ESCHERICHIA COLI HAVING 3-HYDROXYPROPIONATE PRODUCTION ABILITY, WITH 3-HYDROXYPROPIONATE PRODUCTION GENE INSERTED INTO SAME, AND USE THEREOF

Abstract

The present specification pertains to a microorganism and/or Escherichia coli and a use thereof, wherein the microorganism and/or Escherichia coli has 3-hydroxypropionic acid or 3-hydroxypropionate (3-HP) production ability, with a foreign 3-HP production gene inserted into the genomic DNA thereof, and has a use of measuring the production ability of the inserted 3-HP production gene.

Claims

1. An Escherichia coli bacterium having 3-hydroxypropionic acid (3-HP) producing ability, in which a foreign 3-HP producing gene is inserted into genomic DNA with at least one copy number.

2. The E. coli bacterium having 3-HP producing ability according to claim 1, wherein the 3HP producing gene comprises a gene of at least one enzyme selected from the group consisting of glycerol dehydratase, aldehyde dehydrogenase, glycerol dehydratase reactivase and adenosyltransferase.

3. The E. coli bacterium having 3-HP producing ability according to claim 1, wherein at least one gene selected from the group consisting of yqhD, glpK, ldhA, ack-pta and gldA is deleted among genes of the E. coli.

4. The E. coli bacterium having 3-HP producing ability according to claim 1, wherein the 3-HP producing gene is inserted where at least one gene selected from the group consisting of ldhA, gldA, glpK, yqhD, mgsA, poxB, nfrA, fhuA, fadL, adhE, pflB and aldA genes of the E. coli is located.

5. The E. coli bacterium having 3-HP producing ability according to claim 1, wherein the 3-HP producing gene is inserted into genomic DNA by CRISPR-Cas9 system.

6. The E. coli bacterium having 3-HP producing ability according to claim 1, wherein the 3-HP producing ability is increased in proportion to the copy number of the 3-HP producing gene.

7. A composition for determining 3-HP producing ability of a 3-HP producing gene, wherein the composition comprises the E. coli bacterium of claim 1, and the 3-HP producing gene is inserted into genomic DNA of the E. coli bacterium.

8. The composition according to claim 7, wherein the determining 3-HP producing ability is confirming whether the 3-HP production by the E. coli bacterium is proportional to the copy number of the 3-HP producing gene inserted into genomic DNA of the E. coli bacterium.

9. The E. coli bacterium having 3-HP producing ability according to claim 2, wherein the 3-HP producing ability is increased in proportion to the copy number of the 3-HP producing gene.

10. The E. coli bacterium having 3-HP producing ability according to claim 3, wherein the 3-HP producing ability is increased in proportion to the copy number of the 3-HP producing gene.

11. The E. coli bacterium having 3-HP producing ability according to claim 4, wherein the 3-HP producing ability is increased in proportion to the copy number of the 3-HP producing gene.

12. The E. coli bacterium having 3-HP producing ability according to claim 5, wherein the 3-HP producing ability is increased in proportion to the copy number of the 3-HP producing gene.

13. A composition for determining 3-HP producing ability of a 3-HP producing gene, wherein the composition comprises the E. coli bacterium of claim 1, and the 3-HP producing gene is inserted into genomic DNA of the E. coli bacterium.

14. The composition according to claim 13, wherein the determining 3-HP producing ability is confirming whether the 3-HP production by the E. coli bacterium is proportional to the copy number of the 3-HP producing gene inserted into genomic DNA of the E. coli bacterium.

15. A composition for determining 3-HP producing ability of a 3-HP producing gene, wherein the composition comprises the E. coli bacterium of claim 3, and the 3-HP producing gene is inserted into genomic DNA of the E. coli bacterium.

16. The composition according to claim 15, wherein the determining 3-HP producing ability is confirming whether the 3-HP production by the E. coli bacterium is proportional to the copy number of the 3-HP producing gene inserted into genomic DNA of the E. coli bacterium.

17. A composition for determining 3-HP producing ability of a 3-HP producing gene, wherein the composition comprises the E. coli bacterium of claim 4, and the 3-HP producing gene is inserted into genomic DNA of the E. coli bacterium.

18. The composition according to claim 17, wherein the determining 3-HP producing ability is confirming whether the 3-HP production by the E. coli bacterium is proportional to the copy number of the 3-HP producing gene inserted into genomic DNA of the E. coli bacterium.

19. A composition for determining 3-HP producing ability of a 3-HP producing gene, wherein the composition comprises the E. coli bacterium of claim 5, and the 3-HP producing gene is inserted into genomic DNA of the E. coli bacterium.

20. The composition according to claim 19, wherein the determining 3-HP producing ability is confirming whether the 3-HP production by the E. coli bacterium is proportional to the copy number of the 3-HP producing gene inserted into genomic DNA of the E. coli bacterium.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0141] FIG. 1 is a cleavage map of the common recombinant vector comprising Cas9 gene and recombinase.

[0142] FIG. 2 shows the homology arm region connected before and after the insertion site to the 5 and 3 ends of the target gene comprised in the D recombinant DNA.

[0143] FIG. 3 shows the cassette recombinant vector comprising 4 kinds of target genes (inserted genes).

[0144] FIG. 4 shows the 3-HP producing gene plasmid vector, pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector.

[0145] FIG. 5 shows the 3-HP producing pRSF plasmid vector based on the pRSFDuet-1 vector.

MODE FOR INVENTION

[0146] Hereinafter, the present invention will be described in detail by examples. However, the following examples illustrates the present invention only, but the present invention is not limited by the following examples.

[0147] Unless otherwise mentioned in the present description, all temperatures are based on degrees Celsius, and nucleic acid sequences are described in the direction from the 5 end to the 3 end unless otherwise specified.

Example 1. Plasmid Design for Strain Recombination

1-1. Preparation of Common Recombinant Vector (Comprising Cas9 and Recombinase)

[0148] In the present example, a common recombinant vector comprising Cas9 gene and recombinase was prepared.

[0149] More specifically, under araBAD promoter induced RSF origin, arabinose, Cas9 gene (SEQ ID NO: 1) and recombinase (RED recombinase; SEQ ID NO: 2) were inserted into an araC gene and RED recombinase gene expression vector that regulates transcription of Cas9, to prepare a common recombinant vector, and the specific information was shown in Table 1 below.

[0150] The cleavage map of the common recombinant vector was shown in FIG. 1. The common recombinant vector is always maintained in a recombinant cell without an additional gene insertion process after being inserted once at the time of the first gene insertion, and performs a function to edit genome according to the kind of gRNA to be introduced and homolog region.

