ATTENUATION METHOD OF INFLUENZA VIRUS, ATTENUATED INFLUENZA VIRUS STRAIN, AND USE THEREOF

Abstract

The present disclosure relates to an attenuation method of an influenza virus, an attenuated influenza virus strain, and the use thereof, and belongs to the technical field of biomedicine. The attenuation method of the present disclosure includes the following step: deleting a random number of bases at a random position for a transmembrane domain and a cytoplasmic domain of an M2 protein in a conserved region of the influenza virus to obtain an attenuated influenza virus with a corresponding base deletion. An attenuated influenza virus strain prepared by the attenuation method of the present disclosure exhibits prominent growth characteristics on an M2 protein-expressing MDCK cell line; and the virus strain at a high dose can grow in an MDCK cell or a chicken embryo and has a high agglutination titer of chicken red blood cells (CRBCs). Results of intranasal immunization of Balb/C mice show that the virus strain is non-pathogenic to mice compared with the parental virus IAV PR8. The random base deletion of the present disclosure reduces the virulence of the influenza virus and lays a foundation for the screening of safe and effective influenza A virus (IAV) live-attenuated vaccines.

Claims

1. An attenuation method of an influenza virus, comprising the following step: deleting a random number of bases at a random position for a transmembrane domain and a cytoplasmic domain of an M2 protein in a conserved region of the influenza virus to obtain an attenuated influenza virus with a corresponding base deletion.

2. The attenuation method according to claim 1, wherein the influenza virus comprises A/Puerto Rico/8/1934.

3. The attenuation method according to claim 1, wherein the deleting a random number of bases at a random position refers to one selected from the group consisting of (a) to (f): (a) deleting 14 bases from position 73 to position 86 of a coding region for the M2 protein; (b) deleting 20 bases from position 87 to position 106 of a coding region for the M2 protein; (c) deleting 22 bases from position 130 to position 151 of a coding region for the M2 protein; (d) deleting 38 bases from position 152 to position 189 of a coding region for the M2 protein; (e) deleting 65 bases from position 87 to position 151 of a coding region for the M2 protein; and (f) deleting 103 bases from position 87 to position 189 of a coding region for the M2 protein.

4. An attenuated influenza virus strain prepared by the attenuation method according to any one of claims 1 to 3.

5. The attenuated influenza virus strain according to claim 4, wherein a coding region for an M2 protein of the attenuated influenza virus strain has a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

6. A group of plasmids for constructing an attenuated influenza virus strain, wherein the plasmids comprise nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

7. The group of plasmids according to claim 6, wherein a basal plasmid for constructing the plasmids comprises a nucleotide sequence shown in SEQ ID NO: 7.

8. Primers for constructing the plasmids according to claim 6 or 7, wherein the primers have nucleotide sequences shown in SEQ ID NOS: 8-19.

9. A use of the attenuation method according to any one of claims 1 to 3, the attenuated influenza virus strain according to claim 4 or 5, the plasmids according to claim 6 or 7, or the primers according to claim 8 in the preparation of a live-attenuated influenza vaccine.

10. A use of the attenuated influenza virus strain according to claim 4 or 5 in the prevention of influenza A (IA).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0027] FIG. 1 shows agarose gel electrophoresis results of the extracted plasmids PR8-M2-del14, PR8-M2-del20, PR8-M2-del22, PR8-M2-del38, PR8-M2-del65, and PR8-M2-del103 according to the present disclosure;

[0028] FIG. 2 shows agarose gel electrophoresis results of the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 identified by RT-PCR according to the present disclosure;

[0029] FIG. 3 shows growth curves of the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 according to the present disclosure;

[0030] FIG. 4 shows cytopathic effects (CPEs) of MDCK cells infected with the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 for 72 h at different multiplicities of infection (MOIs) according to the present disclosure;

[0031] FIG. 5 shows agglutination titers of MDCK cells infected with the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 for 72 h at different MOIs according to the present disclosure;

[0032] FIG. 6 shows body weight changes of mice within 14 d after immunization with the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 according to the present disclosure; and

[0033] FIG. 7 shows body weight changes of mice within 10 d after the attack of the virus IAV PR8.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0034] The present disclosure provides an attenuation method of an influenza virus, including the following step: deleting a random number of bases at a random position for a transmembrane domain and a cytoplasmic domain of an M2 protein in a conserved region of the influenza virus to obtain an attenuated influenza virus with a corresponding base deletion.

