Competitive and effective bacterial strains
09975816 ยท 2018-05-22
Assignee
Inventors
- Yaowei Kang (Durham, NC, US)
- Shawn Semones (Salem, VA)
- Jessica Smith (Bagsvaerd, DK)
- Kristi Woods (Salem, VA, US)
Cpc classification
C05F11/08
CHEMISTRY; METALLURGY
A01N63/20
HUMAN NECESSITIES
C12R2001/01
CHEMISTRY; METALLURGY
A01N43/90
HUMAN NECESSITIES
International classification
A01N63/00
HUMAN NECESSITIES
A01N43/90
HUMAN NECESSITIES
C05F11/08
CHEMISTRY; METALLURGY
Abstract
According to the present invention new isolates of bacterial strains have been shown to possess unique properties. These bacterial strains are plant growth-promoting rhizobacterium (PGPR), posses an enhanced competitive advantage at colonizing leguminous plants, and enhance the overall performance of leguminous plant growth. Further still, the present invention discloses a novel method for screening and selecting bacterial strains having the aforementioned beneficial characteristics.
Claims
1. A method of enhancing plant growth, comprising: applying an inoculant composition to a seed, to soil in which said seed is to be planted, to soil in which said seed has been planted and/or to a plant that germinates from said seed, said inoculant composition comprising the Bradyrhizobia japonicum strain having the deposit accession number NRRL B-50729.
2. The method of claim 1, wherein application of said inoculant composition results in increased plant yield measured in terms of bushels/acre, increased fruit number, increased root number, increased root length, increased root mass, increased root volume, increased leaf area, increased plant stand, increased plant vigour, and/or increased nitrogen (N.sub.2) fixing capability, as compared to application of one or more commercially available Bradyrhizobium strains.
3. The method of claim 1, wherein application of said inoculant composition results in increased plant yield measured in terms of bushels/acre, increased fruit number, increased root number, increased root length, increased root mass, increased root volume, increased leaf area, increased plant stand, increased plant vigour, and/or increased nitrogen (N.sub.2) fixing capability, as compared to application of USDA 532C.
4. The method of claim 1, wherein said inoculant composition further comprises a peat-based powder or granuale.
5. The method of claim 1, wherein said inoculant composition further comprises an agronomically acceptable liquid carrier.
6. The method of claim 1, wherein said inoculant composition further comprises a growth medium that provides one or more nutrients to said Bradyrhizobia japonicum strain.
7. The method of claim 1, wherein said inoculant composition further comprises one or more isolated plant signal molecules.
8. The method of claim 1, wherein said inoculant composition further comprises at least one lipo-chitooligosaccharide (LCO).
9. The method of claim 1, wherein said inoculant composition further comprises at least one chitooligosaccharide (CO).
10. The method of claim 1, wherein said inoculant composition further comprises at least one chitinous compound, flavonoid, and/or karrikin.
11. The method of claim 1, wherein said inoculant composition further comprises jasmonic acid or an ester, amide, glycoside or salt thereof; linoleic acid or an ester, amide, glycoside or salt thereof; and/or linolenic acid or an ester, amide, glycoside or salt thereof.
12. The method of claim 1, wherein said inoculant composition further comprises at least one phosphate solubilising microorganism.
13. The method of claim 12, wherein said at least one phosphate solubilizing microorganism comprises a strain of Penicillium.
14. The method of claim 12, wherein said at least one phosphate-solubilizing microorganism comprises a strain of P. bilaiae.
15. The method of claim 12, wherein said at least one phosphate solubilizing microorganism comprises the strain P. bilaiae having the deposit accession number NRRL 50169.
16. The method of claim 12, wherein said at least one phosphate solubising microorganism further comprises the strain of P. gaestrivorus having the deposit accession number NRRL 50170.
17. The method of claim 12, wherein said at least one phosphate solubising microorganism further comprises the strain of P. bilaiae having the deposit accession number NRRL 50162.
18. The method of claim 12, wherein said at least one phosphate solubising microorganism further comprises the strain of P. bilaiae having the deposit accession number ATCC 20851.
19. The method of claim 12, wherein said at least one phosphate solubising microorganism further comprises the strain of P. bilaiae having the deposit accession number ATCC 22348.
20. The method of claim 12, wherein said at least one phosphate solubising microorganism further comprises the strain of P. bilaiae having the deposit accession number ATCC 18309.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) The present invention provides isolated strains of bacteria having at least the following enhanced characteristics in comparison to commercially available strains, e.g., commercial strain USDA 532C, wherein enhanced characteristics include, but are not limited to: a. enhanced competitiveness for colonizing a plant; and b. enhanced effectiveness at promoting plant growth.
(8) Bacterial strain(s) as used herein, means bacterial strains that are diazotrophs. That is, bacteria which are symbiotic nitrogen-fixing bacteria. Non-limiting examples of bacterial strains as used herein include, but are not limited to bacteria from the genera Rhizobium spp. (e.g., R. cellulosilyticum, R. daejeonense, R. etli, R. galegae, R. gallicum, R. giardinii, R. hainanense, R. huautlense, R. indigoferae, R. leguminosarum, R. loessense, R. lupini, R. lusitanum, R. mongolense, R. miluonense, R. sullae, R. tropici, R. undicola, and/or R. yanglingense), Bradyrhizobium spp. (e.g., B. bete, B. canariense, B. elkanii, B. iriomotense, B. japonicum, B. jicamae, B. liaoningense, B. pachyrhizi, and/or B. yuanmingense), Azorhizobium spp. (e.g., A. caulinodans and/or A. doebereinerae), Sinorhizobium spp. (e.g., S. abri, S. adhaerens, S. americanum, S. aboris, S. fredii, S. indiaense, S. kostiense, S. kummerowiae, S. medicae, S. meliloti, S. mexicanus, S. morelense, S. saheli, S. terangae, and/or S. xinjiangense), Mesorhizobium spp (M. albiziae, M. amorphae, M. chacoense, M. ciceri, M. huakuii, M. loti, M. mediterraneum, M. pluifarium, M. septentrionale, M. temperatum, M. tianshanense). In one particular embodiment, bacterial strain(s) of the invention further include Bradyrhizobium japonicum strains having the deposit accession numbers NRRL B-50592 (deposited also as NRRL B-59571), NRRL B-50593 (deposited also as NRRL B-59572), NRRL B-50586 (deposited also as NRRL B-59565), NRRL B-50588 (deposited also as NRRL B-59567), NRRL B-50587 (deposited also as NRRL B-59566), NRRL B-50589 (deposited also as NRRL B-59568), NRRL B-50591 (deposited also as NRRL B-59570); NRRL B-50590 (deposited also as NRRL B-59569); NRRL B-50594 (deposited also as NRRL B-50493); NRRL B-50726; NRRL B-50727; NRRL B-50728; NRRL B-50729; NRRL B-50730, or a combination of at least two or more of the above deposited strains, including two of the above strains, at least three of the above strains, at least four of the above strains, at least five of the above strains, at least six of the above strains, at least seven of the above strains, at least eight of the above strains, at least nine of the above strains, at least ten of the above strains, at least eleven of the above strains, at least twelve of the above strains, at least thirteen of the above strains, up to and including all of the above strains.
(9) The term commercially available strain(s) means commercially available bacterial strains, e.g., USDA 532C, USDA 110, USDA 123, USDA 127, USDA 129, etc. Cregan, P. B., et al., 1989, Appl. and Enviro. Microbiol. 55 (10): 2532-2536.
(10) As used herein, enhanced competitiveness and/or enhanced nodulation is defined to mean bacterial strain(s) possessing a dominant percent nodule occupancy, e.g. at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, up to 100% nodule occupancy. Enhanced competitiveness was determined pursuant to the detailed assay(s) described below (see Materials and Methods: Primary Screening Protocol and Competition Study Protocol).
(11) As used herein, the term nodule is defined to include, but is not intended to be limited to, determinate nodules, indeterminate nodules, or a combination thereof. Examples of determinate nodules and indeterminate nodules are well known in the art and described in Denison, R. F., 2000, The Amer. Naturalist. 156 (6): 567-576. Determinate nodules are found on Glycine, Lotus, or Phaseolus species and are round and spherical in shape. (Denison, 2000) Determinate nodules grow only for a limited period of timetypically a few weeks. (Denison, 2000) In contrast to determinate nodules, indeterminate nodules are found on Medicago, Trifolium, and Pisium species, have an elongated shape and grow continuously. (Denison, 2000)
(12) Nodule occupancy is a term known in the art. McDermott T. R. & Graham, P. H., Appl. and Environ. Microbiol. 55(10): 2493-2498. As used herein, nodule occupancy means the percent of nodules occupied by a bacterial strain(s) other than a commercially available Bradyrhizobium strain, e.g. USDA 532C, and/or the number of nodules containing a particular bacterial strain(s) other than a commercially available Bradyrhizobium strain, e.g. USDA 532C, divided by the total number of nodules containing all bacterial strains. Nodule occupancy was determined pursuant to the detailed assay(s) described below (see Materials and Methods: Primary Screening Protocol and Competition Study Protocol) and can be determined from an analysis of nodules from plants obtained from either greenhouse or field samples. By way of example, percent nodule occupancyA/(A+B) wherein A is the number of nodules containing a particular bacterial strain(s) other than a commercially available Bradyrhizobium strain, e.g. USDA 532C, and B is the number of nodules containing a commercially available Bradyrhizobium strain, e.g., USDA 532C. It is well known in the art that, notwithstanding the rare exception, a single nodule will contain only one bacterial strain. Johnston, A. W. B., et al., 1974, J. Gen. Microbiol 87: 343-350; Dunham, D. H. & Baldwin, I. L., 1931, Soil Science 32: 235-249; Johnson, H. W., et al., 1963, Agrono. J. 55: 269-271; Dudman, W. F. & Brockwell, J., 1968, J. Agricul. Res. 19: 739-747; Nicol, H. & Thorton, H. G., 1941, Proc. Roy. Soc. B 130, 32-59; Hughes, D. Q., & Vincent, J. M., 1942, Proc. of the Linnenan Soc. of New South Wales 67: 142-152; and Vincent, J. M. & Waters, L. M., 1953, J. Gen. Microbiol. 9: 357-370.