TABLE-US-00001 TABLE1 SEQ Name Sequence(5.fwdarw.3) IDNO Cas9gene atggataagaaatactcaataggcttagatatcggcacaaatagcgtcggatgggcggtgatcactgat 1 gaatataaggttccgtctaaaaagttcaaggttctgggaaatacagaccgccacagtatcaaaaaaaa tcttataggggctcttttatttgacagtggagagacagcggaagcgactcgtctcaaacggacagctcgt agaaggtatacacgtcggaagaatcgtatttgttatctacaggagattttttcaaatgagatggcgaaa gtagatgatagtttctttcatcgacttgaagagtcttttttggtggaagaagacaagaagcatgaacgtc atcctatttttggaaatatagtagatgaagttgcttatcatgagaaatatccaactatctatcatctgcga aaaaaattggtagattctactgataaagcggatttgcgcttaatctatttggccttagcgcatatgattaa gtttcgtggtcattttttgattgagggagatttaaatcctgataatagtgatgtggacaaactatttatcca gttggtacaaacctacaatcaattatttgaagaaaaccctattaacgcaagtggagtagatgctaaagc gattctttctgcacgattgagtaaatcaagacgattagaaaatctcattgctcagctccccggtgagaag aaaaatggcttatttgggaatctcattgctttgtcattgggtttgacccctaattttaaatcaaattttgatt tggcagaagatgctaaattacagctttcaaaagatacttacgatgatgatttagataatttattggcgca aattggagatcaatatgctgatttgtttttggcagctaagaatttatcagatgctattttactttcagatat cctaagagtaaatactgaaataactaaggctcccctatcagcttcaatgattaaacgctacgatgaaca tcatcaagacttgactcttttaaaagctttagttcgacaacaacttccagaaaagtataaagaaatctttt ttgatcaatcaaaaaacggatatgcaggttatattgatgggggagctagccaagaagaattttataaat ttatcaaaccaattttagaaaaaatggatggtactgaggaattattggtgaaactaaatcgtgaagattt gctgcgcaagcaacggacctttgacaacggctctattccccatcaaattcacttgggtgagctgcatgct attttgagaagacaagaagacttttatccatttttaaaagacaatcgtgagaagattgaaaaaatcttg acttttcgaattccttattatgttggtccattggcgcgtggcaatagtcgttttgcatggatgactcggaag tctgaagaaacaattaccccatggaattttgaagaagttgtcgataaaggtgcttcagctcaatcattta ttgaacgcatgacaaactttgataaaaatcttccaaatgaaaaagtactaccaaaacatagtttgcttta tgagtattttacggtttataacgaattgacaaaggtcaaatatgttactgaaggaatgcgaaaaccagc atttctttcaggtgaacagaagaaagccattgttgatttactcttcaaaacaaatcgaaaagtaaccgtt aagcaattaaaagaagattatttcaaaaaaatagaatgttttgatagtgttgaaatttcaggagttgaa gatagatttaatgcttcattaggtacctaccatgatttgctaaaaattattaaagataaagattttttggat aatgaagaaaatgaagatatcttagaggatattgttttaacattgaccttatttgaagatagggagatg attgaggaaagacttaaaacatatgctcacctctttgatgataaggtgatgaaacagcttaaacgtcgc cgttatactggttggggacgtttgtctcgaaaattgattaatggtattagggataagcaatctggcaaaa caatattagattttttgaaatcagatggttttgccaatcgcaattttatgcagctgatccatgatgatagtt tgacatttaaagaagacattcaaaaagcacaagtgtctggacaaggcgatagtttacatgaacatattg caaatttagctggtagccctgctattaaaaaaggtattttacagactgtaaaagttgttgatgaattggtc aaagtaatggggcggcataagccagaaaatatcgttattgaaatggcacgtgaaaatcagacaactca aaagggccagaaaaattcgcgagagcgtatgaaacgaatcgaagaaggtatcaaagaattaggaag tcagattcttaaagagcatcctgttgaaaatactcaattgcaaaatgaaaagctctatctctattatctcc aaaatggaagagacatgtatgtggaccaagaattagatattaatcgtttaagtgattatgatgtcgatc acattgttccacaaagtttccttaaagacgattcaatagacaataaggtcttaacgcgttctgataaaaa tcgtggtaaatcggataacgttccaagtgaagaagtagtcaaaaagatgaaaaactattggagacaac ttctaaacgccaagttaatcactcaacgtaagtttgataatttaacgaaagctgaacgtggaggtttgag tgaacttgataaagctggttttatcaaacgccaattggttgaaactcgccaaatcactaagcatgtggca caaattttggatagtcgcatgaatactaaatacgatgaaaatgataaacttattcgagaggttaaagtg attaccttaaaatctaaattagtttctgacttccgaaaagatttccaattctataaagtacgtgagattaa caattaccatcatgcccatgatgcgtatctaaatgccgtcgttggaactgctttgattaagaaatatcca aaacttgaatcggagtttgtctatggtgattataaagtttatgatgttcgtaaaatgattgctaagtctga gcaagaaataggcaaagcaaccgcaaaatatttcttttactctaatatcatgaacttcttcaaaacaga aattacacttgcaaatggagagattcgcaaacgccctctaatcgaaactaatggggaaactggagaaa ttgtctgggataaagggcgagattttgccacagtgcgcaaagtattgtccatgccccaagtcaatattgt caagaaaacagaagtacagacaggcggattctccaaggagtcaattttaccaaaaagaaattcggac aagcttattgctcgtaaaaaagactgggatccaaaaaaatatggtggttttgatagtccaacggtagctt attcagtcctagtggttgctaaggtggaaaaagggaaatcgaagaagttaaaatccgttaaagagtta ctagggatcacaattatggaaagaagttcctttgaaaaaaatccgattgactttttagaagctaaagga tataaggaagttaaaaaagacttaatcattaaactacctaaatatagtctttttgagttagaaaacggtc gtaaacggatgctggctagtgccggagaattacaaaaaggaaatgagctggctctgccaagcaaatat gtgaattttttatatttagctagtcattatgaaaagttgaagggtagtccagaagataacgaacaaaaa caattgtttgtggagcagcataagcattatttagatgagattattgagcaaatcagtgaattttctaagcg tgttattttagcagatgccaatttagataaagttcttagtgcatataacaaacatagagacaaaccaata cgtgaacaagcagaaaatattattcatttatttacgttgacgaatcttggagctcccgctgcttttaaata ttttgatacaacaattgatcgtaaacgatatacgtctacaaaagaagttttagatgccactcttatccatc aatccatcactggtctttatgaaacacgcattgatttgagtcagctaggaggtgactga RED atggatattaatactgaaactgagatcaagcaaaagcattcactaaccccctttcctgttttcctaatcag 2 recomgbinase cccggcatttcgcgggcgatattttcacagctatttcaggagttcagccatgaacgcttattacattcagg gene atcgtcttgaggctcagagctgggcgcgtcactaccagcagctcgcccgtgaagagaaagaggcagaa ctggcagacgacatggaaaaaggcctgccccagcacctgtttgaatcgctatgcatcgatcatttgcaa cgccacggggccagcaaaaaatccattacccgtgcgtttgatgacgatgttgagtttcaggagcgcatg gcagaacacatccggtacatggttgaaaccattgctcaccaccaggttgatattgattcagaggtataa aacgaatgagtactgcactcgcaacgctggctgggaagctggctgaacgtgtcggcatggattctgtcg acccacaggaactgatcaccactcttcgccagacggcatttaaaggtgatgccagcgatgcgcagttca tcgcattactgatcgttgccaaccagtacggccttaatccgtggacgaaagaaatttacgcctttcctgat aagcagaatggcatcgttccggtggtgggcgttgatggctggtcccgcatcatcaatgaaaaccagcag tttgatggcatggactttgagcaggacaatgaatcctgtacatgccggatttaccgcaaggaccgtaatc atccgatctgcgttaccgaatggatggatgaatgccgccgcgaaccattcaaaactcgcgaaggcaga gaaatcacggggccgtggcagtcgcatcccaaacggatgttacgtcataaagccatgattcagtgtgcc cgtctggccttcggatttgctggtatctatgacaaggatgaagccgagcgcattgtcgaaaatactgcat acactgcagaacgtcagccggaacgcgacatcactccggttaacgatgaaaccatgcaggagattaac actctgctgatcgccctggataaaacatgggatgacgacttattgccgctctgttcccagatatttcgccg cgacattcgtgcatcgtcagaactgacacaggccgaagcagtaaaagctcttggattcctgaaacaga aagccgcagagcagaaggtggcagcatgacaccggacattatcctgcagcgtaccgggatcgatgtg agagctgtcgaacagggggatgatgcgtggcacaaattacggctcggcgtcatcaccgcttcagaagtt cacaacgtgatagcaaaaccccgctccggaaagaagtggcctgacatgaaaatgtcctacttccacac cctgcttgctgaggtttgcaccggtgtggctccggaagttaacgctaaagcactggcctggggaaaaca gtacgagaacgacgccagaaccctgtttgaattcacttccggcgtgaatgttactgaatccccgatcatc tatcgcgacgaaagtatgcgtaccgcctgctctcccgatggtttatgcagtgacggcaacggccttgaac tgaaatgcccgtttacctcccgggatttcatgaagttccggctcggtggtttcgaggccataaagtcagct tacatggcccaggtgcagtacagcatgtgggtgacgcgaaaaaatgcctggtactttgccaactatgac ccgcgtatgaagcgtgaaggcctgcattatgtcgtgattgagcgggatgaaaagtacatggcgagtttt gacgagatcgtgccggagttcatcgaaaaaatggacgaggcactggctgaaattggttttgtatttggg gagcaatggcgatga

1-2 G Recombinant Vector (Comprising Guide RNA and Ts Origin)

[0151] Under temperature sensitive pSC101 origin, ampicillin antibiotic resistant gene and J23100 promoter, an expression vector comprising sgRNA designating an integration site and sgRNA scaffold (sequence that associates with Cas9) of CRISPR-Cas9 system of Streptococcus pyrogenes (S. pyogenes) was prepared, and named as G (Guide RNA-containing) recombinant vector.

