SUPPRESSING MSH1 FUNCTION

Abstract

The present invention provides methods of identifying and producing dominant negative MSH1 genes in plants and methods of using plants comprising dominant negative MSH1 genes for Msh1 suppression.

Claims

1. A method of identifying a MSH1-DN mutation comprising: a. Producing candidate MSH1-DN mutations in an isolated Msh1 gene that is subsequently transformed into a plant; b. Screening plants or their progeny comprising said candidate MSH1-DN mutations of step (a) for loss of MSH1 function when containing both mutant and normal Msh1 genes; and c. Identifying a MSH1-DN mutation that suppresses MSH1 function in a plant containing both mutant and normal Msh1 genes.

2. The method of claim 1, herein a MSH1-DN mutation in a endogenous Msh1 gene in a plant obtained by: a. Mutagenizing a population of plant cells, seeds, or pollen, and producing plants from the mutagenized plant cells, seeds, or pollen; b. Screening said plants of step (a), or their progeny, to identify plants comprising a MSH1-DN mutation identified by the method of claim 1; and c. Identifying a plant comprising a MSH1-DN mutation.

3. The method of claim 1, wherein a MSH1-DN mutation in a endogenous Msh1 gene in a plant is obtained by: a. Mutagenizing a population of plant cells, seeds, or pollen, and producing plants from the mutagenized plant cells, seeds, or pollen; b. Screening said plants of step (a), or their progeny, to identify plants comprising a MSH1-DN mutation at an MSH1 equivalent amino acid position selected from the group consisting of positions of the MSH1-DN mutations in Table 2; and c. Identifying a plant comprising a MSH1-DN mutation.

4. The method of claim 3, wherein the MSH1-DN mutation is selected from the group of MSH1-DN mutations G772S and S823I.

5. A plant or crop plant comprising a MSH1-DN mutation at an MSH1 equivalent amino acid position selected from the group consisting of positions of the MSH1-DN mutations in Table 2.

6. A plant or crop plant of claim 5, comprising a MSH1-DN mutation is selected from the group of MSH1-DN mutations G772S and S823I.

7. A method for producing a plant exhibiting improved yield comprising the steps of: a. suppressing expression of endogenous MSH1 gene(s) in a plant or plant cell to obtain a first parental plant, wherein suppression of MSH1 expression is effected with a MSH1-DN; b. selfing the first parental plant or crossing the first parental plant to a second parental plant; c. recovering progeny plants or a progeny plant line from the self or cross of the first parental plant of step (b) wherein MSH1 function is restored; and, d. selecting a progeny plant or a progeny plant line from a recovered progeny plant or plant line of step (c) or from a self or outcross of a recovered progeny plant or plant line of step (c) wherein the selected progeny plant or plant line exhibits improved yield in comparison to a control plant, wherein said improved yield is associated with one or more epigenetic changes in the nucleus of the progeny plant cells relative to the corresponding parental chromosomal loci and is heritable.

8. The method of claim 7, wherein said MSH1-DN mutation of step (a) is at an MSH1 equivalent amino acid position selected from the group consisting of non-naturally occurring amino acids at MSH1 equivalent amino acid positions 768, 772, 773, 775, 882, 823, and 853.

9. The method of claim 8, wherein said MSH1-DN mutation is at MSH1 equivalent amino acid position and is selected from the group of MSH1-DN mutations in Table 2.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1. Clustal Omega protein domain alignments of the MSH1 ATPase domain of selected plant species, with three homeologs shown for wheat. The amino acid numbering scheme is shown below the amino acid alignments where the star in bold corresponds to the first digit of the three digit number below it, e.g., the first start from the top corresponds to position 768. SEQ ID NOs for FIGURE: Wheat_2AL, SEQ ID NO:1; Wheat_2DL, SEQ NO:2; Wheat_2BL, SEQ ID NO:3; Sorghum, SEQ ID NO:4; Zea_mays, SEQ ID NO:5; Glycine max_max, SEQ ID NO:6; Arabidopsis_thaliana, SEQ ID NO:7.

DESCRIPTION

[0021] As used herein, the terms MSH1 equivalent amino acid position (singular) or MSH1 equivalent amino acid positions (plural) refer to amino acid positions 768, 772, 773, 775, 882, 823, and 853 when a plant MSH1 protein is aligned to the plant MSH1 proteins shown in FIG. 1, using the numbering shown in FIG. 1. Programs such as BLAST or CLUSTAL OMEGA or other suitable alignment programs can be used for alignment, with homology criteria of at least 50%, 60%, 70%, 80%, 90% or 95% homology. Insertions or deletions of amino acids in the alignments or protein length do not change the position numbering used herein, e.g., the position of the first G in the peptide sequence SEQ ID NO:8 (GPNGGGKS) that corresponds to G768 in FIG. 1 will have MSH1 equivalent amino acid position 768 in all aligned MSH1 proteins regardless of the position number of the amino acids in the protein being compared.