[0035] In the present disclosure, a reverse genetic system is preferentially used to generate a series of random base deletions for a transmembrane domain (TM) and a cytoplasmic domain (CT), and the toxicity of a virus with a random deletion is evaluated, which can facilitate the acquisition of a safe and effective IAV live-attenuated vaccine.

[0036] In the present disclosure, a parental virus targeted by the attenuation method preferably includes A/Puerto Rico/8/1934 (abbreviated IAV PR8).

[0037] In the present disclosure, the deleting a random number of bases at a random position preferably refers to one selected from the group consisting of (a) to (f): [0038] (a) deleting 14 bases from position 73 to position 86 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 1; [0039] (b) deleting 20 bases from position 87 to position 106 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 2; [0040] (c) deleting 22 bases from position 130 to position 151 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 3; [0041] (d) deleting 38 bases from position 152 to position 189 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 4; [0042] (e) deleting 65 bases from position 87 to position 151 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 5; and [0043] (f) deleting 103 bases from position 87 to position 189 of a coding region for the M2 protein, where the coding region has a nucleotide sequence shown in SEQ ID NO: 6.

[0044] An attenuated influenza virus strain prepared by the attenuation method of the present disclosure can grow well on an MDCK cell or a chicken embryo. Babl/C mice are subjected to intranasal immunization with the attenuated influenza virus strain, and then the body weight changes and survival are observed and the viral loads in turbinates and lungs are detected. Results show that the attenuated influenza virus strain is non-pathogenic to mice compared with the parental virus IAV PR8. The attenuation method of the present disclosure lays a foundation for the screening of safe and effective IAV live-attenuated vaccines.

[0045] The present disclosure also provides an attenuated influenza virus strain prepared by the attenuation method described in the technical solution, and the attenuated influenza virus strain is prepared as follows: with A/Puerto Rico/8/1934 as a parental virus, subjecting the M2 protein to one base deletion selected from the group consisting of (a) to (f): [0046] (a) deleting 14 bases from position 73 to position 86 of a coding region for the M2 protein; [0047] (b) deleting 20 bases from position 87 to position 106 of a coding region for the M2 protein; [0048] (c) deleting 22 bases from position 130 to position 151 of a coding region for the M2 protein; [0049] (d) deleting 38 bases from position 152 to position 189 of a coding region for the M2 protein; [0050] (e) deleting 65 bases from position 87 to position 151 of a coding region for the M2 protein; and [0051] (f) deleting 103 bases from position 87 to position 189 of a coding region for the M2 protein.

[0052] In the present disclosure, a coding region for an M2 protein of the attenuated influenza virus strain has a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or SEQ ID NO: 6.

[0053] The present disclosure also provides a group of plasmids for constructing an attenuated influenza virus strain, and the plasmids include nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively. The plasmids of the present disclosure are random base deletion plasmids for the M2 gene. The present disclosure has no special limitations on a construction method of the deletion plasmids, and a conventional construction method of the deletion plasmids well known to those skilled in the art may be adopted. In the present disclosure, a basal plasmid for constructing the plasmids preferably includes a nucleotide sequence shown in SEQ ID NO: 7. The present disclosure has no special limitations on a type of the basal plasmid, as long as the basal plasmid includes a nucleotide sequence shown in SEQ ID NO: 7.

[0054] The present disclosure also provides primers for constructing the plasmids described in the technical solution, and the primers have nucleotide sequences shown in SEQ ID NOS: 8-19.

[0055] The present disclosure also provides a use of the attenuation method described in the technical solution, the attenuated influenza virus strain described in the technical solution, the plasmids described in the technical solution, or the primers described in the technical solution in preparation of a live-attenuated influenza vaccine.

[0056] The attenuation method of an influenza virus, the attenuated influenza virus strain, and the use thereof according to the present disclosure will be further described in detail below with reference to specific examples. The technical solutions of the present disclosure include, but are not limited to, the following examples.

