Plants of the genus Diplotaxis having cytoplasmic male sterility
09970023 · 2018-05-15
Assignee
Inventors
Cpc classification
International classification
A01H1/02
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention concerns plants, seeds and cells of the genus Diplotaxis having cytoplasmic male sterility, and more particularly plants, seeds and cells of the species Diplotaxis tenuifolia. The cytoplasmic male sterility is preferably that imported from Raphanus sativus, known as Ogura sterility. The invention also concerns methods for obtaining Diplotaxis tenuifolia plants carrying cytoplasmic male sterility, as well as various uses for the cytoplasmic male sterility of the plants of the invention.
Claims
1. A seed of the species Diplotaxis tenuifolia, wherein said seed produces a plant having cytoplasmic male sterility and wherein cells of said plant comprise, in their chloroplastic genome, the chloroplastic DNA of Raphanus sativus CMS Ogura.
2. The seed according to claim 1, wherein its cells comprise, in their mitochondrial genome, a portion of the DNA sequence SEQ ID No 1 or a sequence having at least 70% identity with said DNA sequence.
3. The seed according to claim 1, wherein the presence of the chloroplastic genome of Raphanus sativus CMS Ogura in a plant grown from said seed can be tested by comparing the size of the amplification fragment obtained when the primer pair SEQ ID Nos 4 and 5 is used to amplify by PCR the chloroplastic genome of said plant with the size of the amplification fragment obtained for a R. sativus CMS Ogura plant.
4. The seed according to claim 1, wherein cells in a plant grown from said seed have the genomic DNA of Diplotaxis tenuifolia and the mitochondrial and chloroplastic DNA of Raphanus sativus CMS Ogura.
5. A plant of the species Diplotaxis tenuifolia, having cytoplasmic male sterility, grown from a seed according to claim 1.
6. The plant according to claim 5, having no symptoms of chlorosis under normal culture conditions.
7. The plant of claim 6, having no discoloration of leaves due to a lack of chlorophyll.
8. The plant according to claim 5, wherein said plant is a hybrid plant.
9. A cell of a plant of the species Diplotaxis tenuifolia, having cytoplasmic male sterility, wherein said cell comprises, in its chloroplastic genome, the chloroplastic DNA of Raphanus sativus CMS Ogura.
10. A cell of a plant of the species Diplotaxis tenuifolia Diplotaxis, having cytoplasmic male sterility, wherein said cell comprises, in its chloroplastic genome, the chloroplastic DNA of Raphanus sativus CMS Ogura, wherein said cell originates from a plant according to claim 5.
11. A cell of a plant of the species Diplotaxis tenuifolia, having cytoplasmic male sterility, wherein said cell comprises, in its chloroplastic genome, the chloroplastic DNA of Raphanus sativus CMS Ogura, wherein said cell originates from a seed according to claim 1.
12. A method for transferring a cytoplasmic male sterility in a male fertile plant of the genus Diplotaxis, comprising: crossing a plant according to claim 1, as a female parent, with said male fertile plant, thus transferring the cytoplasmic male sterility to the male fertile plant of the genus Diplotaxis.
13. The seed according to claim 1, wherein the presence of the chlorolastic genome of Raphanus sativus CMS Ogura in a plant grown from said seed can be tested by comparing the size of the amplification fragment obtained when the primer pair SEQ ID Nos 14 and 15 is used to amplify by PCR the chloroplastic genome of said plant with the size of the amplification fragment obtained for a R. sativus CMS Ogura plant.
14. The seed according to claim 1, wherein the presence of the chlorolastic genome of Raphanus sativus CMS Ogura in a plant grown from said seed can be tested by comparing the size of the amplification fragment obtained when the primer pair SEQ ID Nos 18 and 19 is used to amplify by PCR the chloroplastic genome of said plant with the size of the amplification fragment obtained for a R. sativus CMS Ogura plant.