[0152] The sgRNA may be prepared by a method known in the art depending on the insertion target site, and the nucleic acid sequence of the gene encoding the sgRNA used in the present invention was shown in Table 2 below.

TABLE-US-00002 TABLE2 gRNAsequence Accession SEQID Nameofthe Target (5.fwdarw.3) Number NO sequence ldhA GCACGTTGTGGCAGGCAGAC BAA14990.1 3 ldhA_gRNA1 TAACGTCTGATTCAGAGAAC (GenBank) 4 ldhA_gRNA2 AACGTCTGATTCAGAGAACA 5 ldhA_gRNA3 yqhD ACTTTCCTGCTGGCGGTTGG BAE77068.1 6 yqhD_gRNA1 CACCAAATTTATCGCCGCAG (GenBank) 7 yqhD_gRNA2 glpK ATTGTCTGGGAAAAAGAAAC BAE77384.1 8 glpK_gRNA1 CGTCGTTCTTCCGAAGTATA (GenBank) 9 glpK_gRNA2 gldA ATCGCGGAGACTGCGCAGTG AAC76927.2 10 gldA_gRNA1 CCTCGATACTGCCAAAGCAC (GenBank) 11 gldA_gRNA2 mgsA CGAGATAACGCTGATAATCG CAA72119.1 12 mgsA_gRNA1 CGCAGCAAGGCTTTCACGTC (GenBank) 13 mgsA_gRNA2 poxB CAGTGCATGGTTGCCCCTTC CAA27725.1 14 poxB_gRNA1 GTACTTGTGGGATCTGCTCC (GenBank) 15 poxB_gRNA2 nfrA CGCATGCAGCCACCAGTAGA AAC36849.1 16 nfrA_gRNA1 CCAGTCGCGCCATTAAAGTC (GenBank) 17 nfrA_gRNA2

1-3. D Recombinant DNA (Comprising Homology Region and Target Gene)

[0153] D (Donor) recombinant DNA comprising a target gene (donor or insert) to be introduced into genome was prepared as follows.

[0154] As the target gene, dhaB, gdrAB, aldH and btuR parts of the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector of Korean Patent Publication No. 10-2020-0051375 were used, and homology arm regions with a length of 1 kb were connected before and after the insertion site at the 5 and 3 ends of the target gene, respectively. Then, the PAM sequence (NNGG) comprised in the homology arm in the 5 direction (beginning part of foreign target gene operon) was substituted with CAAA to prepare a 3-HP producing gene cassette recombinant vector (See FIG. 3). In the PAM sequence, the N base means an A base, a T base, a C base or a G base.

[0155] Specifically, by treating xbaI and paI restriction enzymes (Thermo Scientific) to the pCDF_J23101sdhaB_gdrABcJ23act_aldH_btuR vector, fragments were prepared, and PCR was performed on the genomic DNA of the E. coli W3110 strain (purchased from KCRC) with primers of Table 3 below, and upstream and downstream fragments of the homology arm were prepared, and the two fragments were mixed by In-fusion (TAKARA) reaction to prepare a 3-HP producing gene cassette recombinant vector.

TABLE-US-00003 TABLE3 homologyarmprimer homologyarmsequence(5.fwdarw.3) SEQIDNO ldhA_upstream_For actgaaccgctctaggcgattgggatgtgtgcattacc 48 ldhA_upstream_Rev tagctgtaaatctagatctctctgcactgcccgc 49 ldhA_downstream_For tactagcgcagcttaagctcaaagccaaaggactcg 50 ldhA_downstream_Rev cagcagcctaggttaacgatcaattgcccgctattttcc 51 yqhD_upstream_For actgaaccgctctagggcggagttaatcccgctg 52 yqhD_upstream_Rev tagctgtaaatctagcactttctgttcgcgaaccagtttc 53 yqhD_downstream_For tactagcgcagcttagaacagtatgttaccaaaccggttg 54 yqhD_downstream_Rev cagcagcctaggttaagggctttgccgacacct 55 glpK_upstream_For tactagcgcagcttaacctatggcactggctgct 56 glpK_upstream_Rev tagctgtaaatctaggtcatattacagcgaagctttttgt 57 glpK_downstream_For tactagcgcagcttaaagcgtttatgccgcatccg 58 glpK_downstream_Rev cagcagcctaggttatcttcgttgtcgcctttgacg 59 gldA_upstream_For actgaaccgctctagcatgcacgaagaattccgtaac 60 gldA_upstream_Rev tagctgtaaatctagaaacctaaaacaaatttgtcaccc 61 gldA_downstream_For tactagcgcagcttagaagcggcatgtgcagaagg 62 gldA_downstream_Rev cagcagcctaggttatctgaaaccaccccaatatgtgc 63 mgsA_upstream_For actgaaccgctctaggattgtgattctggagaaaggtcgc 64 mgsA_upstream_Rev tagctgtaaatctagcggaccgtctgaagtaatattgc 65 mgsA_downstream_For tactagcgcagcttatccgcgcaggtaaagtgc 66 mgsA_downstream_Rev cagcagcctaggttacgaatgaatgagagcaaaagcggg 67 poxB_upstream_For actgaaccgctctagcggcattaaagatgcgcgca 68 poxB_upstream_Rev tagctgtaaatctagacaacagcgtgctgggct 69 poxB_downstream_For tactagcgcagcttaagctcgcaatagtgactacattcgc 70 poxB_downstream_Rev cagcagcctaggttacgtgatgacctgcggccc 71 nfrA_upstream_For actgaaccgctctagtgtgcggccaggcgtcgtagtgc 72 nfrA_upstream_Rev tagctgtaaatctaggggcttccggacgatccg 73 nfrA_downstream_For tactagcgcagcttaggcgagcagtttttgcgc 74 nfrA_downstream_Rev cagcagcctaggttaacagaaaaataacgacgaagcaacc 75

[0156] By substituting the PAM sequence with the CAAA sequence, it is possible to prevent the foreign gene insertion site that has already been introduced and expressed in the subsequent repeated steps of transformation from being cleaved by Cas9 again.

[0157] In order to insert the 3-HP producing gene cassette recombinant vector, the sequences of the homology arms acting on the gene targeted to the guide RNA so that the guide RNA sequence of Table 2 acts on the E. coli genome to be inserted were shown in Table 4 below.