Example 1

Construction of Random Base Deletion Plasmids for an M2 Gene of an Influenza Virus

[0057] Plasmids expressing the M2 gene of the influenza virus strain PR8 were extracted (the present disclosure has no special limitations on the construction method of the plasmid, and an M2-overexpressing plasmid can be constructed by a conventional recombinant plasmid construction method with a common plasmid well known by those skilled in the art and the M gene), and PCR amplification was conducted with a series of base deletion primers (primer sequences were shown in Table 1). After a molecular weight was identified by agarose gel electrophoresis to be correct, a target gel band was recovered and subjected to recombination at 50 C. for 15 min, a recombination product was transformed into an Escherichia coli (E. coli) competent cell, and colonies were picked for sequencing; and after a correct sequence was determined, the following deletion plasmids were successfully prepared with endotoxin-free small and medium kits: PR8-M2-del14, PR8-M2-del20, PR8-M2-del22, PR8-M2-del38, PR8-M2-del65, and PR8-M2-del103 (agarose gel electrophoresis results of the extracted plasmids PR8-M2-del14, PR8-M2-del20, PR8-M2-del22, PR8-M2-del38, PR8-M2-del65, and PR8-M2-del103 were shown in FIG. 1).

TABLE-US-00001 TABLE1 Specificprimersequences Deletionplasmid name Primername Primersequence(5-3)(SEQIDNO:) PR8-M2-del14 Del14-F aacggttcaagtgatcgcaaatatcattgggatcttg(8) Del14-R atcacttgaaccgttgcatctg(9) PR8-M2-del20 Del20-F tcctctcactattgctgcacttgacattgtggattcttg(10) Del20-R gcaatagtgagaggatcacttg(11) PR8-M2-del22 Del22-F acattgtggattctttttaccgtcgctttaaatacg(12) Del22-R aagaatccacaatgtcaagtg(13) PR8-M2-del38 Del38-F tttttttcaaatgcatctacggaaggagtgccaaag(14) Del38-R tgcatttgaaaaaaagacg(15) PR8-M2-del65 Del65-F tcctctcactattgctttaccgtcgctttaaatacg(16) Del65-R gcaatagtgagaggatcacttg(17) PR8-M2-del103 Del103-F tcctctcactattgctctacggaaggagtgccaaag(18) Del103-R gcaatagtgagaggatcacttg(19)

Example 2

Rescue and Verification of Replication-Restricted Influenza Viruses

[0058] An HEK293T cell was inoculated into a special six-well plate of Thermo Fisher, and 12 h later, the plasmids including 7 genes of PR8 (pFlu-PR8-PB2, pFlu-PR8-PB1, pFlu-PR8-PA, pFlu-PR8-NP, pFlu-PR8-NS, pFlu-PR8-HA, and pFlu-PR8-NA), each of the series of random base deletion plasmids for the M2 gene constructed in Example 1, and the M2 protein-expressing plasmid were co-transfected into the HEK293T cell; 6 h to 8 h after the transfection, a medium was changed; 48 h after the transfection, the cell plate was frozen and thawed once, and a culture supernatant was collected and inoculated in a T25 culture flask with the M2 protein-expressing MDCK cell; and 72 h to 96 h after the inoculation, the CPE was observed, the culture flask was frozen and thawed once and then centrifuged, and a resulting supernatant was collected. Resulting replication-restricted influenza viruses were named rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103, respectively.

[0059] A viral RNA obtained above was extracted using a viral RNA extraction kit, and RT-PCR amplification was conducted with the primers in Table 2; and after a molecular weight was identified by agarose gel electrophoresis to be correct (FIG. 2), a PCR product was sequenced, and sequencing results showed that the virus was a replication-restricted virus with a corresponding base deletion. FIG. 2 shows agarose gel electrophoresis results of the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 identified by RT-PCR.

TABLE-US-00002 TABLE2 Identifiedprimersequences Primername Primersequence(5-3) Bm-M-F1 cacacacgtctccgggagcaaaagcaggtag(SEQIDNO:20) Bm-M-R1027 cacacacgtctcctattagtagaaacaaggtagttttt(SEQIDNO:21)

Example 3

Determination of Titers of Replication-Restricted Influenza Viruses

[0060] The M2 protein-expressing MDCK cell was inoculated into a 96-well plate; after the cell grew to form a monolayer, 50 L of a replication-restricted influenza virus was added to 450 L of 1% TPCK opi-MEM, and a resulting mixture was thoroughly shaken to obtain a system 1 with a final concentration of 10.sup.1; 50 L of the system 1 was taken and added to 450 L of 1% TPCK opi-MEM, and a resulting mixture was thoroughly shaken to obtain a system 2 with a final concentration of 10.sup.2; in this way, the virus solution was continuously diluted 10-fold to 10.sup.10; then a medium in the 96-well plate was removed, the plate was washed with PBS, and 100 L of a virus solution with a corresponding dilution ratio was added to each well, where 3 replicates were set for each dilution ratio; the cell was cultivated for 72 h in a cell culture incubator at 37 C. and 5% CO.sub.2, and then a CPE was observed; and TCID.sub.50 was calculated by the Reed-Muench method, and a viral titer was shown in Table 3.