15. The seed according to claim 1, wherein the presence of the chlorolastic genome of Raphanus sativus CMS Ogura in a plant grown from said seed can be tested by comparing the size of the amplification fragment obtained when the primer pair SEQ ID Nos 6 and 7 is used to amplify by PCR the chloroplastic genome of said plant with the size of the amplification fragment obtained for a R. sativus CMS Ogura plant.
16. The seed according to claim 1, wherein the presence of the chlorolastic genome of Raphanus sativus CMS Ogura in a plant grown from said seed can be tested by comparing the size of the amplification fragment obtained when the primer pair SEQ ID Nos 12 and 13 is used to amplify by PCR the chloroplastic genome of said plant with the size of the amplification fragment obtained for a R. sativus CMS Ogura plant.
Description
KEY TO FIGURES
(1)
(2)
(3) F=fertile; S=sterile.
EXPERIMENTAL SECTION
Example 1: Production of Male Sterile Diplotaxis tenuifolia Plants (Cytoplasmic)
(4) Summary of Study
(5) The inventors crossed plants of the species Raphanus sativus carrying cytoplasmic male sterility (known as Ogura sterility) with fertile plants of the species Diplotaxis tenuifolia. They carried out several backcrosses in order to obtain a Diplotaxis tenuifolia nucleus while preserving the cytoplasmic male sterility. At the end of these various backcrosses, the plants obtained could be used as female parents for the production of hybrids.
(6) More precisely, the inventors carried out crosses between plants of the species Raphanus sativus as the female parent carrying Ogura cytoplasmic male sterility, which are commercially available, with plants of the species Diplotaxis tenuifolia (fertile) as the male parent. They then obtained nine F1 plants by embryo rescue, resulting from this intergeneric cross.
(7) In a second step, the inventors carried out a first backcross (backcross 1 or BC1) between the F1 plants obtained (Raphanus sativus CMSDiplotaxis tenuifolia) and plants of the species Diplotaxis tenuifolia, i.e. the following scheme:
(Raphanus sativus CMSDiplotaxis tenuifolia)Diplotaxis tenuifolia
(8) (using the international conventional whereby the female parent is mentioned on the side to the left of the cross and the male parent on the side to the right).
(9) The climactic conditions meant that plants could not be obtained by embryo rescue, but repeating the same crosses the following year resulted in six plants which were male sterile.
(10) The inventors then carried out a second backcross (BC2) using the following scheme:
((Raphanus sativus CMSDiplotaxis tenuifolia)Diplotaxis tenuifolia)Diplotaxis tenuifolia.
(11) An embryo was obtained by embryo rescue and resulted in several BC2 plants, which were also male sterile.
(12) The following steps consisted of a third backcross, again with a plant of the species Diplotaxis tenuifolia, followed by a fourth backcross (BC4).
(13) At the end of the fourth backcross, the plants obtained had all of the phenotypical characteristics characterizing the species Diplotaxis tenuifolia and could be used in selection programs, without it being necessary to resort to embryo rescue, especially to obtain parental cell lines carrying cytoplasmic male sterility ready for the production of hybrids.
(14) Furthermore, the inventors carried out several hundred B. Oleracea (Ogura cytoplasmic male sterility)Diplotaxis tenuifolia and Brassica rapa (Ogura cytoplasmic male sterility)Diplotaxis tenuifolia crosses, but none of them resulted in the production of embryos.
(15) More Detailed Description of the Various Steps:
(16) 1. Protocol for Intergeneric or Interspecific Crosses:
(17) Hybridization of Flowers:
(18) No special conditions; the usual protocol described in the literature was employed.
(19) The crosses were of the type B. rapaD. tenuifolia, B. oleraceaD. tenuifolia, R. sativusD. tenuifolia, (R. sativusD. tenuifolia)D. tenuifolia, etc. . . .
(20) Removal of Ovaries or Siliques:
(21) The siliques were removed before they went yellow on the plant for culture (between 4 days and one month after crossing). Of the removed siliques, only the siliques that were more than 20 mm long with a larger diameter and blisters were used.