TABLE-US-00004 TABLE4 homologyarm homologyarmsequence(5.fwdarw.3) SEQIDNO ldhA_upstream ggcgattgggatgtgtgcattacccaacggcaaacgctgtagcgaacagtca 18 cttgccgccgggagctgtggcagctattaattcattaaatccgccagcttataa gttaatgtctgttttgcggtcgccagcgttaactggttcgcggtcagatccactt gtgcaccttctttcagcatttcgctaatggtgttatcgagttcattaagctgcggg ttagcgcacatcatacgggtcattgccagccctttggc ldhA_downstream tactagcgcagcttaagctcaaagccaaaggactcgttcacctgttgcaggta 19 cttcttgtcgtactgttttgtgctataaacggcgagtttcataagactttctccagt gatgttgaatcacatttaagctactaaaaatattttacaaaatttcaaatttaattg aaagctatggcgatattgaaaaattcatcaacaactatgcttagtgtaggcgca accttcaactgaacggttaaacatgccacaatac yqhD_upstream ggcggagttaatcccgctggctgccatcgacggctggaaatgctcatcttcg 20 ccaatgtccatcaacagttcctgtaactgcaaaatatcgacattgagacgcaa ccctgccagcggcacctctgacgtggcataggtttcgcactcaaacggcaac ggcaccgtcagcagcaggtattcattggcatcataacgaaacacgcgttcatt gatataaccgattttatgcccggaaaagagaattatgatgccagg yqhD_downstream tactagcgcagcttagaacagtatgttaccaaaccggttgatgccaaaattca 21 ggaccgtttcgcagaaggcattttgctgacgctaatcgaagatggtccgaaa gccctgaaagagccagaaaactacgatgtgcgcgccaacgtcatgtgggc ggcgactcaggcgctgaacggtttgattggcgctggcgtaccgcaggactg ggcaacgcatatgctgggccacgaactgactgcgatgcacggtctggat glpK_upstream ccgggttgttgattttcttcggtgtgggttgcgttgcagcactaaaagtcgctgg 22 tgcgtcttttggtcagtgggaaatcagtgtcatttggggactgggggtggcaat ggccatctacctgaccgcaggggtttccggcgcgcatcttaatcccgctgtta ccattgcattgtggctgtttgcctgtttcgacaagcgcaaagttattccttttatcg tttcacaagttgccggcgctttctgtgctgcggctt glpK_downstream tactagcgcagcttaacctatggcactggctgctttatgctgatgaacactggc 23 gagaaagcggtgaaatcagaaaacggcctgctgaccaccatcgcctgcgg cccgactggcgaagtgaactatgcgttggaaggtgcggtgtttatggcaggc gcatccattcagtggctgcgcgatgaaatgaagttgattaacgacgcctacga ttccgaatatttcgccaccaaagtgcaaaacaccaatggtgtgtat gldA_upstream catgcacgaagaattccgtaacgcgctggttaacgccgcctctgccgacgct 24 atcgccagcctgctgcaacatgaactggaactgtaaaaggaaacatcatgga actgtatctggacaccgctaacgtcgcagaagtcgaacgtctggcacgcata ttccccattgccggggtgacaactaacccgagcattatcgctgccagcaagg agtccatatgggaagtgctgccgcgtctgcaaaaagcgattggtgat gldA_downstream tactagcgcagcttagaagcggcatgtgcagaaggtgaaaccattcacaaca 25 tgcctggcggcgcgacgccagatcaggtttacgccgctctgctggtagccg accagtacggtcagcgtttcctgcaagagtgggaataacctactccaaactcc cggcttgtccgggagtttgaacgcaaaattgcctgatgcgctacgcttatcag gcctacgcaatctctgcaatatattgaatttgcgtgcttttgtagg mgsA_upstream gattgtgattctggagaaaggtcgctttatcagcccgtggaagcatattctggtt 26 gatgaatttcaggatatctcgccgcagcgggcagcgttgttagcggcattacg caagcaaaacagtcagacgacgttgttcgctgttggtgatgactggcaggcg atttaccgattcagcggtgcgcaaatgtcgctcaccaccgctttccatgaaaa ctttggtgaaggcgaacgctgtgatttagacacgacttaccg mgsA_downstream tactagcgcagcttatccgcgcaggtaaagtgcgagtcgtcagttccataatg 27 tacatccgtagttaactttcctacagattactgtaagcacttatcgctgcaagata aagaccgaaaaagcctgcgcacaggcacaaaaatctcaggaagatggttgt ttttccgcccactgcaggaaagtatttcgcgtttgtgggtcagccagtttaaacc aatacttcagccgttgttctgtgagcacctgagactgcgg poxB_upstream ttaccttagccagtttgttttcgccagttcgatcacttcatcaccgcgtccgctga 28 tgattgcgcgcagcatatacaggctgaaacctttggcctgttcgagtttgatct gcggtggaatggctaactcttctttggcgaccaccacatccaccaacaccgg accgtcgatggagaaggcgcgttgcagggcttcatcaacttcagacgcttttt ctacacggatacccgtaatgccgcacgcttcggcaatgcg poxB_downstream tactagcgcagcttaagctcgcaatagtgactacattcgcggaatagctcttgt 29 gggtgggtttcctggaaatagccgctgccaatttcgctggagggaatatgag cggcaatcgccagtaccggaacgtgattgcggtggcaatcgaacaggccgt tgattaagtgcaggttgccggggccgcacgatccggcgcagaccgccagtt ctccgctaagttgtgcttcagcgccagcggcaaaggccgccacttct nfrA_upstream tgtgcggccaggcgtcgtagtgcgtctcgccggtccagatattccagcggac 30 cccgactccgccaagctgcgcgccctgagtgcctttatcacgatagccgttgt cctgaacgtgagcgtaaggctcaatagtctgtccgttagctaccttctgatgcc agctgacgcgataatctgccgtccacgcctgaatatcctggcggatatattgc gccgcatcgaggtacaggttttgggcaaaccagcctgaaccgt nfrA_downstream tactagcgcagcttaggcgagcagtttttgcgctgcgtcgtactgaccttctttt 31 aacagcaccggtagcgtcgcgccaacaacatactggcggttgtcggcaaac tgtaccgtataattcgccaacgcctgaacggggttagcgctgtatttagataac agatagagccaacttttctcttgtgcgtccgtggtaaatagtggcttattttcaat gagataatgctggaggcgtgctttttcgccacgataagc

[0158] The homology arm connection part and the cassette recombinant vector were shown in FIG. 2 and FIG. 3, respectively.

Example 2. Gene Deletion and Preparation of Strain in which 3-Hydroxypropionic Acid (3-HP) Producing Gene is Inserted into Genomic DNA

[0159] The common recombinant vector, G recombinant vector and D recombinant DNA prepared in Example 1 were transduced into W3110 which was a strain in which yqhD, glpK, ldhA, ack-pta and gldA genes were deleted from E. coli W3110 strain (purchased from KCTC) (yghD, glpK, ldhA, ack-pta and gldA) (named as DKALG strain) with 5 copy numbers, 6 copy numbers and 7 copy numbers, respectively. After that, a transformant was prepared by expressing Cas9 and RED recombinase of the common recombinant vector.

[0160] Transducing 5 copy numbers into the DKALG strain was transducing using ldhA, gldA, glpK, yqhD and mgsA (5) sgRNA of Example 1-2 above as the G recombinant vector, and transducing 6 copy numbers was transducing using ldhA, gldA, glpK, yghD, mgsA and poxB (6) sgRNA of Example 1-2 above, and transducing 7 copy numbers was transducing using ldhA, gldA, glpK, yghD, mgsA, poxB and nfrA (7) sgRNA of Example 1-2 above.

[0161] Specifically, the E. coli strain was cultured to be between O.D (600 nm) 0.5 to 1 under the condition of 37 C. Celsius, and was washed with DW (distilled water) twice and then each recombinant vector 50 to 100 ng was added for electroporation to select a colony. In case of the D recombinant DNA, it was introduced in a linear form or introduced as the vector as it is, by enzymatic treatment or performing PCR for the prepared vector.

[0162] Then, the selected colony was cultured in an LB medium at 37 C. Celsius, and arabinose was added at a concentration of 0.1 to 1% (w/v) to express RED recombinase, and was further cultured at 37 C. Celsius for 1 hour.

[0163] Colony PCR was performed for the prepared transformant, to select a transformed strain, and until removal of the selected transformant G recombinant vector was confirmed, by culturing at 37 C. while performing cell streaking, the G recombinant vector was removed from the transformant. Specifically, by smearing in an ampicillin-added LB-agar plate and an LB-agar plate, respectively, a strain in which growth and development were confirmed in a kanamycin-added medium, but growth was not done in an ampicillin-added medium was selected.

[0164] In case of the colony PCR, considering that the efficiency of Taq polymerase is sharply reduced when amplifying DNA of 5 kb or more, primers were designed so that about 1.0-1.5 kb regions were to be amplified to near 5 of the dhab1 gene inserted from the 100 bp upstream region of the 5 homology arm region, to confirm whether the target gene was inserted, and the specific information of the primers was shown in Table 5 below.

TABLE-US-00005 TABLE5 PrimerName Sequence(5.fwdarw.3) SEQIDNO poxB_For agtgtgcgcaccagatgc 32 poxB_Rev gtttgccgtccagttcgacga 33 nfrA_For cgctctccgttacgttgattaatcg 34 nfrA_Rev gtttgccgtccagttcgacga 35 mgsA_For gaaggcagaaaacgctgtcg 36 mgsA_Rev gtttgccgtccagttcgacga 37 ldhA_For caatgatcggcggttcgc 38 ldhA_Rev gtttgccgtccagttcgacga 39 yqhD_For cacgtcgagtaaccgc 40 yqhD_Rev gtttgccgtccagttcgacga 41 gldA_For ctgcgggcgatcagcatatg 42 gldA_Rev gtttgccgtccagttcgacga 43 glpK_For gctgtttgcctgtttcgacaagc 44 glpK_Rev gtttgccgtccagttcgacga 45

Comparative Example 1. Preparation of Strain in which 3-HP Producing Gene Plasmid Vector is Inserted

[0165] In order to proceed an experiment using a 3-HP producing gene plasmid vector, the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector of Korean Patent Publication No. 10-2020-0051375 having 20-30 copy numbers was prepared, and the structure of the corresponding vector was shown in FIG. 4.