TABLE-US-00003 TABLE 3 Summary of titers of replication-restricted influenza viruses Virus name Viral titer (TCID.sub.50/mL) rPR8-M2-del14 7.75 rPR8-M2-del20 7.75 rPR8-M2-del22 6.75 rPR8-M2-del38 7.5 rPR8-M2-del65 6.75 rPR8-M2-del103 6.75

Example 4

Determination of Growth Curves of Replication-Restricted Influenza Viruses

[0061] The M2 protein-expressing MDCK cell was inoculated into a 48-well plate; after the cell grew to form a monolayer, the replication-restricted influenza viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 were used to infect the cell at an MOI of 0.001, where 3 replicates were set for each group; the cell was cultivated in a 37 C. and 5% CO.sub.2 incubator; a virus was collected at 24 h, 48 h, 72 h, and 96 h after the infection, virus solutions collected at different time points each were continuously diluted 10-fold, where 3 replicates were set for each dilution ratio; a resulting dilution was added to an M2 protein-expressing MDCK cell growing to form a monolayer in a 96-well plate, and the cell was cultivated in a cell culture incubator at 37 C. and 5% CO.sub.2 for 72 h; a CPE was observed, and TCID.sub.50 was calculated by the Reed-Muench method; and data analysis was conducted, and then a growth curve of a replication-restricted influenza virus was plotted (FIG. 3). It can be seen from FIG. 3 that rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del65, and WT-PR8 have similar growth characteristics and can achieve similar viral titers after infection for 48 h, and rPR8-M2-del38 and rPR8-M2-del103 can also exhibit prominent growth characteristics on the M2 protein-expressing MDCK cell.

Example 5

Determination of Growth of Replication-Restricted Influenza Viruses in an MDCK Cell

[0062] An MDCK cell was inoculated into a 48-well plate; after the cell grew to form a monolayer, the replication-restricted influenza viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 each were used to infect the cell at MOIs of 0.001, 0.004, 0.016, 0.064, 0.256, 1.024, 4.096, and 16.384, and the cell was cultivated in a 37 C. and 5% CO.sub.2 incubator for 72 h; a CPE was observed, and the cell was photographed (FIG. 4 shows CPEs of MDCK cells infected with the replication-restricted influenza viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 for 72 h at different MOIs); the cell was repeatedly frozen and thawed three times, then the plate was centrifuged, a resulting supernatant was collected and subjected to a chicken red blood cell (CRBC) agglutination test, and an agglutination titer was recorded (FIG. 5 shows agglutination titers of MDCK cells infected with the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 for 72 h at different MOIs). Experimental results showed that the replication-restricted influenza viruses at high doses grew well on the MDCK cell. It can be seen from FIG. 5 that an attenuation effect of the rPR8-M2-del20 virus is obvious, indicating that the replication-restricted influenza virus obtained by the present disclosure is not absolutely dependent on the M2 protein-expressing MDCK cell line.

[0063] Stock solutions of the replication-restricted influenza viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 each were inoculated into 4 chicken embryos; and 72 h later, an allantoic fluid of a chicken embryo was collected and subjected to a CRBC agglutination test, and an agglutination titer was recorded (Table 4). The rPR8-M2-del20 virus with the optimal attenuation effect can replicate in the chicken embryos and achieve a high CRBC agglutination titer, indicating that the replication-restricted influenza virus of the present disclosure can be produced in large quantities with a chicken embryo, which reduces the cost and increases the yield.