(22) Disinfection:
(23) The siliques were placed in tea ball infusers. They were washed with alcohol for 5 minutes. They were then washed with Bayrochlor solution, 3 cp/L of sterile water with a few drops of Tween 20 (polyoxyethylene sorbitan monolaurate) for 30 minutes, agitating the tea ball infuser regularly. They were then rinsed three times more with sterile water, agitating the tea ball infuser occasionally.
(24) Culture of Ovules:
(25) Of the removed siliques, only those which had changed were open. They were the siliques that were more than 20 mm long with a larger diameter.
(26) The siliques were opened along the dehiscence split using a lance-shaped needle. Well rounded and whitish ovules were removed. They were cultured so that the hilum was in contact with the gelose in order to allow the embryo to develop.
(27) The cultured ovules were observed regularly and transplanted every two weeks. The ovules that turned black and/or went flat (which is synonymous with abortion) were eliminated.
(28) Culture Conditions for the Culture of Ovaries and Ovules
(29) N6 medium, in diffuse light with a photoperiod of 16 hours, at a temperature of 22 C. during the daylight periods and 20 C. during the nighttime period. The composition of this N6 medium is detailed in the publications by Chu, 1978 and Chu et al, 1975.
(30) 1. Development and Multiplication of Plantules Obtained from Embryos.
(31) Composition of the Various Culture Media for the Development and Multiplication of the Plantules Obtained:
(32) Mi01 medium is a base medium from Murashige and Skoog (Murashige and Skoog, 1962) supplemented with Morel vitamin B1, saccharose and Agar-Agar as the gelling agent. The pH of Mi01 medium is 5.8.
(33) Mi55 medium is a base medium from Murashige and Skoog (Murashige and Skoog, 1962) supplemented with Morel vitamin B1, saccharose and Gelrite as the gelling agent, with Ga.sub.3 growth compound after autoclaving. The pH of Mi55 medium is 5.9/6.
(34) Development of Embryos:
(35) The embryos appeared between 1 and 1 months after placing the ovules in culture. The embryos were placed in direct light with a photoperiod of 16 hours, a temperature of 22 C. during the daylight periods and 20 C. during the night time periods.
(36) The embryos can change in two manners: either they form a plantule or a callus forms, regenerating various plantules. The cultured embryos did not immediately produce plantules; there was callus formation, occasionally with buds on top.
(37) The plantules were isolated on a development medium, medium 01 (or Mi01).
(38) Multiplication of Explants
(39) For the Calluses:
(40) The calluses were transplanted onto an induction medium, N6 or Mi55, to regenerate the buds. The buds were transplanted onto Mi01 medium.
(41) For the Buds:
(42) All of the buds from the calluses were subcultured on Mi01 development medium to make them root.
(43) Summary:
(44) for the development and the multiplication of explants, two cases are possible:
(45) 1) Via the callus. Callus culture was carried out on an induction medium. The calluses regenerated buds; 2) buds were available which could be developed directly. This culture was carried out on Mi01 development medium. In order to multiply these plantules, if the plantule had no problems with development, the culture of nodes was used, on Mi01 medium. These nodes (or axillary buds) developed into plantules. If the plantule was stunted and/or there were developmental problems, it was transplanted onto Mi55 multiplication medium.
Rooting the Plantules:
(46) To root the multiplied plantules, for acclimation, they were cultivated on Mi01 rooting medium.
(47) Acclimation:
(48) The inventors then carried out acclimation as soon as the plantules had well developed roots. In vitro culture was continued until such roots had been obtained.
(49) The plants were acclimated in individual pots with a Klasmann Potgrong H horticultural substrate and kept in a mini greenhouse for one week. After one week, the inventors obtained good plants with good roots which were removed from the mini greenhouses.
(50) After three weeks, the plants had a good root system and good leaf development. The plants were then planted in open ground in a tunnel.
(51) Phenotyping of the plants obtained was carried out in order to select those for which the phenotypical characteristics were closest to Diplotaxis tenuifolia while carrying cytoplasmic male sterility (detectable phenotypically due to the absence of pollen).