[0166] In addition, by purifying with qiagen PCR purification kit, after treating xbaI and bglII restriction enzymes (Thermo Scientific) to the pRSFDuet-1 (Merck Millipore 71341) vector, purified fragments of the vector were obtained. After that, for the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector, PCR was performed using primers of Table 6 below, and by treating the xbaI and bglII restriction enzymes and purifying with qiagen PCR purification kit, purified fragments of the 3-HP producing gene cassette recombinant vector were obtained.

TABLE-US-00006 TABLE6 Primer SEQ name Primersequence(5.fwdarw.3) IDNO: 3-HP_For ctagatttacagctagctcagtcc 46 3-HP_Rev tgccatattaataatcgatccctatctgc 47

[0167] The purified fragments of the pRSFDuet-1 vector obtained through the purification process were connected with the purified fragments of the 3-HP producing gene cassette recombinant vector with NEB T4 ligase (NEB M0202S) to prepare a 3-HP producing gene plasmid vector, and the structure of the prepared vector was shown in FIG. 5.

[0168] The prepared pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector and pRSFDuet-1 vector-based 3-HP producing gene plasmid vector was transformed by introducing it into the DKALG strain of Example 2 by electroporation using an electroporation device (Eppendorf Eporator), thereby preparing a strain in which the 3-HP producing gene plasmid based on the pRSFDuet-1 vector was inserted (3-HP_pRSF) and a strain in which the pCDF_J23101_dhaB_gdrAB_J23100_aldH_btuR vector plasmid was inserted (3-HP_pCDF).

Example 3. Cell 2-Step Culture and 3-HP Production

[0169] Culture was carried out through a 2-step culture method using a minimal medium (M9_Gly) containing only glycerol as a carbon source for the strains in which the 3-HP producing gene prepared in Example 2 was inserted into genomic DNA with 5 copy numbers (3-HP_5gD), 6 copy numbers (3-HP_6gD) and 7 copy numbers (3-HP_7gD), respectively, and the strain in which the 3-HP producing gene plasmid vector prepared in Comparative example 1 was inserted with 20-30 copy numbers (3-HP_pCDF) and the strain in which the 3-HP producing gene plasmid vector was inserted with 100 copy numbers or more (3-HP_pRSF).

[0170] The strains were inoculated with 1% in LB medium (growth medium) 50 mL and grown at 37 C. for 24 hours (first step culture), and whole cells were collected by centrifugation and the supernatant was discarded. Thereafter, the collected whole cells were added to a minimal medium containing purified water, M9 minimal medium salt, glycerol, magnesium sulfate and calcium chloride (M9_Gly; production medium) and cultured under the condition of 200 rpm at 37 C. for 24 hours or more (second step culture) to collect samples every predetermined time, and then confirm the 3-HP production by HPLC.

[0171] The LB medium is a medium prepared by dissolving BD Difco Miller Luria-Bertani product in DW (distilled water) at a concentration of 25 g/L and then autoclave sterilizing at 121 C. for 15 minutes, and the minimal medium (M9_Gly) is a medium containing Disodium phosphate 6 g, Monopotassium phosphate 3 g, Ammonium chloride 1 g, Sodium chloride 0.5 g, 1M CaCl.sub.2 0.1 ml, 1M MgSO.sub.4 2 ml, 5 mM Vitamin B.sub.12 0.1 ml and Glycerol 20 g per 1 L of medium. The HPLC measurement condition was shown in Table 7 below.

TABLE-US-00007 TABLE 7 Detector RI / UV detector Column Bio-Rad Aminex HPX-87H Ion Exclusion Column 300 mm 7.8 mm Mobile phase 0.5 mM H2SO4 Flow rate 0.4 mL/min Run time 35 min Column temperature 35 C. Detector temperature 35 C. Injection volume 5 L

Comparative Example 2. Strain Culture and 3-HP Production in the Conventional Way

[0172] Additionally, for comparison with the conventional way, using the strain in which the 3-HP producing gene plasmid vector prepared in Comparative example 1 was inserted with 20-30 copy numbers (3-HP_pCDF) and the strain in which the 3-HP producing gene plasmid vector was inserted with 100 copy numbers or more (3-HP_pRSF), they were cultured in a minimal medium containing Disodium phosphate 6 g, Monopotassium phosphate 3 g, Ammonium chloride 1 g, Sodium chloride 0.5 g, 1M CaCl.sub.2) 0.1 ml, 1M MgSO.sub.4 2 ml, 5 mM Vitamin B12 0.1 ml, Glycerol 20 g, Glucose 5 g and 5% Streptomycin 0.1 ml per 1 L of medium (M9_Glu).

[0173] Specifically, the strains (3-HP_pCDF and 3-HP_pRSF) were inoculated in the LB medium of Example 3 and cultured under the condition of 37 C., 200 RPM for 24 hours, and then the saturated culturing solution was inoculated in the minimal medium (M9_Glu) by 1 (v/v) % volume, and then, in the same manner, culturing which proceeds growth and production simultaneously was carried out under the condition of 37 C., 200 RPM for 24 hours.

Example 4. 3-HP Production Measurement Result According to Culture Method

[0174] The cell concentration measured through absorbance measurement measured in Example 3 and Comparative example 2 above and the 3-HP concentration measured in Example 3 and Comparative example 2 above were shown in Table 8 below.

TABLE-US-00008 TABLE 8 Used Cell 3-HP 3-HP concentration / Type of production concentration concentration cell concentration used strain medium (OD.sub.600) (g/L) (OD.sub.600) 3-HP_5gD M9_Gly 3.84 4.06 1.057 3-HP_6gD M9_Gly 3.78 4.9 1.296 3-HP_7gD M9_Gly 3.63 5.3 1.460 3-HP_pCDF M9_Glu 0.429 0.1967 0.459 3-HP_pRSF M9_Glu 0.477 0.1311 0.275 3-HP_pCDF M9_Gly 2.395 4.8790 2.037 3-HP_pRSF M9_Gly 2.978 0.8319 0.279

[0175] As a result, in case of the strain in which the 3-HP producing gene was inserted into genomic DNA, a linear 3-HP concentration increase was confirmed as the gene copy number increased, and through this, it was confirmed that the corresponding strain was appropriate for confirmation of recombinant gene performance.

[0176] However, in case of the strain in which the plasmid vector was inserted, when comparing the 3-HP concentration produced by the 3-HP_pRSF strain with 100 copy numbers or more and 3-HP_pCDF with 20-30 copy numbers, it was not possible to confirm a 3-HP concentration increase according to the increase in the copy number, and through this, it was confirmed that the corresponding strain was not suitable for confirming recombinant gene performance.

[0177] Through this, it was confirmed that the target gene should be inserted into genomic DNA, not inserted in a plasmid vector form, in order to confirm recombinant gene performance.

Example 5. Confirmation of Change in 3-HP Production According to Increase in Transduced Copy Number

[0178] In order to confirm the change in the 3-HP production of the strain transduced with a higher copy number (10, 12 copy numbers) than the strain in which the 3-HP producing gene transduction confirmed in Example 4 above was done with 5 and 7 copy numbers, the 3-HP production was confirmed in a 5 L fermenter (Working volume 2 L).

5-1. Recombinant Vector and Recombinant DNA Preparation

[0179] By the substantially same method as Example 1-2 above, the G recombinant vector was prepared, and the G recombinant vector was prepared, using gRNA having nucleic acid sequences of Table 9 below (fhuA, fadL, adhE, pflB and aldA) additionally.