(13) As used herein, enhanced effectiveness at promoting growth includes at least one of increased plant yield measured in terms of bushels/acre, increased fruit number, increased root number, increased root length, increased root mass, increased root volume, increased leaf area, increased plant stand, increased plant vigour, and/or increased nitrogen (N.sub.2) fixing capability. Enhanced effectiveness at promoting growth was determined pursuant to the detailed assay(s) described below (see Materials and Methods: Primary Screening Protocol and Performance Study Protocol) and can be determined from an analysis of plants obtained from either greenhouse or field samples.
(14) As used herein increased fruit number means an increased total number of soybean pods on a soybean plant and/or an increased total dry weight of soybean pods on a soybean plant.
(15) As used herein total dry weight means the weight of plant matter (e.g., plant fruit, plant pods, plant roots, plant nodules, whole plants, partial plants, etc.) following incubation at 80 C. for a specified period of time, e.g., at least 4 hours, at least 8 hours, at least 12 hours, at least 24 hours, at least 48 hours, etc., or any period of time necessary to dry the plant matter. It is to be understood that drying times for the purposes of determining total dry weight are dependent on many factors. Non-limiting factors which may impact drying time include the material to be dried, the mass of the material to be dried, the amount of material to be dried, and/or combinations thereof. Incubation can be performed in any temperature controlled device used in the art. For the purposes of this invention, total dry weight was determined with an Eppendorf Innova 42R incubator.
(16) The term increased nitrogen (N.sub.2) fixing capability, as used herein, means the isolated bacteria may increase nitrogen (N.sub.2) fixation. Pursuant to the Performance Study Protocol provided infra (Materials and Methods), the relative nitrogen (N.sub.2) fixing capability of bacteria can be quantified by measuring the total nitrogen content of the plant using standard nitrogen quantifying methods known to those possessing an ordinary skill in the art (e.g., the Kjeldahl method, etc.). See Takahashi, M., et al., 2007. Uptake, Assimilation, and Novel Metabolism of Nitrogen Dioxide in Plants, p. 109-118. In N. Willey (ed.), Phytoremediation: Methods and Reviews, vol. 23. Humana Press, New York; Bremner, J. M. 1965. Total nitrogen, p. 1149-1178. In C. A. Black (ed.), Methods of soil analysis, vol. 2. American Society for Agronomy, Madison; Schank, S. C., et al., 1981, App. and Enviro. Microbiol., 41 (2): 342-345.
(17) In yet another aspect of the present invention, the isolated bacterial strain(s) have an enhanced temperature tolerance. Enhanced temperature tolerance means the range of temperatures at which the isolated bacterial strain(s) are able to grow, e.g., the maximum and minimum temperatures at which isolated Bradyrhizobium strain(s) can grow. In one aspect, enhanced temperature tolerance was determined according to the Temperature Profile Protocol discussed infra (Materials and Methods).
(18) In yet another aspect of the present invention, the isolated bacterial strain(s) are naturally resistant to glyphosate. In one aspect, enhanced temperature tolerance was determined according to the Glyphosate Resistance Profile Protocol discussed infra (Materials and Methods).
(19) In another aspect, the isolated bacterial strain(s) of the present invention includes strain(s) that are closely related to any of the above strains on the basis of 16S rDNA sequence identity. See Stackebrandt E, et al., Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology, Int J Syst Evol Microbiol. 52(3):1043-7 (2002) regarding use of 16S rDNA sequence identity for determining relatedness in bacteria. In an embodiment, the at least one strain is at least 95% identical to any of the above strains on the basis of 16S rDNA sequence identity, at least 96% identical to any of the above strains on the basis of 16S rDNA sequence identity, at least 97% identical to any of the above strains on the basis of 16S rDNA sequence identity, at least 98% to any of the above strains on the basis of 16S rDNA sequence identity, at least 98.5% identical to any of the above strains on the basis of 16S rDNA sequence identity, at least 99% identical to any of the above strains on the basis of 16S rDNA sequence identity or at least 99.5% to any of the above strains on the basis of 16S rDNA sequence identity.
(20) In another embodiment, the present invention includes a method for isolating bacterial strain(s) having enhanced competitiveness for occupying the nodules of a leguminous plant and enhanced effectiveness at promoting leguminous plant growth. As used herein, the term isolate, isolates, isolating, and/or isolated, etc. means that the referenced material is removed from the environment in which it is normally found. The method includes, among other things, a. obtaining a bacterial strain(s) from a soil sample; b. subjecting the bacterial strain(s) and a commercially available strain to a leguminous plant; c. selecting the bacterial strain(s) which are more competitive than the commercially available strain for occupying the nodules of a leguminous plant; d. analyzing the selected bacterial strain(s) which are more competitive than the commercially available strain for occupying the nodules of a leguminous plant for those bacterial strain(s) having an enhanced effectiveness at promoting leguminous plant growth; and e. isolating the bacterial strain(s) having enhanced effectiveness at promoting leguminous plant growth.
(21) In one aspect, the isolated bacterial strain(s) are strains from the genus Bradyrhizobium. In still yet another aspect, the method further includes the step of screening the Bradyrhizobium strain(s) against a specific primer unique to a commercially available strain of Bradyrhizobia, e.g., commercial strain USDA 532C.
(22) In yet another aspect, the method includes isolating a culture of Bradyrhizobia japonicum selected from the group consisting of:
(23) the strain having the deposit accession number NRRL B-50592 (deposited also as NRRL B-59571);
(24) the strain having the deposit accession number NRRL B-50593 (deposited also as NRRL B-59572);
(25) the strain having the deposit accession number NRRL B-50586 (deposited also as NRRL B-59565);
(26) the strain having the deposit accession number NRRL B-50588 (deposited also as NRRL B-59567);
(27) the strain having the deposit accession number NRRL B-50587 (deposited also as NRRL B-59566);
(28) the strain having the deposit accession number NRRL B-50589 (deposited also as NRRL B-59568);
(29) the strain having the deposit accession number NRRL B-50591 (deposited also as NRRL B-59570);
(30) the strain having the deposit accession number NRRL B-50590 (deposited also as NRRL B-59569);
(31) the strain having the deposit accession number NRRL B-50594 (deposited also as NRRL B-50493);
(32) the strain having the deposit accession number NRRL B-50726;
(33) the strain having the deposit accession number NRRL B-50727;
(34) the strain having the deposit accession number NRRL B-50728;
(35) the strain having the deposit accession number NRRL B-50729; and
(36) the strain having the deposit accession number NRRL B-50730, or a combination of at least two or more of the above deposited strains, including more than two, such as, at least three of the above strains, at least four of the above strains, at least five of the above strains, at least six of the above strains, at least seven of the above strains, at least eight of the above strains, at least nine of the above strains, at least ten of the above strains, at least eleven of the above strains, at least twelve of the above strains, at least thirteen of the above strains, up to an including all of the above strains.
(37) In still another aspect, the method includes isolating bacterial strain(s) having enhanced temperature tolerance. See Materials and Methods: Temperature Profile Protocol.
(38) Further still, the method includes isolating a bacterial strain(s) having natural resistance to glyphosate. See Materials and Methods: Glyphosate Resistance Profile Protocol.
(39) In another preferred aspect, the method includes isolating bacterial strain(s) selected from the genus consisting of Rhizobium and Bradyrhizobium capable of enhancing the nodulation of a leguminous plant.
(40) Composition
(41) The present invention includes a composition comprising at least one of the isolated bacterial strain(s) of the present invention or a combination of at least two or more of the above deposited strains, including more than two, such as, at least three of the above strains, at least four of the above strains, at least five of the above strains, at least six of the above strains, at least seven of the above strains, at least eight of the above strains, at least nine of the above strains, at least ten of the above strains, at least eleven of the above strains, at least twelve of the above strains, at least thirteen of the above strains, up to an including all of the above strains and an agronomically suitable carrier.
(42) In some embodiments, the composition may be an inoculant composition. As used herein and in the art, the term inoculant composition refers generally to compositions or materials that introduce compatible bacterial strains either onto an external surface of seeds or in the seed furrow.