(52) 3. Results
(53) Intergeneric Crosses
(54) The inventors carried out the following intergeneric crosses:
Brassica rapa CMSDiplotaxis tenuifolia and B. oleracea CMSDiplotaxis tenuifolia, followed by the following backcrosses:
(Brassica rapa CMSDiplotaxis tenuifolia)Diplotaxis tenuifolia and
(B. oleracea CMSDiplotaxis tenuifolia)Diplotaxis tenuifolia. No embryos were obtained for these two backcrosses, and thus no descendants. The inventors then carried out the following intergeneric cross:
Raphanus sativus (CMS)Diplotaxis tenuifolia.
(55) The siliques were removed and the ovaries were cultured. In total, 135 Raphanus sativus (CMS)Diplotaxis tenuifolia hybridizations were carried out, 1857 siliques were removed and 207 ovules were cultured; using this technique, 9 embryos were obtained, and given the codes RD1 to RD9.
(56) Plants were thus obtained in vitro; they were then acclimated.
(57) First Backcross:
(58) The following year, the inventors carried out a first backcross using the scheme:
[Raphanus sativus (CMS)Diplotaxis tenuifolia]Diplotaxis tenuifolia.
(59) Table 1 summarizes the number of siliques removed with ovules.
(60) TABLE-US-00001 TABLE 1 Code of No of No of % of No of female siliques siliques siliques ovules parent removed with ovules with ovules cultured RD1 49 22 44.9% 400 RD1 100 42 .sup.42% 635 RD2 0 0 0 RD2 0 0 0 RD4 12 8 66.7% 161 RD4 55 32 58.2% 561 RD5 38 2 5.3% 2 RD8 10 3 .sup.30% 4 RD8 26 1 3.8% 2 RD8 10 2 .sup.20% 2 RD8 15 6 .sup.40% 13 RD9 38 14 36.8% 224 RD9 72 34 47.2% 887 Total 425 166 39.1% 2891
(61) The number of siliques containing ovules was mediocre (mean frequency 39.1%).
(62) The ovules were transplanted twice onto fresh N6 medium. No BC1 embryos were obtained for the 2891 ovules that were cultured. However, it should be noted that the first crosses were carried out under poor climactic conditions.
(63) The inventors then carried out a fresh backcross trial the following year, modifying the fertilization method compared with the preceding year. It was decided not to carry out all of the fertilizations simultaneously, but to spread them over a month in order to limit the influence of climactic conditions, and to produce at most 200 buds each day of fertilization.
(64) Table 2 summarizes the results of this second backcross trial.
(65) TABLE-US-00002 Code of No of No of No of No of Code of female siliques ovules germinated embryos plants parent removed cultured ovules obtained obtained RD8 24 58 0 RD8 6 0 0 RD9 50 205 1 0 0 RD3 6 0 0 RD3 0 0 0 RD6 0 0 0 RD6 3 4 0 RD8 36 0 0 RD8 24 2 1 RD2 40 0 0 RD8 33 10 0 RD9 21 80 0 RD3 0 0 0 RD8 25 11 4 2 D6-D7 RD9 38 168 0 RD2 0 0 0 RD3 0 0 0 RD8 31 80 0 RD8 32 7 0 RD8 21 73 0 RD9 15 140 0 RD9 24 61 0 RD8 23 50 0 RD8 0 0 0 RD8 56 130 0 RD8 32 119 0 RD9 27 100 1 1 D4 RD8 58 111 0 RD8 27 141 0 RD8 14 19 0 RD8 21 380 3 4 D1-D2- D3-D5 RD3 7 0 0 RD8 26 8 0 Total 720 1957 10 7
(66) As can be seen from this Table 2, 7 embryos were obtained in total, denoted D1 to D7. Plantule D7 did not develop.
(67) Transplanting the embryos onto N6 medium allowed buds to proliferate: each embryo could then be cloned into several copies. It was then possible to acclimate the plants which would then be used in the following backcrosses, all the while keeping the plantules in vitro.
(68) The F1 and BC1 material was also kept permanently in vitro or in a greenhouse (when contamination problems arose).
