USE OF ATTENUATED TOMATO BROWN RUGOSE FRUIT VIRUS FOR PROTECTING CROPS AGAINST SAME VIRUS
20240360467 ยท 2024-10-31
Inventors
- Aviv DOMBROVSKY (Moshav Segula, IL)
- Elisheva SMITH (Tel Aviv, IL)
- Oded LACHMAN (Petach Tikva, IL)
- Neta LURIA (Ness Ziona, IL)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to the field of agriculture and more particularly to the use of attenuated ToBRFV mutants for cross-protecting Tm-2.sup.2 resistant tomato varieties against ToBRFV infection and reducing disease symptoms. Also provided are methods of protecting agricultural crops such as tomatoes against said virus.
Claims
1. Use of -irradiated tomato brown rugose fruit virus (ToBRFV) mutants for cross-protection against same virus in Tm-2.sup.2 resistant crop plants.
2. The use of attenuated ToBRFV mutants of claim 1 for cross-protecting Tm-2.sup.2 resistant tomato varieties against ToBRFV infection and for reducing disease symptoms
3. The use of attenuated ToBRFV mutants of claim 2 for cross-protecting Tm-2.sup.2 resistant tomato varieties against ToBRFV infection and for reducing disease symptoms wherein said mutants are at least one single nucleotide (nt.) nonsynonymous mutations selected from Table 5
4. The use of attenuated ToBRFV mutants of claim 2 for cross-protect Tm-2.sup.2 resistant tomato varieties against ToBRFV and mild PepMV mixed infections and for reducing the synergistic disease symptoms.
5. The use in claim 4 of attenuated ToBRFV mutants wherein said mutants are at least one single nucleotide (nt.) nonsynonymous mutations selected from Table 5
6. The use of attenuated ToBRFV mutants of claim 3, wherein the mutations in ToBRFV small replicase unit p126 at position 748 alanine (counting the first methionine) to other amino acid that attenuates symptom development on Tm-2.sup.2 resistant tomato plants.
7. The use of attenuated ToBRFV mutants of claim 4, wherein the other amino acid is selected from alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine and valine
8. The use of attenuated ToBRFV mutants of claim 5, wherein the other amino acid is glutamic acid.
9. The use of claim 1, wherein said Tm-2.sup.2 resistant crop plants are tomatoes.
10. The use of claim 7, wherein the tomato plants are selected from Anairis, Anna Russia, Black Krim, Black Zebra, Boludo, Cherokee Purple, Danube, Ikram, Intense, Jawara, Kumato, Montenegro, Monte Rosa, Myla, Pitenza, Retinto, Roma, San Marzano, Velasco, Vernal, Ventero, Zohara, Black Cherry, Round Cherry and Yellow Cherry.
11. A method of protecting plants against ToBRFV infection, which comprises using attenuated ToBRFV strains for cross-protecting the plants against disease manifestation of ToBRFV or a synergic mixture of ToBRFV and mild PepMV isolates.
12. The method of protecting plants against ToBRFV infection of claim 9, wherein the plants are Tm-2.sup.2 resistant tomatoes.
13. The method of protecting plants against ToBRFV infection of claim 10, wherein the tomato plants are selected from Anairis, Anna Russia, Black Krim, Black Zebra, Boludo, Cherokee Purple, Danube, Ikram, Intense, Jawara, Kumato, Montenegro, Monte Rosa, Myla, Pitenza, Retinto, Roma, San Marzano, Velasco, Vernal, Ventero, Zohara, Black Cherry, Round Cherry and Yellow Cherry.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0020]
[0021]
[0022]
[0023]
[0024]
DETAILED DESCRIPTION OF THE INVENTION
[0025] The present invention provides the use of attenuated ToBRFV mutants for cross-protecting Tm-2.sup.2 resistant tomato varieties against ToBRFV infection and reducing disease symptoms. Also provided herein are methods of protecting agricultural crops such as tomatoes against said virus.