[0022] As used herein, the terms mutagenesis or mutagenizing or mutagenized refer to any random or targeted method of changing a gene's sequence including but not limited to chemical mutagens such as alkylating agents and azides, radiation such as gamma rays, x-rays, and particle radiation such as fast and thermal neutrons, beta and alpha particles as well as gene-editing methods including but not limited to methods such as CRISPR, TALENS, homologous recombination with foreign nucleic acids, and chimeric oligonucleotides.

[0023] As used herein, a plant MSH1 sequence refers to a mRNA or cDNA or protein or gene sequence of an endogenous MSH1 gene found in a plant.

[0024] As used herein, the term homology or homologous refers to similar protein sequences when aligned by BLAST or CLUSTAL OMEGA or similar alignment methods. Sequences displaying homology or homologous sequences are 70% to 80%, at least 80% to 90%, or 90% to 95%, or 95% to 100% homologous when scored by amino acids at individual positions in the protein that are identical or conservative amino acid substitutions.

[0025] As used herein, conservative amino acid substitutions are those within the same group: aliphatic (Glycine, Alanine, Valine, Leucine, Isoleucine); Hydroxyl or Sulfur/Selenium-containing (Serine, Cysteine, Selenocysteine, Threonine, Methionine); Cyclic (Proline); Aromatic (Phenylalanine, Tyrosine, Tryptophan); Basic (Histidine, Lysine, Arginine); or Acidic and their Amides (Aspartate, Glutamate, Asparagine, Glutamine).

[0026] As used herein, the term comprising means including but not limited to.

[0027] As used herein, the term progeny refers to any one of a first, second, third, or subsequent generation obtained from a parent plant or plant derived from a plant cell in culture.

[0028] The phrase operably linked as used herein refers to the joining of nucleic acid sequences such that one sequence can provide a required function to a linked sequence. In the context of a promoter, operably linked means that the promoter is connected to a sequence of interest such that the transcription of that sequence of interest is controlled and regulated by that promoter. When the sequence of interest encodes a protein and when expression of that protein is desired, operably linked means that the promoter is linked to the sequence in such a way that the resulting transcript will be efficiently translated. If the linkage of the promoter to the coding sequence is a transcriptional fusion and expression of the encoded protein is desired, the linkage is made so that the first translational initiation codon in the resulting transcript is the initiation codon of the coding sequence. Alternatively, if the linkage of the promoter to the coding sequence is a translational fusion and expression of the encoded protein is desired, the linkage is made so that the first translational initiation codon contained in the 5 untranslated sequence associated with the promoter is linked such that the resulting translation product is in frame with the translational open reading frame that encodes the protein desired. Nucleic acid sequences that can be operably linked include, but are not limited to, sequences that provide gene expression functions (i.e., gene expression elements such as promoters, 5 untranslated regions, introns, protein coding regions, 3 untranslated regions, polyadenylation sites, and/or transcriptional terminators), sequences that provide DNA transfer and/or integration functions (i.e., site specific recombinase recognition sites, integrase recognition sites), sequences that provide for selective functions (i.e., antibiotic resistance markers, biosynthetic genes), sequences that provide scoreable marker functions (i.e., reporter genes), sequences that facilitate in vitro or in vivo manipulations of the sequences (i.e., polylinker sequences, site specific recombination sequences, homologous recombination sequences), and sequences that provide replication functions (i.e., bacterial origins of replication, autonomous replication sequences, centromeric sequences).

[0029] As used herein, the term transgene or transgenic refers to any DNA from in vitro or recombinant DNA source that has been integrated into a chromosome that is stably maintained in a host cell. In this context, sources for the DNA include, but are not limited to, DNAs from an organism distinct from the host cell organism, species distinct from the host cell species, varieties of the same species that are either distinct varieties or identical varieties, DNA that has been subjected to any in vitro modification, recombinant DNA, and any combination thereof.

