Recombinant trypanosoma theileri parasite
09974846 ยท 2018-05-22
Assignee
Inventors
Cpc classification
A61K39/00
HUMAN NECESSITIES
International classification
C12N15/00
CHEMISTRY; METALLURGY
A61K39/00
HUMAN NECESSITIES
Abstract
The present invention relates to the field of the veterinary medicine of bovine animals. In particular the invention relates to a recombinant Trypanosoma theileri parasite, preferably comprising a heterologous nucleic acid sequence that is capable of encoding a protein for instance an antigen, a cytokine, a hormone, an antimicrobial protein, or an antibody. Also disclosed are uses of and methods for making and using the recombinant T. theileri parasite in medical or non-curative treatments; in particular as a sustained delivery vector for proteins to bovine animals, e.g. as a vaccine.
Claims
1. A method for the sustained delivery of a heterologous protein to a bovine animal, said method comprising the inoculation of said bovine animal with a sustained delivery vector comprising a recombinant live T. theileri parasite, so as to achieve the sustained presence of the recombinant live T. theileri parasite, wherein the recombinant live T. theileri parasite comprises an additional nucleic acid sequence comprising from outside towards the centre: restriction enzyme (RE) recognition sites; inward from the RE sites, flanking target regions from the T. theileri genome; internal to the target regions and flanking the central portion, signal sequences for RNA processing selected from the group consisting of SEQ ID NOS: 11-13, 20, 22 and 23; and centrally, at least one heterologous gene encoding at least one heterologous protein and nucleotides 4934 through 5326 from SEQ ID NO: 1 encoding a protein that provides resistance to blasticidin, and wherein the expression and delivery of the heterologous protein by the recombinant T. theileri parasite continues in a sustained way from the moment of inoculation of the bovine animal with the recombinant parasite, to as long as the parasite survives.
2. The method of claim 1, wherein the heterologous protein is a protein or protein-fragment selected from the group consisting of: an antigen, a cytokine, a hormone, an antimicrobial protein or an antibody.
3. The method of claim 1, wherein the method comprises inoculating said bovine animal with two or more different recombinant Trypanosoma theileri parasites.
Description
EXAMPLES
(1) 1. Basic Methodology of Handling T. theileri
(2) 1.1. Culturing of T. theileri In Vitro
(3) Preparation of T. theileri Culture Medium
(4) The base medium used for the culture of T. theileri is HMI-9 medium; this can be batch-ordered, e.g. from Invitrogen, and contains: Iscove's Modified Dulbecco's Medium (from powder, Invitrogen 42200-014), with 0.05 mM bathocuproine disulphonic acid, 1.5 mM L-cysteine, 1.0 mM hypoxanthine, 1.0 mM sodium pyruvate and 0.16 mM thymidine.
(5) After receipt, this was dissolved to a liquid medium, supplemented with 3.024 g/l sodium bicarbonate and 14.3 ?l/l beta-mercaptoethanol. pH was set to 7.5 with sodium hydroxide, and the HMI-9 medium was stored long-time at 4? C.
(6) Before use (in 500 ml batches) the medium was supplemented additionally with 10% Serum+? (synthetic serum replacement, Sigma, 14008C), 20% Foetal calf serum (FCS) and 1% penicillin-streptomycin solution (Sigma, P0781).
(7) HMI-9 was mixed at 1:1 v/v with freshly harvested MDBK-conditioned medium (see below), and filter sterilised at 0.2 ?m to remove any cell debris arising from the MDBK-conditioned medium.
(8) For best results T. theileri culture medium was prepared fresh for use the same day. If stored, it was kept at 4? C., and used within 7 days of preparation.
(9) Culturing of T. theileri Parasites
(10) In
(11) Therefore, cultures of T. theileri were routinely examined microscopically and counted every day, and passaged any time that the density exceeds 5?10.sup.6 cells/ml. This was because T. theileri cultures at densities above 5?10.sup.6 cells/ml (or 1?10.sup.6 cells/ml for transfectants) start to switch towards the straighter cell morphology with loss of the frilly membrane, and have a lower growth rate, and a higher proportion of aberrant cells.
(12) Counting of T. theileri was done using a Z2 Coulter Counter? (Beckman Coulter). Typically 250 ?l of cell-culture was diluted in Isoton Diluent? (Beckman Coulter) to a total volume of 10 ml and then measured once.
(13) For practical reasons, cells were routinely passaged only every other day and subcultured when needed.
(14) To start a new culture, a T25 flask with pre-warmed T. theileri media was seeded with 4?10.sup.4 cells/ml. Seeding should not be below about 1?10.sup.4 cells/ml, as lower densities did not always allow for outgrowth of the parasites. All cultures were incubated at 37? C. in 5% CO.sub.2.
(15) Continuous in vitro cultures of T. theileri parasites in logarithmic growth phase have been maintained for over a year.
(16) 1.2. Preparation of Conditioned Medium
(17) Conditioned medium was used in T. theileri cultures to overcome the requirement for a feeder cell-layer. To prepare appropriate conditioned medium, Madin-Darby bovine kidney (MDBK) epithelial cells were preferred. MDBK cells and components of their culture medium can be obtained from various (non-)commercial sources, for instance from the European cell culture collection (ECACC) as cell line with accession number 90050801.
(18) Preparation of MDBK Culture Medium
(19) The MDBK cell culture base medium was prepared from Eagle's Minimum Essential Medium pre-mixed with Earle's balanced salt solution and sodium bicarbonate (Sigma, M2279). This was supplemented with: 1% MEM non-essential amino acids (Invitrogen, 11140), 1% L-Glutamine solution (from 200 mM solution, Sigma, G7513), and 10% FCS to complete the MDBK-culture medium.
(20) Culturing of MDBK Cells to Produce Conditioned Medium
(21) Actively growing MDBK cells were obtained either from an ongoing culture, or from a frozen stock with some pre-culturing, all using well known techniques.
(22) A culture was started by plating MDBK cells at 4?10.sup.4 cells/cm.sup.2, e.g. by inoculating 3?10.sup.6 MDBK cells, resuspended and washed with PBS, into a 75 cm.sup.2 flask in 15 ml pre-warmed MDBK culture medium. MDBK cells were not seeded below this density as they may not start growing then.
(23) Incubated at 37? C. in 5% CO.sub.2 for 2-3 days until cells reached confluency (i.e. there were no gaps left between the cells). Cells were not allowed to overgrow, as that would deplete the medium too much.
(24) The supernatant culture medium was harvested by pipette into a sterile container; since the MDBK cells were adherent, the medium could be removed without many contaminating cells or centrifugation. Any cell debris was removed by filtration later. Preferably the conditioned medium was used for making T. theileri culture-medium the same day, but could be kept for up to 7 days, stored at 4? C.
(25) MDBK cell culture could be continued by harvesting and passaging according to well known procedures; in short: a T75 culture flask with confluent MDBK cell layer was decanted, and washed with PBS. The cells were detached using brief exposure to 1 ml of 0.25% trypsin/EDTA followed by brief incubation at 37? C. Next 10 ml of MDBK culture medium was added and detached MDBK cells were harvested, counted, and re-seeded in a new T75 flask with pre-warmed medium in a total volume of 40 ml.
(26) 1.3. (Re-)Isolation of T. theileri from a Bovine Animal
(27) T. theileri parasites could be isolated from bovine blood, to obtain T. theileri for recombination, or to re-isolate a recombinant T. theileri some time after its inoculation.
(28) A 10 ml sample of bovine blood was collected into an EDTA-containing vacutainer collection tube. The sample was stored at 4? C. and used preferably within one hour, but use up to 24 hrs was possible.