[0026] The inventors of the present invention have surprisingly uncovered that -irradiated ToBRFV mutants can serve for cross-protection against the virus in Tm-2.sup.2 resistant tomato plants. Thus, overcoming tomato disease and supplying an immediate treatment to alleviate disease symptoms may be accomplished by exposure of ToBRFV virion preparations to -irradiation at various intensities and analyzing isolated ToBRFV clones, systemically infecting tomato plants, for disease symptom alleviation and hindrance of synergistic symptom manifestations.
[0027] According to the present invention, the term agricultural crop refers to the production of field crops such as for food use including the growth of potatoes, sweet potatoes, maize or corn, soybeans, rice, wheat, oats, barley, rye and rice, vegetables such as lettuce and cabbage, fruiting vegetables such as tomatoes, eggplant and pepper, tree fruits such as citrus, peer and plum, small fruit such as berries and cherries.
[0028] According to the present invention, the term virion refers to an entire virus particle, consisting of an outer protein shell called a capsid and an inner core of nucleic acid, wherein the core confers infectivity, and the capsid provides specificity to the virus.
[0029] According to the present invention, the term Tm-2.sup.2 resistance allele refers to a resistance gene.
[0030] According to the present invention, the term rugose means wrinkled.
[0031] According to the present invention, the term dpi refers to days post inoculation.
[0032] According to the present invention, a new severe disease phenotype in Tm-2.sup.2 resistant tomato cultivars has been detected in Israel, wherein the disease cause is the pathogenic effect of synergism between ToBRFV-IL and an attenuated Israel isolate of potexvirus pepino mosaic virus (PepMV), newly occurring in Israel.
[0033] According to the present invention, ToBRFV is a single-stranded positive-sense RNA virus (+ssRNA) encapsidated in a rod like shape particles 300 nm long. The virus has a 6.2 kb genome containing the four open reading frames (ORFs) encoding two subunits of RNA-dependent RNA polymerase (RdRp) complex; a short 126 kDa protein, which is associated with RNA silencing suppression and a large 180 kDa protein; a movement protein (MP) and a 17 kDa coat protein (CP).
[0034] According to some embodiments of the present invention, several ToBRFV mutants have been identified that although systemically infected tomato plants were not permissive for symptom development and were effective in cross-protection studies against challenging with ToBRFV-IL or a mixture of ToBRFV-IL and mild PepMV-Israeli isolates.
[0035] According to some other embodiments of the present invention, sequencing of ToBRFV mutants are provided that show three non-synonymous nucleotide mutations at the RNA dependent RNA polymerase coding region.
[0036] According to an embodiment of the present invention, an easy and fast strategy is provided that may be immediately implemented to circumvent ToBRFV viral disease damages in crops worldwide.
[0037] According to the present invention, the new disease phenotype resembles the characteristics of aggressive PepMV strains showing marbled fruits as well as the severe scarred and open unripe fruits with yellowing and narrowing leaves and shoestring-like leaves that are often observed in the mixed infected plants.
[0038] According to the present invention, the Israeli isolate of PepMV alone caused a light leaf yellowing. PepMV is a single-stranded positive-sense RNA virus (+ssRNA) with filamentous particles 508 nm long. The PepMV 6.4 kb genome has five ORFs encoding the RdRp complex, triple gene block proteins and a 26 kDa CP.
[0039] According to some embodiments, primer sets for specific identification of ToBRFV using reverse transcription are provided, wherein the obtained cDNA served for PCR amplification of the whole viral genome (6000 bp) using the forward primer F-22 and the reverse primer R-CP, as detailed in Table 1 below.