TABLE-US-00009 TABLE9 SEQ gRNAsequence ID Nameofthe Target (5.fwdarw.3) AccessionNumber NO sequence fhuA TACGGCTGGTTGCCGAAAGAGGG P06971 76 fhuA_gRNA1 GCCAAAGATCCGGCAAACTCCGG (UniProt) 77 fhuA_gRNA2 fadL GCACCGATTAACGACCAATTTGG P0A8V6(Uniprot) 78 fadL_gRNA1 CCTGAAATGTGGGAAGTGTCAGG 79 fadL_gRNA2 adhE CGGGTGCGGGGAGAAGATAATG P0A9Q7(Uniprot) 80 adhE_gRNA G pflB CATTACTTTGTCCCACAGGGTGG P09373(Uniprot) 81 pflB_gRNA aldA GATTCACGCGTCATTAATAGTGG P25553(Uniprot) 82 aldA_gRNA

[0180] In addition, D recombinant DNA was prepared by the substantially same method as Example 1-3 above, and primers of Table 10 below were additionally used, and homology arms having sequences of Table 11 below were further used, to prepare D recombinant DNA.

TABLE-US-00010 TABLE10 homologyarmprimer homologyarmsequence(5.fwdarw.3) SEQIDNO fhuA_upstream_For ACTGAACCGCTCTAGTACCAACAATAACG 83 TAGATACCTGG fhuA_upstream_Rev TAGCTGTAAATCTAGAGACTGTCGCGCCG 84 CAATA fhuA_downstream_For TACTAGCGCAGCTTAGCACCGTCTAAAGG 85 TAAGCAGT fhuA_downstream_Rev CAGCAGCCTAGGTTATCCGACGGCGGCTG 86 ATGA fadL_upstream_For ACTGAACCGCTCTAGAAAACCTGACCCAT 87 AACACTC fadL_upstream_Rev TAGCTGTAAATCTAGGACCATAACCTCAA 88 TGATTTATTTT fadL_downstream_For TACTAGCGCAGCTTACGATTCACTATAGC 89 CTGGC fadL_downstream_Rev CAGCAGCCTAGGTTAATTAACTTCATCAT 90 TGTTATTTTCA adhE_upstream_For ACTGAACCGCTCTAGAAAGCGCAGCGCC 91 AGCTC adhE_upstream_Rev TAGCTGTAAATCTAGACAACGGCGTAATC 92 TGTGCTTC adhE_downstream_For TACTAGCGCAGCTTACTTGCTCTTGAGTG 93 AAACTGGCA adhE_downstream_Rev CAGCAGCCTAGGTTATAACGCGTACCCCA 94 GACGATG pflB_upstream_For ACTGAACCGCTCTAGCAGTGATGTACTGT 95 TTAGCCAGCCA pflB_upstream_Rev TAGCTGTAAATCTAGGTAAATCTGGTGTT 96 CTGACCGGTCT pflB_downstream_For TACTAGCGCAGCTTAGTAACACCTACCTT 97 CTTAAGTGGA pflB_downstream_Rev CAGCAGCCTAGGTTAGGCGAGATATGATC 98 TATATCAATTT aldA_upstream_For ACTGAACCGCTCTAGATGCACCACGCTGG 99 TTAAGT aldA_upstream_Rev TAGCTGTAAATCTAGTATTACCGGTCAAA 100 AGAGCGGG aldA_downstream_For TACTAGCGCAGCTTAAAACCTTTGGCCCG 101 GTGC aldA_downstream_Rev CAGCAGCCTAGGTTAGGTGCGAAGAAGG 102 TGTTGATTTCC

