Method for Do Novo Biosynthesis of Chondroitin Sulfate
20180135089 ยท 2018-05-17
Inventors
Cpc classification
C12Y208/02017
CHEMISTRY; METALLURGY
C12P19/26
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a method for chondroitin sulfate biosynthesis, belongs to the field of pharmaceuticals field. CS was biosynthesized by sulfating the chondroitin with C4ST or C6ST in Tris-HCI buffer assisted with 3-phosphoadenosine 5-phophosulfate (PAPS). C4ST and C46ST came from bioengineered Escherichia coli or Pichia pastoris. Chondroitin came from bioengineered Bacillus subtilis 168.
Claims
1. A method for biosynthesis of Chondroitin sulfate (CS), comprising CS by sulfating chondroitin using C4ST or C6ST assisted with a PAPS regeneration system; wherein C4ST and C6ST are produced by microorganisms heterogeneously expressing a gene encoding C4ST or C6ST from animals.
2. The method according to claim 1, wherein a host used to express C4ST or C6ST is Escherichia coli or Pichia pastoris, and accordingly, a plasmid used for recombinant expression is pET or pPIC.
3. The method according to claim 1, wherein a sequence of the gene encoding C4ST is set forth in Gene ID: 58250 in NCBI; and wherein a sequence of the gene encoding C6ST is set forth in Gene ID: 53374 in NCBI.
4. The method according to claim 1, comprising using the PAPS regeneration system to catalyze PNPS to PAPS, wherein the PAPS regeneration system contains 0.1-100 g ASST IV, 0.1-50 mM PNPS (p-nitrobenzenesulphonic acid), 1-200 M PAP (35-adenosine diphosphate) and 1-200 mM Tris-HCI, pH5-9.
5. The method according to claim 4, comprising expressing ASST IV in E. coli. based on the plasmids of pET; wherein a sequence of a gene encoding ASST IV is set forth in Gene ID: 83783 in NCBI.
6. The method according to claim 1, comprising adding 0.1-100 g C4ST or C6ST to the PAPS regeneration system for CS synthesis.
7. The method according to claim 4, wherein a specific activity of ASST IV is 0.1-100 nmol/min.Math.mg.Math.protein.
8. The method according to claim 1, wherein a specific activity of C4ST is 0.1-100 pmol/min.Math.mg.Math.protein, and wherein a specific activity of C6ST is 0.1-100 pmol/min.Math.mg.Math.protein.
9. The method according to claim 1, comprising sulfating chondroitin using C4ST or C6ST assisted with the PAPS regeneration system under 25-50 C. within 1-50 hours.
10. The method according to claim 9, comprising sulfating chondroitin using C4ST or C6ST assisted with the PAPS regeneration system within 20-50 hours.
11. The method according to claim 1, comprising producing chondroitin by a recombinant Bacillus subtilis 168; wherein the recombinant B. subtilis 168 is constructed by expressing KfoC and KfoA in a genome and co-expressing genes related to a synthetic pathway of chondroitin, including genes related to the synthetic pathway of UDP-glucuronic acid (UDP-GlcUA) or UDP-N-Acetylglucosamine (UDP-GlcNAc).
12. The method according to claim 11, wherein genes related to the synthetic pathway of UDP-GlcUA include pgcA, gtaB, tuaD, and wherein genes related to the synthetic pathway of UDP-GlcNAc include glmS, glmM, glmU.
13. The method according to claim 11, wherein the recombinant B. subtilis 168 is constructed by expressing KfoC and KfoA in a genome and co-expressing genes tuaD and glmU, or co-expressing genes tuaD, glmU, gtaB, glmM and glmS.
14. The method according to claim 11, comprising using a plasmid pP43NMK to express genes related to the synthetic pathway of chondroitin.
15. The method according to claim 11, comprising culturing the recombinant B. subtilis 168 at 37 C. for 24-60 hours to produce chondroitin, and collecting chondroitin form a supernant of the culture; wherein a fermentation medium of the culture comprises 20 g/L yeast extract, 15 g/L or 50 g/L surcose, 3.9 g/L K.sub.2SO.sub.4, 1.5 g/L MgSO.sub.4 and 50 mM phosphate buffer, and has a PH of 6.5-7.5.
