SPATIAL BARCODING

20230032082 · 2023-02-02

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method of spatially barcoding a given location on a substrate, and further to spatially barcoding detection probes present in a sample such as a biological tissue specimen for the purposes of analysing molecular features present in the tissue. Such analysis may include: i) the spatial expression of one or more biological molecules, specifically; ii) the spatial analysis of the transcriptome and/or iii) the spatial analysis of the proteome, including post-translational protein modifications. The invention further relates to various component products for performing such methods that include reagents kits, instrumentation and software.

Claims

1. A method of spatially barcoding one or more locations of a substrate, comprising: (a) Binding one or more root nucleic acid molecules to the or each location on which the spatial barcode will be constructed, wherein the or each root molecule may comprise a photocleavable group; (b) Optionally, if the or each root molecule does not comprise a photocleavable group, adding a photocleavable group to the or each root molecule; (c) Illuminating a location of interest on the substrate to be spatially barcoded, wherein the illumination cleaves or alters the photocleavable group of the or each root molecule present within the location; (d) Adding an index sequence to the or each root molecule within the location illuminated in step (b), wherein the index sequence comprises a photocleavable group; (e) Repeating steps (c) and (d) until the desired index sequences are added to form a spatial barcode attached to the or each root molecule within the location.

2. The method according to claim 1, wherein the substrate is inert or living, preferably the substrate is living, preferably the substrate is a tissue.

3. A method of spatially barcoding one or more detection probes, comprising: (a) Providing a tissue with one or more detection probes bound to one or more biological molecules of interest, wherein the or each detection probe may comprise a photocleavable group; (b) Optionally, if the or each detection probe does not comprise a photocleavable group, adding a photocleavable group to the or each detection probe; (c) Illuminating an area of interest within the tissue to be spatially barcoded, wherein the illumination cleaves or alters the photocleavable group of the or each detection probe within the area; (d) Adding an index sequence of the spatial barcode to the or each detection probe within the area illuminated in step (b), wherein the index sequence comprises a photocleavable group; (e) Repeating steps (c) and (d) until the desired index sequences are added to form a spatial barcode attached to the or each detection probe within the area of interest.

4. The method according to claim 3, wherein the one or more biological molecules are selected from: nucleic acids, proteins, post-translational protein modifications, metabolites, small bioactive molecules, nucleotides, and drugs.

5. The method according to claim 3 or 4, wherein the one or more detection probes comprise a binding region to bind to a biological molecule, preferably the binding region may be an aptamer, nucleic acid, nucleic acid mimic, protein, or a mixture thereof.

6. A method of analysing one or more transcripts in a tissue, comprising: (a) Contacting the tissue with one or more detection probes to allow the or each detection probe to bind to a transcript of interest, wherein the or each detection probe comprises a photocleavable group; (b) Optionally, if the or each detection probe does not comprise a photocleavable group, adding a photocleavable group to the or each detection probe; (c) Illuminating an area of interest within the tissue to be spatially barcoded, wherein the illumination cleaves or alters the photocleavable group of the or each detection probe within the area; (d) Adding an index sequence of the spatial barcode to the or each detection probe within the area illuminated in step (b), wherein the index sequence comprises a photocleavable group; (e) Repeating steps (c) and (d) until the desired index sequences are added to form a spatial barcode attached to the or each detection probe within the area of interest; (f) Sequencing the one or more spatially barcoded detection probes of step (d) or a derivative thereof.

7. The method according to claim 6, wherein the transcript is RNA, preferably mRNA.

8. The method according to claim 6 or 7, wherein the or each detection probe binds to the polyA region of a transcript of interest.

9. The method according to claim 8, wherein the method further comprises a step of elongating the or each detection probe, preferably at the 3′ end, preferably by reverse transcription.

10. The method according to claim 9, wherein the step of elongating takes places between steps (a) and (b).

11. The method according to any of claims 6-10, wherein the or each detection probe comprises a binding region, wherein the binding region is a nucleic acid, or a nucleic acid mimic.

12. A method of analysing one or more markers within a tissue, comprising: (a) Contacting the tissue with one or more detection probes to allow the or each detection probe to bind to a marker of interest, wherein the or each detection probe comprises a photocleavable group; (b) Optionally, if the or each detection probe does not comprise a photocleavable group, adding a photocleavable group to the or each detection probe; (c) Illuminating an area of interest within the tissue to be spatially barcoded, wherein the illumination cleaves or alters the photocleavable group of the or each detection probe within the area; (d) Adding an index sequence of the spatial barcode to the or each detection probe within the area illuminated in step (b), wherein the index sequence comprises a photocleavable group; (e) Repeating steps (c) and (d) until the desired index sequences are added to form a spatial barcode attached to the or each detection probe within the area of interest; (f) Sequencing the one or more spatially barcoded detection probes of step (d) or a derivative thereof.

13. The method according to claim 12, wherein the or each marker is a biological molecule, preferably selected from: proteins, post-translational protein modifications, metabolites, small bioactive molecules, nucleotides, or drugs.

14. The method according to claim 13, wherein the or each marker is a protein, and the method is a method of analysing one or more proteins in the tissue.

15. The method according to claims 12-14, wherein the or each detection probe comprises binding region, preferably wherein the binding region is a protein, aptamer, nucleic acid, nucleic acid mimic or a mixture thereof, preferably wherein the binding region is an antibody or a nanobody.

16. A method of analysing one or more transcripts and one or more markers in a tissue, comprising: (a) Contacting the tissue with a plurality of detection probes to allow the detection probes to bind to both a nucleic acid and a marker of interest in the tissue, wherein the or each detection probe comprises a photocleavable group; (b) Optionally, if the or each detection probe does not comprise a photocleavable group, adding a photocleavable group to the or each detection probe; (c) Illuminating an area of interest within the tissue to be spatially barcoded, wherein the illumination cleaves or alters the photocleavable group of the or each detection probe within the area; (d) Adding an index sequence of the spatial barcode to the or each detection probe within the area illuminated in step (b), wherein the index sequence comprises a photocleavable group; (e) Repeating steps (c) and (d) until the desired index sequences are added to form a spatial barcode attached to the or each detection probe within the area of interest; (f) Sequencing the one or more spatially barcoded detection probes of step (d) or derivatives thereof.

17. The method according to claim 16, wherein the one or more markers are selected from: proteins, post-translational protein modifications, metabolites, small bioactive molecules, nucleotides, or drugs, preferably the one or more markers are proteins.

18. The method according to claim 16 or 17, wherein the plurality of detection probes comprises: one or more detection probes comprising a binding region which is a nucleic acid, nucleic acid mimic, or aptamer, and one or more detection probes comprising a binding region which is a protein, preferably the protein binding region is an antibody or a nanobody.

19. The method according to any of claims 1-18, wherein the method further comprises a step of assigning a unique spatial barcode to each location or area of interest before step (c).

20. The method according to any of claims 1-19, wherein the location or area of interest may be a two-dimensional or three-dimensional region, preferably a three-dimensional region.

21. The method according to claim 20, wherein the three-dimensional region is between 1 μm.sup.3-150 mm.sup.3 in size, between 1 μm.sup.3-1 mm.sup.3 in size, between 1 μm.sup.3-1,000,000 μm.sup.3 in size, between 1 μm.sup.3-200,000 μm.sup.3 in size, between 1 μm.sup.3-20,000 μm.sup.3 in size, or between 1 μm.sup.3- 1000 μm.sup.3 in size.

22. The method according to any preceding claim, wherein the area or location of interest comprises a collection of cells, preferably from 1 up to 100,000,000 cells, 1,000,000 cells, 1000 cells, 100 cells, 10 cells, preferably the area or location of interest comprises a single cell or a sub-cellular region or compartment.

23. The method according to any preceding claim, wherein the method further comprises a step of selecting one or more locations or areas of interest, preferably multiple locations or areas of interest are selected, preferably prior to step (a).

24. The method according to any of claim 3-11, or 16-23, wherein the biological molecule is a nucleic acid, and wherein the method further comprises a step of pre-amplification, preferably pre-amplification of the nucleic acids of interest or the transcripts of interest, preferably prior to step (a).

25. The method according to any of claim 3-11, or 16-24, wherein the biological molecule is a nucleic acid, and wherein step (a) of the method may comprise contacting the tissue with one or more, or a plurality of, split detection probes to allow the or each split detection probe to bind to a nucleic acid of interest and form a whole detection probe, preferably wherein contacting the tissue with the split detection probes comprises contacting the tissue with first and second parts of each detection probe.

26. The method according to any preceding claim, wherein the or each detection probe is as defined in claim 36.

27. The method according to any preceding claim, wherein the or each index sequence is selected from the library of index sequences as defined in claim 42.

28. The method according to any preceding claim, wherein step (b) comprises the addition of a bridge molecule to the or each root molecule or detection probe, wherein the bridge molecule is between 5 to 40 nucleotides in length and comprises a photocleavable group at the 5′ end or 3′end.

29. The method according to any preceding claim, wherein the photocleavable group is a light-sensitive group which protects the 5′ or 3′ end, preferably the photocleavable group comprises a cage, preferably the photocleavable group comprises a nitrobenzyl group, dimethoxy-nitrobenzyl group, nitrophenyl group, or nitroveratryl group.

30. The method according to any preceding claim, wherein the photocleavable group is cleaved or altered by illumination, preferably illumination cleaves or alters the photocleavable groups in the illuminated location or area.

31. The method according to claim 30, wherein the or each location or area of interest is illuminated by light having a wavelength between 300-600 nm, between 310 nm-570 nm, between 320 nm-550 nm, between 330 nm-520 nm, between 340 nm-480 nm, between 350 nm-450 nm, or between 360 nm-420 nm, preferably in a one-photon photorelease process.

32. The method according to claim 30, wherein the or each location or area of interest is illuminated by light having a wavelength between 680 nm and 900 nm, between 700 and 850 nm, or between 720 and 800 nm, preferably in a two-photon photorelease process.