(29) A T25 flask was filled with 8 ml pre-warmed, and freshly prepared T. theileri medium. Aseptically add 2 ml of the fresh bovine blood to the T25 flask and incubate for a minimum of 4 hours at 37? C. and 5% CO.sub.2 in an incubator, to allow for the coagulation of the blood in the medium.
(30) After incubation and clotting, the supernatant medium was decanted into a new culture flask, being careful not to disturb the solids in the flask. These solids were gently washed once with 3 ml fresh T. theileri medium, and this wash medium was also decanted into the new flask. To both flasks the culture medium was filled up to a total volume of about 12 ml. Both flasks were incubated at 37? C. and 5% CO.sub.2, and monitored daily by light microscopy for the presence of T. theileri at 400? magnification. Parasites were visible within one week of culture in both flasks; the flask with the solids contained more parasites but these were not so easily observed.
(31) The T. theileri parasite used by the inventors was obtained using a similar protocol, as a contaminant of a culture of pericytes isolated from retinal microvasculature from a British cow (Canfield, A. E. et al., 1996, J. Cell. Sci., vol. 109, p. 343-353).
(32) 1.4. Storage of T. theileri Parasites
(33) Cultures of (recombinant) T. theileri could be kept at room temperature up to one week, while maintaining viability. However, for long-time storage of T. theileri parasites, they were stored frozen, using a freezing medium; this consisted of T. theileri culturing medium (incorporating 50% MDBK conditioned medium) and 14% glycerol. The freezing medium was pre-warmed to 37? C. before use.
(34) Next, T. theileri cells were harvested from an actively growing culture by centrifugation at 1000?g for 10 minutes at room temperature. Carefully decant the medium supernatant. The T. theileri cells were then resuspended in T. theileri freezing medium at a concentration of about 2?10.sup.5 cells/ml. This mixture was aliquoted into appropriate containers for frozen storage, for example into 1 ml cryotubes.
(35) The cryotubes were carefully cooled down at about 1-3? C./min, for instance by placing in a polystyrene box and placing the box at ?80? C. overnight. Next day the cooled cryotubes could be placed in long-term frozen storage: at ?80? C. for storage of weeks-months, or in liquid nitrogen for storage of years.
(36) Thawing and reviving (recombinant) T. theileri parasites from long-term cold storage as frozen stabilates in glycerol could for example be done in the following way: T25 culture flasks with 10 ml of prewarmed and freshly prepared T. theileri culture medium were made ready. The ampoule containing the T. theileri was removed from cold storage and transported to the laboratory on ice (in less than 5 minutes). The vial was thawed quickly by swirling the bottom of the tube in a water bath at 37? C. for approximately 1 minute, until the frozen content releases from the side of the ampoule. The vial was then disinfected by liberal application of a 70% ethanol solution. To transfer the culture from the tube, 1 ml of pre-warmed T. theileri media was pipetted into the ampoule and the whole content was dropped into the T25 culture flask. The culture was then left to recover overnight in an incubator (37? C., 5% CO.sub.2). Next day the T. theileri parasites were counted and cultured in fresh medium, and in the case of transfected T. theileri, the proper amount of a selective drug was added.
(37) 2. Obtaining T. theileri Genomic Sequence Information
(38) For the construction of the various vectors, cassettes and mutant parasites according to the invention, the inventors had to identify the required genetic information from the genome of T. theileri, for use as target region for insertion of a mutation according to the invention, and/or to provide RNA processing signals for the expression of heterologous nucleic acid sequence inserts.
(39) For lack of genetic information from T. theileri, the inventors derived consensus sequences for desired genes and untranslated regions of T. theileri from corresponding genomic regions from T. brucei and T. cruzi, using for example Genbank publications NZ_AAHB00000000 and NZ_AAHK00000000 respectively. Next, degenerated PCR primers were designed that incorporated the variations observed, to amplify the desired region of the T. theileri genome. The actual cloning and sequencing techniques were based on standard protocols.
(40) To overcome the variation between the IR sequences of Trypanosoma species the focus was repeated gene clusters in the T. theileri genome. PCR amplification was then started from the more conserved ends of the coding regions, which allowed the PCR to proceed into the unknown IR's.
(41) This approach was applied to obtain the T. theileri IR from two regions of the Tubulin gene cluster, and one from the PFR gene region. The degenerated primers used were:
(42) TABLE-US-00001 SEQ ID NO Primername Sequence5->3 3 a-tubrev cccaaraarttraaigcrtcrtcytcitcicc 4 b-tubUTR ggiatggaygaratggarttyacigargc 5 a-TubulinF cccgciaaigticarmgigcigtitgyatgatigc 6 b-TubulinR ccciaaigtcatcatiaticiitciggita 7 PFR-F gggaarcargargargtiaaratigcigcigar 8 PFR-R gggrttrtgiatyttytgyttickigcigcytc
(43) The nucleotides of the degenerated primers are represented in standard IUB code, wherein r=a or g, i=inosine, y=c or t, m=a or c, s=c or g and w=a or t.
(44) For the Tubulin alpha-beta IR, after amplification by degenerated primers, a set of regular primers was used to obtain the entire alpha-beta Tubulin IR sequence:
(45) TABLE-US-00002 SEQIDNO Primername Sequence5->3 9 Tub-UTRfor ggagtactagatatgtagagc 10 Tub-UTRrev ccctgaacacacacaatctcgc
(46) This way a number of IR sequences were determined, which could advantageously be used either as genomic targeting regions for the insertion of a mutation according to the invention, or for providing the required RNA processing signals for expression of an inserted heterologous sequence.
(47) In SEQ ID NO's: 11-13 (and 20) are presented IR sequences (represented from the first nucleotide of the IR after the upstream stop codon, through to the last nucleotide of the IR before the downstream start-codon) from:
(48) SEQ ID NO: 11 beta-alpha Tubulin intergenic region
(49) SEQ ID NO: 12: alpha-beta Tubulin intergenic region
(50) SEQ ID NO: 13: PFR intergenic region
(51) In areas of the T. theileri genome that were found to be more conserved, the use of degenerated primers was not necessary, and consensus primers could advantageously be used. This was applied to obtaining the Actin IR and to obtain the 5 en 3 ends of the 18S SSU rRNA genome region of T. theileri, by way of the following primers:
(52) TABLE-US-00003 SEQ ID NO Primername Sequence5->3 14 Actin-UTR gggtatcgtacacaacaagtg For 15 Actin-UTR ccctagcagattgctcctcctc Rev 16 SSU5-ApaI- atagggcccgcatggctcattacatcagacg For 17 SSU5-AvrII- agacctaggcaacaaaagccgaaacggtagcc Rev 18 SSU3-PacI- gggttaattaaatcctcagcacgtttcttactt For 19 SSU3-Rev-For atacccgggctgcaggcaggttca For
(53) This way the Actin IR and both ends of the 18S SSU rRNA gene region of the T. theileri genome could be determined. All these could conveniently be used as target region for mutation insertion, and the actin IR could serve as RNA processing signal.
(54) For the actin IR (SEQ ID NO: 20), the same sequence of 392 nucleotides was identified from 3 different actin IR's in the Actin tandem gene array, and it is therefore a consensus sequence. The part of the T. theileri actin IR that provides the splice-leader acceptor site (SEQ ID NO: 21), was found to be comprised in the 3 part of this actin IR that begins at nucleotide 256 of SEQ ID NO 20.
(55) Further genome targeting regions for use in the invention are the 5 and 3 regions of the T. theileri 18s SSU rRNA gene, presented herein as:
(56) SEQ ID NO: 22: 5 end of 18s SSU rRNA
(57) SEQ ID NO: 23: 3 end of 18s SSU rRNA.