Description
BRIEF DESCRIPTION OF FIGURES
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
DETAILED DESCRIPTION
[0034] Analysis of C4ST and C6ST activity: The activity of C4ST and C6ST was analysis based on chondroitin. The reaction liquor were 20 mM Tris-HCI (pH7.0), 3 mM PNPS, 20 M PAP, 10 mg ASST IV, 5 mg/mL chondroitin, and 20
g C4ST or C6ST. The reaction was happened at 37 C. for 20 h, and terminated by heating at 100 C. for 5 min. At last, the absorbance was determinated at 400 nm. The blank was reaction liquor components with no C4ST and
[0035] C6ST. Product rate was calculation by the formula Y=10.sup.-3*(18.83*(AC-AASST IV)+0.38; Ac: the absorbance of C4ST or C6ST; AASST IV: the absorbance of blank.
[0036] Chondroitin molecular weight analysis: The moleculat weight of chondroitin was analysed by combination of Multi-Angle Laser Light Scattering Instrument and Size Exclusion Chromatography with Ultrahydrogel Linea on refractive index detector. It was performed with 0.5 mL/min phase (0.1 M NaNO.sub.3) at 50 C. for 20 min and injection volumn was 20 L.
Example 1 The Production of ASST IV, C4ST C6ST by Bioengineered E. coli
[0037] The genes encoding Rat ASST IV C4ST, and C6ST were separately inserted between the Nde I and Not I sites of pET26b after the T7 promoter and fusing with His-tag in the N-terminal to obtain the engineering plasmids pET26b-C4ST, pET26b-C6ST, and pET26b-ASST IV (The primers used were listed in Tab. 2). Finally, those plasmids were transformed into E. coli BL21 (DE3) and plated on LB plate with 50 g/mL ampicillin for screening.
[0038] The E. coli BL21 separately containing pET26b-C4ST, pET26b-C6ST, and pET26b-ASST IV was cultivated in Luria-Bertani (LB) medium with 50 g/mL ampicillin at 37 C. in a rotary shake at 220 rpm. Two milliliter of culture was inoculated into 50 mL of LB medium with 50 g/mL ampicillin and cultivated at 37 C. Then, after 2 h, OD.sub.600 of the broth reached 0.6-0.8, 30 L of 0.1 mM IPTG (isopropyl--D-thiogalactopyranoside) was add into the broth. After it was induced at 16 C. for 48 h, cells were harvested by centrifugation at 8000 rpm for 5 min at 4 C.
[0039] The recombinant E. coli BL21 were washed by 20 mM Tris-HCI (pH7.0), and diluted in 20 mM Tris-HCI (pH7.0) to have an absorbance of 10 at 600 nm. The suspended cells were lysed by sonication at 4 C. The cleared lysate was mixed were separated by 8-12% SDS-PAGE and identified by size comparison to Pre-stained standard (ThermoFisher, Germany) (
Example 2 Construction of Bioengineered P. pastoris
[0040] Genes encoding Rat C4ST, C6ST were amplified by PCR using the PrimeSTAR HS (Premix) with the primes containing the sequence of pPIC3.5K as overlapping overhangs in the 5-terminal, followed by Gibson isothermal assembly cloning to circularize to obtain the engineering pPIC3.5K-C4ST, and pPIC3.5K-C6ST with alpha signal peptide (The primers used were listed in Table 2). Then, the transformation and recombinant screening were proposed according to the instructions of A Pichia Vector for Multicopy Integration and Secreted Expression (Invitrogen, Germany).
[0041] pPIC3.5K-C4ST and pPIC3.5K-C6ST were separately transformed into P. pastoris GS115 to get recombinant P. pastoris GS115. Recombinant P. pastoris GS115 was cultivated in 50 mL BMMY medium containing 0.5 g/L methanol at 20 C. 200 rpm for 5 d. The culture supernatants were collected for C4ST and C6ST purification. The supernatants were filtered through a 0.22 m membrane and concentrated with Millipore ultrafiltration system according to the manufacturer's instructions with a membrane of 3 kDa cut off, the resulted samples were analysis and identified by SDS and MALDI-FOR-MASS (
[0042] C4ST and C6ST activity was also assayed by changes of absorbance at 400 nm due to the formation of free 4-nitrophenol as described with some modification (
Example 3 Synthesis of CSA, CSC
[0043] The conversion of chondroitin to CSA or CSC involved two steps, including PAPS regeneration and sulfotransferase modification. In briefly, the standard reaction mixture containing 3 mM 3-phosphoadenosine 5-phosphate (PNPS), 10 mg ASST IV (0.1-100 nmol/min*mg*protein) and 5 mg/mL chondroitin, and 20 g C4ST (0.1-100 pmol/min*mg*protein) or C6ST (0.1-100 pmol/min*mg*protein), and 20 mM Tris-HCI (pH7.0) buffer. The mixture was incubated at 37 C. for 20 h for CSA or CSC.