33. The method according to any preceding claim, wherein the or each index sequence is added by ligation, preferably by ligation onto the 5′ or 3′ end of a root molecule, bridge molecule, or detection probe present in the location or area illuminated in step (c).

34. The method according to claim 33, wherein the ligation is by a ligase enzyme, preferably a ligase selected from T4 ligase, T3 ligase, or Taq ligase.

35. A tissue produced by the method of any of claims 3-34, wherein the tissue comprises spatially barcoded detection probes.

36. A detection probe comprising: (i) A binding region; (ii) A species barcode; and (iii) A photocleavable group

37. The detection probe according to claim 36, wherein the binding region allows the detection probe to bind to a biological molecule, preferably the binding region comprises a nucleic acid, nucleic acid mimic, aptamer, or a protein.

38. The detection probe according to claim 36 or 37, further comprising an amplification region, preferably wherein the amplification region comprises a promoter for a polymerase, preferably the amplification region is a nucleic acid.

39. The detection probe according to claims 36-38 wherein the species barcode allows identification of the biological molecule that the detection probe binds to, preferably the species barcode is a nucleic acid.

40. The detection probe according to claims 36-39, further comprising a unique molecule identifier (UMI), preferably wherein the UMI allows quantification of detection probes, preferably wherein the UMI is unique to the detection probe, preferably wherein the UMI is a nucleic acid.

41. The detection probe according to claims 36-40, wherein the photocleavable group is a light-sensitive group which protects the 5′ or 3′ end of a the detection probe, preferably the photocleavable group comprises a cage, preferably the photocleavable group comprises a nitrobenzyl group, dimethoxy-nitrobenzyl group, nitrophenyl group, or nitroveratryl group.

42. A library of index sequences, wherein each index sequence comprises: (i) A total length of between 5 and 50 nucleotides; and (ii) A photocleavable group bound to one or both of the 5′ or 3′ ends.

43. The library according to claim 42, wherein each index sequence is a nucleic acid.

44. The library according to claim 42 or 43 wherein each index sequence comprises an overhang of preferably 4-15 nucleotides in length at the 5′ and 3′ end, preferably 6 or 7 nucleotides in length at the 5′ and 3′ end.

45. The library according to claims 42-44, wherein each index sequence has a total length of between 19-20 nucleotides.

46. A spatial barcode comprising a plurality of index sequences, wherein the index sequences are selected from the library according to any of claims 43-45.

47. The spatial barcode according to claim 46, wherein the spatial barcode comprises between 1 to 50 index sequences.

48. A spatial barcode according to claim 46 or 47, wherein the spatial barcode is between 10 and 250 nucleotides in length.

49. A spatially barcoded detection probe comprising a detection probe linked to a spatial barcode, wherein the spatial barcode is as defined in any of claims 46-48.

50. The spatially barcoded detection probe according to claim 49, wherein the detection probe is as defined in any of claims 36-41.

51. A kit, the kit comprising: a library of index sequences as defined in any of claims 42-45, one or more detection probes as defined in any of claims 36-41, optionally a ligase enzyme, and optionally one or more reagents.

52. A system for spatial barcoding, the system comprising: (i) an instrument for viewing a substrate; (ii) a light source for illuminating one or more locations of the substrate; (iii) microfluidic circuit for delivering one or more index sequences and reagents to the substrate; and (iv) a processor for implementing software operable to control the instrument, light source, and microfluidic circuit.

53. The system according to claim 52, wherein the substrate is a tissue.

54. The system according to claim 52 or 53, wherein the system is for spatially barcoding one or more locations, detection probes and/or markers.

55. The system according to any of claims 52-54, wherein the one or more locations are areas.

56. The system according to any of claims 52-55 wherein the instrument is further for directing the light source, preferably the instrument is a microscope, preferably a light microscope.

57. The system according to any of claims 52-56 further comprising an optical system, wherein the optical system comprises an element to direct illumination to the or each location or area of interest, preferably the element is a movable mirror, preferably the optical system is comprised within a microscope.

58. The system according to any of claims 52-57, wherein the processor implements software which is operable to: (i) conduct image processing of the tissue; (ii) assign a spatial barcode to each selected location or area of interest of the substrate or tissue; (iii) control illumination of the selected locations or areas of interest; and/or (iv) control fluid flow through the microfluidic circuit.

59. The system according to any of claims 52-58, wherein the microfluidic circuit comprises one or more channels for delivering one or more index sequences and reagents to the substrate, preferably wherein the channels are in fluid communication with the substrate.

60. The system according to any of claims 52-59, wherein the microfluidic circuit comprises one or more storage chambers for storing the index sequences and reagents, preferably wherein the one or more storage chambers are in fluid communication with the channels and the substrate.

Description

[0385] Further features and embodiments of the present invention will now be described by reference to the following figures in which:

[0386] FIG. 1 shows: A schematic of an embodiment of the system of the invention. The system includes a microscope body, which can include a low-magnification objective, motorized stage, and motorized focus; a fluidic circuit connected to several reservoirs for index molecules, reagents, buffers and ligase enzymes, a flow cell in which the specimen is placed, a light source comprising a high-power LED or laser in the UV, visible or IR spectrum, an optical path used to direct light from the light source into the microscope, and a beam shaper used to produce patterned illumination (i.e. a digital micro-mirror device). All of the components of the system are controlled by a computer implementing an integrated control software;

[0387] FIG. 2 shows: A flow-chart of an embodiment of the method of the invention. The process includes imaging of the specimen, identification of individual areas of interest by automated segmentation, selection of a subset of the areas of interest for spatial barcoding, assignment of individual spatial barcodes to each area of interest, and a cyclical spatial barcoding process in which 1) illumination is applied to some of the areas of interest to release a photocleavable group, making the DNA molecules there contained compatible with extension by ligase, 2) flowing an index over the sample, 3) using an enzymatic process to link the enzyme to the DNA molecules in the area(s) of interest that were illuminated, 4) wash and repeat;

[0388] FIG. 3 shows: The structure of an embodiment of a photocleavable 5′ block on an oligonucleotide. The photocleavable group is released by illumination in the UV or violet range (340 nm to 410 nm) and yields an accessible 5′ phosphate group on the oligonucleotide, which can be targeted by ligation. The photocleavable group can be linked, on the side opposite to the protected phosphate, to a fluorophore group or to another nucleotide. This allows detection of the 5′ block and its release via fluorescence microscopy;

[0389] FIG. 4 shows: Proof of concept of light-triggered ligation. A 75 bp duplex oligonucleotide with a photo-cleaved 5′ end (in which the photocleavable group was tagged with a fluorophore) was irradiated with light of different intensities and wavelength and incubated with a second shorter oligonucleotide (20 bp) and T4 ligase. In all the irradiated samples, the photocage was completely removed (see loss of cy3 fluorescence) and the two oligos were ligated, producing a novel species at 95 bp. The high molecular weight bands in lanes 1-7 correspond to the two oligonucleotides still bound to the ligase enzyme (which affects their electrophoretic mobility);

[0390] FIG. 5 shows: Proof of concept for the attachment of an index molecule to a detection probe attached to a solid surface (glass slide). The schematics (A) indicate the process happening during the experiment. The photocleavable group at the 5′ of a detection probe (BALI probe) is cleaved by illumination, and an index is ligated. In this case, the photocleavable group is labelled with the cy3 fluorescent dye, and the index with the cy5 fluorescent dye. The image on the bottom indicates: (B) first row: fluorescence image of the specimen surface after illumination has been applied to cleave the photocleavable group in two areas of interest with the shape of a “1” and “2” numbers. The “1” area was irradiated for 2 minutes, and the “2” area for 5 minutes. The Cy3 signal is decreased in the irradiated areas in a way proportional to irradiation time, indicating removal of the photocleavable group. There is no cy5 signal. (C) fluorescence image after ligation of a cy5 labelled index and initial washing of unligated indices. The irradiated areas are now positive for cy5 signal, while the non-irradiated areas show some background signal indicating a certain amount of indices bound a specifically. (D) fluorescence image of the same sample after extended washes. The cy5 signal in the non-irradiated areas is now back to the values that it had prior to the ligation, indicating removal of the index from all areas except the irradiated ones, where the index has been added to the growing spatial barcode. The plots on the right of each image correspond to the intensity profile of the cy5 image over the dotted line;

[0391] FIG. 6 shows: Proof of concept of spatial barcoding on a solid surface with two cycles of index ligation plus DNA bridge ligation. The schematics on top (A) indicate the process happening during the experiment. The detection probe (BALI probe) is ligated to a DNA bridge molecule bearing a photocleavable group labelled with the Alexa 488 fluorophore (cyan). The photocleavable group is cleaved by illumination, and a first index is ligated which bears a second photocleavable group labelled with the cy5 fluorophore (violet). The second photocleavable group is again removed by illumination, and a third index, labelled with Atto 568, is ligated (yellow). The images on the bottom (B) show the slide surface after the first photorelease step, after the ligation of the first index, and after the ligation of the second index. Two areas with reduced Alexa 488 signal (cyan) are visible on the left image, corresponding to the areas that have lost the first photocleavable group on the DNA bridge molecule. In the middle image, both areas show cy5 signal (pink), indicating successful ligation of the first index. In the right image, the leftmost area shows a reduced cy5 signal, due to the removal of the second photocleavable group, and an Atto568 signal (yellow), indicating successful ligation of the second index;

[0392] FIG. 7 shows: Proof of concept of light control of index ligation on cells. The schematic on top (A) indicates the process happening during the experiment. The photocleavable group at the 5′ of a detection probe (BALI probe) is cleaved by illumination, and an index is ligated. In this case, the photocleavable group is labelled with the cy3 fluorescent dye, and the index with the cy5 fluorescent dye. The image below (B) corresponds to the cy5 channel (in red) image collected on the fluorescence microscope after the ligation of the tagged index. The shape of the area of interest (a “1”) can be seen as an area of increased cy5 signal. In the top left of the image a red halo is visible, corresponding to a reflection of the 647 nm laser on the surface of the coverslip (not real signal);