(58) 3. Construction of Integration Cassettes and Transfer Vectors
(59) The T. theileri transfervectors for the invention were assembled in a modular way, so that different elements could conveniently be exchanged, to create different integration cassettes, and thus generate the different recombinant T. theileri parasites tested. Graphical representations of a number of exemplary insertion cassettes are represented in
(60) The plasmid backbone used for all experiments was derived from the pGemT Easy? plasmid (Promega) that was linearised using its PstI and ApaI restriction enzyme recognition sites. The inserts made introduced some modified restriction sites that were convenient for the excision of the integration cassettes; the Tubulin based cassettes used ApaI and PstI restriction sites, and the 18S SSU based cassettes used ApaI and XmaI sites. These manipulations were all done using PCR cloning primers according to standard protocols. The relevant PCR cloning primers used in the course of the construction work are listed below.
(61) For Tubulin IR based insertion cassettes, the targeting sequences used for directing the homologous recombination are two IR sequences from the Tubulin gene region. Each was adapted to have convenient restriction enzyme sites for directional cloning; the alpha-beta Tubulin IR (SEQ ID NO: 12) was adapted to an ApaI-FseI fragment using primers ab-tub NotI and ab-tub FseI (SEQ ID NO's: 24 and 25) (because in this case the ApaI site is derived from the pGEM backbone itself). Similarly, the beta-alpha Tubulin IR (SEQ ID NO: 11) was adapted to a BglII-PacI fragment using primers ba-tub BglII and ba-tub PacI (SEQ ID NO's: 26 and 27).
(62) For 18S SSU rRNA gene based insertion cassettes, the two ends of the gene were incorporated into a transfervector, after adaptation of their end sequences whereby the 5 18S SSU rRNA gene fragment (SEQ ID NO: 22) was adapted to an ApaI-AvrII fragment using primers SSU5-ApaI-For and SSU5-AvrII-Rev (SEQ ID NO's: 28 and 29); and the 3 18S SSU rRNA gene fragment (SEQ ID NO: 23) was adapted to a PacI-XmaI fragment using primers SSU3-PacI-For and 3SSU-Rev-XmaI (SEQ ID NO's: 30 and 31).
(63) TABLE-US-00004 SEQ ID NO Primername Sequence5->3 24 ab-tub-NotI aaagcggccgctagatatgtagagctacccc 25 ab-tub-FseI cccggccggccatttctcttcagactgttattc 26 ba-tub-BgIII gggagatcttaaatgggatacatgggggtgc 27 ba-tub-PacI gggttaattaagttgaaaaaaagaaaaaacttg 28 SSU5-ApaI-For atagggcccgcatggctcattacatcagacg 29 SSU5-AvrII- agacctaggcaacaaaagccgaaacggtagcc Rev 30 SSU3-PacI-For gggttaattaaatcctcagcacgtttcttactt 31 3SSU-Rev-XmaI atacccgggctgcaggcaggttca
(64) Wherein: ab-tub=alpha-beta Tubulin IR; ba-tub=beta-alpha Tubulin IR; SSU5=5 end of 18S SSU rRNA gene; SSU3=3 end of 18S SSU rRNA gene.
(65) Subsequently, a wide variety of other elements has been incorporated in these transfervectors, and was transfected into T. theileri parasites. Described here are: the antibiotic resistance gene for Blasticidin (BSD) (nucleotides 4934 through 5326 from SEQ ID NO: 1); marker genes eGFP (SEQ ID NO: 77) and CAT (nucleotides 3590 through 4249 from SEQ ID NO: 1); and antigen genes sACE-1 (SEQ ID NO: 78) and Bd37 (nucleotides 5200 through 6222 from SEQ ID NO: 2).
(66) Each of these was appropriately flanked with RNA processing signals as described above.
(67) Also, the heterologous nucleic acid sequences for expression of a protein could be flanked by trafficking signals: N-terminal BiP fragment (nucleotides 3949 through 5193 from SEQ ID NO: 2), or a GPI anchor (SEQ ID NO: 79).
(68) For the Bd37 gene insert a shortened core version was created (SEQ ID NO: 80), wherein the hydrophobic sequences of the native Bd37 N-terminal signal sequence and C-terminal GPI anchor were deleted, to be able to accurately manipulate its protein-trafficking behaviour.
(69) All these elements were provided with convenient restriction sites by PCR, using PCR cloning primers SEQ ID NO's: 32-66, see Table 1, to allow directional cloning. The specific restriction enzyme sites used varied, dependent on the order in which these elements were incorporated in a particular insertion cassette, and the restriction sites used for the other elements.
(70) Throughout all manipulations, care was taken not to disturb the reading frame by introduction of stop codons: all restriction enzymes used had 6 base recognition sites, therefore only changed or introduced two amino acids but left the reading frame intact. Also, when an N- or C-terminal fusion was introduced, the native start or stop codon was removed, and was provided by the fused sequence. The Bd37 core sequence without trafficking signals was provided with new start and stop signals, also respecting its reading frame.
(71) Transfervectors were constructed and amplified in E. coli bacteria according to standard procedures.
(72) TABLE-US-00005 TABLE1 Cloningprimersusedfortheconstructionofvariousinsertioncassettesand transfervectorsforT.theilerirecombination SEQIDNO Primername Sequence5->3 32 Actin-AscI gggggcgcgcctggcttgtgtttatctatttc 33 Actin-KpnI cccggtacctgttgaaatagtaactcg 34 ba-tub-AscI-For ggaggcgcgccaaatgggatacatggggg 35 ba-tub-KpnI-Rev ggaggtaccgttgaaaaaaagaaaaaacttg 36 splice-AvrII-For gggcctagggtcgttgttatcgttgtacg 37 splice-FseI-Rev gacggccggccgaaatagtaactcgatatgc 38 BSDKpn-F cccggtaccatggccaagcctttgtctcaa 39 BSDBgl-R cccagatctttagccctcccacacataaccag 40 BSDForFseI ataggccggccatggccaagcctttgtctcaa 41 BSDRevAscI ataggcgcgccttagccctcccacacataaccag 42 BiP-For-FseI agaggccggccatgtcgaggatgtggctgacc 43 BiP-Rev-XhoI gggctcgagcccgccaacctcgctttcaccg 44 BiP-For-KpnI ataggtaccatgtcgaggatgtggctgacc 45 BiP-For-FseI-SpeI ataggccggccactagtatgtcgaggatgtggctg acc 46 GPI-Rev-BgIII ataagatctttagaatgcggcaacgagagc 47 GPI-For-XbaI atatctagacctgaacctggtgctgcaacgc 48 GPI-Rev-AscI ataggcgcgccttagaatgcggcaacgagagc 49 GPI-For-HindIII ataaagcttcctgaacctggtgctgcaacgc 50 Bd37-Core-F-FseI ataggccggccatgttcaatggcaataatgtgagc tgc 51 Bd37-Core-R-AscI ataggcgcgccttatccctgacctgatcctgcagc aca 52 Bd37-Core-F-AvrII atacctaggttcaatggcaataatgtgagctgc 53 Bd37-Core-R-HindIII ataaagctttccctgacctgatcctgcagcaca 54 ACE-fullFse GGAGGCCGGCCATGAGTCCACTTTGAAGGAAAG 55 ACE-fullAsc ATAGGCGCGCCTCGCTTGTGCTTCTCGGTTCTC 56 ACE-Acc65-F GGAGGTACCATGAGAGTCCACTTTGAAGGAAA 57 ACE-Bgl-R GGGAGATCTCTATTCGCTTGTGCTACTC 58 EGFP-FseI GGGGGCCGGCCATGGTGAGCAAGGGCGAGG 59 EGFP-AscI GGGGGCGCGCCTTACTTGTACAGCTCGTCC 60 CATForFseI ATAGGCCGGCCATGGAGAAAAAAATCACTGGATAT 61 CATRevAscI ATAGGCGCGCCTTACGCCCCGCCCTGC 62 CATForXhoI GGGCTCGAGGAGAAAAAAATCACTGGATATACC 63 CATRevXbaI ATATCTAGACGCCCCGCCCTGCCA 64 CATForKpnI ATAGGTACCATGGAGAAAAAAATCACTGGATAT 65 CATRevBgIII ATAAGATCTTTACGCCCCGCCCTGC 66 CATForFseI ATAGGCCGGCCATGGAGAAAAAAATCACTGGATAT
(73) Wherein in Table 1:
(74) Actin=actin IR-complete; ba-tub=beta-alpha Tubulin IR; splice=Actin IR-splice leader acceptor site; Bd37-core=Bd37 sequence without hydrophobic sequences at its termini; and ACE full=full length sACE-1 gene from D. viviparus.