(43) The composition may comprise one or more agronomically acceptable carriers. In instances where multiple agronomically acceptable carriers are used, the agronomically acceptable carriers may be the same or different. As used herein in connection with carrier, the term agronomically acceptable refers to any material which can be used to deliver the actives to a seed, soil or plant, and preferably which carrier can be added (to the seed, soil or plant) without having an adverse effect on plant growth, soil structure, soil drainage or the like. Suitable carriers comprise, but are not limited to, wheat chaff, bran, ground wheat straw, peat-based powders or granules, gypsum-based granules, and clays (e.g., kaolin, bentonite, montmorillonite). Formulations as liquid, peat, or wettable powder will be suitable for coating of seeds. When used to coat seeds, the material can be mixed with water, applied to the seeds and allowed to dry. Example of yet other carriers include moistened bran, dried, sieved and applied to seeds prior coated with an adhesive, e.g., gum arabic. In embodiments that entail formulation of the actives, the agronomically acceptable carrier may be aqueous. If a liquid carrier is used, the liquid (e.g., water) carrier will typically include growth media to culture the bacterial strains. Non-limiting examples of suitable growth media for the bacterial strains include mannitol yeast extract, glycerol yeast extract, or any media known to those skilled in the art to be compatible with, and/or provide growth nutrients to the bacterial strains.
(44) Also encompassed by the compositions of the present invention are compositions including one or more signal molecules. Non-limiting examples of plant signal molecules include nod factors (i.e., lipo-chitooligosaccharies), chitooligosaccharides, chitinous compounds, flavonoids, jasmonic acid or derivatives thereof, linoleic acid or derivatives thereof, linolenic acid or derivatives thereof, karrikins, or combinations thereof.
(45) Lipo-chitooligosaccharide compounds (LCO's), also known in the art as symbiotic Nod signals or Nod factors, consist of an oligosaccharide backbone of -1,4-linked N-acetyl-D-glucosamine (GlcNAc) residues with an N-linked fatty acyl chain condensed at the non-reducing end. LCO's differ in the number of GlcNAc residues in the backbone, in the length and degree of saturation of the fatty acyl chain, and in the substitutions of reducing and non-reducing sugar residues. An example of an LCO is presented below as formula I:
(46) ##STR00001##
in which:
(47) G is a hexosamine which can be substituted, for example, by an acetyl group on the nitrogen, a sulfate group, an acetyl group and/or an ether group on an oxygen,
(48) R.sub.1, R.sub.2, R.sub.3, R.sub.5, R.sub.6 and R.sub.7, which may be identical or different, represent H, CH.sub.3 CO, C.sub.x, H.sub.y CO where x is an integer between 0 and 17, and y is an integer between 1 and 35, or any other acyl group such as for example a carbamyl,
(49) R.sub.4 represents a mono-, di- or triunsaturated aliphatic chain containing at least 12 carbon atoms, and n is an integer between 1 and 4.
(50) LCOs may be obtained (isolated and/or purified) from bacteria such as Rhizobia, e.g., Rhizobium spp., Bradyrhizobium spp., Sinorhizobium spp. and Azorhizobium spp. LCO structure is characteristic for each such bacterial species, and each strain may produce multiple LCO's with different structures. For example, specific LCOs from S. meliloti have also been described in U.S. Pat. No. 5,549,718 as having the formula II:
(51) ##STR00002##
in which R represents H or CH.sub.3CO and n is equal to 2 or 3.
(52) Even more specific LCOs include NodRM, NodRM-1, NodRM-3. When acetylated (the RCH.sub.3 CO), they become AcNodRM-1, and AcNodRM-3, respectively (U.S. Pat. No. 5,545,718).
(53) LCOs from Bradyrhizobium japonicum are described in U.S. Pat. Nos. 5,175,149 and 5,321,011. Broadly, they are pentasaccharide phytohormones comprising methylfucose. A number of these B. japonicum-derived LCOs are described: BjNod-V (C.sub.18:1); BjNod-V (A.sub.C, C.sub.18:1), BjNod-V (C.sub.16:1); and BjNod-V (A.sub.C, C.sub.16:0), with V indicating the presence of five N-acetylglucosamines; Ac an acetylation; the number following the C indicating the number of carbons in the fatty acid side chain; and the number following the : the number of double bonds.
(54) LCO's used in compositions of the invention may be obtained (i.e., isolated and/or purified) from bacterial strains that produce LCO's, such as strains of Azorhizobium, Bradyrhizobium (including B. japonicum), Mesorhizobium, Rhizobium (including R. leguminosarum), Sinorhizobium (including S. meliloti), and bacterial strains genetically engineered to produce LCO's.
(55) Also encompassed by the present invention are compositions using LCOs obtained (i.e., isolated and/or purified) from a mycorrhizal fungus, such as fungi of the group Glomerocycota, e.g., Glomus intraradicus. The structures of representative LCOs obtained from these fungi are described in WO 2010/049751 and WO 2010/049751 (the LCOs described therein also referred to as Myc factors).
(56) Further encompassed by compositions of the present invention is use of synthetic LCO compounds, such as those described in WO 2005/063784, and recombinant LCO's produced through genetic engineering. The basic, naturally occurring LCO structure may contain modifications or substitutions found in naturally occurring LCO's, such as those described in Spaink, Crit. Rev. Plant Sci. 54:257-288 (2000) and D'Haeze, et al., Glycobiology 12:79R-105R (2002). Precursor oligosaccharide molecules (COs, which as described below, are also useful as plant signal molecules in the present invention) for the construction of LCOs may also be synthesized by genetically engineered organisms, e.g., as in Samain, et al., Carb. Res. 302:35-42 (1997); Samain, et al., J. Biotechnol. 72:33-47 (1999).
(57) LCO's may be utilized in various forms of purity and may be used alone or in the form of a culture of LCO-producing bacteria or fungi. Methods to provide substantially pure LCO's include simply removing the microbial cells from a mixture of LCOs and the microbe, or continuing to isolate and purify the LCO molecules through LCO solvent phase separation followed by HPLC chromatography as described, for example, in U.S. Pat. No. 5,549,718. Purification can be enhanced by repeated HPLC, and the purified LCO molecules can be freeze-dried for long-term storage.
(58) Chitooligosaccharides (COs) are known in the art as -1-4 linked N actyl glucosamine structures identified as chitin oligomers, also as N-acetylchitooligosaccharides. CO's have unique and different side chain decorations which make them different from chitin molecules [(C.sub.8H.sub.13NO.sub.5)n, CAS No. 1398-61-4], and chitosan molecules [(C.sub.5H.sub.11NO.sub.4)n, CAS No. 9012-76-4]. Representative literature describing the structure and production of COs is as follows: Van der Holst, et al., Current Opinion in Structural Biology, 11:608-616 (2001); Robina, et al., Tetrahedron 58:521-530 (2002); Hanel, et al., Planta 232:787-806 (2010); Rouge, et al. Chapter 27, The Molecular Immunology of Complex Carbohydrates in Advances in Experimental Medicine and Biology, Springer Science; Wan, et al., Plant Cell 21:1053-69 (2009); PCT/F100/00803 (Sep. 21, 2000); and Demont-Caulet, et al., Plant Physiol. 120(1):83-92 (1999). The COs may be synthetic or recombinant. Methods for preparation of recombinant COs are known in the art. See, e.g., Samain, et al. (supra.); Cottaz, et al., Meth. Eng. 7(4):311-7 (2005) and Samain, et al., J. Biotechnol. 72:33-47 (1999).
(59) Compositions of the present invention may also include chitinous compounds (other than COs), flavonoids, jasmonic acid, linoleic acid and linolenic acid and their derivatives, and karrikins.
(60) Chitins and chitosans, which are major components of the cell walls of fungi and the exoskeletons of insects and crustaceans, are also composed of GlcNAc residues. Chitinous compounds include chitin, (IUPAC: N-[5-[[3-acetylamino-4,5-dihydroxy-6-(hydroxymethyl)oxan-2yl]methoxymethyl]-2-[[5-acetylamino-4,6-dihydroxy-2-(hydroxy methyl)oxan-3-yl]methoxymethyl]-4-hydroxy-6-(hydroxymethyl)oxan-3-ys]ethanamide), and chitosan, (IUPAC: 5-amino-6-[5-amino-6-[5-amino-4,6-dihydroxy-2(hydroxymethyl)oxan-3-yl]oxy-4-hydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-2(hydroxymethyl)oxane-3,4-diol). These compounds may be obtained commercially, e.g., from Sigma-Aldrich, or prepared from insects, crustacean shells, or fungal cell walls. Methods for the preparation of chitin and chitosan are known in the art, and have been described, for example, in U.S. Pat. No. 4,536,207 (preparation from crustacean shells), Pochanavanich, et al., Lett. Appl. Microbiol. 35:17-21 (2002) (preparation from fungal cell walls), and U.S. Pat. No. 5,965,545 (preparation from crab shells and hydrolysis of commercial chitosan). Deacetylated chitins and chitosans may be obtained that range from less than 35% to greater than 90% deacetylation, and cover a broad spectrum of molecular weights, e.g., low molecular weight chitosan oligomers of less than 15 kD and chitin oligomers of 0.5 to 2 kD; practical grade chitosan with a molecular weight of about 15 kD; and high molecular weight chitosan of up to 70 kD. Chitin and chitosan compositions formulated for seed treatment are also commercially available. Commercial products include, for example, ELEXA (Plant Defense Boosters, Inc.) and BEYOND (Agrihouse, Inc.).