TABLE-US-00011 TABLE11 homologyarm homologyarmsequence(5.fwdarw.3) SEQIDNO fhuA_upstream taccaacaataacgtagatacctggtttgcgggcattgacggcagcacggtg 103 accatcacctgggtcggccgtgataacaaccagccgaccaaactgtatggtg ccagcggggcaatgtcgatttatcagcgttatctggctaaccagacgccaac gccgctgaatcttgttccgccagaagatattgcagatatgggcgtggactacg acggcaactttgtttgcagcggtggcatgcgtatcttgccggtctggaccagc gatccgcaatcgctgtgccagcagagcgagatgcagcagcagccgtcagg caatccgtttgatcagtcttctcagccgcagcaacagccgcaacagcaacct gctcagcaagagcagaaagacagcgacggtgtagccggttggatcaagga tatgtttggtagtaattaacatctaagcgtgaaataccggatggcgagttgcca tccggtaaaataacatcccatctaagatattaaccctttcttttcatctggttgttta ttaacccttcaggaacgctcagattgcgtaccgcttgcgaacccgccagcgtt tcgaatattatcttatctttataataatcattctcgtttacgttatcattcactttacat cagagatataccaatggcgcgttccaaaactgctcagccaaaacactcactg cgtaaaatcgcagttgtagtagccacagcggttagcggcatgtctgtttatgca caggcagcggttgaaccgaaagaagacactatcaccgttaccgctgcacct gcgccgcaagaaagcgcatgggggcctgctgcaactattgcggcgcgaca gtct fhuA_downstream gcaccgtctaaaggtaagcagtatgaagtcggcgtgaaatatgtaccggaag 104 atcgtccgattgtagttactggtgccgtgtataatctcactaaaaccaacaacct gatggcggaccctgagggttccttcttctcggttgaaggtggcgagatccgc gcacgtggcgtagaaatcgaagcgaaagcggcgctgtcggcgagtgttaa cgtagtcggttcttatacttacaccgatgcggaatacaccaccgatactaccta taaaggcaatacgcctgcacaggtgccaaaacacatggcttcgttgtgggct gactacaccttctttgacggtccgctttcaggtctgacgctgggcaccggtgg tcgttatactggctccagttatggtgatccggctaactcctttaaagtgggaagt tatacggtcgtggatgcgttagtacgttatgatctggcgcgagtcggcatggc tggctccaacgtggcgctgcatgttaacaacctgttcgatcgtgaatacgtcg ccagctgctttaacacttatggctgcttctggggcgcagaacgtcaggtcgtt gcaaccgcaaccttccgtttctaatttctcttttggggcacggatttccgtgccc atttcacaagttggctgttatgcaggaatacacgaatcattccgataccactttt gcactgcgtaatatctcctttcgtgtgcccgggcgcacgcttttgcatccgctg tcgttaacctttcctgccgggaaagtgaccggtctgattggtcacaacggttct ggtaaatccactctgctcaaaatgcttggccgtcatcagccgccgtcgga fadL_upstream aaaacctgacccataacactcccctgtaaaaaaataaataaagtggtctgacc 105 tgatcatagtcttaaccatttttttacatttagccaagtggagaaaagggaaagt gggagctatgacacagagagaaaagaagaagagaaaagaaaacgcccct gccagcaactgacaggggcgtacgtacccgagaggaattaacgcagaccc agctggaaaatcagcatttcagcttcgcaggcaaaagtgaaatcgatatcca ggcgcacaccgtcagactcttcagtgaaagtcggggtgattttgcaaggttca gattccacgctacgggctttttcagtcagegccgccagcgtttgctctgcttct gcgcggtttgcaaacacgcggctgtaagacgcggtgcagtcggagttgtcc ataatggtgccaacatccatacagcagcaaaccggggtttcatcagcactac atttactcatcgttgatttcctctgtatgtgcacccaaggtgccagataaacgttg tggatattttacgcttccggaaagtgctgctccagttgttaattctgcaaaatcg gataagtgaccgaaatcacacttaaaaatgatctaaaacaaaattcacccgaa tccatgagtgcgccacctccaaattttgccagctggatcgcgtttcttagatcat atttgaaaaaagatagaaacatacttgcaacattccagctggtccgacctatac tctcgccactggtctgatttctaagatgtacctcagaccctacacttegcgctcc tgttacagcacgtaacatagtttgtataaaaataaatcattgaggttatggtc fadL_downstream cgattcactatagcctggcttacaccagctggagtcagttccagcagctgaaa 106 gcgacctcaaccagtggcgacacgctgttccagaaacatgaaggctttaaag atgcttaccgcatcgcgttgggtaccacttattactacgatgataactggacctt ccgtaccggtatcgcctttgatgacagcccagttcctgcacagaatcgttctat ctccattccggaccaggaccgtttctggctgagtgcaggtacgacttacgcat ttaataaagatgcttcagtcgacgttggtgtttcttatatgcacggtcagagcgt gaaaattaacgaaggcccataccagttcgagtctgaaggtaaagcctggctg ttcggtactaactttaactacgcgttctgataacgcgttcgcctggataaagtca cctgcatagcaggtgactttaactcccccacttcaccgaaagtagtgtcctcat tgcttacctcctgagttttgcaaacagcctgttggcagcttgccctttcaaatca ataagcggtatccacagacaaacctgaagggaaaggcatattttcaggcgtt ctgctcgtccttctcaaagagtttacttttctgcatttccaggatactcccccccc ctggctattgtgcgctcatacactcaaattaaagataggttctaaataaatgagc gttttttgatagtctatttcattaggtaatatatatttgtaacaaatcaatcaaaatg gaataaaatcatgctaccatctatttcaatcaacaataccagcgcagcttaccc agaatccatcaatgaaaataacaatgatgaagttaat adhE_upstream aaagcgcagcgccagctcttcgaagtgagtttccggatgttcgtacataaccc 107 acatgatcttcgcggcgtccatcggggaaccaccacccagcgcgataatca cgtctggtttgaaggagtttgccagttctgcacctttacgaacgatgctcaggg tcgggtccgcttctacttcgaagaagacttcagtttcaacgcctgctgctttcag tacggaagtgatctgatcagcataaccattgttgaacaggaagcggtcagtca cgatgagcgcacgtttgtggccatcagtaatcacttcatccagcgcgattggc agggagccacggcggaagtagatagatttcggaagtttgtgccacaacatgt tttcagctcgcttagcaacggttttcttgttgatcaggtgtttcggaccaacgtttt cagagatggagttaccaccccaagaaccacaacccagagtcagggaaggt gcgagtttgaagttatacaggtcaccgataccaccctgagacgctggggtgtt aatcaggatacgcgccgttttcattttctgaccgaagtaagaaacgcgagccg gttggttatcctggtcagtgtacaggcaagaggtatgaccgataccgcccata gcaaccagtttctctgctttttctaccgcgtcttcgaaatctttagcgcggtacat tgccagagtcggggacagtttttcatgtgcgaacggttcgctttcatcaacaac ggtcacttcaccgatcagaatcttggtgttttctggtacagagaagcctgccag ttcagcaattttataggctggctgaccaacgatagccgcgttcagcgcaccgt ttttcaggataacatcctgaacagctttcagctctttaccctgcaacagatagcc gccgtgggttgcaaaacgttcacgtacagcgtcataaacagagtcaacaaca acaacagactgttcagaagcacagattacgccgttgt adhE_downstream cttgctcttgagtgaaactggcatattcacgctgggctttttttacacgctctacg 108 agtgcgttaagttcagcgacattagtaacagccataatgctctcctgataatgtt aaacttttttagtaaatcatctgctcgaatacgagagtatagtcagtgcggtgat gatttgcttaacctatgaaaatcaaaagcttactcgcgctcacactcactgtgat ttactaaaagagtttaaacattagagttattatctctaatgcgtcacttccaggtg gcgtaagcaagattactcacttctgggtactgattacgtgatccaaatcaaattt ttgcaaagctgacacctttcagcatcgcttttcgccattatagctaacagttaata aattgtagtatgatttggtggctacattagcatgttttgcacaactagataacaat aacgaatgatagcaattttaagtagttaggaggtgaaaaatgctgtcaaaagg cgtattgtcagcgcgtcttttcaaccttatttatggctaacattatccggcttttgct tcggagctaaccgtgattcagaccttttttgattttcccgtttacttcaaatttttcat cgggttatttgcgctggtcaacccggtagggattattcccgtctttatcagcatg accagttatcagacagcggcagcgcgaaacaaaactaaccttacagccaac ctgtctgtggccattatcttgtggatctcgctttttctcggcgacacgattctaca actttttggtatatcaattgattcgttccgtatcgccgggggtatcctggtggtga caatagcgatgtcgatgatcagcggcaagcttggcgaggataaacagaaca agcaagaaaaatcagaaaccgcggtacgtgaaagcattggtgtggtgccac tggcgttgccgttgatggggggccaggggcgatcagttctaccatcgtctg gggtacgcgtta pflB_upstream cagtgatgtactgtttagccagccagtccatgaagtgatccatgcgctccatca 109 cttcatcatagttcaggacatcgcctttgatcggttcagacttcggaccaacct gcattttcagtttttcgtcaacgccgccgttgattgcgtacagcatggttttcgcc aggtttgcacgcgcaccgaagaactgcatttgtttaccaacgatcatcgggct tacgcagcaagcaatagcgtagtcatcgttgttgaagtccggacgcatcagg tcatcgttctcatactgcagagaagaggtgtcgatggacactttagcggcgaa tttcttgaagttcagcggcagtttttcagaccacagaatggtcatgttcggttcc ggagacggacccatggtgtacagggtgttcaggaaacggaagctgtttttgg taaccagggtacgaccgtcgaggcccataccaccgatagattcggttgccca gatcgggtcgccagagaacagttcatcgtattccggagtacgcaggaagcg aaccatacgcagtttcatgaccaggtggtcaaccatttcctgcgcttcttgttcg gtgatcttgccagctttcaggtcacgttcgatgtacacatccaggaaggtgga ggtacgaccgaaggacattgcagcaccgttctgagacttaacagcagccag gtagccgaagtaagtccactggatagcttcctgagcgttggtagccggacca gagatgtcgtagccgtatttcgcagccatttctttcatctgacccagagcgcgg tgctgttcagcgatttcttcgcgcagacggatagtctgttccaggtttacgccgt tttccagatcagcctgcagagaagtgaactgtgccagtttgtctttcatcaggta gtcgataccgtacagcgcaacgcgacggtagtcaccgatgatacggccacg gccatatgcatctggcagaccggtcagaacaccagatttac pflB_downstream gtaacacctaccttcttaagtggattttttatttactgcgtacttcgacaaccatta 110 atggtggtcgttttcacgcaggtaaatgacccagtatgtcaacccaaccaaca aaccaccaccgataatgttgccgatcgtaaccggaatcaggttatcagtgatg aaattcatcacggtcaggtgagaaaaattttccggtgcagaaccgactgcggt ccaaaattccggggatgcgaagtcgcggattacaatacccatcgggatcata aacatgtttgcgatactgtgctcaaaaccgctggcaacaaacatcgcgaccg gcagcaccataatgaacgctttgtccatcaggctgcggccagaataactcatc catactgccagacataccatcaggtttgccaggataccaagacagacggcct caataaaagtatggtgcactttgtggtcggcggtttgtaggacgtttagtcccc attgaccatttgcggtcatatactcgccggaaagccacattaaaagtacaaac agcagtgcgccgaccaggttgccaaaatagacatttagccagtttttcgccaa ctgaccccaggtgatgcgcccactcgccttagcaacaacaatcaacacggt ggaagtaaagagatcggctccgcagacaacacaaagaatcagccccagag agaagcaaatgccgccaaccagttttgccatgccgaagggcattgtgcctgt gccagtggttgctgtgatatagaagacgaatgcgattgagatgaaaacaccg gcggtaatcgccagatagaaagtcttaagcggatgtttcgttgctttatagaca cccgcctcttcggccactttggccattgcagcaggaagtaaaagatcaaaag ggttgtcagctttcacactaactctctctttattaagtcggcgacgagatactaa caaagcattatagatgagaaattgatatagatcatatctcgcc aldA_upstream atgcaccacgctggttaagttatcccggattcgttcctcagttaggaaataacg 111 cagacagtgtaatctttattaatcagttacaaggattatggccagttgagcgtta tctctcactactcactggcgagctgccgcgtttacgcgatgatagcgatggct acggtccccgcgggcgagattttatcgttcacgttgattttccggcagaagtca tccatgcatggcaaacgctgaaacatgatgcggtgctcatcgaggcgatgga aagtcgctcgttacgttaaaaattgcccgtttgtgaaccacttgtttgcaaacgg gcatgactcctgacttttatttctgccttttattccttttacacttgtttttatgaagcc cttcacagaattgtcctttcacgattccgtctctctgatgattgatgttaattaaca atgtattcaccgaaaacaaacatataaatcacaggagtcgcccatgtcagtac ccgttcaacatcctatgtatatcgatggacagtttgttacctggcgtggagacg catggattgatgtggtaaaccctgctacagaggctgtcatttcccgcataccc gatggtcaggccgaggatgcccgtaaggcaatcgatgcagcagaacgtgc acaaccagaatgggaagcgttgcctgctattgaacgcgccagttggttgcgc aaaatctccgccgggatccgcgaacgcgccagtgaaatcagtgcgctgatt gttgaagaagggggcaagatccagcagctggctgaagtcgaagtggctttta ctgccgactatatcgattacatggcggagtgggcacggcgttacgagggcg agattattcaaagcgatcgtccaggagaaaatattcttttgtttaaacgtgcgctt ggtgtgactaccggcattctgccgtggaacttcccgttcttcctcattgcccgc aaaatggctcccgctcttttgaccggtaata aldA_downstream aaacctttggcccggtgctgccagttgtcgcatttgacacgctggaagatgct 112 atctcaatggctaatgacagtgattacggcctgacctcatcaatctatacccaa aatctgaacgtcgcgatgaaagccattaaagggctgaagtttggtgaaactta catcaaccgtgaaaacttcgaagctatgcaaggcttccacgccggatggcgt aaatccggtattggcggcgcagatggtaaacatggcttgcatgaatatctgca gacccaggtggtttatttacagtcttaatgagtgaaagaggcggaggttttttcc tccgcctgtgcgcgtcagagtttagcgaatttttcgagggtgcgaataagctgt gtgacgaagccatattcgttatcgtaccaggcgaccgttttcaccagttgtaaa tcgcccacggcggtaatttccgtttgcgtggcatcaaacaccgaaccgaaat ggctgccaatgatatcggaagagactatttcttcatcggtataaccaaatgact cgttattggtggttgcttgtttaagtgcgttattcacctcttcggcagtcactttttt ccgagaatcgataccagttcagtgaccgaacctgttttcaccggcacgcgttg cgcatgacctttcagtttgccgctcagttccgggatcaccagaccaatggcttt tgccgcccccgtagtgtggggaatgatattttctgccgctgcgcgtgaagcac gtaaatctttaccacgcgggccatccaccagtgactgggtgccagtataggc atgaatggtcgtcatcgtgccgacttctatcccgaaactgtcatgcaaggcttt ggccatcggcgcaagacagttagtggtgcatgacgccacggaaacaatggt gtcgttgccatccagagtgtcgtcattgacgttataaacgatagttttcatttcac cggcaggggcggaaatcaacaccttcttcgcacc