[0393] FIG. 8 shows: Index sequence optimization by comparison of different index overhang sequences and length for the purpose of maximizing ligation efficiency and minimizing cross-talk between barcodes. The schematic on top (A) describes the process happening during the experiment: a first DNA duplex (corresponding to the last portion of a detection probe, bridge DNA molecule, or root DNA molecule, or to an index) is ligated to a second DNA duplex representing an index sequence. Each duplex is produced by the annealing of a 12 nt and a 18-19 nt DNA oligonucleotides. The 5′ overhang of both molecules is different between different lanes in the experiment. There are four overhang sequences, named A-D. The overhang of sequence A is complementary to the overhang of sequence B, and the overhang of sequence C is complementary to the overhang of sequence D. Furthermore, each overhang can have two different lengths, 6 nt or 7 nt. DNA duplexes containing different combinations of the overhangs are mixed and ligated by T4 ligase. The images on the bottom correspond to a non-denaturing agarose gel in which the molecular species produced by the ligation reaction. The lanes are loaded as follows: GEL 1 (B): 1: DNA length ladder, 2: overhang A+B, both 6 nt, 3: overhang A+B, both 7 nt, 4: overhang C+D, both 6 nt, 5: overhang C+D, both 7 nt, 6: overhang A6 nt+B7 nt, 7: overhang A7 nt+B6 nt, 8: overhang Clint+D7 nt, 9: overhang C7 nt+D6 nt, 10: DNA length ladder, GEL 2 (C): 1: DNA length ladder, 2: overhang A6 nt+D7 nt, 3: overhang A7 nt+D6 nt, 4: overhang C6 nt+B7 nt, 5: overhang C7 nt+B6 nt, 6: overhang A+D, both 6 nt, 7: overhang A+D, both 7 nt, 8: overhang C+B, both 6 nt, 9: overhang C+B, both 7 nt, 10: DNA length ladder. Bands are visible at ˜30 bp (ligated duplex, 30 or 31 bp), ˜20 bp (non-ligated duplex, 19 or 20 bp with overhangs), and below 10 nt (single stranded DNA species, running lower than the corresponding dsDNA band). The non-ligated duplex band is sometimes absent as the conditions under which the gel was ran (in particular temperature) could cause its denaturation in some cases. A band corresponding to the ligated duplex is only present when both the length and the sequence of the overhangs are compatible, indicating no cross-talk between different overhangs. The ligation efficiency is in the range of 80%/90%;

[0394] FIG. 9 shows: Proof of concept of the production of a spatial barcode by sequential ligation of index molecules on a detection probe bound to a solid surface (magnetic bead), using the optimized index molecule design tested in example 5. Two cycles using indices without photocleavable groups. The image represents a denaturing TBE-urea poly-acrylamide gel on which different samples are loaded according to Table 6. For samples 1-7, the material loaded on the gel is the RNA produced from T7 transcription of the detection probe linked to the spatial barcode. The detection prove length is 100 nt, and the RNA produced by the detection probe alone is 70 nt. Each index adds approx. 20 nt to the molecule. Therefore, the expected RNA length for the non-extended detection probe is 70 nt, for the detection probe+1 index is 90 nt, and for the detection probe+2 indices is 110 nt. The 100 nt BALI_26 oligo is loaded in the second to last lane for size reference. The first and last lane are loaded with DNA size ladder.

[0395] FIG. 10 shows: schematic diagrams of various options encompassed within the methods of spatial barcoding of the invention relating to the detection probe; (A) typical spatial barcoding process showing a detection probe bound to a nucleic acid of interest, where the detection probe comprises a binding region at the 3′ end, a species barcode, and a photocleavable group at the 5′ end; (B) a spatial barcoding process which further comprises a pre-amplification step in which an amplification product is produced by rolling circle amplification from the nucleic acid of interest, prior to binding of the detection probe; (C) a spatial barcoding process which uses a split detection probe comprising a first part and a second part which both bind to a nucleic acid of interest and anneal to each other to form a whole detection probe; (D) a spatial barcoding process in which the detection probe binds to the polyA region of a nucleic acid of interest, typically for transcriptome analysis, which includes a step of elongating the detection probe by reverse transcription at the 3′ end to form a detection probe comprising a sequence complementary to the transcript of interest.

[0396] FIG. 11 shows: results of an experiment performing cyclic barcoding on gel beads to produce a spatial index of length from 1 to 7 bits (example 7). (A) scheme of the experiment: a double strand DNA root molecule modified with a fluorescent group is attached to an agarose bead and extended by several cycles of ligation using different index sequences and two alternating ligation overhangs. (B) results of experiment detected by denaturing poly-acrylamide gel electrophoresis. Lane 1 is a DNA length marker, lane 2 is the molecule after 1 cycle of ligation, lane 3-8 are the molecule after 2-7 cycles of ligation, lane 9-12 are increasing concentrations of the root molecule alone used to quantify molecular abundance by densitometry (C) left: estimate of the cumulative ligation efficiency after 1-7 cycles, defined as the fraction of fully extended root molecule over the total root molecule present in the experiment. Right: estimate of the per-cycle ligation efficiency for each of the ligation steps, defined as the fraction of extended root molecule for that cycle over the total amount of root molecule elongated to at least the step immediately before the one being measured. The first cycle has lower efficiency, presumably due to steric hindrance of the gel bead.

[0397] FIG. 12 shows: results of an experiment (example 8) comparing different index sequences for their ligation efficiency in conditions similar to the ones described in example 7. Specifically, the different sequences were tested for ligation in position 2 of an elongating spatial barcode, in order to avoid the reduced efficiency due to the steric hindrance of the gel bead shown in FIG. 11. (A) poly-acrylamide gel electrophoresis showing the root molecule (approx. 70 nucleotides) and the ligation product with each of the index sequence (over 100 nucleotides). Sequence IDs are described in example 8. Each gel also includes several lanes loaded with increasing concentration of the root oligo used to calibrate densitometry quantification. (B) estimate of the ligation efficiency for each index sequence, normalised by the efficiency of index sequence 7 (barcode 7 in example 8), chose as reference. The efficiency was calculated as the ratio between the abundance of the elongated root molecule (over 100 nucleotides) over the total abundance of the root molecule used in the experiment.

[0398] FIG. 13 shows: results of a proof of concept experiment (example 9) aimed at measuring gene expression in cultured cells using the methods of this invention and illumina DNA sequencing as quantification tool. For this experiment we used a pool of detection probes targeting two genes, green fluorescent protein and red fluorescent protein, expressed in two separate cell populations. Each population was barcoded with a different index sequence. The two populations were deconvolved after sequencing by matching the spatial barcodes assigned by the methods of this invention, and the abundance of the detection probes targeting each gene quantified. In a successful experiment, the gene abundance measured by the experiment should correspond to the fluorescent gene expressed in each cell population. (A) scheme of the experiment (B) computational analysis pipeline used to calculate results. (C) left: fraction of reads mapped to each spatial barcode (“GFP population” or “RFP population”) detected into the library produced from GFP or RFP cells. Essentially all reads bear the correct spatial barcode. Right: gene abundance measured for the GFP and RFP detection probes in each cell population. The GFP detection probes are predominantly detected in the GFP population and viceversa, indicating that the protocol can detect gene expression. Detection of RFP proves in the GFP population and viceversa is due to a specific binding of the detection probes

[0399] FIG. 14 shows: results on an experiment (example 10) aimed at showing that spatial barcoding can successfully measure the abundance of detection probes bound to different areas of the same tissue (example 9 was done on separate cell populations). A functionalised hydrogel bearing root molecules designed to resemble detection probes is used for this experiment. Areas of different sizes are uncaged and barcoded with a 2-bit spatial barcode using the methods of this invention. The abundance of detection probes in each spatially barcoded area is measured by illumina sequencing by mapping the spatial barcode present in each read. In a successful experiment, the abundance of root molecules measured in each spatially barcoded area should match the area size. (A) scheme of the experiment. (B) results of the quantification. The 2-bit spatial barcodes assigned to the “large” and “small” area were “1a2a” and “1b2b”. The experiment correctly measures more molecules for 1a2a. The other combinations (“1a2b” and “1b2a”) are presumably products of spontaneous uncaging and ligation produced by stray light in the experiment (since the proof of concept experiment could not be done in completely light-proof conditions)

[0400] FIG. 15 shows: results of an experiment (example 11) aimed at demonstrating a method of signal amplification. A cell population bearing an expressed barcode in their genome (and therefore expressing a mRNA transcript with the barcode sequence) were subjected to the “STARmap” protocol, producing a DNA concatemer specific for the barcode itself. Detection probes designed according to the methods of this invention were then hybridized to the concatemer and detected by ligation with a photocaged index bearing a fluorescent group. The concatamers were also detected directly by fluorescence in-situ hybridization (FISH) in a separate coverslip. The expected binding pattern is a punctate staining around the cell nucleus. TOP: nuclear stain and concatemer signal from direct FISH binding, BOTTOM: nuclear stain and concatemer signal from the detection probes ligated with a fluorescent index. The binding pattern corresponds, indicating that it's possible to target binding probes (and therefore perform the methods of this invention) on an amplified target produced by methods such as STARmap.

EXAMPLES

[0401] Methods are specified below when used. All oligonucleotides sequences were obtained from Integrated DNA technologies, AtdBio or Biomers, and all the chemicals (unless otherwise specified) from Sigma-Aldrich.

[0402] The term ‘cage’ or ‘PC spacer’ throughout refers to a photocleavable spacer modification with the following structure (formula I) as is shown in FIG. 3:

##STR00001##

Example 1

[0403] A 75np DNA duplex with a fluorescent 5′ phosphate block capping an 8 nt overhang was produced by mixing the BALI_01 and BALI_02 primers at 10 μM final concentration in 2×SSC buffer, incubating the solution at 95° C. for 2 minutes, and letting it cool down at room temperature (20° C.) for 30 minutes. A second, shorter DNA duplex was produced by the same procedure annealing the BALI_03 and BALI_04 primers.