(69) The acclimated plants were cultured from axillaries. The stem sections were disinfected with a solution of Bayrochlor solution (3 cp/L) for 30 minutes. The axillaries were deposited on a base medium (for example Mi01).
(70) Second Backcross:
(71) The inventors then carried out the second backcross using the scheme:
[[Raphanus sativus (CMS)Diplotaxis tenuifolia]Diplotaxis tenuifolia]Diplotaxis tenuifolia
(72) The siliques were removed a few days after hybridization, in order to culture the ovules.
(73) With the 60 hybridizations carried out, 1149 siliques were removed and 5505 ovules were cultured.
(74) A single embryo was obtained; it was transplanted every two weeks onto Mi55 or N6 medium to obtain a callus then buds which developed into plantules.
Example 2: Characterization of Mitochondrial and Chloroplastic Genome of Diplotaxis tenuifolia Plants
(75) In Brassicaceae, the chloroplastic genome and the mitochondrial genome are characterized by exclusively maternal heredity. The inventors used three mitochondrial genes described in patent EP 0 549 726 and chloroplastic microsatellite markers (or SSR for simple sequence repeat) described in the publication by Flannery et al (2006), in order to characterize the male cytoplasm in the male sterile Diplotaxis tenuifolia plants of the invention.
(76) It should be recalled that the mitochondrial genome and chloroplastic genome of a Diplotaxis tenuifolia plant of the invention comprises sequences originating from Raphanus sativus.
(77) The oligonucleotides defined within the orf138 gene and the formylmethionine transfer RNAt gene respectively allow amplification of a 512 and 401 base pair fragment, only in plants comprising Ogura sterility.
(78) Amplification in the cox I gene (small sub-unit 1 of cytochrome oxidase) of a 655 base pair fragment of the mitochondrial genome of radish acted as a control in that said fragment had to be amplified in all of the lines tested.
(79) The presence or absence of amplification of fragments of mitochondrial sequences using said primers could be used to characterize the various plants employed in the present invention as regards their cytoplasmic male sterility.
(80) The allelic variation of the SSR chloroplastic microsatellite markers tested allowed the provenance of the chloroplastic genome of the Diplotaxis tenuifolia plants of the invention to be characterized, and more particularly the presence of chloroplastic sequences characteristic of Raphanus sativus.
(81) The length of the fragment of the chloroplastic sequences amplified using these primers could be employed to characterize the various plants used in the present invention as regards the nature of their chloroplastic genome.
(82) The chloroplastic genome of the Diplotaxis tenuifolia plants obtained using the method described in this invention differ from other Diplotaxis tenuifolia plants for which their chloroplastic genome does not originate from the genus Raphanus.
(83) A. Analysis of Mitochondrial Markers and PCR Conditions
(84) Total DNA (nuclear and cytoplasmic genomes) of fertile and male sterile Diplotaxis tenuifolia plants of the invention was isolated from the leaves of 8 week old plants using the protocol developed by Dellaporta (1983). Use of specific markers of the orf138 and T-RNAt genes in order to detect Ogura cytoplasmic male sterility:
(85) TABLE-US-00003 Orf138 Sense primer:oligo37: (SEQIDNo22) 5-GCATCACTCTCCCTGTCGTTATCG-3 (8M); Antisense primer:oligo38: (SEQIDNo23) 5-ATTATTTTCTCGGTCCATTTTCCA-3 (8M). T-RNAt Sense primer:TRNAFM-610U: (SEQIDNo24) 5-ACGTGTAGCCCTGTATGGACT-3 (8M); Antisense primer:TRNAFM-987L: (SEQIDNo25) 5-GGTATTGTCACTTCCCGTTTC-3 (8M).