TABLE-US-00001 TABLE1 Name Primer Amplicon (nt.position) Sequence(5-3) set size(bp) F-22(22) CCACAACAACAAACAACAA 1 1,550 R-1572(1,572) CTAATGCGTCTCCCGACACT F-1070(1,070) TTACAGCGCAATGGAAGATG 2 1,495 R-2565(2,565) GCCTGCTTACCCGGTACTAA F-2527(2,527) ATGGAGAGCCTCATGTCAGC 3 1,700 R-4228(4,228) AGCTGGCGTCTTCCTTGTAA F-4035(4,035) GGCCTTGCAGACGATTGTGT 4 1,570 R-5607(5,607) TGCAAGCCTTACAGACATCG F-5557(5,557) TTTAGTAGTAAAAGTGAGAAT 5 720 R-CP(6,192) GATTTAAGTGGAGGGAAAAACAC
[0040] Table 2 below includes data on local lesion induction of -irradiated purified virions of tomato brown rugose fruit virus.
TABLE-US-00002 TABLE 2 -irradiation .sup.aTobacco .sup.bNecrotic local intensity plant No. lesion No./leaf 200Gray 1 18, 15, 50 2 60, 30, 32 3 30, 11, 12 5kGray 1 70, 40, 45 2 30, 30, 20 3 30, 35, 28 10kGray 1 8, 15, 15 2 3, 3, 0 3 8, 6, 5 20kGray 1 8, 7, 3 2 2, 3, 2 3 2, 1, 0 40kGray 1 1, 1, 0 2 0, 0, 0 3 3, 1, 1 60kGray 1 2, 1, 0 2 3, 1, 0 3 2, 1, 1 .sup.aNicotiana tabacum cv. Xanthi; .sup.bData collected at 3-7 days post inoculation; Gray = -irradiation intensity dose units.
[0041] According to the present invention, as depicted in
[0042] (b) Hypersensitive response of tomato plants cv. H8009 to inoculation of several -irradiated ToBRFV clones.
[0043] According to the present invention, the -irradiation applied on the purified ToBRFV-IL virions differentially affects the viral genome of the viral preparation. Therefore, the necrotic LLs developed on N. tabacum cv. Xanthi represent clones of ToBRFV mutants differentially affected by the -irradiation treatment at each of the intensities. Multiple clones of -irradiated ToBRFV, extracted from a number of individual necrotic LLs of each intensity, were tested for systemic infection of mildly susceptible tomato plants cv. H8009.
[0044] According to the present invention, as depicted in
[0045] Furthermore, the inoculated leaves of the a-symptomatic plants that were negative in ELISA test showed necrosis, as depicted in
[0046] Various isolated -irradiated ToBRFV clones have been tested for systemic spread and symptom development in the highly susceptible tomato cv. M82 and concomitantly analyzed the efficiency of Tm-2.sup.2 resistant tomato cv. Zohara in blocking/alleviating symptom development by the mutant clones.
[0047] -irradiated ToBRFV clones, isolated after exposure of ToBRFV-IL virion preparations to increasing -irradiation intensities, showed inversely correlated systemic infection efficiency in tomato plants cv. H8009, which were tested by ELISA, as depicted in.
[0048] According to the present invention, systemic infection and symptom manifestations induced by -irradiated ToBRFV clones were studied by inoculating the highly susceptible tomato plants cv. M82 and the Tm-2.sup.2 resistant tomato plants cv. Zohara. Three groups of -irradiated ToBRFV clones were tested, which showed three different characteristics upon inoculation of the mildly susceptible tomato plants cv. H8009: [0049] (i) a-symptomatic plants that were ToBRFV-ELISA negative indicating lack of systemic infection and showed HR induced LLs; [0050] (ii) a-symptomatic plants that were ToBRFV-ELISA positive indicating systemic infection; [0051] (iii) symptomatic plants that were ToBRFV-ELISA positive indicating systemic infection.