[0404] Immediately after dimerization, the longer duplex was split into several samples and irradiated (or not) with different wavelength of light for increasing durations. Irradiation was produced either by a collimated solid state 405 nm laser with intensity of approximately 100 mw/mm.sup.2, or by a UV crosslinker (UVP-CL1000) equipped with 365 nm fluorescent bulbs, with the samples at approx. 2 cm from the emitter.

[0405] After irradiation, 2 μl of the duplex (corresponding to 20 μmol) were combined with one molar equivalent of the shorter duplex, 10 μl of NEB quick ligase buffer (see below), and 2000 U of T4 ligase (NEB) in a 20 μl reaction for 30 minutes at room temperature (21° C.). After ligation, the samples (plus a control sample including the first duplex alone) were ran on a non-denaturing 12% acrylamide gel in Tris-Borate EDTA buffer. The gel was stained using SYBR-Gold (Thermo Fischer scientific) at 1:10000 dilution in 1×TBS for 30 minutes, and imaged on an Amersham Typhoon imager in the cy2 and cy3 channel. The background/corrected image was produced by dividing the cy3 channel image by the cy2 channel image, in order to remove the bleed-through signal from sybr-gold.

TABLE-US-00001 TABLE 1 BALI_01 [Cy3] [cage] CTAGGTCG SEQ ID ATGTCGAGAG CAATTAGAGT NO: 1 CGCGCCTTAAGATACAGATC GGAAGAGCGTCGTGTAG CGCGCCTTAAGATAC BALI_02 GTATCTTAAGGCGCGACTC SEQ ID TAATTGCTCTCGACAT NO: 2 BALI_03 GGTAGTAT AGCTACCATG SEQ ID NO: 3 BALI_04 CGACCTAG CATGGTAGCT SEQ ID NO: 4 (“Cage” refers to the photocleavable spacer oligo modification, as shown in FIG. 3, “cy3” refers to a cyanine 3 fluorescent group bound to the 5′ of the molecule)

Example 2

[0406] A solid surface labelled with a detection probe was produced as follows: the BALI_05 oligonucleotide was diluted to 1 μM final concentration in PBS buffer (250 μl per slide). A 1:100 dilution of a 10 mM solution of BS(PEG)9 crosslinker (Pierce) in DMSO was added to the mix, and the resulting solution was spread on a glass slide coated with aminoalkylsilane (Sigma, Silane-Prep) using a coverslip. The slide was incubated for 2 h at 30° C. in a humid chamber, washed for 10 minutes with 0.1% glycine in PBS, and washed several times in PBS.

[0407] In order to produce a double-stranded end on the detection probe, the BALI_06 oligonucleotide was diluted to a final 1 μM concentration in 2×SSC and incubated on the slide surface for 5 minutes at 95° C. temperature, followed by 30 minutes at room temperature. The slide was washed three times for 5′ washes in 2×SSC.

[0408] The slide functionalised with the double-stranded molecule was imaged on a Leica SP5 confocal microscope equipped with a 30 mW 405 nm solid state laser, an argon laser line at 514, a He—Ne laser at 543 nm, and a solid state 647 nm laser. Cy3 was excited using the 514 and 543 nm laser lines, and the fluorescence signal was captured by a PMT after a 550-600 nm bandpass filter. Cy5 was excited by the 647 nm laser and the relative fluorescence signal captured by a PMT after a 660-750 nm bandpass filter. Once the surface of the slide was identified by detecting the plane of maximum cy3 signal, photorelease was produced by illuminating two region of interest with 100% power of the 405 nm laser for 2 minutes and 5 minutes, respectively. After photorelease, the slide was washed three times for 5′ in 2×SSC.

[0409] The BALI_07 and BALI_08 oligos were mixed to a 5 μM final concentration in 2×SSC buffer, heated at 95° C. for 5 minutes, and allowed to cool down at room temperature for 30 minutes. A ligation solution was prepared by mixing: 107.5 μl of ultra-pure water, 125 μl 2× quick ligation mix (NEB), 12.5 ul T4 ligase, high concentration (NEB), and 5 μl (final 100 uM) of BALI_07/08 oligos. The ligation solution was incubated on the slide for 30 minutes at room temperature, followed by three 5′ washes in 2×SSC.

[0410] After the first series of washes, the slide was imaged again using the same parameters of the first imaging. Following imaging, the slide was washed further twice for 10 minutes in 0.2×SSC at 50° C., and once in 0.2×SSC at room temperature. The slide was then imaged a third time with the same settings.

TABLE-US-00002 TABLE 2 BALI_05 [Cy3] [cage] CTAGGTCG SEQ ID ATGTCGAGAG CAATTAGAGT NO: 5 CGCGCCTTAAGATAC AGATCGGAAGAGCGTCGTGTAG CGCGCCTTAAGATAC [Aminolink C6] BALI_06 GTATCTTAAGGCGCGACTC SEQ ID TAATTGCTCTCGACAT NO: 6 BALI_07 [Cy5] GGTAGTAT SEQ ID AGCTACCATG NO: 7 BALI_08 CGACCTAG CATGGTAGCT SEQ ID NO: 8 (“Cage” refers to the photocleavable spacer oligo modification as shown in FIG. 3, “cy3” refers to a cyanine 3 fluorescent group bound to the 5′ of the molecule, “cy5” refers to a cyanine 5 fluorescent group bound to the 5′ end of a molecule, ‘aminolink C6’ refers to an NH2 group)

Example 3

[0411] A solid surface labelled with a detection probe was produced as follows: the BALI_09 oligonucleotide was diluted to 1 μM final concentration in PBS buffer (250 ul per slide). A 1:100 dilution of a 10 mM solution of BS(PEG)9 crosslinker (Pierce) in DMSO was added to the mix, and the resulting solution was spread on a glass slide coated with aminoalkylsilane (Sigma, Silane-Prep) using a coverslip. The slide was incubated for 2 h at 30° C. in a humid chamber, washed for 10 minutes with 0.1% glycine in PBS, and washed several times in PBS.

[0412] In order to produce a double-stranded end on the detection probe, the BALI_09 oligonucleotide was diluted to a final 1 μM concentration in hybridization buffer (10% ethylene carbonate in 2×SSC) and incubated on the slide surface for 15 minutes at room temperature, followed by two 5′ washes in hybridization solution at room temperature and three washes in 2×SSC at room temperature.

[0413] The detection probe bound to the slide was extended by a DNA bridge molecule bearing a photocleavable group and the Alexa-488 fluorophore as follows: the BALI_10 and BALI_11 primers were diluted to a final concentration of 5 μM in 5×SSC buffer, heated at 95 C for 5 minutes, and gradually cooled down to 30° C. on a PCR cycler using a temperature gradient of

[0414] −1° C./30″. A ligation solution was prepared by mixing: 107.5 μl of ultra-pure water, 125 ul 2× quick ligation mix (NEB), 12.5 μl T4 ligase, high concentration (NEB), and 5 μl (final 100 μM) of BALI_10/11 oligos. The ligation solution was incubated on the slide for 30 minutes at room temperature, followed by three 5′ washes in 2×SSC

[0415] The slide bearing the detection probe extended by the photocleaved DNA bridge molecule was imaged on a Leica SP5 confocal microscope equipped with a 30 mW 405 nm solid state laser, an argon laser line at 488 and 514 nm, a He—Ne laser at 543 nm, and a solid state 647 nm laser. Alexa 488 was excited using the 488 nm laser, and the relative fluorescence signal captured by a PMT after a 510-540 nm bandpass filter. Atto 568 was excited by the 543 nm laser line and the relative fluorescence signal captured by a PMT after a 560-600 nm bandpass filter. Cy5 was excited by the 647 nm laser and the relative fluorescence signal captured by a PMT tube after a 660-750 nm bandpass filter. Once the surface of the slide was identified by detecting the plane of maximum Alexa 488 signal, photorelease was produced by illuminating two rectangular region of interest with 100% power of the 405 nm laser for 5 minutes each. After photorelease, the slide was washed three times for 5′ in 2×SSC.

[0416] For the first spatial barcoding step, a double-stranded index composed of the BALI_12 and BALI_13 primers was produced by annealing the two oligonucleotides at a final concentration of 5 μM as described before. A second ligation reaction was prepared as described before and incubated on the slide for 30′ at room temperature. After the ligation, the slide was washed for three times in 2×SSC at room temperature. The slide was imaged as above. Light was used to photorelease the photocleavable group only on one of the two barcoded areas for the same time and using the same power described above.

[0417] For the second spatial barcoding step, a double-stranded index composed of the BALI_13 and BALI_14 primers was produced by annealing the two oligonucleotides at a final concentration of 5 μM as described before. A third ligation reaction was prepared as described before and incubated on the slide for 30′ at room temperature. After the ligation, the slide was washed for three times in 2×SSC at room temperature and for three times for 5′ in 0.2×SSC at 50° C. The slide was imaged as above for a third time with the same settings

TABLE-US-00003 TABLE 3 BALI_09 GGTAGTAT SEQ ID ATGTCGAGAGCTAGC NO: 9 CGCGCCTTAAGATAC CAATTAGAGT AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG [Aminolink C6] BALI_10 GCTAGCTCTCGACAT SEQ ID NO: 10 BALI_11 [Atto488] [cage] SEQ ID GTACCTGT NO: 11 CAGCTACCATG BALI_12 [5′ PHOS] ATACTACC SEQ ID CATGGTAGCTG NO: 12 BALI_13 [Cy5] [cage] GTATCGAG SEQ ID CTCTATACAC NO: 13 BALI_14 [5′ PHOS] ACAGGTAC SEQ ID GTGTATAGAG NO: 14 BALI_15 [Atto565] [cage] SEQ ID GTGAGCGT  NO: 15 CGGACACCTAC BALI_16 [5′ PHOS] CTCGATAC SEQ ID GTAGGTGTCCG NO: 16 (“Cage” refers to the photocleavable spacer oligo modification as shown in FIG. 3, “Atto488” refers to a the atto488 green fluorescent group bound to the 5′ of the molecule, “Atto565” refers to the atto565 red fluorescent group bound to the 5′ end of a molecule, “cy5” refers to a cyanine 5 fluorescent group bound to the 5′ end of a molecule, ‘aminolink C6’ refers to an NH2 group, 5′PHOS refers to phosphate)

Example 4

[0418] A cell monolayer bound to a detection probe was produced as follows: U2OS cells (ATCC® HTB-96) were grown until confluence on a circular #1.5 coverslip of 40 mm diameter, previously coated with 10 mg/ml poly-L-lysine in PBS for 12 h. Cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% Fetal Bovine Serum and 1% Penicillin/Streptomycin antibiotics. Prior to the experiment, cells were fixed in 4% paraformaldehyde in PBS for 15 minutes at room temperature and washed 3 times for 5 minutes at room temperature.