(86) The position of these various primers is illustrated in
(87) TABLE-US-00004 Sense primer:COX1-244U: (SEQIDNo26) 5-GGTAATTGGTTTGTTCCGATT-3 (8M); Antisense primer:COX1-805L: (SEQIDNo27) 5-CATGCCTAGATACCCGAAGAC-3 (8M). The PCR reaction for these markers was carried out on 20 l samples comprising:
(88) 5.0 L of diluted total DNA (2 to 10 ng/L)
(89) 2.0 L of 10PCR buffer (Invitrogen)
(90) 2.0 L of MgCl.sub.2 25 mM (Invitrogen)
(91) 1.5 L of dNTP mixture (2 mM of each dNTP; SIGMA)
(92) 0.7 L sense primer (8 M)
(93) 0.7 L antisense primer (8 M)
(94) 0.15 L ADN Taq polymerase, 5 U/L (Invitrogen)
(95) 7.95 L H.sub.2O.
(96) The profile of the PCR thermocycles was as follows: for the amplification of ORF138 and T-RNAt:
(97) 3 minutes at 94 C.; then 35 cycles of (30 sec at 94 C., 45 sec at 68.5 C., 1 min at 72 C.); 7 min at 72 C. then back down to 4 C., on a PCT GeneAmp 2700 system (Applied Biosystems). for the amplification of COX1:
(98) 3 minutes at 94 C.; then 35 cycles of (30 sec at 94 C., 45 sec at 54 C., 1 min at 72 C.); 7 min at 72 C. then back down to 4 C., on a PCT GeneAmp 2700 system (Applied Biosystems).
(99) A portion of the PCR products was checked on 1.5% agarose gel and the remainder underwent sequencing using Sanger's method.
(100)
(101) The scale shown on the left hand side of the gel confirms that the amplified fragments were of a size in agreement with prediction, i.e. approximately 512 base pairs for ORF138, approximately 401 for T-RNAt and approximately 655 for COX1.
(102) The inventors also sequenced two amplified fragments (ORF138 and T-RNAt), which confirmed that their size was in agreement with the expected sizes, but also that the sequence of the amplified fragments was identical or almost identical to the sequence listed as being linked to the Ogura CMS in Raphanus sativus, namely Z18896.
(103) Sequencing of the amplified fragments (consensus of sequencing of several fragments) produced the following results (the underlined sequences correspond to the sequences for the primers): 512 base pair fragment of orf138:
(104) TABLE-US-00005 (SEQIDNo20) GCATCACTCTCCCTGTCGTTATCGACCTCGCAAGGTTTTTGAGACGGCCG AAACGGGAAGTGACAATACCGCTTTTCTTCAGCATATAAATGCAATGATT ACCTTTTTCGAAAAATTGTCCACTTTTTGTCATAATCTCACTCCTACTGA ATGTAAAGTTAGTGTAATAAGTTTCTTTCTTTTAGCTTTTTTACTAATGG CCCATATTTGGCTAAGCTGGTTTTCTAACAACCAACATTGTTTACGAACC ATGAGACATCTAGAGAAGTTAAAAATTCCATATGAATTTCAGTATGGGTG GCTAGGTGTCAAAATTACAATAAAATCAAATGTACCTAACGATGAAGTGA CGAAAAAAGTCTCACCTATCATTAAAGGGGAAATAGAGGGGAAAGAGGAA AAAAAAGAGGGGAAAGGGGAAATAGAGGGGAAAGAGGAAAAAAAAGAGGG GAAAGGGGAAATAGAGGGGAAAGAGGAAAAAAAAGAGGTGGAAAATGGAC CGAGAAAATAAT.
(105) A single difference in one nucleotide (position 43 of SEQ ID No 20) was revealed compared with the corresponding sequence of Z18896 (SEQ ID No 1). 401 base pair fragment of T-RNAt:
(106) TABLE-US-00006 (SEQIDNo21) ACGTGTAGCCCTGTATGGACTCGCGAAGCAGGTCTCCGGTCGGTGTCCAA GATTTGATCTAACTATTGAGTGAGGACTACTTACCGATTGATAGAATAAT ACGTATATAAGAAGAAGGCTGCTTTGTGGAGTGATCTTTCTCGAAATGAA TTAAGTAAGGGCGCTATGTTCAGATTCTGAACCAAAGCACTAGTTGAGGT CTGAAAGCCTTATGAGCAGAAGTAATAAATACCTCGGGGAAGAAGCGGGG TAGAGGAATTGGTCAACTCATCAGGCTCATGACCTGAAGATTACAGGTTC AAATCCTGTCCCCGCACCGTAGTTTCATTCTGCATCACTCTCCCTGTCGT TATCGACCTCGCAAGGTTTTTGAAACGGCCGAAACGGGAAGTGACAATAC C.