5-2. Gene Deletion and Preparation of Strain in which 3-HP Producing Gene is Inserted into Genomic DNA

[0181] The common recombinant vector prepared in Example 1-1, G recombinant vector and D recombinant DNA prepared in Example 5-1 were transduced into W3110 which was a strain in which yqhD, glpK, ldhA, ack-pta and gldA genes were deleted from E. coli W3110 strain (purchased from KCTC) (yqhD, glpK, ldhA, ack-pta and gldA) (named as DKALG strain) with 5 copy numbers, 7 copy numbers, 10 copy numbers and 12 copy numbers, respectively. After that, a transformant was prepared by expressing Cas9 and RED recombinase of the common recombinant vector.

[0182] The 5-copy number and 7-copy number transducing was performed by the substantially same method as Example 2 above, and the 10-copy number transducing was transducing using ldhA, gldA, glpK, yghD, mgsA, poxB, nfrA, fhuA, fadL and adhE (10) sgRNA of Example 5-1 above, and the 12-copy number transducing was transducing using ldhA, gldA, glpK, yghD, mgsA, poxB, nfrA, fhuA, fadL, adhE, pflB and aldA (12) sgRNA. In addition, in order to confirm insertion of the target gene, using primers of Table 12 below in addition to the primers used in Example 2 above, insertion of the target gene was confirmed.

TABLE-US-00012 TABLE12 Primer SEQ Name PrimerSequence(5.fwdarw.3) IDNO fhuA_For tggaccatgcagcaggtggtacaac 113 fhuA_Rev gtttgccgtccagttcgacga 114 fadL_For gtacgtaaaccgctaacaatggcga 115 fadL_Rev gtttgccgtccagttcgacga 116 adhE_For ttcgggaacttgtagatacgtttac 117 adhE_Rev gtttgccgtccagttcgacga 118 pflB_For gtacttgtcgtgcatgtagtgga 119 pflB_Rev gtttgccgtccagttcgacga 120 aldA_For gttccgccgtatgactgg 121 aldA_Rev gtttgccgtccagttcgacga 122

5.3 Cell 2-Step Culture and 3-HP Production

[0183] For the strains in which the 3-HP producing gene prepared in Example 5.2 was inserted into genomic DNA with 5 copy numbers (3-HP_5gD), 7 copy numbers (3-HP_7gD), 10 copy numbers (3-HP_10gD) or 12 copy numbers (3-HP_12gD), respectively, high concentration cell culture was performed in a 5 L fermenter (Working volume 2 L) by a fed-batch culture method.

[0184] Specifically, glucose 20 g/L, and an antibiotic for selection (streptomycin) 25 mg/L was added to MR medium (KH.sub.2PO.sub.4 6.67 g, (NH.sub.4).sub.2HPO.sub.4 4 g, MgSO.sub.4.Math.7H2O 0.8 g, citric acid 0.8 g, and trace metal solution 5 mL per 1 L; herein, Trace metal solution was 5M HCl 5 mL, FeSO.sub.4.Math.7H.sub.2O 10 g, CaCl.sub.2 2 g, ZnSO.sub.4.Math.7H.sub.2O 2.2 g, MnSO.sub.4.Math.4H.sub.2O 0.5 g, CuSO.sub.4.Math.5H.sub.2O 1 g, (NH.sub.4).sub.6Mo.sub.7O.sub.2.Math.4H.sub.2O 0.1 g, and Na.sub.2B.sub.4O.sub.2.Math.10H.sub.2O 0.02 g per 1 L) and it was used as a cell culture medium, and the temperature of 35 C. Celsius was maintained. pH was maintained at 6.95 using ammonia water, and the dissolved oxygen amount (DO) was maintained at 20% while increasing the stirring speed stepwise up to 900 rpm, and the aeration was maintained at 1 vvm, and the fed-batch culture was performed using the pH-stat feeding method, and glucose was added at 3 g/L.

[0185] After completing the high concentration cell culture of 20 hours, the cell culture solution was centrifuged at 6,000 rpm at 4 degrees Celsius for 10 minutes to recover cells. The recovered cells were suspended in PBS (phosphate-buffered saline) and used in the next step.

[0186] The medium for 3-HP production was prepared by adding 70 g/L of glycerol and 50 uM of vitamin B.sub.12 to M9 medium comprising no glucose. The cell suspension prepared above was inoculated into the medium for 3-HP production so that the cell inoculum amount was 5 g/L (based on dry cell weight), and the 3-HP production step was performed in a 5 L fermenter (Working volume 2 L). The culture condition for 3-HP production was that the temperature was maintained at 35 C. Celsius, and the stirring speed was maintained at 300 rpm, and the aeration was maintained at 1 vvm, and the pH was maintained at 7.0 using Ca(OH).sub.2, and it was proceeded for 24 hours.

[0187] The 3-HP concentration over time in the 3-HP production process was measured by high pressure liquid chromatography (High Pressure; HPLC), and the result was shown in Table 13 below.

TABLE-US-00013 TABLE 13 3-HP concentration Type of used strain (g/L) 3-HP_5gD 64.6 3-HP_7gD 75.6 3-HP_10gD 91.0 3-HP_12gD 115.5

[0188] As a result, as confirmed in Example 4 above, in case of the strain in which the 3-HP producing gene was inserted into genomic DNA, a linear 3-HP concentration increase was confirmed as the gene copy number increased, and in particular, in case of inserting the gene of 10 copy numbers and 12 copy numbers, a linear 3-HP concentration increase was confirmed. Through this, it was confirmed that the corresponding strain was suitable for confirmation of recombinant gene performance, and inserting a target gene into genomic DNA for confirmation of recombinant gene performance was appropriate.