[0419] To crosslink a detection probe to the cell surface, the BALI_05 oligonucleotide was diluted to 1 μM final concentration in PBS buffer (250 μl per slide). A 1:100 dilution of a 10 mM solution of BS(PEG)9 crosslinker (Pierce) in DMSO was added to the mix, and the resulting solution was spread on the coverslip containing the cells. The slide was incubated for 12 h at room temperature (21° C.), washed for 10 minutes with 0.1% glycine in PBS, and washed twice for 5 minutes in 2×SSC.

[0420] In order to produce a double-stranded end on the detection probe, the BALI_06 oligonucleotide was diluted to a final 1 μM concentration in hybridization buffer (10% ethylene carbonate in 2×SSC) and incubated on the slide surface for 15 minutes at room temperature, followed by two 5′ washes in hybridization solution at room temperature and three washes in 2×SSC at room temperature.

[0421] The slide functionalised with the double-stranded molecule was imaged on a Leica SP5 confocal microscope equipped with a 30 mW 405 nm solid state laser, an argon laser line at 514, a He—Ne laser at 543 nm, and a solid state 647 nm laser. Cy3 was excited using the 514 and 543 nm laser lines, and the fluorescence signal was captured by a PMT after a 550-600 nm bandpass filter. Cy5 was excited by the 647 nm laser and the relative fluorescence signal captured by a PMT after a 660-750 nm bandpass filter. Once the surface of the slide was identified by detecting the plane of maximum cy3 signal, photorelease was produced by illuminating a region of interest with 100% power of the 405 nm laser for 5 minutes. After photorelease, the slide was washed three times for 5′ in 2×SSC.

[0422] The BALI_07 and BALI_08 oligos were mixed to a 5 μM final concentration in 2×SSC buffer, heated at 95° C. for 5 minutes, and allowed to cool down at room temperature for 30 minutes. A ligation solution was prepared by mixing: 107.5 μl of ultra-pure water, 125 ul 2× quick ligation mix (NEB), 12.5 ul T4 ligase, high concentration (NEB), and 5 μl (final 100 uM) of BALI_07/08 oligos. The ligation solution was incubated on the slide for 30 minutes at room temperature, followed by three 5′ washes in 2×SSC.

[0423] After the first series of washes, the slide was imaged again using the same parameters of the first imaging, only in the cy5 channel.

Example 5

[0424] Two index molecules were produced by annealing each of the following oligonucleotides:

TABLE-US-00004 TABLE 4 BALI_017 [phosphate]  Overhang A SEQ ID GTGCGTGCACCACAGTCG 6 nt NO: 17 BALI_018 [phosphate]  Overhang C SEQ ID GTGACCGCACCACAGTCG 6 nt NO: 18 BALI_019 ACGCACCGGGACTCGTGC Overhang B SEQ ID 6 nt NO: 19 BALI_020 GGTCACCGGGACTCGTGC Overhang D SEQ ID 6 nt NO: 20 BALI_021 [phosphate]  Overhang A SEQ ID GTGACGTGCACCACAGTCG 7 nt NO: 21 BALI_022 [phosphate]  Overhang C SEQ ID GTGGACCGCACCACAGTCG 7 nt NO: 22 BALI_023 ACGTCACCGGGACTCGTGC Overhang B SEQ ID 7 nt NO: 23 BALI_024 GGTCCACCGGGACTCGTGC Overhang D SEQ ID 7 nt NO: 24

[0425] With the BALI_025 oligonucleotide:

TABLE-US-00005 BALI_025 GCACGAGTCCCG SEQ ID NO: 25

[0426] In each case, the forward and reverse oligonucleotides were diluted to a final concentration of 5 μM in TE buffer, incubated for 5 minutes at 95° C., and cooled down to 25° C. in a PCR cycler using a temperature gradient of −1 C/30 seconds.

[0427] A ligation mix was prepared by mixing the following: 7 μl ultrapure water, 10 μl 2× quick ligation mix (NEB), 1 μl T4 ligase, high concentration (NEB), and 1 μl each of the two index molecules to be tested (final concentration 200 nM)

[0428] The reaction was incubated for 30 minutes at room temperature. The samples were then diluted in loading buffer and ran on a non-denaturing acrylamide gel. The gel was stained using SYBR-Gold (Thermo Fischer scientific) at 1:10000 dilution in 1×TBS for 30 minutes, and imaged on an Amersham Typhoon imager in the cy2 channel.

Example 6

[0429] Magnetic beads were functionalised with a detection probe as follows. The BALI_26 oligonucleotide was desalted using a GE life sciences Illustra microspin G-25 column according to the supplier instructions. 50 μl of a 100 μM oligo were used for the desalting. 200 μl of Dynabeads M270 carboxylic acid (Thermo Scientific) were washed twice in 25 mM MES buffer at pH 4.7 and resuspended in 50 μl of 100 mM MES buffer at pH 4.7. The bead slurry was supplemented with 30 μl of the desalted BALI_26 oligo and 20 μl of ultrapure water. This mix (100 μl) was added to 100 ul 25 mM MES buffer at pH 4.7 in which 1 mg EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) had been previously resuspended. The reaction was incubated for 12 h at 4° C. on a tube rotator, and the beads were washed 4 times for 5′ each in 50 mM tris pH 7.4+0.1% Tween 20 to quench the reaction.

[0430] The BALI_26 oligonucleotide encodes a detection probe ending with a “A” overhang, 6 nt.

[0431] In order to produce a double-stranded molecule at the end of the detection probe, 140 μl of the functionalised beads were resuspended in 2×SSC and supplemented with 14 μl of 100 uM BALI_10 oligo (see examples above). The resulting mixture was incubated at 95° C. for 5 minutes and allowed to cool down to room temperature for 30 minutes on a rotator.

[0432] Different index molecules were produced by annealing the oligonucleotides specified below. In each case, the oligos were annealed by mixing them at a final concentration of 5 uM in TE buffer, heating them to 95° C. for 5 minutes, and cooling them down to 25° C. in a PCR cycler with a thermal gradient of −1° C./30 seconds.

TABLE-US-00006 TABLE 5 Sample BALI_19 Index molecule exposing the following barcodes: 1 and Side facing the existing spatial barcode: B 6 nt BALI_25 (match for the BALI_26 oligo) Side exposed to the addition of new indices: no overhang Sample BALI_24 Index molecule exposing the following barcodes: 2 and Side facing the existing spatial barcode: D 7 nt BALI_25 (no match) Side exposed to the addition of new indices: no overhang Sample BALI_27 Index molecule exposing the following barcodes: 3 and Side facing the existing spatial barcode: B 6 nt BALI_28 (match for the BALI_26 oligo) Side exposed to the addition of new indices: C 7 nt Sample BALI_29 Index molecule exposing the following barcodes: 4 and Side facing the existing spatial barcode: D 7 nt (no BALI_30 match) Side exposed to the addition of new indices: A 6 nt Sample As sample 5 3 Sample As sample 6 3

[0433] The functionalised beads with the annealed BALI_10 oligo were captured on a magnetic tube rack and resuspended in a ligation solution comprising: 8 μl ultrapure water, 10 μl 2× quick ligation mix (NEB), 1 μl T4 ligase, high concentration (NEB), and 1 μl of 5 μM annealed oligo as per scheme above (final 100 nM). A seventh reaction was assembled as negative control without any index molecule. Each reaction was incubated for 30 minutes at room temperature with rotation.

[0434] Following the first ligation reaction, the beads were washed 3 times for 5′ in 2×SSC.

[0435] A second ligation mix was then assembled for samples 5 and 6 according to the scheme below

TABLE-US-00007 TABLE 7 Sample BALI_29 Index molecule exposing the following barcodes: 5 and Side facing the existing spatial barcode: D 7 nt BALI_30 (match for the index added during the first ligation) Side exposed to the addition of new indices: A 6 nt Sample BALI_27 Index molecule exposing the following barcodes: 6 and Side facing the existing spatial barcode: B 6 nt (no BALI_28 match) Side exposed to the addition of new indices: C 7 nt

[0436] The ligation reaction was assembled as indicated above and incubated for the same time with rotation. After ligation, the beads were washed for 3 times for 5′ each in 2×SSC.

[0437] Following the second ligation on samples 5 and 6, all seven samples were subjected to signal amplification using T7 RNA in-vitro transcription. For each sample, the beads were captured using a magnet tube rack and resuspended in 100 μl of hybridization buffer (10% ethylene carbonate in 2×SSC) supplemented with 1 μM final of T7 promoter oligo. The beads were incubated in this solution for 30 minutes at room temperature with rotation and washed 3 times for 5 minutes in hybridization solution.

[0438] Following the last wash, beads from each sample were resuspended in 50 μl of T7 transcription solution comprising: 10 μl of 5× transcription buffer (Promega), 2 μl of RNAseOUT nuclease inhibitor (Thermo Fisher), 2 μl of T7 polymerase (Promega), 5 μl 100 mM DTT, 10 μl of 2.5 mM NTP mix, and 21 μl ultrapure water. The reaction was incubated for 3 h at 37° C. with shaking.

[0439] Following the reaction, the beads from each sample were immobilized using a magnetic tube rack, and the supernatant containing the amplified detection probes connected to the spatial barcode was collected, mixed with 2× denaturing RNA loading buffer, and ran on a 15% TBE-Urea poly-acrylamide gel.