[0030] MSH1 Proteins

[0031] Representative MSH1 protein sequences from a non-limiting selection of plants species are provided in Table 1. The Genbank protein accession numbers or protein sequences or SEQ ID numbers are provided. Clustal omega alignment (or a similar alignment program such as BLAST or a program for aligning two or more sequences) of two or more of these proteins with candidate MSH1 proteins is useful for validating a candidate MSH1 protein is an authentic MSH1 protein as authentic MSH1 proteins will be highly conserved with the MSH1 proteins in Table1, especially for plants in similar plant genus, families, order, class or groups. Sequences in Table 1 may not be full length and may not include all the MSH1 family members in polyploid species.

TABLE-US-00001 TABLE 1 MSH1 protein sequences from a non- limiting selection of plant species NCBI Genbank Protein Species Accession Number Capsella rubella XP_006299281.1 Ricinus communis XP_002528340.1 Populus trichocarpa XP_002314510.1 Theobroma cacao XP_007035297.1 Citrus sinensis XP_006480235.1 Citrus clementine XP_006420379.1 Vitis vinifera XP_002282256.1 Prunus persica XP_007225427.1 Fragaria vesca subsp. Vesca XP_004297941.1 Solanum tuberosum XP_006340883.1 Cucumis sativus XP_004134396.1 Solanum lycopersicum XP_0004247788.1 Cicer arietinum XP_004497789.1 Glycine max NP_001238217.1 Phaseolus vulgaris AAX31514.1 Oryza sativa Japonica Group NP_001053261.1 Oryza sativa Indica Group CAH67334.1 Oryza brachyantha XP_006652491.1 Setaria italic XP_004976164.1 Medicago truncatula XP_003590183.1 Zea mays AFW58800.1 Cucumis sativus ACA35268.1 Hordeum vulgare subsp. Vulgare BAK01143.1 Sorghum bicolor XP_002448138.1 Wheat SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3

[0032] Examples of suitable plants for the present invention may include, for example, species of the Family Gramineae, including Sorghum bicolor and Zea mays; species of the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale, and Triticum.

[0033] In some embodiments, plants or plant cells may include, for example, those from corn (Zea mays), canola (Brassica napes, Brassica raga ssp.), Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgate), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus animus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), duckweed (Lemna), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucijra), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia spp.), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.

[0034] Examples of suitable vegetables plants may include, for example, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).

[0035] Examples of suitable ornamental plants may include, for example, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.

[0036] Examples of suitable ornamental plants may include, for example, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.

[0037] Examples of suitable leguminous plants may include, for example, guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, peanuts (Arachis sp.), crown vetch (Vicia sp.), hairy vetch, adzuki bean, lupine (Lupines sp.), trifolium, common bean (Phaseolus sp.), field bean (Pisum sp.), clover (Melilotus sp) Lotus, trefoil, lens, and false indigo.

[0038] Examples of suitable forage and turf grass may include, for example, alfalfa (Medicago s sp.), orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.

EXAMPLES

[0039] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1

Identification of Candidate MSH1-DN Mutations

[0040] Dominant negative mutations previously identified in non-plant species were mapped by protein homology to the Arabidopsis MSH1 protein. A subset of these were selected as candidate MSH1-DN mutations and are identified in Table 2 and their positions within the ATPase domain of selected plant MSH1 proteins is shown in FIG. 1. The MSH1 protein sequences are highly conserved in plants as shown in FIG. 1 and the corresponding position of the candidate MSH1-DN amino acids in other plant MSH1 proteins can be readily identified by alignment as shown in FIG. 1. These candidate MSH1-DN amino acid positions are referred to as MSH1 equivalent amino acid positions and refer to amino acid positions 768, 772, 773, 775, 882, 823, and 853 when a plant MSH1 protein is aligned to the plant MSH1 proteins shown in FIG. 1, using the numbering shown in FIG. 1. Programs such as BLAST or CLUSTAL OMEGA or other suitable alignment programs can be used for alignment, with homology criteria of at least 50%, 60%, 70%, 80%, 90% or 95% homology. Insertions or deletions of amino acids in the alignments or protein length do not change the position numbering used herein, e.g., the position of the first G in the peptide sequence SEQ ID NO:8 GPNGGGKS that corresponds to G768 in FIG. 1 will have MSH1 equivalent amino acid position 768 in all aligned MSH1 proteins regardless of the position number of the amino acids in the protein being compared

Example 2

Production of Transgenic Plants Containing MSH1-DN Mutations

[0041] A binary vector capable of Agrobacterium-mediated DNA transfer and containing an Arabidopsis Msh1 gene was mutated in the ATP binding domain to contain the amino acid mutations and corresponding DNA mutations are shown in Table 2. Construction of this vector and mutants was accomplished as follows, The base vector is a right border pVS1 binary plasmid capable of DNA transfer into plant cells. This binary vector contains a spectinomycin resistance gene for bacterial selection. For visual selection of transformed seeds a DsRED marker was also present in this vector. This DsRED gene uses a constitutive soybean ubiquitin promoter similar to that reported (Hernandez-Garcia et al. 2010) and a 3 polyadenylation region from the Cauliflower Mosaic Virus 35S.