[0052] Thus, several -irradiated ToBRFV mutants that although systemically infected Tm-2.sup.2 resistant tomato cv. Zohara did not show symptoms tested at 45 dpi as depicted in
TABLE-US-00003 TABLE 3 Inoculum Tm-2.sup.2 source - resistant irradiation Susceptible Zohara Inoculum source intensity M-82 tomato tomato characteristics identifier plants ELISA plants ELISA Tomato cv. .sup.a, b60kGray- Severe High No High H8009 systemic 13 mosaic & symptoms symptoms: No shoestring- ELISA: No like HR: Yes .sup.a, b60kGray- Severe High No High 16 mosaic symptoms 20kGray-6 Mosaic High Mosaic High (weak) & (weak) shoestring- like (weak) 20kGray-14 Severe High Mosaic High mosaic (weak) .sup.b20kGray- Severe High No High 16 mosaic & symptoms shoestring- like Tomato cv. .sup.a, b60kGray- Severe High No High H8009 systemic 8 mosaic & symptoms symptoms: No shoestring- ELISA: High like (weak) .sup.b20kGray-3 No High No Negative symptoms symptoms .sup.b20kGray- Mosaic & High No High 11 shoestring- symptoms like (weak) .sup.b20kGray- Severe High No High 15 mosaic & symptoms shoestring- like (weak) .sup.b20kGray- Shoestring- High No High 18 like symptoms 20kGray-19 Mosaic & High Mosaic High shoestring- (weak) like (medium) .sup.b10kGray-2 Mosaic & High No High shoestring- symptoms like (medium) Tomato cv. 60kGray-3 Mosaic & High Mosaic High H8009 systemic shoestring- (weak) symptoms: yes like (weak) ELISA: High .sup.a -irradiated ToBRFV clones analyzed for mutations; .sup.bB-irradiated ToBRFV clones subjected to challenging studies. HR = Hypersensitive Response.
[0053] According to some embodiments of the present invention, tobamoviruses that systemically infect tomato plants, but do not cause disease symptoms, serve for cross-protection against disease causing tobamoviruses. Selected -irradiated ToBRFV clones, which systemically infected Tm-2.sup.2 resistant tomato plants cv. Zohara, have been tested by ELISA, without symptom manifestation, as detailed in Table 3.
[0054] According to the present invention,
[0055] (a1-3) Differential symptom manifestations in susceptible M82 (plants on the left) and Tm-2.sup.2 resistant Zohara (plants on the right) tomato plants upon systemic infection with -irradiated ToBRFV clones at 45 days post-inoculation.
[0056] The depicted inoculating -irradiated ToBRFV clones were: [0057] (a1), 60kGray-8; [0058] (a2), 60kGray-13; [0059] (a3), 10kGray-2;
[0060] (b, c and d) Differential symptom manifestations observed in Tm-2.sup.2 resistant Ikram tomato plants, pre-inoculated with various -irradiated ToBRFV clones that were tested for cross-protection efficiency towards challenging with a mixture of ToBRFV-IL and mild PepMV-Israeli isolates. The depicted challenged -irradiated ToBRFV clones were: [0061] (b1, b2), 60kGray-8; [0062] (c1, c2), 20kGray-15; [0063] (d1, d2), 10kGray-2.
[0064] According to some embodiments of the present invention, tobamoviruses that systemically infect tomato plants but do not cause disease symptoms serve for cross-protection against disease causing tobamoviruses.
[0065] According to the present invention, -irradiated ToBRFV clones that systemically infected Tm-2.sup.2 resistant tomato plants cv. Zohara have been selected and tested by ELISA, without symptom manifestation, as detailed in Table 3. The selected clones were each inoculated onto 10 Tm-2.sup.2 resistant tomato plants cv. Ikram and at 10 dpi the plants were challenged with ToBRFV-IL. The challenged -irradiated ToBRFV inoculated plants did not show symptoms up to 30 days post challenging although several -irradiated ToBRFV inoculated plants showed systemic accumulation of ToBRFV, tested by ELISA, as detailed in Table 4. The plants were than subjected to a second challenging with a mixture of ToBRFV-IL and a mild PepMV-Israeli isolate or PepMV-Israeli isolate only, depending on the systemic accumulation of ToBRFV, in order to establish effectivity of cross-protection against the synergistic phenotype induced in mixed infected tomato plants.