TABLE-US-00008 TABLE 8 SEQ ID Name Sequence Notes NO BALI_26 [phosphate] GTGCGT SEQ ID ATGTCGAGAGCTAGC NO: 26 CGCGCCTTAAGATAC CAATTAGAGT AGATCGGAAGAGCGT CGTGTAGCTCCCTAT AGTGAGTCGTATTA CTAGCTAGCG [aminolink C6] BALI_27 ACGCACCGGGACTCG Overhang SEQ ID TGC B 6 nt NO: 27 BALI_28 [phosphate] GTGG Overhang SEQ ID ACCGCACGAGTCCCG C 7 nt NO: 28 BALI_29 GGTCCACCGACTG Overhang SEQ ID TGGTGC D 7 nt NO: 29 BALI_30 [phosphate] GTGC  Overhang SEQ ID GTGCACCACAGTCG A 6 nt NO: 30 T7 TAATACGACTCAC SEQ ID promoter TATAGGGAG NO: 31 (‘aminolink C6’ refers to an NH2 group)

Example 7

[0440] Cyclic Barcoding on Solid Gel Beads.

TABLE-US-00009 TABLE 9 SEQ ID Name in Name NO. figure  Sequence BALI_31 32 BL_91 [NH2] CTACTACGGCTAGCC TAATACGACTCACTATAGGGAG ACTCTAATTG GTATAGAATTCCGCG GCTAGCTCTCGACAT BALI_32 33 BL_92 [phosphate] GTGCGT ATGTCGAGAGCTAGC CGCGGAATTCTATAC CAATTAGAGT CTCCCTATAGTGAGT CGTATTA GGC [cy5] BALI_33 34 BL045 ACGCACCGGGACTCGTGC BALI_34 35 BL046 [phosphate] GTGGACCGCACGAGTCCCG BALI_35 36 BL047 [phosphate] GTGCGTGCACGTATGGCG BALI_36 37 BL048 GGTCCACCGCCATACGTGC (“cy5” refers to a cyanine 5 fluorescent group)

[0441] This protocol mimics the process of producing a spatial barcode on detection probes. A double stranded DNA root molecule bearing a fluorophore is attached to an agarose gel bead, which has mechanical features compatible with those of the gel produced during the in-situ labelling protocol. Multiple cycles of ligation are then performed using different index sequences. The efficiency of each ligation step is measured by densitometry on denaturing acrylamide electrophoresis.

[0442] Oligo-modified agarose beads were prepared by reacting NHS-modified sepharose beads (GE Healthcare) with the BALI_31 oligo ad a final concentration of 25 uM in 50 mM Sodium Borate buffer, pH 8.5, for 4 h at room temperature. The reaction was stopped by adding ⅕th volume of 1M Tris-HCl pH 8, followed by several washes in Tris-Edta buffer (100 mM Tris-HCl pH 8, 2.5 mM EDTA). For every wash, beads were pelleted by centrifuging them at

[0443] Oligos BALI_32, BALI_34 and BALI_35 were phosphorylated by incubating them at 37 C for 30 minutes, at a concentration of 10 uM, in a reaction buffer composed of 200 uM ATP, 1×PNK reaction buffer (NEB), and 10 U T4 polynucleotide kinase (NEB), and purified through a G25 sepharose spin column (Illustra microspin). Following this, oligos BALI_33 and BALI_34 and oligos BALI_35 and BALI_36 were annealed by mixing them in Tris-EDTA buffer (TE) at a final concentration of 5 uM, heating up at 95 C for 2 minutes, and cooling down to RT for 30 minutes.

[0444] The oligo-conjugated agarose beads (20 ul of 25% bead slurry for each sample) were hybridized with the root oligo BALI_32 by incubating them in hybridization buffer (10% Ethylene Carbonate, 2×SSC), supplemented with the root oligo at 1 uM final concentration, at room temperature for 30 minutes. After this, the beads were washed three times for 10 minutes in hybridization buffer, and three times for 5 minutes in 2×SSC.

[0445] The first cycle of ligation was performed by incubating the bead sample in 20 ul a reaction buffer composed by 1× T4 ligase buffer (NEB), 0.75 uM annealed oligos BALI_33 and BALI_34, and 100/ul U T4 DNA ligase (NEB) for 30 minutes at room temperature. Following the ligation, samples were washed twice in 2×SSC for 5 minutes each. After this, more cycles of ligation (up to seven in total) were performed as above, alternating annealed oligos BALI_35/36 and BALI_33/34.

[0446] The final ligated product was purified by washing the bead samples twice in 2×SSC for 5 minutes, resuspending them in 20 ul 2×SSC, and adding 20 ul of 2× denaturing RNA loading buffer (95% Formamide, 5% TBE, 10 mg/ml bromophenol blue). The samples were heated at 95 C for 5 minutes, spun quickly to pellet beads, and the supernatant was collected and loaded on a 8% denaturing polyacrylamide gel for analysis. Beads subjected to one, two, three, four, five, six or seven ligation cycles were compared, and quantified by densitometry after imaging of the gel, measuring the ligation efficiency. Results are shown in FIG. 11.

Example 8

[0447] Comparison of Ligation Efficiency for Different Index Sequences.

TABLE-US-00010 TABLE 10 SEQ ID Name in Name NO: figure Sequence notes BALI_37 38 BL174 [phosphate] GTGCGTGCACCACAGTCG Barcode 1 BALI_38 39 BL175 GGTCCACCGACTGTGGTGC Barcode 1 BALI_39 40 BL176 [phosphate] GTGCGTGCACCGACCTCG Barcode 2 BALI_40 41 BL177 GGTCCACCGAGGTCGGTGC Barcode 2 BALI_41 42 BL178 [phosphate] GTGCGTGCACCGTGTACG Barcode 3 BALI_42 43 BL179 GGTCCACCGTACACGGTGC Barcode 3 BALI_43 44 BL180 [phosphate] GTGCGTGCACCTAGATCG Barcode 4 BALI_44 45 BL181 GGTCCACCGATCTAGGTGC Barcode 4 BALI_45 46 BL182 [phosphate] GTGCGTGCACGAGTCCCG Barcode 5 BALI_46 47 BL183 GGTCCACCGGGACTCGTGC Barcode 5 BALI_47 48 BL184 [phosphate] GTGCGTGCACGGACGACG Barcode 6 BALI_48 49 BL185 GGTCCACCGTCGTCCGTGC Barcode 6 BALI_49 50 BL186 [phosphate] GTGCGTGCACGTATGGCG Barcode 7 BALI_50 51 BL187 GGTCCACCGCCATACGTGC Barcode 7 BALI_51 52 BL188 [phosphate] GTGCGTGCACTATCTGCG Barcode 8 BALI_52 53 BL189 GGTCCACCGCAGATAGTGC Barcode 8 BALI53 54 BL190 [phosphate] GTGCGTGCACTCAGGTCG Barcode 9 BALI_54 55 BL191 GGTCCACCGACCTGAGTGC Barcode 9 BALI_55 56 BL192 [phosphate] GTGCGTGCAGAGATGACG Barcode 10 BALI_56 57 BL193 GGTCCACCGTCATCTCTGC Barcode 10 BALI_57 58 BL230 [phosphate] GTGCGTGCCACACATCCG Barcode 11 BALI_58 59 BL231 GGTCCACCGGATGTGTGGC Barcode 11 BALI_59 60 BL232 [phosphate] GTGCGTGCCACATGCTCG Barcode 12 BALI_60 61 BL233 GGTCCACCGAGCATGTGGC Barcode 12 BALI_61 62 BL234 [phosphate] GTGCGTGCCACGGTAGCG Barcode 13 BALI_62 63 BL235 GGTCCACCGCTACCGTGGC Barcode 13 BALI63 64 BL236 [phosphate] GTGCGTGCCAGCCGATCG Barcode 14 BALI_64 65 BL237 GGTCCACCGATCGGCTGGC Barcode 14 BALI_65 66 BL238 [phosphate] GTGCGTGCCAGTATAGCG Barcode 15 BALI_66 67 BL239 GGTCCACCGCTATACTGGC Barcode 15 BALI_67 68 BL240 [phosphate] GTGCGTGCTACACCGGCG Barcode 16 BALI_68 69 BL241 GGTCCACCGCCGGTGTAGC Barcode 16 BALI_69 70 BL242 [phosphate] GTGCGTGCTACTCGTCCG Barcode 17 BALI_70 71 BL243 GGTCCACCGGACGAGTAGC Barcode 17 BALI_71 72 BL244 [phosphate] GTGCGTGCTAGACTCCCG Barcode 18 BALI_72 73 BL245 GGTCCACCGGGAGTCTAGC Barcode 18 BALI73 74 BL246 [phosphate] GTGCGTGCTAGCTGAGCG Barcode 19 BALI_74 75 BL247 GGTCCACCGCTCAGCTAGC Barcode 19 BALI_75 76 BL248 [phosphate] GTGCGTGCTCACTCACCG Barcode 20 BALI_76 77 BL249 GGTCCACCGGTGAGTGAGC Barcode 20

[0448] This experiment was performed to compare the relative ligation efficiency for 20 pair of different spatial indexes. The experiment was performed by ligating each pair of oligonucleotides forming a barcode in position “2” of a growing spatial barcode. The overhang sequences used for ligation are identical for all barcodes, and corresponding to those used for oligos BALI_35 and BALI_36.

[0449] Ligation was performed on beads using the same protocol described for “cyclic barcoding on solid gel beads” above. Agarose beads conjugated to BALI_31 and hybridized with BALI_32 were first ligated with annealed oligos BALI_33/34, and then (for the second cycle) with a the pair of annealed oligos corresponding to each barcode (i.e. BALI_37/38 for barcode 1).

[0450] Following the second ligation, the samples were analysed by denaturing polyacrylamide gel electrophoresis and quantified by densitometry as described above, and the ligation efficiency of the second ligation cycle measured for each barcode. Results are shown in FIG. 12.