[0042] An Arabidopsis Msh1 full-length genomic DNA (gDNA), containing and expressed from its native promoter (Virdi et al., 2016, Molecular Plant, 9: 245-260) was sub-cloned at a location 3 to the DsRED gene in the pVS1 binary vector using standard restriction enzyme digestion and ligation cloning methods. Al the 3 end of the MSH1 genomic clone, a Cauliflower Mosaic Virus 35S 3 polyadenylation region is used as the 3 polyadenylation region was used instead of the native Arabidopsis Msh1 3 polyadenylation region. To facilitate the cloning of the single-amino acid mutations into the Arabidopsis ATPase domain coding region, two unique restriction sites (XhoI and AvrII) were engineered via silent mutations at positions 5037 nt and 5512 nt, with the numbering respective to the ATG initiation codon in the MSH1 full-length gDNA.

[0043] Nine amino acids mutations in Table 2 were targeted as candidate dominant negative mutations. Nine DNA fragments, each encoding one of the amino acid mutations in Table 2, were constructed as follows. First, two PCR fragments, one spanning the region between the XhoI and the mutation region and the second spanning the mutation region to the AvrII restriction sites were amplified using oligonucleotides containing the mutation sequence modification desired. The first PCR fragment was flanked by XhoI and BsaI restriction sites, while the second PCR fragment was flanked by BsaI and AvrII restriction sites. Both PCR amplicons were purified, digested with the corresponding enzymes, and ligated into the base vector previously digested with XhoI and AvrII. The BsaI restriction sites were designed to cleave the DNA adjacent to the BsaI recognition sequence, facilitating the joining of both PCR fragments into the base vector while removing the BsaI recognition sites. The sequence of each of the resulting constructs containing a MSH1 full-length gDNA containing the targeted mutation was verified by DNA sequencing.

[0044] The final binary constructs were electroporated into Agrobacterium EHA105 and the resulting Agrobacterium strain were used for floral dip transformation of wild-type Arabidopsis flowering plants. Transgenic seeds are identified by their fluorescent red color.

TABLE-US-00002 TABLE2 DominantNegativeMSH1candidateaminoacidmutations DNMut1:G768D SEQIDNO:10TGPNGGGKS.fwdarw. SEQIDNO:12TDPNGGGKS SEQIDNO:9ACTGGACCTAACGGTGGTGGTAAATCG.fwdarw. SEQIDNO:11 ACTGACCCTAACGGTGGTGGTAAATCG DNMut2:G772S SEQIDNO:10TGPNGGGKS.fwdarw. SEQIDNO:14TGPNGSGKS SEQIDNO:9ACFGGACCTAACGGTGGTGGTAAATCG.fwdarw. SEQIDNO:13 ACTGGACCTAACGGTTCCGGTAAATCG DNMut3:G773D SEQIDNO:10TGPNGGGKS.fwdarw. SEQIDNO:16TGPNGGDKS SEQIDNO:9ACTGGACCTAACGGTGGTGGTAAATCG.fwdarw. SEQIDNO:15 ACTTGGACCTAACGGTGGTGACAAATCG DNMut4:S775N SEQIDNO:10TGPNGGGKS.fwdarw. SEQIDNO:18TGPNGGGKN SEQIDNO:9ACTGGACCTAACGGTGGTGGTAAATCG.fwdarw. SEQIDNO:17 ACTGGACCTAACGGTGGTGGTAAAAAC DNMut5:S822P SEQIDNO:26KSSFQVE.fwdarw. SEQIDNO:20KPSFQVE SEQIDNO:25AAAAGTTCTTTCCAGGTAGAA.fwdarw. SEQIDNO:19 AAACCTTCTTTCCAGGTAGAA DNMut6:S822L SEQIDNO:26KSSFQVE.fwdarw. SEQIDNO:22KLSFQVE SEQIDNO:25AAAAGTTCYFFCCAGGTAGAA.fwdarw. SEQIDNO:21 AAACTTTCTTTCCAGGTAGAA DMMut7:S823I SEQIDNO:26KSSFQVE.fwdarw. SEQIDNO:24KSIFQVE SEQIDNO:25AAAAGTTCTTTCCAGGTAGAA.fwdarw. SEQIDNO:23 AAAAGTATCTTCCAGGTAGAA DNMut8:T853D SEQIDNO:28GTETAKG.fwdarw. SEQIDNO:30GDETAKG SEQIDNO:27GGGACAGAGACAGCAAAAGGC.fwdarw. SEQIDNO:29 GGGGATGAGACAGCAAAAGGC DNMut9:T853I SEQIDNO:28GTETAKG.fwdarw. SEQIDNO:32GIETAKG SEQIDNO:27GGGACAGAGACAGCAAAAGGC.fwdarw. SEQIDNO:31 GGGATTGAGACAGCAAAAGGC