(107) No divergences were observed between SEQ ID NO: 21 and the corresponding sequence of Z18896 (SEQ ID No 1).
(108) This means that it can be concluded that the mitochondrial genome of male sterile Diplotaxis tenuifolia plants in accordance with the present invention is indeed that of the female parent in the intergeneric cross, i.e. that of Raphanus sativus CMS.
(109) B. Analysis of Chloroplastic Markers and PCR Conditions
(110) Use of SSR (simple sequence repeat or microsatellite marker) to distinguish between fertile plants and plants carrying the cytoplasmic male sterility of the invention.
(111) The markers used are shown in Table 3.
(112) Polymorphism analysis of the SSR markers was carried out on a MegaBACE DNA analysis system with the aid of a LPA high resolution separation matrix with a resolution to a single base (General Electrics Healthcare Inc).
(113) These SSR markers were amplified using the M13 tail universal primer to amplify many SSR fragments targeted using a single labeled M13 primer (various dyes available, such as FAM, HEX or NED) and many sense M13 primers. The reaction medium for the PCR consisted of a 100 L sample comprising:
(114) 5.0 L of diluted total DNA (2 to 10 ng/L)
(115) 1.0 L of 10PCR buffer (Invitrogen)
(116) 1.0 L of MgCl.sub.2 25 mM (Invitrogen)
(117) 1.0 L of dNTP mixture (2 mM of each dNTP; SIGMA)
(118) 0.6 L sense primer-M13 (2 M)
(119) 0.6 L antisense primer (8 M)
(120) 0.12 L M13 primer labeled with FAM, HEX or NED (8 M)
(121) 0.12 L DNA Taq polymerase 5 U/L (Invitrogen)
(122) 0.56 L H.sub.2O.
(123) The profile for the PCR thermocycles was as follows:
(124) 3 minutes at 94 C.; then 35 cycles of (15 sec at 94 C., 20 sec at 50 C., 15 sec at 72 C.); 7 min at 72 C. then back down to 4 C., on a GeneAmp 2700 PCT system (Applied Biosystems).
(125) The genotyping analysis was carried out on a MegaBACE.
(126) Four to six SSR products were diluted to one twentieth and multiplexed in the same capillary with 5 L of ET-400 ROX (standard size scale). The conditions of use were as follows:
(127) Injection time: 110 seconds;
(128) Voltage on injection: 3 kV;
(129) Run time: 65 minutes
(130) Voltage during run: 9 kV
(131) Filters: dye set II
(132) The MegaBACE Fragment Profiler 1.0 program can convert raw data into size-related data. Table 4 contains the SSR alleles obtained for the various fertile and male sterile plants of the present invention.
(133) The analysis was carried out on 2 different lines of fertile Diplotaxis tenuifolia and on 2 lines of Diplotaxis tenuifolia of the present invention, as well as on one line of Brassica oleracea carrying Ogura cytoplasmic male sterility in accordance with patent EP 0 549 726 and on the Raphanus sativus line carrying Ogura cytoplasmic male sterility.