(61) Flavonoids are phenolic compounds having the general structure of two aromatic rings connected by a three-carbon bridge. Flavonoids are produced by plants and have many functions, e.g., as beneficial signaling molecules, and as protection against insects, animals, fungi and bacteria. Classes of flavonoids include chalcones, anthocyanidins, coumarins, flavones, flavanols, flavonols, flavanones, and isoflavones. See, Jain, et al., J. Plant Biochem. & Biotechnol. 11:1-10 (2002); Shaw, et al., Environmental Microbiol. 11:1867-80 (2006).
(62) Representative flavonoids that may be useful in compositions of the present invention include genistein, daidzein, formononetin, naringenin, hesperetin, luteolin, and apigenin. Flavonoid compounds are commercially available, e.g., from Natland International Corp., Research Triangle Park, NC; MP Biomedicals, Irvine, Calif.; LC Laboratories, Woburn Mass. Flavonoid compounds may be isolated from plants or seeds, e.g., as described in U.S. Pat. Nos. 5,702,752; 5,990,291; and 6,146,668. Flavonoid compounds may also be produced by genetically engineered organisms, such as yeast, as described in Ralston, et al., Plant Physiology 137:1375-88 (2005).
(63) Jasmonic acid (JA, [1R-[1,2(Z)]]-3-oxo-2-(pentenyl)cyclopentaneacetic acid) and its derivatives, linoleic acid ((Z,Z)-9,12-Octadecadienoic acid) and its derivatives, and linolenic acid ((Z,Z,Z)-9,12,15-octadecatrienoic acid) and its derivatives, may also be used in compositions of the present invention. Jasmonic acid and its methyl ester, methyl jasmonate (MeJA), collectively known as jasmonates, are octadecanoid-based compounds that occur naturally in plants. Jasmonic acid is produced by the roots of wheat seedlings, and by fungal microorganisms such as Botryodiplodia theobromae and Gibberella fujikuroi, yeast (Saccharomyces cerevisiae), and pathogenic and non-pathogenic strains of Escherichia coli. Linoleic acid and linolenic acid are produced in the course of the biosynthesis of jasmonic acid. Jasmonates, linoleic acid and linoleic acid (and their derivatives) are reported to be inducers of nod gene expression or LCO production by rhizobacteria. See, e.g., Mabood, Fazli, Jasmonates induce the expression of nod genes in Bradyrhizobium japonicum, May 17, 2001; and Mabood, Fazli, Linoleic and linolenic acid induce the expression of nod genes in Bradyrhizobium japonicum, USDA 3, May 17, 2001.
(64) Useful derivatives of linoleic acid, linolenic acid, and jasmonic acid that may be useful in compositions of the present invention include esters, amides, glycosides and salts. Representative esters are compounds in which the carboxyl group of linoleic acid, linolenic acid, or jasmonic acid has been replaced with a COR group, where R is an OR.sup.1 group, in which R.sup.1 is: an alkyl group, such as a C.sub.1-C.sub.8 unbranched or branched alkyl group, e.g., a methyl, ethyl or propyl group; an alkenyl group, such as a C.sub.2-C.sub.8 unbranched or branched alkenyl group; an alkynyl group, such as a C.sub.2-C.sub.8 unbranched or branched alkynyl group; an aryl group having, for example, 6 to 10 carbon atoms; or a heteroaryl group having, for example, 4 to 9 carbon atoms, wherein the heteroatoms in the heteroaryl group can be, for example, N, O, P, or S. Representative amides are compounds in which the carboxyl group of linoleic acid, linolenic acid, or jasmonic acid has been replaced with a COR group, where R is an NR.sup.2R.sup.3 group, in which R.sup.2 and R.sup.3 are independently: hydrogen; an alkyl group, such as a C.sub.1-C.sub.8 unbranched or branched alkyl group, e.g., a methyl , ethyl or propyl group; an alkenyl group, such as a C.sub.2-C.sub.8 unbranched or branched alkenyl group; an alkynyl group, such as a C.sub.2-C.sub.8 unbranched or branched alkynyl group; an aryl group having, for example, 6 to 10 carbon atoms; or a heteroaryl group having, for example, 4 to 9 carbon atoms, wherein the heteroatoms in the heteroaryl group can be, for example, N, O, P, or S. Esters may be prepared by known methods, such as acid-catalyzed nucleophilic addition, wherein the carboxylic acid is reacted with an alcohol in the presence of a catalytic amount of a mineral acid. Amides may also be prepared by known methods, such as by reacting the carboxylic acid with the appropriate amine in the presence of a coupling agent such as dicyclohexyl carbodiimide (DCC), under neutral conditions. Suitable salts of linoleic acid, linolenic acid, and jasmonic acid include e.g., base addition salts. The bases that may be used as reagents to prepare metabolically acceptable base salts of these compounds include those derived from cations such as alkali metal cations (e.g., potassium and sodium) and alkaline earth metal cations (e.g., calcium and magnesium). These salts may be readily prepared by mixing together a solution of linoleic acid, linolenic acid, or jasmonic acid with a solution of the base. The salt may be precipitated from solution and be collected by filtration or may be recovered by other means such as by evaporation of the solvent.
(65) Karrikins are vinylogous 4H-pyrones e.g., 2H-furo[2,3-c]pyran-2-ones including derivatives and analogues thereof. Examples of these compounds are represented by the following structure:
(66) ##STR00003##
wherein; Z is O, S or NR.sub.5; R.sub.1, R.sub.2, R.sub.3, and R.sub.4 are each independently H, alkyl, alkenyl, alkynyl, phenyl, benzyl, hydroxy, hydroxyalkyl, alkoxy, phenyloxy, benzyloxy, CN, COR.sub.6, COOR, halogen, NR.sub.6R.sub.7, or NO.sub.2; and R.sub.5, R.sub.6, and R.sub.7 are each independently H, alkyl or alkenyl, or a biologically acceptable salt thereof. Examples of biologically acceptable salts of these compounds may include acid addition salts formed with biologically acceptable acids, examples of which include hydrochloride, hydrobromide, sulphate or bisulphate, phosphate or hydrogen phosphate, acetate, benzoate, succinate, fumarate, maleate, lactate, citrate, tartrate, gluconate; methanesulphonate, benzenesulphonate and p-toluenesulphonic acid. Additional biologically acceptable metal salts may include alkali metal salts, with bases, examples of which include the sodium and potassium salts. Examples of compounds embraced by the structure and which may be suitable for use in the present invention include the following: 3-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1CH.sub.3, R.sub.2, R.sub.3, R.sub.4H), 2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.2, R.sub.3, R4H), 7-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.2, R.sub.4H, R.sub.3CH.sub.3), 5-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.2, R.sub.3H, R.sub.4CH.sub.3), 3,7-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.3CH.sub.3, R.sub.2, R.sub.4H), 3,5-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.4CH.sub.3, R.sub.2, R.sub.3H), 3,5,7-trimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.3, R.sub.4CH.sub.3, R.sub.2H), 5-methoxymethyl-3-methyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1CH.sub.3, R.sub.2, R.sub.3H, R.sub.4CH.sub.2OCH.sub.3), 4-bromo-3,7-dimethyl-2H-furo[2,3-c]pyran-2-one (where R.sub.1, R.sub.3CH.sub.3, R.sub.2Br, R.sub.4H), 3-methylfuro[2,3-c]pyridin-2(3H)-one (where ZNH, R.sub.1CH.sub.3, R.sub.2, R.sub.3, R.sub.4H), 3,6-dimethylfuro[2,3-c]pyridin-2(6H)-one (where ZNCH.sub.3, R.sub.1CH.sub.3, R.sub.2, R.sub.3, R.sub.4H). See, U.S. Pat. No. 7,576,213. These molecules are also known as karrikins. See, Halford, supra.
(67) Compositions of the present invention may further include an agriculturally/agronomically beneficial agent. Non-limiting examples of such agents that may be useful in the practice of the present invention include herbicides, fungicides and insecticides.
(68) Suitable herbicides include bentazon, acifluorfen, chlorimuron, lactofen, clomazone, fluazifop, glufosinate, glyphosate, sethoxydim, imazethapyr, imazamox, fomesafe, flumiclorac, imazaquin, and clethodim. Commercial products containing each of these compounds are readily available. Herbicide concentration in the composition will generally correspond to the labeled use rate for a particular herbicide.
(69) A fungicide as used herein and in the art, is an agent that kills or inhibits fungal growth. As used herein, a fungicide exhibits activity against a particular species of fungi if treatment with the fungicide results in killing or growth inhibition of a fungal population (e.g., in the soil) relative to an untreated population. Effective fungicides in accordance with the invention will suitably exhibit activity against a broad range of pathogens, including but not limited to Phytophthora, Rhizoctonia, Fusarium, Pythium, Phomopsis or Selerotinia and Phakopsora and combinations thereof.