[0045] Mutations are numbered DNMut1 to DNMut9 and show the amino acid change flanking the position number. The position numbers are shown in FIG. 1. Below each mutant name is the amino acid motif with the wild type sequence to the left of the arrow and the DN mutation to the right of the arrow. Below these are the corresponding cDNA sequences of the normal and DN mutation genes. The amino acid and codon changes are underlined and in bold.

Example 3

Screening Arabidopsis Plants for MSH1-DN Mutations that Inhibit Wild Type MSH1

[0046] Transgenic plants were grown from DsRED positive T1 seeds and examined for light green, yellow, or white leaf variegation, leaf morphology changes, and flowering time, as functional indicators of impaired MSH1 function. T1 plants were grown to maturity, seeds collected, and DsRED T2 seeds identified. These T2 plants were also examined for light green, yellow, or white leaf variegation, leaf morphology changes, and flowering time, indicative of impaired MSH1 function as loss of MSH1 function often has stronger variegation phenotypes in the second generation for loss of MSH1 function. Lineages showing leaf variegation in the T1 and/or T2 generation identified MSH1-DN mutations capable of suppressing the function of the endogenous wild type MSH1 protein as these plants have two copies of wild type endogenous Msh1 genes in addition to the MSH1-DN mutated transgene(s). A number of independently transformed transgenic T1 and T2 progeny from dominant negative mutants G772S and S823I displayed loss of MSH1 function phenotypes, indicating these were the most efficient dominant negative mutants for inhibiting wild type MSH1 function.

Example 4

CRISPR Gene Editing to Introduce MSH1-DN Mutations into Endogenous Msh1 Genes

[0047] CRISPR gene editing technologies are used for targeted mutagenesis at plant genes targeted by suitably designed guide RNAs against the ATPase domain of endogenous MSH1 genes. The breakage-repair reactions following CRISPR cleavage creates useful mutations that are screened by PCR/DNA sequencing or Taqman SNP detection methods (or equivalent SNP methods) for the desired MSH1-DN mutations in cells or plants. Introduction of a DNA repair template and a Msh1-Targeted CRISPR/guide RNA increases the frequency of recovering targeted MSH1-DN mutations (for a recent review of CRISPR/CAS9 in plants, see Bortesi and Fischer, 2015, Biotechnology Advances 33(10): 41-52).

Example 5

EMS Mutagenesis to Produce MSH1-DN Mutations in Plant Endogenous Genes

[0048] EMS methods of creating random point mutations are well known with published protocols for treating soybean seeds or maize pollen. Once mutagenized M2 seeds have been produced from the progeny of the mutagenized plants, pooling of the seeds and next generation sequencing of pools of DNA from the pooled seeds is used to identify M2 plants with the desired sequence change. A plant containing a MSH1-DN mutation in an endogenous Msh1 gene is produced by this EMS/screening method.

REFERENCES

[0049] Hernandez-Garcia, C M, Bouchard, R, Rushton, P, Jones, M, Chen, X, Timko, M, and Finer, J (2010) High level transgenic expression of soybean (Glycine max) GmERF and Gmubi gene promoters isolated by a novel promoter analysis pipeline. BMC Plant Biol. 10: 237.

[0050] Virdi, K S, Wamboldt, Y, Kundariya, H, Laurie, J D, Keren, I, Sunil Kumar, K R, Block, A, Basset, G. Luebker, S, Elowsky. C. Day, P M, Roose, J L, Bricker, T M, Elthon, T, and Mackenzie, S A (2016) MSH1 Is a Plant Organellar DNA Binding and Thylakoid Protein under Precise Spatial Regulation to Alter Development. Molecular Plant. 9: 245-260.