[0066] According to the present invention, -irradiated ToBRFV clones protect Tm-2.sup.2 resistant tomato plants cv. Ikram against ToBRFV-IL disease symptom development, as detailed in Table 4 below.
TABLE-US-00004 TABLE 4 Symptom Inoculum source development at ELISA at Viral 2.sup.nd -irradiation 30 days post 30 days post challenge at 30 Inoculum source intensity ToBRFV-IL 1.sup.st ToBRFV-IL 1.sup.st days post 1.sup.st characteristics identifier challenge challenge challenge Tomato cv. H8009 60kGray -13 Negative +7/10 PepMV-Israeli systemic isolate symptoms: No 60kGray -16 Negative +6/10 *A viral mixture ELISA: No Tomato cv. H8009 60kGray -1 Negative Negative *A viral mixture systemic 60kGray -8 Negative +9/10 PepMV-Israeli symptoms: No isolate ELISA: No 20kGray -3 Negative Not tested *A viral mixture 20kGray -11 Negative Not tested PepMV-Israeli isolate 20kGray -15 Negative Negative *A viral mixture 20kGray -18 Negative Negative *A viral mixture 10kGray -2 Negative +2/10 *A viral mixture *A viral mixture contained ToBRFV-IL and a mild PepMV-Israeli isolate preparations. Symptom development inspected at 18 days post the 2.sup.nd challenging stage showed mosaic manifestations on upper leaves of the Tm-2.sup.2 resistant tomato plants cv. Ikram pre-inoculated with 10kGray-2 -irradiated ToBRFV clone whereas other challenged plants including plants pre-inoculated with 20kGray-15 and 60kGray-8 -irradiated ToBRFV clones were a-symptomatic (FIG. 3b-d).
[0067] According to some embodiments of the present invention, sequencing of -irradiated ToBRFV mutants systemically infected Tm-2.sup.2 resistant tomato plants cvs. Zohara and Ikram that block ToBRFV disease symptom development revealed non-synonymous nucleotide substitution in the p126 small replicase subunit at the non-conserved region II, position 748 alanine (counting the first methionine).
[0068] According to the present invention, one ToBRFV mutant clone, depicted in
[0069] Furthermore, A748E substitution, which changes a hydrophobic aa with a non-polar side chain to an acidic aa with an electrically charged side chain, has occurred at the p126 subunit that was implicated in RNA silencing suppression.
[0070] A similar substitution directed to the nonpolar alanine at position 747 of the tobamovirus TMV that was substituted with threonine with the electrically charged side chain has caused inactivation of the non-conserved site II activity as suppressor of RNA silencing.
[0071] Without wishing to be bound by any particular theory, it is assumed herein that these findings indicate that ToBRFV p126 has a crucial activity in symptom development on Tm-2.sup.2 resistant tomato plants.
[0072] According to some embodiments of the present invention, methods are provided of using attenuated ToBRFV strains for cross-protecting plants such as Tm-2.sup.2 resistant tomatoes against disease manifestation of ToBRFV or a synergic mixture of ToBRFV and mild PepMV isolates.
[0073] According to some embodiments of the present invention, the tomato plants are selected from Anairis, Anna Russia, Black Krim, Black Zebra, Boludo, Cherokee Purple, Danube, Ikram, Intense, Jawara, Kumato, Montenegro, Monte Rosa, Myla, Pitenza, Retinto, Roma, San Marzano, Velasco, Vernal, Ventero, Zohara, Black Cherry, Round Cherry, Yellow Cherry and the like.
EXAMPLES
[0074] The following examples further illustrate the invention but, of course, should not be construed as in any way limiting its scope.
Example 1
Preparation of -Irradiated ToBRFV Clones.