(70) Commercial fungicides may be suitable for use in the present invention. Suitable commercially available fungicides include PROTG, RIVAL or ALLEGIANCE FL or LS (Gustafson, Plano, Tex.), WARDEN RTA (Agrilance, St. Paul, Minn.), APRON XL, APRON MAXX RTA or RFC, MAXIM 4FS or XL (Syngenta, Wilmington, Del.), CAPTAN (Arvesta, Guelph, Ontario) and PROTREAT (Nitragin Argentina, Buenos Ares, Argentina). Active ingredients in these and other commercial fungicides include, but are not limited to, fludioxonil, mefenoxam, azoxystrobin and metalaxyl. Commercial fungicides are most suitably used in accordance with the manufacturer's instructions at the recommended concentrations.
(71) As used herein, an insecticide exhibits activity against a particular species of insect if treatment with the insecticide results in killing or inhibition of an insect population relative to an untreated population. Effective insecticides in accordance with the invention will suitably exhibit activity against a broad range of insects including, but not limited to, wireworms, cutworms, grubs, corn rootworm, seed corn maggots, flea beetles, chinch bugs, aphids, leaf beetles, and stink bugs.
(72) Commercial insecticides may be suitable for use in the present invention. Suitable commercially-available insecticides include CRUISER (Syngenta, Wilmington, Del.), GAUCHO and PONCHO (Gustafson, Plano, Tex.). Active ingredients in these and other commercial insecticides include thiamethoxam, clothianidin, and imidacloprid. Commercial insecticides are most suitably used in accordance with the manufacturer's instructions at the recommended concentrations.
(73) Compositions of the present invention also are intended to include the use of one or more phosphate solubilizing agent. As used herein, phosphate solubilizing agents, include, but are not limited to, phosphate solubilizing microorganisms. As used herein, phosphate solubilizing microorganism is a microorganism that is able to increase the amount of phosphorous available for a plant. Phosphate solubilizing microorganisms include fungal and bacterial strains. In an embodiment, the phosphate solubilizing microorganism is a spore forming microorganism.
(74) Non-limiting examples of phosphate solubilizing microorganisms include species from a genus selected from the group consisting of Acinetobacter, Arthrobacter, Arthrobotrys, Aspergillus, Azospirillum, Bacillus, Burkholderia, Candida Chryseomonas, Enterobacter, Eupenicillium, Exiguobacterium, Klebsiella, Kluyvera, Microbacterium, Mucor, Paecilomyces, Paenibacillus, Penicillium, Pseudomonas, Serratia, Stenotrophomonas, Streptomyces, Streptosporangium, Swaminathania, Thiobacillus, Torulospora, Vibrio, Xanthobacter, and Xanthomonas.
(75) Non-limiting examples of phosphate solubilizing microorganisms are selected from the group consisting Acinetobacter calcoaceticus, Acinetobacter spp., Arthrobacter spp., Arthrobotrys oligospora, Aspergillus niger, Aspergillus spp., Azospirillum halopraeferans, Bacillus amyloliquefaciens, Bacillus atrophaeus, Bacillus circulans, Bacillus licheniformis, Bacillus subtilis, Burkholderia cepacia, Burkholderia vietnamiensis, Candida krissii Chryseomonas luteola, Enterobacter aerogenes, Enterobacter asburiae, Enterobacter spp., Enterobacter taylorae, Eupenicillium parvum, Exiguobacterium spp., Klebsiella spp., Kluyvera cryocrescens, Microbacterium spp., Mucor ramosissimus, Paecilomyces hepialid, Paecilomyces marquandii, Paenibacillus macerans, Paenibacillus mucilaginosus, Pantoea aglomerans, Penicillium expansum, Pseudomonas corrugate, Pseudomonas fluorescens, Pseudomonas lutea, Pseudomonas poae, Pseudomonas putida, Pseudomonas stutzeri, Pseudomonas trivialis, Serratia marcescens, Stenotrophomonas maltophilia, Streptomyces sp., Streptosporangium spp., Swaminathania salitolerans, Thiobacillus ferrooxidans, Torulospora globosa, Vibrio proteolyticus, Xanthobacter agilis, and Xanthomonas campestris.
(76) In one embodiment, the phosphate solubilizing microorganism is a strain of the fungus Penicillium. Strains of the fungus Penicillium that may be useful in the practice of the present invention include P. bilaiae (formerly known as P. bilaii), P. albidum, P. aurantiogriseum, P. chrysogenum, P. citreonigrum, P. citrinum, P. digitatum, P. frequentas, P. fuscum, P. gaestrivorus, P. glabrum, P. griseofulvum, P. implicatum, P. janthinellum, P. lilacinum, P. minioluteum, P. montanense, P. nigricans, P. oxalicum, P. pinetorum, P. pinophilum, P. purpurogenum, P. radicans, P. radicum, P. raistrickii, P. rugulosum, P. simplicissimum, P. solitum, P. variabile, P. velutinum, P. viridicatum, P. glaucum, P. fussiporus, and P. expansum.
(77) In another embodiment, the phosphate solubilizing microorganism Penicillium species is P. bilaiae, P. gaestrivorus, and/or a combination thereof. In still another embodiment, the P. bilaiae strains are selected from the group consisting of ATCC 20851, NRRL 50169, ATCC 22348, ATCC 18309, NRRL 50162 (Wakelin, et al., 2004. Biol Fertil Soils 40:36-43) and the P. gaestrivorus strain is NRRL 50170 (see, Wakelin, supra.).
(78) According to compositions of the invention, it is envisioned that more than one phosphate solubilizing microorganism may be used, such as, at least two, at least three, at least four, at least five, at least 6, including any combination of the Acinetobacter, Arthrobacter, Arthrobotrys, Aspergillus, Azospirillum, Bacillus, Burkholderia, Candida Chryseomonas, Enterobacter, Eupenicillium, Exiguobacterium, Klebsiella, Kluyvera, Microbacterium, Mucor, Paecilomyces, Paenibacillus, Penicillium, Pseudomonas, Serratia, Stenotrophomonas, Streptomyces, Streptosporangium, Swaminathania, Thiobacillus, Torulospora, Vibrio, Xanthobacter, and Xanthomonas, including one species selected from the following group: Acinetobacter calcoaceticus, Acinetobacter spp., Arthrobacter spp., Arthrobotrys oligospora, Aspergillus niger, Aspergillus spp., Azospirillum halopraeferans, Bacillus amyloliquefaciens, Bacillus atrophaeus, Bacillus circulans, Bacillus licheniformis, Bacillus subtilis, Burkholderia cepacia, Burkholderia vietnamiensis, Candida krissii Chryseomonas luteola, Enterobacter aerogenes, Enterobacter asburiae, Enterobacter spp., Enterobacter taylorae, Eupenicillium parvum, Exiguobacterium spp., Klebsiella spp., Kluyvera cryocrescens, Microbacterium spp., Mucor ramosissimus, Paecilomyces hepialid, Paecilomyces marquandii, Paenibacillus macerans, Paenibacillus mucilaginosus, Pantoea aglomerans, Penicillium expansum, Pseudomonas corrugate, Pseudomonas fluorescens, Pseudomonas lutea, Pseudomonas poae, Pseudomonas putida, Pseudomonas stutzeri, Pseudomonas trivialis, Serratia marcescens, Stenotrophomonas maltophilia, Streptomyces spp., Streptosporangium spp., Swaminathania salitolerans, Thiobacillus ferrooxidans, Torulospora globosa, Vibrio proteolyticus, Xanthobacter agilis, and Xanthomonas campestris.
(79) In another embodiment, the present invention includes a method of enhancing plant growth, comprising applying to plants, plant seeds, or soil surrounding plants, or plant seeds one or more of the bacterial strain(s) of the present invention (including a composition comprising at least one of the isolated bacterial strain(s) of the present invention and an agronomically acceptable carrier. The one or more bacterial strains may comprise only one bacterial strain or a combination of at least two or more of the strains of the present invention, including more than two, such as, at least three of the above strains, at least four of the above strains, at least five of the above strains, at least six of the above strains, at least seven of the above strains, at least eight of the above strains, at least nine of the above strains, at least ten of the above strains, at least eleven of the above strains, at least twelve of the above strains, at least thirteen of the above strains, up to an including all of the above strains.
(80) Applications
(81) Methods of the invention include a treatment step for applying at least one of the isolated strains and/or compositions comprising at least one of the isolated strains to seeds, seedlings, roots, plants, soils, or combinations thereof. Treating or treatment, as the terms are used herein and in the art, refers to any application which results in contact of seeds, seedlings, roots, or plants with an effective amount of a treatment composition or components to enhance competitiveness for colonizing a plant and effectiveness at promoting plant growth.
(82) The effective amount and/or suitable application rates vary according to the type of soil, the type of plants, the amounts of the source of micronutrients present in the soil or added thereto, etc. and a suitable rate can be found without difficulty by simple trial and error experiments for each particular case. Normally, the rate for applying at least one of the isolated strains and/or compositions comprising at least one of the isolated strains falls into the range of 110.sup.2-110.sup.8 colony forming units (cfu) per seed (when coated seeds are used). In a specific embodiment, the application rate falls in the range of 110.sup.4-110.sup.5 colony forming units (cfu) per seed (when coated seeds are used. On a granular carrier, the application rate falls into the range of 110.sup.8-110.sup.13 cfu per hectare. In a specific embodiment, the application rate on a granular carrier falls into the range of 210.sup.11-610.sup.11 cfu per hectare. Even though the inoculant compositions and/or compositions used according to the present invention may include a mixture/combination of at least two or more different bacterial strains, it is the total amount of colony forming units in the combined mixture that is referred to throughout the specification. The effective amount of LCO and/or CO used in a composition of the invention for treating a seed directly is expressed in units of concentration and generally ranges from about 10.sup.5 to about 10.sup.14 M (molar concentration), and in some embodiments, from about 10.sup.5 to about 10.sup.11 M, and in some other embodiments from about 10.sup.7 to about 10.sup.8 M. Expressed in units of weight, the effective amount generally ranges from about 1 to about 400 g/hundred weight (cwt) seed, and in some embodiments from about 2 to about 70 g/cwt, and in some other embodiments, from about 2.5 to about 3.0 g/cwt seed.