(75) 4. Transfection of T. theileri
(76) 4.1. Preparation of Cells and Transfection Protocol
(77) From a culture of logarithmically growing T. theileri parasites, at least 10 ml of culture at about 5?10.sup.5 cells/ml was used for each transfection. The transfections were done as quickly as possible to minimize the amount of time the cells were at room temperature. The cells were pelleted by centrifugation at 1000?g, for 10 minutes at room temperature.
(78) Under sterile conditions, e.g. in a laminar airflow cabinet, the medium supernatant was carefully removed and the T. theileri cell pellet was resuspended into 1 ml of sterile PBS to wash the cells. This was re-centrifuged at 1000?g (10 min., room temp.). Meanwhile, T25 culture flasks (1 per transfection) were prepared with 10 ml of pre-warmed T. theileri medium.
(79) The PBS supernatant was discarded and the pelleted cells resuspended in 100 ?l Ingenio? transfection buffer (Mirus Bio). The vector DNA was prepared as described below, in an amount of at least 7.5 ?g of linear DNA to approximately 1?10.sup.7 cells, and placed in a cuvette for the Nucleofector II? electroporation device (Lonza).
(80) Transfection was done with Nucleofector program X-001 (recommended for mouse CD8+ T cells). Immediately after the electroporation, the cells were transferred to the pre-prepared culture flask, and incubated for 24 hrs (at 37? C., in 5% CO.sub.2).
(81) 4.2. Preparation of Transfervector DNA
(82) Transfervectors were constructed and analysed as described above. For transfection, 15 ?g of plasmid DNA was digested with an appropriate restriction enzyme to linearise the vector, and to excise the pGEM T Easy? plasmid backbone. Transfervectors for Tubulin IR targeting experiments were digested with the enzymes ApaI and PstI, and transfervectors for targeting to the 18S SSU rRNA gene were digested with ApaI and XmaI.
(83) The digested plasmid fragments were separated by gel electrophoresis on a 1% agarose gel. The resulting bands were visualized on a UV transilluminator and the band corresponding to the integration cassette was excised from the gel, thereby purifying it away from the vector backbone. The linear DNA of the integration cassette was purified using a NucleoSpin? Extract II? kit (Macherey-Nagel) as per manufacturer's instructions except that the elution was done for four consecutive times with 50 ?l of the elution buffer provided with the kit, to a total elution volume of 200 microliters. Next the eluted DNA was precipitated with ethanol/acetate at ?80? C. After centrifugation, the supernatant was carefully removed, the pellet was air-dried, and resuspended in 5 ?l TE buffer (1 mM Tris-HCl (pH 8) and 0.1 mM EDTA).
(84) 4.3. Selection of Transfectants
(85) Transfected T. theileri parasites are placed under drug selection to select out those cells that were successfully and stably transfected. Therefore, after the initial 24 hour recovery period each transfection was processed: 0.5 ml of each culture is placed in a well of a 24-well plate to act as a no drug control, to which fresh T. theileri media is added to a total volume of 2 ml. The remainder of the culture was centrifuged (1000?g, room temp.) for 10 minutes. Cells were resuspended in 10 ml of pre-warmed T. theileri culture medium containing the selective drug at the selective concentration. For the transfervectors used in these experiments Blasticidin is the drug for selection, used at a final concentration of 10 ?g/ml.
(86) The resuspended cells were aliquotted into 24 well plates at 1:2, 1:10 and 1:20 dilutions in T. theileri culture medium and the volume of each well was brought to 2 ml with pre-warmed T. theileri media containing the selective drug. The plates were examined daily under the light-microscope. After 5-7 days 1 ml of medium was carefully removed from the top of each well by pipette, and replaced by 1 ml of fresh T. theileri culture medium with the selective drug at the appropriate concentration.
(87) Those T. theileri cells not effectively transfected, died off within a few days. The cells in the no-drug control well however grew out in any case, indicating that the transfection itself had not damaged the cells. After 10-14 days of incubation, the transfectants surviving the selection became visible, as actively swimming parasites. These were further amplified and either stored as described, or used for analysis of insert and expression (see below).
(88) 5. Northern Blot Analysis of Recombinant T. theileri mRNA Transcription Levels
(89) In vitro mRNA transcription levels were determined from stably transfected recombinant T. theileri parasites that incorporated heterologous genes like eGFP, CAT, ACE, and Bd37, either inserted in the Tubulin IR genomic region or in the 18S SSU rRNA gene.
(90) 5.1. Harvest of RNA from T. theileri
(91) To collect RNA samples, 25 ml cell cultures of logarithmically growing recombinant T. theileri parasites were used; these were centrifuged at 1000?g for 10 minutes at room temperature. RNA samples were isolated using the QIAGEN RNEasy? Mini Kit (Qiagen, 74106) as per the manufacturer's instructions, using the optional DNase treatment steps as described. Next RNA samples were stored at ?80? C. until processing.
(92) 5.2. Preparation of the Riboprobes
(93) The target sequence of the riboprobe reaction is cloned into pGEM T Easy? vector as per the manufacturer's instructions (Promega, A1360). Linear probes were produced via PCR reaction, by way of M13 primed PCR. The PCR labelling reaction components are: 1 ?l template DNA (about 100 ng); 5 ?l 5?DNA Pol Buffer; 1.25 ?l MgCl.sub.2 (25 mM); 0.1 ?l M13 forward primer (100 ?M); 0.1 ?l M13 reverse primer (100 ?M); 0.25 ?l dNTPs (2 mM each); 0.25 ?l DNA Pol enzyme (5 U/ml); and 17.05 ?l double distilled water up to 25 ?l.
(94) Next the PCR was run as follows: start with 5 min. 95? C.; followed by 35 cycles of: 95? C. 45 s., 60? C. 45 s., and 72? C. 1 min. Finally 72? C. for 5 min.
(95) The PCR product was DIG-labelled using the DIG RNA Labelling Kit? (SP6/T7) (Roche, 11175025910) as per the manufacturer's instructions, to produce Dig labelled riboprobes. The probes were stored at ?80? C. until use.
(96) 5.3. RNA Gel Electrophoresis and Northern Blotting
(97) RNA gel electrophoresis, and the subsequent transfer, and blotting was performed essentially according to the manufacturer's instructions of the DIG Northern Starter Kit? (Roche, 12039672910), with some amendments: Agarose gels contained 1.1% v/v formaldehyde and were run for 2 hours at 150 V. Transfer was to positively-charged Nylon membrane by capillary transfer with 20?SSC overnight. Next the membranes were fixed by UV-cross linking (0.12 joules, 254 nm), and blocking and hybridization steps were done in a hybridization oven at 68? C.