[0075] Purified ToBRFV preparation from symptomatic leaves of ToBRFV-IL inoculated tomato plants cv. Ikram, were applied on filter-paper rectangles and subjected to -irradiation using Electron Beam (E-Beam) irradiation at six different intensities, using accelerator EBLab300. Discs (4 of 0.5 cm each), isolated from each -irradiated viral preparation, were subjected to virus extraction in 200 l 10 mM sodium phosphate buffer, pH=7.0. After vortex application and centrifugation, the extractions were applied on Nicotiana tabacum cv. Xanthi plants. The third fourth and fifth leaves below the apex of each plant were inoculated and inspected for necrotic local lesion (LL) development. At 10 dpi LLs were picked, each crushed in 40l 10 mM sodium phosphate buffer, pH=7.0. Samples (20 l) were applied onto mildly susceptible tomato plants cv. H8009, one LL extract per plant. At 14 dpi inoculated tomato plants were tested for ToBRFV by ELISA.
Example 2
[0076] Study of Tm-2.sup.2 resistance efficiency against the various -irradiated ToBRFV clones.
[0077] -irradiated ToBRFV clones that were applied on tomato plants cv. H8009 showed three different characteristics: (1) a-symptomatic and ELISA negative, which showed necrosis in the inoculated leaves; (2) a-symptomatic and ELISA positive; (3) symptomatic and ELISA positive. The tomato plants cv. H8009 showed a successful hypersensitive response (HR) towards several -irradiated ToBRFV clones. The Tm-2.sup.2 resistance efficiency was tested by comparing a tomato variety harboring Tm-2.sup.2 to M82 variety which was susceptible to ToBRFV-IL. -irradiated ToBRFV clones from each of the three groups were inoculated onto the highly susceptible tomato plants cv. M82 and the Tm-2.sup.2 resistant tomato plants cv. Zohara. At 45 dpi plants were tested by ELISA and inspected for symptom development.
Example 3
[0078] Cross-protection studies using -irradiated ToBRFV clones for resistance induction against ToBRFV-IL in single infection and in a mixture of ToBRFV-IL and PepMV-Israeli isolate.
[0079] -irradiated ToBRFV clones that systemically infected Tm-2.sup.2 resistant tomato plants cv. Zohara, as tested by ELISA, but did not induce symptom development, inspected at 45 dpi, were each inoculated to 10 Tm-2.sup.2 resistant tomato plants cv. Ikram. At 10 dpi the plants were challenged by inoculation with ToBRFV-IL. At 30 days post-ToBRFV-IL challenging the plants remained a-symptomatic and were tested by ELISA. Plants that were ELISA positive for ToBRFV were subjected to a 2.sup.nd challenging assay by sap-mechanical inoculation with PepMV-Israeli isolate that was propagated on Datura stramonium plants. Plants challenged by ToBRFV-IL that were ELISA negative were subjected to a 2.sup.nd challenging assay by inoculation with a mixture of ToBRFV-IL and PepMV-Israeli isolate preparations.
Example 4
Viral Purification, RT-PCR and Sequencing of -Irradiated ToBRFV Clones.
[0080] Leaf samples of inoculated tomato plants were ground in general extraction buffer. The Accuprep Viral RNA Extraction kit was used for viral RNA extraction. For reverse transcription (RT), the qPCRBIO cDNA synthesis kit was used. The obtained cDNA served for PCR amplification of the whole viral genome (6000 bp) using the forward primer F-22 and the reverse primer R-CP, as detailed in Table 1. For genome walking sequencing 5 designed primer sets were used for segment amplification and the obtained amplicons were sequenced. The authenticity of each amplified genome segment was confirmed using the Basic Local Alignment Search Tool (BLAST) search algorithm against the National Center for Biotechnology Information (NCBI) GenBank (https://blast.ncbi.nlm.nih.gov/Blast.cg) and alignment of the deduced amino acid sequence was performed using SnapGene software.
[0081] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.
[0082] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including, and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0083] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of those preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.