(83) For purposes of treatment of seed indirectly, i.e., in-furrow treatment, the effective amount of the LCO or CO generally ranges from 1 g/acre to about 70 g/acre, and in some embodiments, from about 50 g/acre to about 60 g/acre. For purposes of application to the plants, the effective amount of the LCO or CO generally ranges from 1 g/acre to about 30 g/acre, and in some embodiments, from about 11 g/acre to about 20 g/acre.
(84) Treatment may be accomplished directly, i.e., by application directly on seeds, seedlings, roots, or plants (including foliage), or may be accomplished indirectly, i.e., by application to the soil (including in furrow).
(85) As will be understood, treatment with each component may be accomplished sequentially or simultaneously. For example, if a liquid carrier is used, the components may be co-slurried in a commercial treater mix tank and subsequently applied to seeds by any suitable coating process, e.g., film coating. In the film coating process, a slurry is sprayed onto the seeds in a continuous coating process. Alternatively, for example, if a dust or powder carrier is used, the components can be sequentially applied. Accordingly, treatment may also encompass foliar application and/or application of the compositions in furrow.
(86) Non-limiting examples of plants to be treated by the isolated strains and/or compositions comprising at least one of the isolated strains include leguminous crops. Non-limiting examples of leguminous crops include, but are not limited to, plants such as soybean, alfalfa, peanut, pea, lentil, bean, and clover. As will be appreciated, the term crop encompasses any plant material that may be harvested.
(87) Culture
(88) The present invention is directed to a biologically pure culture of Bradyrhizobia japonicum strain(s)
(89) the strain having the deposit accession number NRRL B-50592 (deposited also as NRRL B-59571);
(90) the strain having the deposit accession number NRRL B-50593 (deposited also as NRRL B-59572);
(91) the strain having the deposit accession number NRRL B-50586 (deposited also as NRRL B-59565);
(92) the strain having the deposit accession number NRRL B-50588 (deposited also as NRRL B-59567);
(93) the strain having the deposit accession number NRRL B-50587 (deposited also as NRRL B-59566);
(94) the strain having the deposit accession number NRRL B-50589 (deposited also as NRRL B-59568);
(95) the strain having the deposit accession number NRRL B-50591 (deposited also as NRRL B-59570);
(96) the strain having the deposit accession number NRRL B-50590 (deposited also as NRRL B-59569);
(97) the strain having the deposit accession number NRRL B-50594 (deposited also as NRRL B-50493);
(98) the strain having the deposit accession number NRRL B-50726;
(99) the strain having the deposit accession number NRRL B-50727;
(100) the strain having the deposit accession number NRRL B-50728;
(101) the strain having the deposit accession number NRRL B-50729; and
(102) the strain having the deposit accession number NRRL B-50730.
(103) As used herein, the phrase biologically pure culture means a culture essentially free from biological contamination and having a genetic uniformity such that different subcultures taken therefrom will display substantially identical genotypes and phenotypes (e.g., cultures have a purity of at least 60%, of at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, up to 100% pure). Such cultures may be useful in large-scale fermentation or for other commercial purposes. Accordingly, mutants, transconjugants, recombinants, and genetically engineered variants which are derived from Bradyrhizobium japonicum strains having the deposit accession numbers NRRL B-50592 (deposited also as NRRL B-59571), NRRL B-50593 (deposited also as NRRL B-59572), NRRL B-50586 (deposited also as NRRL B-59565), NRRL B-50588 (deposited also as NRRL B-59567), NRRL B-50587 (deposited also as NRRL B-59566), NRRL B-50589 (deposited also as NRRL B-59568), NRRL B-50591 (deposited also as NRRL B-59570); NRRL B-50590 (deposited also as NRRL B-59569); NRRL B-50594 (deposited also as NRRL B-50493); NRRL B-50726; NRRL B-50727; NRRL B-50728; NRRL B-50729; NRRL B-50730, and cultures thereof are within the scope of the invention.
(104) In one embodiment the culture is a strain having the deposit accession number NRRL B-50592 (deposited also as NRRL B-59571). In another embodiment the culture is a strain having the deposit accession number NRRL B-50593 (deposited also as NRRL B-59572). In another embodiment the culture is a strain having the deposit accession number NRRL B-50586 (deposited also as NRRL B-59565). In another embodiment the culture is a strain having the deposit accession number NRRL B-50588 (deposited also as NRRL B-59567). In another embodiment the culture is a strain having the deposit accession number NRRL B-50587 (deposited also as NRRL B-59566). In another embodiment the culture is a strain having the deposit accession number NRRL B-50589 (deposited also as NRRL B-59568). In another embodiment the culture is a strain having the deposit accession number NRRL B-50591 (deposited also as NRRL B-59570). In another embodiment the culture is a strain having the deposit accession number NRRL B-50590 (deposited also as NRRL B-59569). In another embodiment the culture is a strain having the deposit accession number NRRL B-50594 (deposited also as NRRL B-50493). In another embodiment the culture is a strain having the deposit accession number NRRL B-50726. In another embodiment the culture is a strain having the deposit accession number NRRL B-50727. In another embodiment the culture is a strain having the deposit accession number NRRL B-50728. In another embodiment the culture is a strain having the deposit accession number NRRL B-50729. In another embodiment the culture is a strain having the deposit accession number NRRL B-50730.
(105) Deposit of Biological Material
(106) The following biological material has been deposited under the terms of the Budapest Treaty at American Type Culture Collection (ATCC), 10801 University Blvd., Manassas, Va. 20108, USA, and the Microbial Genomics and Bioprocessing Research Unit (NRRL) National Center for Agricultural Utilization Research 1815 N. University Street, Peoria, Ill. 61604, USA and given the following accession number:
(107) TABLE-US-00001 TABLE 1 Deposit of Biological Material Identification Accession Number Date of Deposit Bradyrhizobia japonicum NRRL B-50592 Nov. 9, 2011 NRRL B-59571 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50593 Nov. 9, 2011 NRRL B-59572 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50586 Nov. 9, 2011 NRRL B-59565 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50588 Nov. 9, 2011 NRRL B-59567 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50587 Nov. 9, 2011 NRRL B-59566 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50589 Nov. 9, 2011 NRRL B-59568 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50591 Nov. 9, 2011 NRRL B-59570 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50590 Nov. 9, 2011 NRRL B-59569 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50594 Nov. 9, 2011 NRRL B-50493 Mar. 8, 2011 Bradyrhizobia japonicum NRRL B-50726 Mar. 9, 2012 Bradyrhizobia japonicum NRRL B-50727 Mar. 9, 2012 Bradyrhizobia japonicum NRRL B-50728 Mar. 9, 2012 Bradyrhizobia japonicum NRRL B-50729 Mar. 9, 2012 Bradyrhizobia japonicum NRRL B-50730 Mar. 9, 2012 *NRRL indicates deposit with the Agricultural Research Service Culture Collection, Peoria, IL.
(108) The strain has been deposited under conditions that assure that access to the culture will be available during the pendency of this patent application to one determined by the Commissioner of Patents and Trademarks to be entitled thereto under 37 C.F.R. 1.14 and 35 U.S.C. 122. The deposit represents a pure culture of the deposited strain. The deposit is available as required by foreign patent laws in countries wherein counterparts of the subject application or its progeny are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject invention in derogation of patent rights granted by governmental action.
(109) The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention.
EXAMPLES
Materials and Methods
(110) Media
(111) YEM Agar (YEMA): (10 g/L D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.4.7H.sub.2O; 12.0 g/L Agar; pH6.8).
(112) Liquid YEM: (10 g/L D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.4.7H.sub.2O;pH6.8).
(113) DNA Isolation Protocol
(114) For strains grown on plates, a 1 L loop of each strain from plates was added individually to 100 L PrepMan Ultra DNA Isolation solution from Applied Biosystems. The solution was heated to 100 C. for 10 minutes. Isolated DNA was used for PCR analysis.
(115) For DNA isolated from nodules, nodules were removed with forceps from soybean roots and rinsed in diH.sub.2O. Nodules were placed individually in 100 uL PrepMan Ultra DNA Isolation solution from Applied Biosystems, broken apart, and heated at 100 C. for 10 minutes using a 96-well PCR Plate also from Applied Biosystems. Disposable toothpicks were used to break the nodules open to avoid cross contamination. Isolated DNA was used for PCR analysis.