Example 9

[0451] Light-Dependent Barcoding Gene Expression Measurements Through BALI on Cells.

[0452] In this experiment, cultured cells expressing either green fluorescent protein (GFP) or red fluorescent protein (RFP) were plated on two separate coverslips, and subjected to our protocol for light-dependent barcoding and gene expression measurement. This was done with a library of detection probes including sequences targeting both the GFP and RFP genes (BALI_77 to BALI_84), and using light to barcode such probes with one of two different spatial barcodes. Spatial barcode 1 was used to label GFP cells, whereas spatial barcode 2 was used to label RFP cells. Illumina sequencing was then used to measure how many detection probes targeting GFP/RFP were present in each spatially barcoded population.

[0453] 4t1 mouse tumour cells expressing GFP or RFP were cultured on #1.5 thickness glass coverslips functionalised first with BIND-silane (GE Healthcare), and then overnight with 0.01% poly-L-lysine in complete culture medium (DMEM, 10% fetal bovine serum). Prior to the experiment, cells were fixed in 4% paraformaldehyde for 15 minutes, washed in PBS, and permeabilised in 0.5% Triton X-100 in phosphate-buffered saline (PBS) for 10 minutes.

[0454] The detection probes were diluted in encoding hybridization buffer (2×SSC buffer, 30% formamide, 10% dextran sulphate, 1 mg/ml yeast tRNA, 1:100 NEB murine ribonuclease inhibitor) at a final concentration of 1 uM, and the sample was diluted in the resulting mix for 48 h at 37 C in a humidified chamber. After the hybridization, the sample was washed twice at 47 C for 30 minutes in encoding wash buffer (2×SSC, 30% formamide), and twice at room temperature for 5 minutes in 2×SSC.

[0455] A thin hydrogel was cast over the cells by coating the coverslips with a 80 ul drop of degassed hydrogel buffer (4% 19:1 acrylamide:bis-acrylamide mix, 0.3M NaCl, 60 mM Tris-HCl pH 8, 0.05% TEMED, 0.05% Ammonium persulfate) and incubating for 1 h at room temperature. The samples were then digested in digestion buffer (2% SDS, 50 mM tris-HCl pH 8, 0.5% Triton X-100, 1:100 NEB Proteinase K enzyme) overnight at 37 C in a humidified chamber. After the clearing, the coverslips were washed three times for 1 h in 2×SSC, then washed in secondary hybridization buffer (10% Ethylene Carbonate, 2×SSC) for 5 minutes, and hybridized with the BALI_85 oligo (10 nM final concentration, diluted in secondary hybridization buffer) for 15 minutes at room temperature. Finally, samples were washed once in secondary hybridization buffer and once in SSC for 5 minutes each.

[0456] Uncaging of the detection probes was performed on a leica SP5 confocal microscope equipped with a 30 mW 405 nm laser, using a 10× objective and 100% laser power. Uncaging was done for 5 minutes on 5 field of views (approx. 1 mm2 each) per sample. Following uncaging, samples were ligated with either spatial barcode 1 or spatial barcode 2 by first annealing the BALI_86 and BALI_87 barcodes or BALI_88 and BALI_89 barcodes (by diluting them in 5×SSC at 5 uM concentration, heating at 95 C for 5 minutes and cooling down slowly to room temperature over 30 minutes), and then incubating them for 30 minutes at room temperature in a ligation mix composed by 1×NEB quick ligation buffer, 100 U/ul T4 DNA ligase, and 100 nM annealed spatial barcode.

[0457] Following the ligation step, the hydrogel including the cells was scraped from the coverslips, transferred to a 1.5 ml tube, and diluted in 500 ul 0.4M NaCl. DNA was released by vortexing for 1 h at high speed and purified by ethanol precipitation.

[0458] The precipitated DNA (including the barcoded detection probes) was used to produce an illumina sequencing library by two successive rounds of PCR, first using the BALI_90 and BALI_91 primer and the Q5 enzyme from NEB (standard protocol) and the using the Illumina universal forward truseq primer and indexed DNA LT reverse truseq primers (indexes 006 and 012) and the NEB phusion enzyme (standard protocol).

[0459] The libraries were sequenced using an Illumina MiSeq sequencer (paired end 150 reads) and analysed through a bioinformatic pipeline developed in the python programming language, which is briefly schematised in additional FIG. 13B.

TABLE-US-00011 TABLE 11 SEQ ID Name Sequence NO: BALI_80 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN CATCGTGAGT SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID TTGAAGAAGATGGTGCGCTCCTGGACGTAGCCTTCG NO: 78 BALI_80 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN CATCGTGAGT SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID CTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCAC NO: 79 BALI_80 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN CATCGTGAGT SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID TGCTTGTCGGCCATGATATAGACGTTGTGGCTGTTG NO: 80 BALI_80 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN CATCGTGAGT SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID CATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAG NO: 81 BALI_81 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN GGTACAGATG SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID GATGGCCATGTTATCCTCCTCGCCCTTGCTCACCAT NO: 82 BALI_82 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN GGTACAGATG SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID CTCGGGGAAGGACAGCTTCAAGTAGTCGGGGATGTC NO: 83 BALI_80 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN GGTACAGATG SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID CTTGTAGGTGGTCTTGACCTCAGCGTCGTAGTGGCC NO: 84 BALI_84 [CAGE] GTGACC ATGTCGAGAGCTAGC NNNNNNNNNNNNNNN GGTACAGATG SEQ AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG ID CTGTTCCACGATGGTGTAGTCCTCGTTGTGGGAGGT NO: 85 BALI_85 GCTAGCTCTCGACAT SEQ ID NO: 86 BALI_86 AGACGTGTGCTCTTCCGATCTCAGCTACCATG SEQ ID NO: 87 BALI_87 GGTCACCATGGTAGCTGAGATCGGAAGAGCACACGTCT SEQ ID NO: 88 BALI_88 AGACGTGTGCTCTTCCGATCTGACAATGAGGC SEQ ID NO: 89 BALI_89 GGTCACGCCTCATTGTCAGATCGGAAGAGCACACGTCT SEQ ID NO: 90 BALI_90 AGACGTGTGCTCTTCCGATCT SEQ ID NO: 91 BALI_91 TAATACGACTCACTATAGGGAGCTACAC SEQ ID NO: 92 Illumina AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA SEQ universal CGCTCTTCCGATCT ID FW NO: 93 Truseq Illumina CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCA SEQ Truseq GACGTGTGCTCTTCCGATC ID LT rev. NO: 94 index 006 Illumina CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCA SEQ Truseq GACGTGTGCTCTTCCGATC ID LT rev. NO: 95 index 012 (“cage” refers to the Photocleavable spacer modification as shown in FIG. 3, ‘N’ refers to any nucleotide of A, T, G, or C)

Example 10

[0460] Spatial Indexing and Assessment of Quantification Capability on Functionalised Hydrogel.

TABLE-US-00012 TABLE 12 SEQ ID Name NO: Sequence Notes BALI_ 96 [acrylate] cgacatcggca 92 agCTACTACGGCTAGCC TAATACGACTCACTATAGGGAG ACTCTAATTG GTATAGAATTCCGCG GCTAGCTCTCGACAT BALI_ 97 [phosphate] GTGACGT 93 ATGTCGAGAGCTAGC CGCGGAATTCTATAC CAATTAGAGT CTCCCTATAGTGAGTCGTATTA GGC BALI_ 98 [cy5][cage] GaGCGTgcaccacagtcg Bit0 94 BALI_ 99 ACGTCACcgactgtggtgc Bit0 95 BALI_ 100 [cy3][cage] GTGGACCgcacgtatggcg 1a 96 BALI_ 101 ACGCtCcgccatacgtgc 1a 97 BALI_ 102 [cy3][cage] GTGGACCgcacgagtcccg 1b 98 BALI_ 103 ACGCtCcgggactcgtgc 1b 99 BALI_ 104 AGACGTGTGCTCTTCCGAT 2a 100 CTACTGAGGTGAGC BALI_ 105 GGTCCACGCTCACCTCAGTA 2a 101 GATCGGAAGAGCACACGTCT BALI_ 106 AGACGTGTGCTCTTCCGATC 2b 102 TCGACGATCTAGC BALI_ 107 GGTCCACGCTAGATCGTCGAGA 2b 103 TCGGAAGAGCACACGTCT BALI_ 108 AGACGTGTGCTCTTCCGATCT 104 BALI_ 109 AATGATACGGCGACCACCGAGA 105 TCTACACTCTTTCCCTACACGA CGCTCTTCCGATCTNNNNNNGC GGCTAGCTCTCGACAT (“cage” refers to the Photocleavable spacer modification as shown in FIG. 3, “acrylate” to a 5′ acrydite group, “cy3” refers to a cyanine 3 fluorescent group bound to the 5′ of the molecule, “cy5” refers to a cyanine 5 fluorescent group bound to the 5′ end of a molecule, ‘N’ refers to any nucleotide of A, T, G, or C)

[0461] This experiment is designed to measure whether the amount of detection probes bound to a spatial region of a sample (in this case a functionalised hydrogel), and spatially indexed by our technology, can be measured by sequencing. Detection probes are homogeneously distributed on a functionalised coverslip, and two areas (a large one and a small one) are functionalised using different 2-bit spatial barcodes (two indexes each). Sequencing is then used to validate that the barcode assigned to the “large” area is more abundant than the barcode assigned to the “small” area.

[0462] An oligo-functionalised hydrogel was prepared by first pre-annealing oligos BALI_92 and BALI_93 by combining them to a final concentration of 15 uM in 2×SSC, heating to 95 C for 2 minutes and cooling down to room temperature for 30 minutes, and then diluting the annealed oligos to a final concentration of 1 uM in degassed gel buffer (4% 19:1 acrylamide:bisacrylamide, 0.3 M NaCl, 60 mM Tris-HCl pH 8). A 80 ul drop of the gel solution was used to coat coverslips functionalised in BIND-Silane (GE healthcare) by incubation for 1 h at room temperature. BALI_92 and BALI_93 are designed to mimic a detection probe with an annealed stabiliser region.