(98) 5.4. Northern Blot Probe Sequences
(99) The various probes used for labelling and hybridisations, were mostly based on the entire coding sequence of the various inserted genes; The primers for making the riboprobes are described in Table 1, and were, for eGFP: primers EGFP-FseI and EGFP-AscI; for CAT: CAT For FseI and CAT Rev AscI; for BSD: BSD For FseI and BSD Rev AscI; for sACE-1: ACE-full Fse and ACE-full Asc.
(100) The Bd37 probe contained only a part of the Bd37 gene, and was generated using primers:
(101) TABLE-US-00006 SEQIDNO Primername Sequence5->3 67 Bd37NorthernF ACGCAGCAAGGTGGTGCGAA 68 Bd37NorthernR GCGCTGCTTCAACACTGTCACC
6. CAT Elisa Assays
(102) The expression of Chloramphenicol transferase (CAT) from the CAT gene inserted in recombinant T. theileri parasites was detected by Elisa, using a CAT ELISA? kit (Roche, 11363727001) according to the manufacturer's instructions. In short:
(103) From a logarithmically growing parasite culture, at a concentration between 0.5 and 1?10^6 cells/ml, a precise parasite cell count was made immediately prior to sample preparation, to be able to calculate CAT expression per 10^6 parasites later. A sample of 10 nil of the counted culture was centrifuged (1000?g, 10 min., room temperature), and the cell pellet was washed 3 times in 1 ml of cold 1?PBS. Finally parasites were recovered by centrifugation in a 1.5 ml Eppendorf tube at 4000?g for 2 min. at room temp. The pelleted cells were resuspended in 1 ml of 1? Lysis buffer (provided with the kit) by rapping the tubes along a tube rack and then left to stand for 20 minutes at room temperature. Next the sample was centrifuged at 4000?g for 5 minutes to remove cell debris. The lysis-supernatant was divided into 2?500 ?l in fresh Eppendorf tubes, snap frozen in liquid nitrogen, and stored at ?80? C. until use. Samples of wild-type T. theileri were also harvested as negative controls.
(104) The CAT ELISA was carried out as per the manufacturer's instructions with 1:10 and 1:100 dilutions of the cell-lysates, and CAT protein expression was measured by reading of the OD 405 nm. For determining quantitative expression levels, CAT expression levels were calculated in ng/10^6 parasites (in starting sample), from a reference sample of CAT protein of known concentration, according to the manufacturer's instructions.
(105) 7. In Vitro Results of Heterologous Expression by Recombinant T. theileri Parasites
(106) 7.1. eGFP Expression by Recombinant T. theileri Parasites from the Tubulin IR Locus
(107) Recombinant T. theileri parasites were generated with transfervector pabEABSDba (
(108) Stable recombinants were selected using Blasticidin drug-selection, and three lines of recombinant parasites were amplified in vitro. RNA was isolated from each line, as described above, and tested with a DIG-labelled riboprobe specific for eGFP mRNA. Results are presented in the left panels of
(109) The upper left panel shows the results after the blotting and hybridisation. eGFP mRNA was detected in all three lines of recombinant T. theileri parasites, but not in wildtype T. theileri RNA (untransfected parental cell-line). Some difference in the level of expression can be observed, however that reflects minor variability in sampling and processing.
(110) In conclusion: all three independent lines of recombinant T. theileri express the eGFP gene from the Tubulin IR locus, in addition to expression of the Blasticidin drug-resistance gene.
(111) 7.2. sACE-1 Expression by Recombinant T. theileri Parasites from the Tubulin IR Locus
(112) Similar to the eGFP Northern blots described above, recombinant T. theileri parasites that expressed a soluble version of the D. viviparus acetylcholinesterase-1 (sACE-1) from the Tubulin IR locus, were generated, drug selected, and grown in vitro. The transfervector used to make the recombinant T. theileri tested here, was highly similar to the ones displayed in
(113) Results are presented in the right panels of
(114) In conclusion: a recombinant T. theileri was made that was shown to express the sACE-1 gene from the Tubulin IR genomic locus, next to expression of the Blasticidin drug-resistance gene.
(115) 7.3. CAT Expression by Recombinant T. theileri Parasites from the Tubulin IR Locus
(116) Again similar to the results above for the expression of the eGFP and ACE genes, the expression of a CAT gene from the Tubulin IR genomic locus was demonstrated for differently constructed recombinant T. theileri parasites; all expressing CAT, but varying in the IR sequence that was incorporated in between the CAT and the BSD gene; IR sequences used were from beta-alpha Tubulin IR (the map of the transfervector used is represented in
(117) All three recombinants expressed the CAT gene (in addition to the BSD gene), as demonstrated by Northern blot and by CAT protein Elisa; results are presented in
(118) In the top two panels of
(119) The bottom panel of
(120) In conclusion, it was once more demonstrated that recombinant T. theileri could be generated that express a heterologous nucleic acid, here: BSD, and CAT, and that modifications could be made in the design of the expression construct to vary and thus optimise expression as required.
(121) 7.4. Protein Expression by Recombinant T. theileri Parasites from the 18S SSU rRNA Gene Locus
(122) Similar to expression from the Tubulin IR locus, recombinant T. theileri parasites were also generated that expressed a number of proteins from the 18S SSU rRNA locus on their genome. Again, different genes were integrated and expressed, in different constellations, and with varying IR sequences. Some of the transfervectors used in these experiments are presented in
(123) An overview of results for the expression of one or more CAT genes in different conformations, from the 18S SSU rRNA genomic locus of recombinant T. theileri parasites in vitro is presented in Table 2.
(124) The various constructs tested, having different elements in the insertion cassettes, are presented schematically. For most of these a corresponding vector map is presented in the Figures, numbers are indicated in the table. Protein genes used for this set of experiments were CAT and BSD; mostly CAT was present upstream of BSD, but the reverse was also tested. CAT has been inserted as single or as tandem insert, and either with or without signal sequences; signal sequences were either the BiP N-terminal signal or both BiP and a GPI anchor sequence.
(125) CAT expression was determined by Elisa as described. To study protein trafficking and the effect thereon from N- or C-terminal sequences, CAT expression was also quantified in cell-culture supernatants, and the percentage of secreted CAT per total CAT expressed was calculated.
(126) TABLE-US-00007 TABLE 2 Protein expression results from various constructs with one or more CAT genes in the 18S SSU rRNA gene of a recombinant T. theileri parasite CAT expression ng/10{circumflex over ()}6 trypanosomes. % secr/ FIG. insertion cassette from 5-> 3 Cellular Secreted total 5 5 SSU- CAT actin IR BSD ba Tub IR- 27.3 15.6 36 Spl Lead 3 SSU no fig. 5 SSU- CAT PFR IR BSD ba Tub IR- 22.1 8.5 28 Spl Lead 3 SSU no fig. 5 SSU- CAT ba Tub BSD ba Tub IR- 27.6 17.1 38 intracellular Spl Lead IR 3 SSU no fig. 5 SSU- BSD actin IR CAT ba Tub IR- 46.3 15.7 25 Spl Lead 3 SSU no fig. 5 SSU- BSD PFR IR CAT ba Tub IR- 38.3 11.6 23 Spl Lead 3 SSU 6 5 SSU- BSD ba Tub CAT ba Tub IR- 66.9 11.7 15 Spl Lead IR 3 SSU 7 5 SSU- BiP CAT ba Tub BSD ba Tub IR- 0.27 0.64 70 secreted Spl Lead IR 3 SSU 8 5 SSU- BiP CAT GPI ba Tub BSD ba Tub IR- 3.6 0.29 7 surface Spl Lead IR 3 SSU expr. 9 5 SSU- BiP CAT ba Tub BiP CAT ba Tub BSD ba Tub IR- 3.1 54 Spl Lead IR IR 3 SSU 10 5 SSU- BiP CAT GPI ba Tub BiP CAT GPI ba Tub BSD ba Tub IR- 3.6 2 Spl Lead IR IR 3 SSU
7.5, Results and Conclusions from CAT Expression by Various Recombinant T. theileri Parasites
(127) The tested IR regions were all competent for RNA processing resulting in protein expression, and good levels of heterologous antigen expression and an average of 45 ng antigen/10.sup.6 parasites was obtained from the T. theileri 18S SSU rRNA gene locus. It was noted that the upstream expression site in these constructs showed somewhat lower protein levels than the downstream expression site(s); a similar effect was also noted for insertions in the tubulin IR locus. Also some variations in the levels of secreted CAT protein were noted, which probably resulted from a process or normal cell death/lysis, even though the parasite cultures all looked normal.