(116) PCR Protocol
(117) Polymerase chain reactions (PCR) were performed using Applied Biosystems Veriti 96-well Fast Thermal Cycler. PCRs were set up for each strain. 2 L of DNA was added to 0.5 L of a 3 primer, 0.5 L of a 5 primer, 0.5 L of Taq Polymerase (New England Biolabs, Inc.) and 21.5 L of Platinum Blue PCR Supermix (Invitrogen). The PCR mixture was heated to 94 C. for 4 minutes. Following denaturation, the PCR was performed for 35 cycles with the following program: 94 C. for 1 minute, 68 C. or primer annealing dependent temperature(s) for 1 minute, and reaction extension at 72 C. for 1 minute. After completion of the PCR program, 5 L of PCR mixture was run on a Lonza FlashGel system.
(118) Strain Isolation Protocol
(119) To isolate strains, nodules were surface sterilized with 10% household bleach for 2 minutes. Nodules were rinsed in sterile water and then placed in a microcentrifuge tube with 250 uL of sterile water. Nodules were crushed with sterile toothpicks and the Rhizobium strains were released into the water. Two 10 uL loops of water were streaked out for single colonies onto YEMA plates. All plates were wrapped with Parafilm and grown at 30 C. in an Eppendorf Innova 42R incubator. Growing time differed per isolate.
(120) Primary Screening Protocol
(121) Strains were primarily screened by two distinct protocols, i.e., the Soybean Field Soil Protocol (USDA 532C Treated Field) and the Untreated (Control) Field Protocol. Each protocol is described.
(122) Soybean Field Soil Protocol (USDA 532C Treated Field)
(123) Soybean seeds coated with USDA 532C were planted in various soils throughout soybean growing regions in the United States, e.g., South Dakota, North Dakota, Georgia, Iowa, Nebraska, Illinois, Indiana, Texas, Kansas, Minnesota, etc. Soybean seeds treated with Bradyrhizobium japonicum strain USDA 532C were grown in these soils, harvested, and the soybean nodules were analyzed directly using PCR analysis. Forty (40) nodules were collected from each soil sample. Individual soybean nodules were loaded into a single well of 96 well microtiter plate. DNA from those individual soybean nodules was isolated directly from nodules based on the procedure described supra (see Materials and Methods: DNA Isolation Protocol).
(124) PCR analysis using USDA 532C specific primer 209 was performed directly on the 96 well plate (see Materials and Methods: PCR Protocol). The amplification of primer 209 (0.9 kb band) from the 40 nodules was calculated to determine the percent amplification. If the 0.9 kb DNA amplification was less than or equal to 30% (i.e., greater than or equal to 70% of the PCR was negative for primer 209 amplification), then the soil sample contained Bradyrhizobium japonicum strains with greater competitiveness than the USDA 532C strain. Soybean nodules with less than or equal to 30% amplification contained native strains identified as being more competitive than USDA 532C based on the procedure described (see Materials and Methods: Strain Isolation Protocol).
(125) If more than 30% of soybean nodules were colonized by Bradyrhizobia japonicum strain USDA 532C, then the soil was deemed unfit for novel strain isolation and the soil sample was terminated.
(126) Untreated Field (Control) Protocol
(127) Nodules were obtained from soybean fields untreated with USDA 532C, in the following states: Arkansas, Georgia, Illinois, Indiana, Iowa, Oklahoma, Nebraska, Kansas, Missouri, and Texas. Bradyrhizobium japonicum strains were isolated directly from these nodules per the protocol described supra (see Materials and Methods: Strain Isolation Protocol). Isolated strains were put into direct competition with Bradyrhizobia japonicum strain USDA 532C per the Competition Study Protocol (see Materials and Methods: Competition Study Protocol). Isolated strains that occupied more than 70% of soybean nodules when compared to Bradyrhizobia japonicum strain USDA 532C, were selected for performance evaluation (see Materials and Methods: Performance Study Protocol).
(128) Competition Study Protocol
(129) Optical densities were determined. (Nanodrop ND1000 Spectrophotometer) A 1:1 inoculum ratio of USDA 532C to each isolate strain was obtained. USDA 532C was diluted or concentrated to an optical density of 0.5 at 600 nm and 0.5 mL of USDA 532C inoculum was set aside for each isolate. All isolate strains were either concentrated or diluted to an optical density of 0.5 at 600 nm using the following calculation: (0.5 optical density USDA 532C)(0.5 mL USDA 532C)=(isolate strain optical density)(isolate strain mL). 0.5 mL of USDA 532C was added to 0.5 mL of each isolate as separate treatments. Soybean seeds were coated with the inoculum mixture at a rate of 0.5 mL inoculum mixture per 12 soybean seeds. The seeds were allowed to imbibe for 30 minutes. 5 of the 12 treated soybean seeds were planted in Fafard 3B Potting mix in a 1 gallon pot. Gloves were worn to plant the seeds and were changed between treatments. Following planting, the 7 remaining treated soybean seeds were discarded.
(130) At germination, pots were thinned to 3 plants. Plants were grown for 6-7 weeks in a greenhouse and cross-contamination during the watering process was avoided. Temperatures ranged from approximately 23 C.-32 C. Watering was performed on an as needed basis. Nodules were harvested from each treatment and used for DNA isolation and PCR analysis with USDA 532C specific primer 209. See Materials and Methods: DNA isolation protocol and PCR Protocol.
(131) Performance Study Protocol
(132) The performance study is a direct strain to strain performance comparison between a single isolated strain and commercially available Bradyrhizobium japonicum strain USDA 532C. The isolate strain and the control strain (Bradyrhizobium japonicum strain USDA 532C) were streaked out concurrently on separate YEMA plates. The isolate strain and the control strain were separately inoculated into 5 mL of YEM liquid media to obtain an initial optical density of 0.03 at 600 nm in each inoculum tube. (Nanodrop ND1000 Spectrophotometer) The isolate strain and the control strain were incubated separately at 30 C. for 3 days. Following incubation, the inoculum for the isolate strain and the control strain was further diluted or concentrated to a final optical density of 0.5 at 600 nm in each inoculum tube (Nanodrop ND1000 Spectrophotometer) to obtain a test treatment (isolate strain) and a control treatment (control strain Bradyrhizobium japonicum strain USDA 532C).
(133) 0.75 mL of the test treatment was added to 32 soybean seeds. The treated seeds were allowed to imbibe for 30 minutes. After 30 minutes, 2 seeds were planted into 15 separate (446) pots in Fafard 3B Potting mix. Gloves were worn to plant the seeds and were changed between treatments. Following planting, the 2 remaining treated soybean seeds were discarded. This process was repeated for the control treatment.
(134) At germination, test treatment and control treatment pots were thinned to a single plant. Plants were grown for 8-10 weeks in a greenhouse and cross-contamination during the watering process was avoided. Temperatures ranged from approximately 23 C.-32 C. Watering was performed on an as needed basis. After 8-10 weeks, pods were harvested and dried overnight at 80 C. Analysis with JMP statistical software (SAS Institute, Inc.) was used to determine statistically significant performance enhancement compared to Bradyrhizobium japonicum strain USDA 532C.
(135) Temperature Profile Protocol
(136) Isolated Bradyrhizobium japonicum strains were streaked onto YEMA plates (10 g/L D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.4.7H.sub.2O; 12.0 g/L Agar; pH6.8) and incubated at 30 C. and 35 C. respectively for 7 days. The isolated strains were analyzed for their ability to grow isolated colonies.
(137) Glyphosate Resistance Profile Protocol
(138) Isolated Bradyrhizobium japonicum strains were streaked onto 1 mM glyphosate, and 2 mM glyphosate, YEMA plates (10 g/L D-mannitol; 0.50 g/L Oxoid yeast extract; 0.10 g/L NaCl; 0.50 g/L K.sub.2HPO.sub.4; 0.20 g/L MgSO.sub.4.7H.sub.2O; 12.0 g/L Agar; pH6.8). The plates were incubated at 30 C. for 7 days and the strains were analyzed for their ability to grow isolated colonies.
(139) Antibiotic Profile Protocol
(140) Isolated Bradyrhizobium japonicum strains were T-streaked onto gentamicin (50 mg/L) YEMA, chloramphenicol (50 mg/L) YEMA, polymyxin B (100 mg/L) YEMA, carbenicillin (100 mg/L) YEMA, neomycin (50 mg/L) YEMA, and nalidixic acid (50 mg/L) YEMA. The plates were incubated at 30 C. for 7 days and the strains were analyzed for their ability to grow isolated colonies.
(141) Diversilab PCR Protocol
(142) Diversilab PCR was set up using the Diversilab Pseudomonas Kit from BioMerieux. This kit contained proprietary primers designed to amplify various portions of the genome to produce a fingerprint of multiple DNA amplifications. Each strain has a unique fingerprint and percent similarity among strains can be determined using the Diverilab software.