Example 4 CS Disaccharide Fractionation Analysis
[0044] CS disaccharide fraction was analysed by LCMS after it was lysed by chondroitinase ABC at 37 C. for 5-20 h and terminated at 100 C. for 5 min. The LC were performed at C18 Reverse phase column, 0.3 mm*250 mm, with phase A (8 mM CH.sub.3COOH), phase B (8 mM CH.sub.3COOH 70% methanol/H.sub.2O). The elution condition was in Table 1. The MS were performed with nitrogen as the desolation gas and as a nebulizer in negative-ion modes. The nebulizer flow was 0.75 L/min and nozzle temperature was 140 C. The N.sub.2 was also the drying gas with the flow 1.2 mL/min. The negative ion spectra were generated by scanning the range of 40-2000 m/z, with special ion peaks M/Z 397 and 458 (
TABLE-US-00001 TABLE 1 Time (min) PhaseA(%) PhaseB(%) 0 100 0 3 100 0 13 98 2 28 86 14 41 75 25 57 61 39 74 45 55 84 10 90 104 100 0
Example 5 Construction of Recombinant B. subtilis with Coexpression Pathway Gene
[0045] At first, B. subtilis E168C components were prepared. The inorganic ions components was (g/L): K.sub.2HPO.sub.4, 140; KH.sub.2PO.sub.4, 60; (NH.sub.4).sub.2SO.sub.4, 20; (Na.sub.3C.sub.6H.sub.5O.sub.7.Math.2H.sub.2 O); MgSO.sub.4.Math.7H.sub.2O, 2. GMI solutions used for components preparation containing 9.7 mL inorganic ions, 2.5 mL 20% glucose, 0.4 mL 5% casein, 1 mL 10% yeast extract per 100 mL. GMII solutions used for components preparation containing 9.7 mL inorganic ions, 2.5 mL 20% glucose, 0.08 mL 5% casein, 0.04 mL 10% yeast extract, 0.25 mL 1M MgCl.sub.2, 0.05 mL 1M CaCl.sub.2 per 100 mL. In detail, the colony of B. subtilis E168C was inoculated in 5 mL GMI, and cultivated at 30 C., 125 rpm for 16 h. Then, it was inoculated into 18 mL GMI with 10% (V/V), and cultivated at 37 C., 200 rpm for 3.5 h. Following, it was inoculated into 90 mL GMII with 10% (V/V), and cultivated at 37 C., 200 rpm for 1.5 h. Then, the cells were collected by centrifugation at 4 C., 5000 g for 10 min, and resuspended in 10 mL GMII, packaged it in 500 L for each one.