(128) The secretion level seemed to fluctuate around 20-25% in most cases tested, although there were outliers: CAT Expression in the absence of any trafficking signals resulted in about 38% of the expressed antigen being released into the cell culture medium (either by active secretion, or through release from dying cells). The addition of specific trafficking signals was successful in directing the heterologous antigen within T. theileri for secretion (with the BiP protein N-terminus), or for surface expression (with the BiP protein N-terminus and a GPI-anchor addition sequence at the C-terminus).
(129) As expected, the BiP fusion CAT protein was found predominantly in the cell culture media, displaying a much higher secretion rate (73%) than the untargeted construct (15-38%, for different clones tested). The GPI-anchored CAT protein, in contrast, was found almost exclusively (95%) to be cell-associated, indicating its presence on the cell surface. Total CAT protein expression levels were somewhat lower when trafficking signals were used; this may be due to a shorter half-life in the extracellular milieu in the case of the secreted protein, or due to spatial constraints, or surface protein turnover, in the case of the GPI-anchored protein.
(130) 7.6. Expression of the Bd37 Gene by Recombinant T. theileri Parasites
(131) Recombinant T. theileri were generated that expressed the Babesia divergens Bd37 antigen from the 18S SSU rRNA gene locus. Different constructs were made and tested, having one or two Bd37 genes inserted upstream of the BSD gene, and the Bd37 gene was tested with or without trafficking signals. Also a core version of the Bd37 gene was tested, i.e. without its native N- and C-terminal hydrophobic sequences.
(132) The resulting recombinant parasites were tested in vitro, by Northern blot and Elisa. Next, some of these recombinants were tested in vivo in bovine animals by inoculation and monitoring immune-responses.
(133) 7.7. Northern Blotting of Recombinant T. theileri Parasites Expressing the Bd37 Antigen
(134) By similar method as described above, the recombinant T. theileri parasites expressing one or more Bd37 inserts (in addition to a BSD gene) were analysed by Northern blotting: DIG-labelled probes specific for the Bd37 gene were used. Results are presented in
(135) T. theileri recombinants tested were generated by transfection with the insertion cassettes comprised in the transfervectors: Lanes 2 and 3: p53Bd37, (two separate clones were tested); Lane 4: p53BiPBd37; Lane 5: p53BiPBd37GPI; Lane 6: p53BB tandem (vector map in
(136) Results indicated that all recombinants expressed the Bd37 gene(s), with sizes of the transcripts modified depending whether no signals were attached (
(137) 7.8. Detection of Bd37 Seroresponse in Bovines, Using Elisa
(138) The level of seroresponse by bovines inoculated with a recombinant T. theileri parasite expressing the Bd37 vaccine antigen, was monitored by an antibody Elisa. Alternatively, a competition Elisa was used to detect the quality of the seroresponse; in the competition test a second antibody (a mouse monoclonal antibody specific for Bd37 and known to be capable of providing passive immunity) was used to detect competition for binding to a standard amount of coated recombinant Bd37 antigen. A short description of both methods:
(139) Recombinant (E. coli) expressed His-tagged Bd37 antigen was diluted to 5 ?g per ml in coating buffer (coating buffer=0.01 M sodium carbonate pH 9.6), and 100 ?l was coated in microtitre wells overnight at 37? C., packed against evaporation. The coating buffer was removed and 200 ?l blocking buffer (3% w/v BSA in 10 mM PBS) was added, and incubated at 37? C. for 60 minutes. The plates were washed 3 times with 200 ?l washing buffer (10 mM PBS, pH 9.6). Bovine serum samples were diluted in blocking buffer, and 100 ?l were incubated in the coated wells (all subsequent incubation steps were carried out at 37? C. for 60 minutes). Next plates were washed, and in case of competition Elisa, incubated with 100 ?l of Moab Bd37 diluted 1:1000 in blocking buffer and incubate. Next plates were washed and incubated with conjugated antibody: 100 ?l of an HRP conjugated anti-bovine or -anti-mouse antibody respectively, and incubated. Plates are washed, stained with TMB substrate, stopped with sulfuric acid, and OD is measured at 450 nm in an ELISA reader.
(140) Bd37 Elisa results are presented in the section on the animal trials.
(141) 8. Nested PCR Assays for Detection of T. theileri
(142) Nested PCR assays were developed to sensitively monitor the presence of T. theileri; either the infection with recombinant T. theileri parasites in inoculated bovines, or the detection of any pre-existing infection with wildtype T. theileri in the experimental bovine animals.
(143) 8.1. General Procedures
(144) Bovine blood samples we divided into 2, and DNA was extracted as described below. Next, these 2 samples were each assayed in duplo according to the nested PCR protocol described below. This gives a total of four assays of each blood sample.
(145) The primer-sets used were either directed to a T. theileri Tubulin IR sequence to detect all T. theileri, recombinant and wildtype, or to a specific inserted gene, e.g. the Bd37 gene, to detect specific recombinants. The protocols used were the same except for the annealing temperatures.
(146) The resulting PCR products were assessed by gel-electrophoresis on a 1% agarose gel according to standard techniques, which was stained with Ethidium Bromide, looking for a band of the correct size. A bovine blood sample was considered positive if 2 or more of the 4 assays showed a correct band.
(147) The signal strength for the PCR product of the Tubulin IR was generally higher than that of the inserted gene, which matches the difference in number of target copies: many for Tubulin IR, and one or two (when the recombinant parasites had been transfected with the tandem construct) for the heterologous gene insert.
(148) Because of variation in signal strength for the positive bands, the were only used for qualitative interpretation: positive-negative scoring. The variation observed resulted from the very small amounts of T. theileri genomic material present in the bovine blood samples tested.
(149) 8.2. DNA Isolation from Whole Blood for PCR:
(150) The procedure was modified from literature (Higuchi R., Rapid, efficient DNA extraction for PCR from cells or blood, in: Amplifcations: a forum for PCR users, Norwalk, Conn. ed., Perkin Elmer Cetus, 1989, vol. 2, p. 1-3). In short: 1 ml of whole bovine blood was collected in an EDTA-containing vacutainer. 500 ?l lysis buffer (see below) was added to each tube and vortexed to suspend evenly. Samples were centrifuged for 30 s. at 16.000?g to pellet the nuclei. Next, supernatant was carefully pipetted off and discarded. The pellet was resuspended in lysis buffer. The extraction was repeated two more times, or until no haemoglobin remained and pellet appeared creamy white with no red. Then the pellets were resuspended in 100 ?l PBND buffer with proteinase K (see below), and incubated at 55? C. for 60 min. Finally, samples were heated to 97? C. for 10 min. to inactivate the proteinase K. The crude extracted DNA was used directly in PCR reactions.
(151) Lysis buffer consisted of: 0.32 M Sucrose; 10 mM Tris-HCl (pH 7.5); 5 mM MgCl.sub.2; and 0.75% v/v Triton X-100.
