts. It is worth noting that there is variation between the differentiation efficiencies of different clones (
[0155] In conclusion, the inventors demonstrated that ReprograMC approach provide an induction advantage for enhanced iPSC generation. The technology disclosed herein has the potential to accelerate and standardize iPSC research, bringing it to clinical applications more rapidly.
[0156] To summarize, reprogramming somatic cells to pluripotent stem cells (iPSCs) by monolayer cultures is plagued by low efficiencies, high levels of manipulation and operator unpredictability during the multistep process of choosing and subculturing a limited number of clones for expansion and differentiation. The inventors have developed an all-in-one ReprograMC (Reprogramming on Microcarriers) method to solve these challenges. To produce clinically useful iPSCs, it is important to choose the correct donor cell type and the best reprogramming method. Human somatic cells, such as skin biopsy (e.g. foreskin fibroblasts) and human blood samples (e.g. erythroblasts, T-cells, and hematopoietic stem cells) are favoured cell types for the induced of pluripotency because they are from the patient own tissue, easy to obtain and easy to reprogram. Five sources of human somatic cells were reprogrammed, selected, expanded, and differentiated by the ReprograMC method. Improvement of transduction efficiencies of up to 2 times was observed using Sendai virus. Accelerated reprogramming by the ReprograMC method was 7 days faster than monolayer, providing between 20 to 50-fold more clones to choose from fibroblasts, peripheral blood mononuclear cells, T cells and CD34+ stem cells. This was observed to be due to an earlier induction of genes (-catenin, E-cadherin and EpCAM) on day 4 vs. monolayer cultures which occurred on days 14 or later. Higher expression of -catenin could activate the Wnt/-catenin pathway which is necessary during the initiation phase of reprogramming. Following that, faster induction, and earlier stabilization of pluripotency genes (Nanog, Lin28A, Sall4, Oct3/4, Sox 2 and Klf4) occurred during the maturation phase of reprogramming (after day 7) in the ReprograMC vs. monolayer method (after days 12-14). Integrated expansion and efficient differentiation to the 3 germ layers as well as to the cardiomyocyte and blood lineages was further demonstrated by the ReprograMC method. This microcarrier, suspension agitated method is also amenable to automation for processing more donor samples in a small footprint; thus, potentially alleviating the many challenges of manual monolayer selection of iPSCs.
[0157] Therefore, the present disclosure provides a novel method of iPSCs cell lines production in high numbers by employing automation, high throughput techniques and standardized protocols. The present disclosure also provides a novel microcarriers platform for parallel iPSCs generation, selection, expansion and differentiation towards functional cells (e.g. cardiomyocytes and blood). This provides a platform for large-scale in vitro iPSCs studies. The present disclosure is also the first demonstration that microcarriers technology enables the application of cell reprogramming in the development of personalized medicines. Further, the novel platform described reduces the high complexity of manual processes, which are involved in the production of iPSCs and their differentiated functional cells, in bioprocessing technology.
REFERENCES
[0158] Chen, A. K., X. Chen, et al. (2011). Critical microcarrier properties affecting the expansion of undifferentiated human embryonic stem cells. Stem cell research 7(2): 97-111. [0159] Lam, A. T., A. K. Chen, et al. (2014). Conjoint propagation and differentiation of human embryonic stem cells to cardiomyocytes in a defined microcarrier spinner culture. Stem cell research & therapy 5(5): 110. [0160] Lam, A. T., J. Li, et al. (2015). Improved Human Pluripotent Stem Cell Attachment and Spreading on Xeno-Free Laminin-521-Coated Microcarriers Results in Efficient Growth in Agitated Cultures. BioResearch open access 4(1): 242-257. [0161] Sivalingam, J., H. Y. Chen, et al. (2018). Improved erythroid differentiation of multiple human pluripotent stem cell lines in microcarrier culture by modulation of Wnt/beta-Catenin signaling. Haematologica 103(7): e279-e283.