[0046] The recombinant plasmids pP43-DBA, pP43-UMS, pP43-DU, and pP43-DU-PBMS used for coexpression pathway genes were construction based on the parent expression plasmid pP43NMK (Production of specific-molecular-weight hyaluronan by metabolically engineered Bacillus subtilis 168, Metabolic Engineering, 2016, Jinpeng). Then, they were transformed into B. subtilis E168C components by chemical transformation, and cultured in LB plates with 50 g/mL kanamycin for transformant selection. All the transformant were confirmed by colony PCR with the primers gtaB-F/pgcA-R, glmM-F/glmS-R, tuaD-F/glmU-R, and glmU-F/gtaB-R. The results of electrophoresis were in
TABLE-US-00002 Primerssequences:5-3: gtaB-F: ATGAAAAAAGTACGTAAAGCCATAA pgcA-R: TTATTTTGCTGTTGACTCAACAA glmM-F: ATGGGCAAGTATTTTGGAACAGACG glmS-R: TTACTCCACAGTAACACTCTTCGCA tuaD-F: GTGAAAAAAATAGCTGTCATTGGAAC glmU-R: TTATTTTTTATGAATATTTTTCACATAATC glmU-F: ATGGATAAGCGGTTTGCAGTTG gtaB-R: TTAGATTTCTTCTTTGTTTAGTAAAC
Example 6 Production of Chondroitin by Recombinant Strains in Flask
[0047] All the four recombinant strains were inoculated into LB with 50 g/mL kanamycin, cultured at 37 C., 200 rpm for 16 h. Then, they were inoculated with 10% (V/V) into fermentation medium (20 g/L yeast extract, 50 g/L sucrose, 3.9 g/L K.sub.2SO.sub.4, 1.5 g/L MgSO.sub.4, 50mM phosphate buffer, pH7.0 50 g/mL kanamycin ), cultured in 37 C., 200 rpm for 54 h. And then, it was induced at the second hours by 20 g/L xylose. All the medium for B. subtilis E168C culture have no kanamycin. After fermentation, the culture was centrifugated at 10000 g for 5 min, and the supernants were collected. Then 3V ethanol were added and mixed at 4 C. for 1 h for the precipitation, after centrifugated at 10000 g for 5 min, the sediment was collected and resuspended in H.sub.2O. Then, the centrifugation and resuspend steps were repeats for three times for chondroitin purification. The chondroitin concentration was assayed by Bitter-Muir carbazole assay. 200 L samples and 1 mL Na.sub.2B.sub.4O.sub.7.10H.sub.2O-H.sub.2SO.sub.4 were mixed in tubes and boiled for 15 min. After they were cooled down, 50
L carbazole was added and mixed, then boiled for 15 min. The optical density was determinated after they were cooled down, and the chondroitin yield was calculated.
[0048] The chondroitin yield was increased by recombinant strains (B. subtilis E168C/pP43-DBA 2.17 g/L, B. subtilis E168C/pP43-UMS 2.37 g/L, B. subtilis E168C/pP43-DU 1.96 g/L, B. subtilis E168C/pP43-DU-PBMS 2.67 g/L), compared to parent (1.83 g/L) (
TABLE-US-00003 TABLE 2 Difference of chondroitin molecular weight produced by recombinant B. subtilis Strains .sup.aM.sub.n (kDa) .sup.bM.sub.w (kDa) .sup.cI.sub.p B. subtilis E168C 69.58 0.62 83.51 0.98 1.21 0.03 B. subtilis E168C/ 59.83 0.87 84.36 1.02 1.41 0.04 pP43-DBA B. subtilis E168C/ 89.83 0.67 97.02 1.88 1.08 0.08 pP43-UMS B. subtilis E168C/ 48.20 1.39 72.78 1.60 1.51 0.03 pP43-DU B. subtilis E168C/ 101.02 1.08 119.20 2.18 1.18 0.02 pP43-DB-PBMS .sup.anumber-average molecular weight(M.sub.n); .sup.brelative molecular mass(M.sub.w); .sup.cpolydispersity(I.sub.p = M.sub.w/M.sub.n).
Example 7 Production of Chondroitin by B. subtilis E168C/pP43-DU-PBMS in 3 L Fermentor with Strategy of Feed-Batch
[0049] B. subtilis E168C/pP43-DU-PBMS was inoculated into 150 mL LB broth, with 50 g/mL kanamycin and cultivated at 37 C., 200 rpm for 16 h. Then, they were inoculated with 10% (V/V) into fermentation medium (20 g/L yeast extract, 50 g/L sucrose, 3.9 g/L K.sub.2SO.sub.4,1.5 g/L MgSO.sub.4, 50 mM phosphate buffer, pH7.0 50 g/mL kanamycin ), and cultivated at 37 C., 2 vvm. 2h after the inoculation into fermentation medium, 20 g/L xylose was added. The pH was adjusted to 7.0 by 5 M NaOH. The stirred rate was adjusted to 600 rpm at the 6th hours, and 800 rpm at the 8th hours. 800 g/L sucrose solution was feed when the sucrose concentration of broth bellowed than 5 g/L to keep the sucrose concentration at 0-5 g/L. In detail, the feed strategy was 7.5, 7.5,15,10 g/L/h during 8-12 h. After the fermentation, the Mw, Mn, and Ip were assayed by HPSEC-MALLS.
[0050] It showed that Time course of chondroitin production was in S style. Chondroitin mainly accumulated during later stationary phase (