(152) PBND buffer (PCR Buffer with Nonionic Detergents) consisted of: 50 mM KCl; 10 mM Tris-HCl (pH 8.3); 2.5 mM MgCl.sub.2; 0.1 mg/ml gelatine; 0.45% (v/v) Nonidet P40; and 0.45% (v/v) Tween 20. This was sterilised by autoclaving, which also dissolved the gelatine. Stocks were stored frozen. Immediately before use, per ml of PBND buffer, 0.5 ?l of 60 ?g/ml proteinase K was added.
(153) 8.3. Nested PCR Protocol:
(154) For all first round PCRs, the PCR reaction was set up in a total volume of 25 ?l with: 3 ?l of extracted DNA Sample; 5 ?l of 5? GoTaq Flexi? Buffer; 1.25 ?l MgCl.sub.2 (at 25 mM); 0.1 ?l (at 100 mM) of each of the two first round primers; 0.25 ?l of dNTP mixture (at 2 mM of each nucleotide); 0.25 ?l of DNA polymerase (at 5 U/?l); and 15.5 ?l double distilled water. The reagents used were from the GoTaq Flexi? DNA Polymerase kit (Promega, M8305).
(155) Next the PCR Reaction was run on a Biometra T Professional Basic? PCR machine with the following settings: initially: 4 min. at 95? C., and next 35 cycles of: 45 s. 95? C.; 45 s. of annealing; and 45 s. at 72? C.; followed by a final 4 minutes at 72? C. The annealing temperatures were different for the different PCR assays: for detecting a T. theileri Tubulin IR sequence, annealing was done at 60? C., and for detecting the inserted Bd37 gene, annealing was at 67? C.
(156) After the first round, 3 ?l of the PCR reaction product was used in the second PCR reaction using a reaction mix similar to that for the first round, except that only 4.4 ?l of 5?DNA Pol Buffer was used, and of course the PCR primers used were those for the 2.sup.nd stage. The second stage PCR used the same PCR temperature cycling program.
(157) Primers used for the nested PCR assays were:
(158) TABLE-US-00008 SEQIDNO Primername Sequence5->3 69 TubDiagF1 agtagcaacgacagcagcagt 70 TubDiagR1 gtaaagtgtttgaagaagagctcg 71 TubDiagF2 cgattctcttcgcctgtttgt 72 TubDiagR2 actaaccgcgaccaaagaagt 73 Bd37DiagF1 atgaaaaccagtaagattctcaac 74 Bd37DiagR1 tgataccgaagacaatggcagaca 75 Bd37DiagF2 agcgaaggatggcttcttaggact 76 Bd37DiagR2 tcaacactgctgctatctgcctcc
(159) The set-up of the nested PCR assays for a T. theileri Tubulin IR, and initial results, are presented in
(160) The expected sizes of the PCR products are: for the Tubulin IR: 1.sup.st round: 627 bp, and 2.sup.nd round: 515 bp; and for the Bd37 gene insert: 1.sup.st round: 887 bp and 2.sup.nd round: 602 bp.
(161) The specificity of the nested PCR for the Tubulin IR sequence was validated by testing known negative bovine cells: a cultured bovine MBDK cell line, to confirm that the screening was parasite specific. Also a herd of healthy farm cattle was tested, and infection with wildtype T. theileri was detected in 21 out of the 22 animals tested, even slightly higher than prevalence levels reported in literature.
(162) The sensitivity of the nested PCR, in its optimised form as described, was such that it could routinely detect T. theileri parasites down to a level of about 10 per ml of the original sample; in the set up as described that means that from each original sample tested in fourfold, at least two assays needed to be positive to be counted. The sensitivity was validated by testing of mouse and bovine (parasite negative) blood samples that were spiked with known amounts of parasites.
(163) 9. Animal Trials Testing Recombinant T. theileri Parasites In Vivo
(164) To test the feasibility and the efficacy of recombinant T. theileri expressing a heterologous nucleic acid inserted in their genome, animal trials in bovines were performed.
(165) In one set-up, the efficacy of expression in vivo was tested, and because most of the experimental animals were T. theileri negative at the start of the experiment, this also provided information on the safety of the inoculation with recombinant T. theileri.
(166) A follow up trial expanded on the positive findings, and used a different expression construct, a larger group of animals, with more animals that were T. theileri positive at the start of the experiment.
(167) 9.1. General Outline of 1.sup.st Animal Trial
(168) Recombinant T. theileri parasites expressing the Bd37 vaccine-antigen were prepared as described, by transfection with the insertion cassette from the transfervector p53BB Tandem (its vector map is presented in
(169) An animal trial (n=6) was performed in 6 weeks old calves, which ran for 13 weeks. The calves were kept in fly free level 2 containment facilities to prevent insect born natural infections. At 1 week prior to inoculation and at day zero, the calves were checked by nested PCR for any pre-existing T. theileri infection. At day zero, each calve was inoculated i.v. with 10^5 recombinant T. theileri parasites expressing the tandem Bd37 vaccine antigens with N-terminal signal sequence. At day 16 one calve became ill with bacterial pneumonia unrelated to the experimental treatment, and was removed from the trial. At week 8 all remaining calves received a booster inoculation i.v. with 10^6 of the same recombinant T. theileri parasites. At week 13 the trial was terminated.
(170) All through the trial, and before its start, weekly blood samples were taken from all animals to monitor the presence of the recombinant T. theileri parasite by PCR, and detect the bovine's seroresponse to the Bd37 vaccine-antigen by Elisa as described.
(171) 9.2. PCR Results of 1.sup.st Animal Trial
(172) Nested PCR's were done at start and at regular intervals during the trial. Detection was for Tubulin IR, detecting all T. theileri, or for Bd37, detecting recombinant T. theileri parasites. Results are presented in
(173) The results show that at the start of the trial, only calf 158 had a pre-existing T. theileri infection, which was non-recombinant as no animal had any reactivity with the Bd37 gene. All inoculated calves reacted positive from 4 days after inoculation, for T. theileri, and in particular for recombinant T. theileri. The infection with recombinant T. theileri parasites was maintained over the course of the trial up until week 13, and no animal cured itself of the infection.
(174) 9.3. Bd37 Elisa Results of 1.sup.st Animal Trial
(175) Serum samples collected before and during the animal trial were tested in the antibody Elisa and in competition Elisa.
(176) Bd37 Antibody Elisa Results
(177) Results are presented in
(178) Also calf 158 seroconverted, even though this had a pre-existing infection with wild type T. theileri.
(179) Most notable was that while expression of the foreign Bd37 antigen continues, and the bovine host went through a specific seroconversion, nevertheless, the recombinant T. theileri does not get cleared by the host's immune system; on the contrary: the host's serum titres show a steady increase over the course of the experiment, indicating a sustained presence of the recombinant parasites, and a sustained expression of its heterologous insert to the bovine host animal.
(180) At 8 weeks after the initial inoculation a booster inoculation was given. However no boost of the Bd37 specific antibody levels can be observed. Apparently an equilibrium level of T. theileri infection had already been established which was not increased.
(181) Bd37 Competition Elisa Results
(182) Results of the Bd37 competition Elisa are presented in
(183) As can be seen from the results, in the samples with low amounts of blocking sera there was some signal interference, leading to absorbance values above the 100% level (100% being the unblocked maximal binding level of the anti-Bd37 MoAb to the coated Bd37 protein). This cleaned out, as blocking increased.
(184) All sera that contained Bd37 antibody were able to compete increasingly for binding at higher serum concentrations. The pre-immune serum had a noticeably lesser effect, hardly different from the levels at the lowest concentrations, which were considered negative.