[0463] The functionalised gel was first washed 3 times for 5 minutes at in 2×SSC (room temperature). A first ligation was then performed to attach a caged “bridge” molecule to the detection probes. Oligos BALI_94 and BALI_95 were annealed by combining them to a final concentration of 5 uM in 2×SSC, heating to 95 C for 2 minutes and cooling down to room temperature for 30 minutes, and then further diluted to a final concentration of 500 nM in a ligation mix including 1× Quick ligation buffer (NEB) and 100 U/ul T4 DNA ligase. The functionalised coverslips were incubated with the ligation mix for 30 minutes at room temperature, and washed 3 times for 3 minutes at room temperature in 2×SSC.

[0464] Following the ligation, a dephosphorylation reaction was performed to remove any phosphate group produced by spontaneous a specific uncaging of the photocage group. This was done by incubating the samples for 30 minutes at 37 C in a mixture including 1× Outsmart buffer (NEB) and 0.05 U/ul shrimp alkaline phosphatase, followed by three washes at room temperature for 5 minutes in 2×SSC.

[0465] Uncaging of the first “large” area was then performed on a leica SP5 confocal microscope equipped with a 30 mW 405 nm laser, using a 10× objective and 100% laser power. Uncaging was done for 5 minutes on 20 fields of view (approx 1 mm.sup.2 each). Following this, the first bit of the spatial barcode was ligated to this area by incubating the sample for 30 minutes at room temperature in a ligation mix including 1× Quick ligation buffer (NEB), 100 U/ul T4 DNA ligase and 500 nM of oligos BALI_96 and BALI_97 annealed as described above. Ligation was followed by 3 washes at room temperature for 5 minutes is 2×SSC.

[0466] A second “small” area was then uncaged (as above, 4 fields of view), followed by ligation using annealed oligos BALI_98 ad BALI_99 and by another round of washes.

[0467] The first “large” area was then localized again on the microscope using the loss of cy5 fluorescence and the acquisition of cy3 fluorescence as guide, and uncaged again with the same parameters, followed by ligation with oligos BALI_100 and BALI_101. The same was done for the “small” area, with oligos BALI_102 and BALI_103. In between ligation/uncaging steps the sample was washed three times at room temperature for 5 minutes in 2×SSC.

[0468] After completion of the spatial barcoding, the signal from the barcoded detection probes was amplified by in-situ RNA transcription by incubating the sample in a transcription mixture containing 130 ul ultrapure H2O, 72 ul NTP mix (from the NEB Hiscribe T7 quick kit) and 14.4 ul of T7 RNA polymerase. Transcription was performed for 2 h at 37 C, after which the gel and transcription mixture were collected, diluted with 130 ul ultrapure H2O, and purified via ethanol precipitation in presence of 0.3 M Sodium acetate.

[0469] The recovered RNA was reverse transcribed using the superscript III kit (thermo scientific) according to standard protocols, using BALI_104 as a gene-specific primer. The resulting cDNA was then converted in an Illumina sequencing library using primers BALI_105 and the standard reverse indexed Truseq LT primer (index 006)

[0470] The libraries were sequenced using an Illumina MiSeq sequencer (paired end 150 reads) and analysed through a custom bioinformatics pipeline to quantify the abundance of each spatial index combination. Results are shown in FIG. 14.

Example 11

[0471] Increased Signal to Noise Ratio by Using Detection Probes Against Pre-Amplified Transcripts.

TABLE-US-00013 TABLE 13 SEQ ID Name NO: Sequence BALI_106 110 [Phosphate]ACATTAGATTGCC TGATCGCTGTCGGATTATTACTAT CGCATACACTAAAGATA BALI_107 111 CAACGCTGTCAGCTAAGCGCTAAT GTTATCTT BALI_108 112 [Phosphate]GTGACGT ATGTCGAGAGCTAGC CCGTGGACATCT NNNNNNNNNNNNNNN AGATCGGAAGAGCGTCGTGTAG CTCCCTATAGTGAGTCGTATTA CTAGCTAGCG GATTGCCTGATCGCTGTCG BALI_109 113 [Atto 565]GATTGCCTGATCGCTGTCG (‘N’ refers to any nucleotide of A, T, G, or C, “Atto565” refers to the atto565 red fluorescent group bound to the 5′ end of a molecule)

[0472] In this experiment we demonstrate the possibility of targeting detection probes against amplified molecules which are produced on top of target RNA transcripts. Specifically, we are producing a DNA concatemer by rolling circle amplification (RCA) following the circularization of a detection probe for an artificial barcode expressed in the genome of a cell population. The circularization is performed through splint ligation, using a second probe (targeted just downstream of the first one on the same expressed barcode) as stabiliser. This signal amplification protocol is known in the art and described in a technique called “starMAP” (see reference at Pubmed ID 29930089).

[0473] The detection probe, in this experiment, is targeted to a unique sequence found on the DNA concatemer produced by the amplification. The amplification technique can be used to increase the signal from each target of a detection probe, resulting in increased signal-to-noise ratio for detection.

[0474] In this experiment, we detect the DNA concatamers both by direct hybridization with a fluorescent probe (BALI_109), and then by hybridization of a detection probe followed by ligation of a caged bridge molecule, showing that the same pattern of binding is obtained.

[0475] Cells expressing an artificial DNA barcode (4t1_barcode cells, provided by a collaborator in our laboratory) were cultured on #1.5 thickness glass coverslips functionalised first with BIND-silane (GE Healthcare), and then overnight with 0.01% poly-L-lysine in complete culture medium (DMEM, 10% fetal bovine serum). Two samples were prepared, one for direct detection by fluorescence in-situ hybridization and one for detection via detection probe hybridization and ligation.

[0476] Prior to the experiment, cells were fixed in 4% paraformaldehyde for 10 minutes, washed in PBS, and permeabilized by incubation in Methanol for 10 minutes at −20 C.

[0477] After permeabilization, the samples were washed once at room temperature for 5 minutes in PBS supplemented with 0.1% Tween 20 and 0.1 U/ul superase RNAse inhibitor (Thermo Scientific) (from now: PBSTR) and once at room temperature for 5 minutes in hybridization buffer (2×SSC, 10% formamide, 1% Tween 20, 20 mM vanadyl ribonuclease complex, 0.1 mg/ml salmon sperm DNA). The two hybridization probes (BALI_106 and BALI_107) were diluted to 25 uM in ultrapure H2O, heat up at 95 C for 2 minutes, and cooled down to room temperature for 30 minutes and then further diluted to a 100 nM final concentration in hybridization buffer. Hybridization was performed at 40 C overnight.

[0478] The following day, the samples were washed twice in PBSTR for 20 minutes each at 37 C, and once in a 1:1 solution of 4×SSC/PBSTR for 20 minutes at 37 C. A ligation mix was then added, including 40 U/ul T4 DNA ligase, 0.1 U/ul Superase RNAse inhibitor, 1×T4 ligase buffer (NEB), and 0.2 mg/ml BSA. The ligation was carried out for 2 h at room temperature, and the samples were then washed twice at room temperature for 5 minutes in PBSTR. Signal amplification was then performed by incubating the samples 2 h at 30 C in an amplification mix including 0.2 U/ul Phi29 DNA polymerase, 250 uM dNTP, 20 uM aminoallyl dUTP, 0.1 U/ul Superase RNAse inhibitor, and 1×Phi29 polymerase buffer (NEB). Finally, the sample was washed twice at room temperature for 5 minutes in PBSTR, and once at room temperature for 5 minutes in PBS.

[0479] The amplicons produced in the sample were functionalised with acrylic acid by incubating the samples in 20 mM Acrylic Acid NHS ester in PBS for 2 h at room temperature, followed by two washed at room temperature for 5 minutes in PBS. A thin hydrogel was cast over the cells by coating the coverslips with a 80 ul drop of degassed hydrogel buffer (4% 19:1 acrylamide:bis-acrylamide mix, 2×SSC, 0.05% TEMED, 0.05% Ammonium persulfate) and incubating for 1 h at room temperature. The samples were then digested in digestion buffer (1% SDS, 2×SSC, 0.2 mg/ml NEB Proteinase K enzyme) for 1 h at 37 C in a humidified chamber, and washed 3 times at room temperature for 5 minutes in PBS.

[0480] For direct FISH detection, the amplicons were detected by incubating the sample for 30 minutes in presence of a 500 nM dilution of the detection probe (BALI_109) in 2×SSC/10% Formamide, followed by three washes at room temperature for 5 minutes in 2×SSC. Images were acquired on a Leica SP5 confocal microscope.

[0481] For detection probe binding and ligation, the samples were incubated for 5 minutes at room temperature in encoding hybridization buffer (2×SSC, 30% formamide), and hybridized with the BALI_108 probe diluted to a final concentration of 225 nM in a encoding hybridization mix including 2×SSC buffer, 30% formamide, 10% dextran sulphate, 1 mg/ml yeast tRNA, and 1:100 NEB murine ribonuclease inhibitor. The samples were then washed twice at 47 C for 30 minutes in encoding hybridization buffer, and once at room temperature for 5 minutes in 2×SSC. A ligation was then performed to attach the caged and fluorescent “bridge” molecule to the detection probes. Oligos BALI_94 and BALI_95 were annealed by combining them to a final concentration of 5 uM in 2×SSC, heating to 95 C for 2 minutes and cooling down to room temperature for 30 minutes, and then further diluted to a final concentration of 500 nM in a ligation mix including 1× Quick ligation buffer (NEB) and 100 U/ul T4 DNA ligase. The functionalised coverslips were incubated with the ligation mix for 30 minutes at room temperature, and washed 3 times for 3 minutes at room temperature in 2×SSC. The samples were then imaged to detect the caged detection probe on the same microscope described above. For both imaging experiments, counter-staining of nuclei was performed in SYTO 16 at 0.33 uM concentration for 10 minutes in 2×SSC. Results are shown in FIG. 15.