(143) The PCR was setup accordingly. 2 L of DNA was added to 18.0 L of Re-PCR MM1, 2.0 L of primer mix, 0.5 L of Taq Polymerase (New England Biolabs, Inc.) and 2.5 L of Taq Polymerase buffer (New England Biolabs, Inc.) for a total volume of 25 uL. The PCR was heated to 94 C. for 2 minutes and then run for 35 cycles according to the following: 94 C. for 0.5 minutes, then 50 C. for 0.5 minutes, and finally 70 C. for 1.5 minutes. After the completion of the 35 cycles, the entire reaction was maintained at 70 C. for 3 minutes. Following completion of the PCR analysis, the PCR product was run on the Agilent 2100 Series Bioanalyzer. Diversilab DNA Reagents & Supplies Kit from BioMerieux was used to load PCR product onto Diversilab System chips. The kit was maintained according to instructions. Before use, the kit sat at room temperature for 30 minutes prior to loading the Diversilab chip. The Diversilab chip was loaded in full accordance with all protocols and instructions provided. Upon completion of loading the Diversilab chip, the chip was loaded into the Agilent 2100 Series Bioanalyzer and the analysis performed until completion.
Example 1
Unique Primer Design for Commercial Bradyrhizobium Strain USDA 532C
(144) A genetic identification method was developed to evaluate the competitiveness of commercial Bradyrhizobium japonicum strain USDA 532C against native strains in the field. A primer specific to USDA 532C was identified and PCR technology was used to efficiently evaluate competitiveness of USDA 532C in the field.
(145) Complete genome sequencing of USDA 532C was performed at Novozymes Davis. Twenty-five different DNA fragments were found to have low homology with public sequences of Bradyrhizobium japonicum. DNA was isolated from strains of B. japonicum (USDA 532C, P152, Br173, Br187, P190, and P194) grown on plates according to the procedure described supra (see Materials and Methods: DNA Isolation Protocol). Additional sequence analysis was performed on those twenty-five DNA fragments. Putative unique primers for USDA 532C strain were chosen and used for USDA 532C-specific primer screening by PCR against some representative Bradyrhizobium japonicum strains. After PCR evaluation, a single unique primer for USDA 532C was identified and was designated as p209.
(146) Primer 209 sequence was as follows:
(147) TABLE-US-00002 P209p5 SEQIDNO:1 TTGGGTTGAGCATGCCCACCCGGACGG, P209p3 SEQIDNO:2 GTCTCAGTTGCCGAGCCCACGGCGC
Primer Specificity
(148) The twenty-five primers were individually tested for positive identification of USDA 532C. The primers were further tested for USDA 532C specificity through PCR using USDA 532C and 5 different native strains of B. japonicum (P152, Br173, Br187, P190, and P194) for comparison. Genome sequencing indicated that Br187 and USDA 532C were genetically the same.
(149) TABLE-US-00003 TABLE 2 Primer Screening Summary PCR Primer USDA 532C P152 Br173 Br187 P190 P194 Temp 787 65 1114 + + + + + + 65 1181 + + + + + + 64 943 + + + + + + 60 1073 + + + + + + 65 125 + + 68 209* + + 68 487 + + 68 567 + + 58 744 + + 65 811 + + 65 989 + + 69 1073 + + 69 989 a + + 64 893 + + 64 2254 + + + + 68 607 + + + + 68 389 + + + + 60 728 + + + + 65 869 + + + + 62 1424 + + + + + 65 1181 + + + + + + 60 989 b + + + + + 65 895 + + + + + 65 943 + + + 64 *Primer 209 exhibited the clearest bands and was chosen for further evaluation.
(150) Table 2 summarizes the findings (+ indicates a positive identification of a PCR amplification band in the gel, indicates no DNA amplification).
(151) Referring to
(152) The specificity of primer 209 was tested against native strains P152, Br173, Br187, Br190, Br194, and USDA 532C. See
Example 2
(153) Analyzing and Isolating Novel Strains
(154) Primer 209 was used as a marker to indicate the presence or absence of colonization by Bradyrhizobia japonicum strain USDA 532C into the root nodules of soybean plants. Bands (i.e., a 0.9 kb band) indicating the presence of primer 209 represent a positive identification of Bradyrhizobia japonicum strain USDA 532C. See
(155) Isolated Bradyrhizobium japonicum strains were selected from nodules according to both screening protocols (see Materials and Methods: Primary Screening Protocol). The selected strains were isolated from the nodules according to the isolation procedure (see Materials and Methods: Strain Isolation Protocol).
Example 3
(156) Head-to-Head Competition Evaluation
(157) All isolated strains were put into a screening program designed to directly challenge the competitiveness of the isolate against Bradyrhizobium japonicum strain USDA 532C in terms of nodule colonization ability (see Materials and Methods: Competition Study Protocol).
(158) Isolated primer 209 specific to USDA 532C was used as a marker to indicate the presence or absence of colonization by Bradyrhizobia japonicum strain USDA 532C into the root nodules of soybean plants. Positive identification for primer 209 indicated the colonization of Bradyrhizobia japonicum strain USDA 532C into the root nodules of soybean plants. Conversely, the absence of bands indicating positive identification for primer 209 indicated colonization of a native strain into the root nodules of soybean plants other than Bradyrhizobia japonicum strain USDA 532C. Isolated strains that exhibited a greater than 70% colonization of the analyzed nodules were chosen for a second evaluation for confirmation. Strains were subject to at least two rounds of competition evaluation. Through this procedure, over 1000 isolates have been screened for enhanced competitiveness.
Example 4
(159) Performance Evaluation
(160) The performance study is a direct strain to strain comparison of isolated strains to USDA 532C. Enhanced performance was measured as a function of Pod Dry Weight (g). See Materials and Methods: Performance Study Protocol. Results are provided in Tables 3A-3D
(161) TABLE-US-00004 TABLE 3A Enhanced Performance as a Function of Pod Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL B-59571 85 5.92 NRRL B-59567 80 6.12 NRRL B-59572 85 6.05 NRRL B-59565 80 5.87 USDA532-C 5.72
The percent colonization was confirmed in triplicate studies and increased pod dry weight was confirmed in duplicate studies for all strains.
(162) TABLE-US-00005 TABLE 3B Enhanced Performance as a Function of Pod Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL B-50493 75 4.86 NRRL B-59570 80 5.30 USDA532-C 5.45
The percent colonization was confirmed in triplicate studies and increased pod dry weight was confirmed in duplicate studies for all strains.
(163) TABLE-US-00006 TABLE 3C Enhanced Performance as a Function of Pod Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL B-59566 85 5.30 NRRL B-59569 85 5.50 NRRL B-59568 95 5.69 USDA532-C 4.69
The percent colonization was confirmed in triplicate studies and increased pod dry weight was confirmed in duplicate studies for all strains.
(164) TABLE-US-00007 TABLE 3D Enhanced Performance as a Function of Pod Dry Weight (g) Strain Percent Colonization Pod dry weight (g) NRRL B-50726 95 5.79 NRRL B-50727 85 5.02 NRRL B-50728 83 5.78 NRRL B-50729 83 5.94 NRRL B-50730* 90 5.94 USDA532-C 5.45
The percent colonization and increased pod dry weight were confirmed in duplicate studies for all strains except NRRL B-50730* which has only had one round of testing.
(165) Commercially available strain USDA 532C was used as a control for each evaluation. Results of Tables 3A-3D indicate that all but one of the isolated strains had enhanced performance when compared to the control, USDA 532C.
Example 5
(166) Characterization Study
(167) Isolated Bradyrhizobium japonicum strains were further characterized based on temperature, glyphosate resistance, and antibiotic profiles (see Materials and Methods: Temperature Profile, Glyphosate Resistance Profile, and Antibiotic Profile Protocols). Results provided in Table 4.
(168) TABLE-US-00008 TABLE 4 Characterization of Isolated Strains as a Function of Temperature Profile, Glyphosate Resistance, and Antibiotic Resistance NRRL NRRL NRRL NRRL NRRL NRRL NRRL NRRL NRRL B- B- B- B- B- B- B- B- B- USDA Treatment 59565 59572 59567 59566 59570 59568 59569 50493 59571 532C 30 C. + + + + + + + + + + 35 C. + + + + + 1.0 mM glyphosate + + + + 2.0 mM glyphosate + + Gentamicin + + + + + Chloramphenicol + + + + + + + Polymyxin B + + + + + + + + + + Carbenicillin + + + + Neomycin + + + + + + + Nalidixic acid + +
(169) Table 4 summarizes the results (+ indicates growth with isolated colonies, indicates no growth, and + indicates a few isolated colonies/minimal and sporadic growth). Results indicate that strains NRRL B-59570, NRRL B-59568, NRRL B-59565, NRRL B-59566 and NRRL B-50493 are tolerant to temperatures of substantially 35 C. Results further indicate that isolated strains NRRL B-59569, NRRL B-59568, NRRL B-59565, and NRRL B-50493 are naturally resistant to glyphosate. Strains NRRL B-59566 and NRRL B-59569 were found to have resistance to nalidixic acid.
Example 5
(170) DNA Fingerprint Development
(171) Top performing isolates were put through DNA Diversilab fingerprint analysis (see Materials and Methods: Diversilab PCR Protocol). DNA was isolated from each strain according to the methods discussed (see Materials and Methods: DNA Isolation Protocol). Isolated DNA was used for PCR analysis.
(172) Results to the Diversilab DNA Fingerprint Analysis are indicated in
(173) The invention described and claimed herein is not to be limited in scope by the specific embodiments herein disclosed, since these embodiments are intended as illustrations of several aspects of the invention. Any equivalent embodiments are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.
(174) Various references are cited herein, the disclosures of which are incorporated by reference in their entireties.