(185) The mouse monoclonal antibody that the bovine sera competed with, had been demonstrated to be effective in providing Gerbils a protective passive immunity against B. divergens challenge (Precigout, E. et al., 2004, Int. J. for Parasitol. vol. 34, p. 585-593; and Hadj-Kadour 2007, supra). Consequently it was concluded that the bovine antibodies that were induced, at the levels that were obtained, were equally protective against B. divergens challenge.
(186) 9.4. General Outline of 2.sup.nd Animal Trial
(187) To expand on the positive results of the animal trial described, an extended animal trial was initiated. This further studied the effect of the trafficking of the expressed heterologous insert, on the immune-response generated in the bovine host. Therefore recombinant T. theileri were generated using transfervector: p53Bd37core XmaI (
(188) 2.sup.nd Animal Trial Protocol:
(189) A group of 12 calves of 6 weeks old was set aside, and tested for pre-existing T. theileri infection by jugular venapuncture, and nested PCR on whole blood. 4 of the 12 animals were found to be T. theileri positive. Prior to housing in the containment facilities the calves were treated with Danafloxacin (anti-bacterial) and an insecticide. Calves were divided into two groups, each receiving 10^5 i.v. of the recombinant T. theileri. The take of the inoculation was monitored at day 2, 5 and 7 post-inoculation. The possibility for re-inoculation with a repeated, or an increased dose was calculated in, but appeared unnecessary as all animals reacted positive for recombinant T. theileri at day 7 p.i. The inoculated animals are being monitored to follow persistence of parasitaemia and establishment of antibody responses to the heterologous antigen, up to 12 weeks after initial inoculation.
(190) The animals will be blood sampled (20 ml) every 7 days to monitor dynamics of infection and any antigen-specific antibody responses induced. Parasites will be expanded from sampled blood by in vitro culture to monitor continued expression of the expressed heterologous antigen by the TG parasites. At the time of sacrifice an additional 500 ml sample of blood will be taken in addition to normal samples for the purposes of producing a large quantity of serum.
LEGEND TO THE FIGURES
(191)
(192) Graphical representation of various insertion cassettes used for the invention.
(193)
(194) Growth rate of T. theileri parasites in in vitro culture at different starting densities. Error bars indicate a 5% confidence interval.
(195)
(196) Map of transfervector pabEABSDba, comprising eGFP and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the Tubulin IR region on the T. theileri genome.
(197)
(198) Map of transfervector pabCTBba, comprising CAT and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the Tubulin IR region on the T. theileri genome; the sequence is provided in SEQ ID NO: 1.
(199)
(200) Map of transfervector p53 CAB, comprising CAT and BSD ORF's, flanked by RNA processing signals, with the Actin IR Splice leader acceptor site (SL) preceding the CAT gene, and the complete actin IR sequence in between the two coding genes; the whole is inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome.
(201)
(202) Map of transfervector p53BTC, comprising CAT and BSD ORF's, wherein BSD is in the upstream expression position. The genes are flanked by RNA processing signals, with the Actin IR Splice leader acceptor site preceding the BSD gene, and the beta-alpha Tubulin IR sequence in between the two coding genes; the whole is inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome.
(203)
(204) Map of transfervector p53 BiPCAT, comprising CAT and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The CAT gene additionally was provided with an upstream trafficking signal (BiP).
(205)
(206) Map of transfervector p53 BiPCATGPI, comprising CAT and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The CAT gene additionally was provided with upstream (BiP) and downstream (GPI) trafficking signals.
(207)
(208) Map of transfervector p53 BC Tandem, comprising CAT and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The CAT gene additionally was provided with an upstream trafficking signal (BiP), and the whole BiP-CAT construct was duplicated and inserted in tandem.
(209)
(210) Map of transfervector p53 BCG Tandem, comprising CAT and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The CAT gene additionally was provided with upstream (BiP) and downstream (GPI) trafficking signals, and the whole BiP-CAT-GPI construct was duplicated and inserted in tandem.
(211)
(212) Map of transfervector p53 BB Tandem Xma, comprising Bd37 and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The Bd37 gene additionally was provided with an upstream trafficking signal (BiP), and the whole BiP-Bd37 construct was duplicated and inserted in tandem; the sequence is provided in SEQ ID NO: 2.
(213)
(214) Map of transfervector p53 Bd37 Core XmaI, comprising Bd37 and BSD ORF's, whereby the Bd37 gene was cleared from N- and C-terminal hydrophobic sequences (hence: core). ORF's are flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome.
(215)
(216) Map of transfervector p53 BB Core Tandem XmaI, comprising the Bd37-core and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The Bd37-core ORF additionally was provided with an upstream trafficking signal (BiP), and the whole BiP-Bd37-core construct was duplicated and inserted in tandem.
(217)
(218) Map of transfervector p53 BBG Core Tandem XmaI, comprising the Bd37-core and BSD ORF's, flanked by RNA processing signals, and inserted in between targeting regions for insertion into the 18S SSU rRNA gene on the T. theileri genome. The Bd37-core ORF additionally was provided with upstream (BiP) and downstream (GPI) trafficking signals, and the whole BiP-Bd37-core-GPI construct was duplicated and inserted in tandem.
(219)
(220) Results from expression by recombinant T. theileri of heterologous genes from the Tubulin IR locus: expression of eGFP (left panels), and ACE proteins (right panels); with both lower panels presenting images from agarose gels stained with Ethidium bromide, showing the total RNA that was loaded and run, before the gel was blotted. The upper panels present the results of Northern blotting for eGFP (left) and sACE-1 (right). The three lanes for the eGFP expression represent three identical, but individually isolated, recombinants; wt are RNA samples from wildtype T. theileri parasites.
(221)
(222) Results from expression by recombinant T. theileri of the CAT gene from the Tubulin IR locus.
(223) Top two panels: results of Northern blots for CAT expression by three different recombinant constructs, that differ in the IR sequence that was incorporated in between the CAT and the BSD gene; IR sequences used were from Actin IR, PFR IR, and beta-alpha Tubulin IR (last: see
(224) The bottom graph displays the results of an Elisa detecting CAT protein expression, for a negative control, and a CAT expressing recombinant T. theileri, produced from the pabCTBba transfervector (
(225) Error bars indicate a 5% confidence interval.
(226)
(227) Northern blot results detecting Bd37 mRNA from recombinant T. theileri parasites expressing one or more copies of the Bd37 vaccine antigen gene from the 18S SSU rRNA genome locus. Lane 1: Parental line, un-transfected Lane 2: T. theileri recombinant generated from transfervector p53Bd37-clone 1 (vector resembling that of
(228)
(229) Outline and results of a nested PCR assay for the detection of all T. theileri parasites, via amplification of a T. theileri Tubulin IR sequence.
(230) Left and left-bottom panels representing Eth.Br. stained agarose gels with PCR products from initial first PCR round, and from second nested PCR round.
(231) Left most lane: molecular weight marker (sizes from bottom to top: 200, 400, 600, 800, and 1000 bp). Subsequent lanes: H.sub.2O=negative control sample with water; and subsequently three lanes with respectively 1000, 125 or zero T. theileri parasites per ml of bovine blood.
(232)
(233) Nested PCR's on recombinant parasites from animal trial; detection was of Tubulin IR, detecting all T. theileri (
(234)
(235) Results of the Elisa detecting Bd37 antibodies produced in the calves during the course of the animal trial. Absorbance levels indicate presence of bound bovine antibody.
(236)
(237) Results of the competition Elisa detecting Bd37 antibodies produced in the calves during the course of the animal trial. Increasing amounts of the animal test sera competed for binding to coated Bd37 antigen, with a Bd37 specific Moab. Absorbance levels indicate presence of bound murine antibody.