TABLE-US-00004 TABLE 4 CRBC agglutination titers of chicken embryos infected with the replication-restricted influenza viruses Agglutina- Agglutina- Agglutina- Agglutina- tion titer tion titer tion titer tion titer Virus name 1 (2.sup.n) 2 (2.sup.n) 3 (2.sup.n) 4 (2.sup.n) rPR8-M2-del14 9 9 8 8 rPR8-M2-del20 9 8.5 8 8 rPR8-M2-del22 5.5 6 5 5 rPR8-M2-del38 7 7 6 8.5 rPR8-M2-del65 8 8.5 8 8 rPR8-M2-del103 8 7 8 7.5

Example 6

Immunization Experiment of Replication-Restricted Viruses

[0064] 4-5 week-old Balb/C female mice were divided into 7 groups, with 8 mice in each group. The mice each were subjected to intranasal immunization with the replication-restricted viruses rPR8-M2-del14, rPR8-M2-del20, rPR8-M2-del22, rPR8-M2-del38, rPR8-M2-del65, and rPR8-M2-del103 and the parental virus IAV PR8 at TCID.sub.50 of 10.sup.6, and 3 d after the immunization, 3 mice were selected from each group and sacrificed, and turbinates and lungs were collected and ground; and a ground tissue was taken and tested for a viral load by the same determination method as in Example 3, and TCID.sub.50 was calculated by the Reed-Muench method. Viral titers were shown in Table 5. A body weight of each of the remaining 5 mice in each group was measured and recorded daily for 14 d, and a body weight change curve of mice was plotted (FIG. 6). It was found that, compared with the WT-PR8 virus, a body weight of the mice immunized with the viruses rPR8-M2-del14, rPR8-M2-del20, and rPR8-M2-del65 first decreased and then increased, a body weight of the mice immunized with the viruses rPR8-M2-del22, rPR8-M2-del38, and rPR8-M2-del103 fluctuated slightly, and the mice immunized with the virus WT-PR8 all died on day 5 after the immunization, indicating that the replication-restricted influenza virus of the present disclosure was non-pathogenic to mice; and a serum HI titer on day 14 after the immunization was 2.sup.6.5 to 2.sup.10 (Table 6), indicating that the attenuated influenza virus strain had a prominent immunization effect. Moreover, 21 d after the immunization, the WT-PR8 strain was used to infect the mice at TCID.sub.50 of 10.sup.6, then a body weight of each of the mice was measured and recorded daily for 10 d, and a body weight change curve of mice was plotted (FIG. 7). It can be seen from the figure that a body weight of the mice immunized with the viruses rPR8-M2-del14, rPR8-M2-del22, and rPR8-M2-del38 fluctuated slightly after the infection, indicating that these three attenuated influenza viruses have a prominent protective effect, which lays a foundation for the screening of safe and effective IAV live-attenuated vaccines.

TABLE-US-00005 TABLE 5 Replication of replication-restricted influenza viruses in mice Immuniza- Immuniza- tion dose tion time Viral titer (TCID50/mL) Virus name (TCID50) (d) Turbinate Lung rPR8-M2-del14 10.sup.6 3 0; 0; 0 4.75; 4.5; 3.75 rPR8-M2-del20 10.sup.6 3 0; 0; 0 0; 4.5; 0 rPR8-M2-del22 10.sup.6 3 0; 0; 1.98 0; 1.98; 0 rPR8-M2-del38 10.sup.6 3 3.25; 0; 0 0; 0; 0 rPR8-M2-del65 10.sup.6 3 0; 0; 0 0; 0; 0 rPR8-M2-del103 10.sup.6 3 0; 2.75; 0 0; 0; 0

TABLE-US-00006 TABLE 6 HI titers of mice immunized with the replication-restricted influenza viruses Immunization Immunization time HI titer Virus name dose (TCID50) (d) Mouse 1 Mouse 2 Mouse 3 Mouse 4 Mouse rPR8-M2-del14 10.sup.6 14 2.sup.10 2.sup.9 2.sup.9 2.sup.8 2.sup.8 rPR8-M2-del20 10.sup.6 14 2.sup.9 2.sup.8 2.sup.8 2.sup.8 2.sup.8 rPR8-M2-del22 10.sup.6 14 2.sup.7 2.sup.7 2.sup.6.5 2.sup.7 2.sup.7 rPR8-M2-del38 10.sup.6 14 2.sup.7 2.sup.9.5 2.sup.8.5 2.sup.8 2.sup.7 rPR8-M2-del65 10.sup.6 14 2.sup.9.5 2.sup.8.5 2.sup.8 2.sup.9 2.sup.8 rPR8-M2-del103 10.sup.6 14 2.sup.8 2.sup.7 2.sup.8 2.sup.8 2.sup.8

[0065] The above are merely preferred implementations of the present disclosure. It should be noted that several improvements and modifications may further be made by a person of ordinary skill in the art without departing from the principle of the present disclosure, and such improvements and modifications should also be deemed as falling within the protection scope of the present disclosure.