(134) TABLE-US-00007 TABLE3 Primersusedforchloroplasticgenotyping. Primer Sequence SEQID Gene MF1_M13F 5-CACGACGTTGTAAAACGACTCAATTGCACATTCTAGAATTCTAAG-3 SEQIDNo2 trnL-F gene MF1_R 5-CAATTCAATATGGTTATATATTAGAG-3 SEQIDNo3 MF2_M13F 5-CACGACGTTGTAAAACGACGGTTCCGTCGTTCCCATCGC-3 SEQIDNo4 RPL16 gene MF2_R 5-CATAATAATTAGATAAATCTGTTCC-3 SEQIDNo5 MF3_M13F 5-CACGACGTTGTAAAACGACAATGGTATGACTAGCTTATAAGG-3 SEQIDNo6 trnE-trnT gene MF3_R 5-CTTAACAATGAGATGAGGCAATC-3 SEQIDNo7 MF4_M13F 5-CACGACGTTGTAAAACGACCGGATCTATTATGACATATCC-3 SEQIDNo8 psaA-ycf3 gene MF4_R 5-GAAATATGAATACACTAGATTAGG-3 SEQIDNo9 MF5_M13F 5-CACGACGTTGTAAAACGACCCTGGCGGTATCAAGATGCCACT-3 SEQIDNo10 trnT-rpoC2 gene MF5_R 5-GCCATAATGGTACAGAACTAT-3 SEQIDNo11 MF6_M13F 5-CACGACGTTGTAAAACGACGAAGGAATAGTCGTTTTCAAG-3 SEQIDNo12 atpB-rbcL gene MF6_R 5-CATAATTAGAGTTCCATTTCGG-3 SEQIDNo13 MF7_M13F 5-CACGACGTTGTAAAACGACCGGCAGGAGTCATTGGTTCAAA-3 SEQIDNo14 TrnM-atpE gene MF7_R 5-GATTTTGTAACTAGCTGACG-3 SEQIDNo15 MF8_M13F 5-CACGACGTTGTAAAACGACCTTATATTCATAAGCGAAGAAC-3 SEQIDNo16 rbcL-accD gene MF8_R 5-AATAACAATAGATGAATAGTCA-3 SEQIDNo17 MF9_M13F 5-CACGACGTTGTAAAACGACGGGCCGTTATGCTCATTACG-3 SEQIDNo18 ndhB-rps7 gene MF9_R 5-TCCTATTCATGGGGATTCCG-3 SEQIDNo19
(135) TABLE-US-00008 TABLE 4 Results of genotyping with 9 chloroplastic SSRs. The numbers represent the size of the alleles of the amplification fragments as the number of bases MF1 MF2 MF8 MF7 MF9 MF4 MF3 MF5 MF6 B. oleracea CMS 184 190 265 170 328 160 306 218 178 (patent EP 0 549 726) Raphanus sativus 183 193 264 180 319 158 303 218 183 CMS Ogura D. tenuifolia 1 183 190 146 173 327 164 298 218 176 D. tenuifolia 3 183 191 147 173 327 158 312 218 180 CMS D. tenuifolia 1 183 193 264 180 319 158 303 218 183 CMS D. tenuifolia 2 183 193 264 180 319 158 303 218 183
(136) It will be recalled that the chloroplasts of a Diplotaxis tenuifolia plant of the invention originate from Raphanus sativus.
(137) In plants of the Brassica oleracea type carrying Ogura cytoplasmic male sterility, following the fusion of protoplasts to allow the cytoplasmic male sterility of Raphanus sativus to be imported into Brassica oleracea, the chloroplasts are distinguished from those of Raphanus sativus.
(138) The results of Table 4 confirm that the lengths of the amplified fragments are identical for the 2 Diplotaxis tenuifolia lines of the present invention (i.e. CMS, the last two lines of the table), and these lengths are also identical to those of the amplified fragments for the Ogura male sterile Raphanus sativus line. This means that it can be concluded that the chloroplastic genome of male sterile Diplotaxis tenuifolia plants of the present invention does indeed originate from Raphanus sativus (used as the female parent in the intergeneric cross).
(139) The results obtained relating to the chloroplastic genome confirm that the chloroplastic genome of the plants of the invention correspond to the chloroplastic genome of Raphanus sativus and that it is distinguished from the chloroplastic genome of plants such as those described in patent EP 0 549 726.
(140) Furthermore, the chloroplastic genome of the plants of the invention, carrying cytoplasmic male sterility, are also distinguished from that of male fertile plants of the species Diplotaxis tenuifolia.
(141) In order to distinguish between a male sterile Diplotaxis tenuifolia plant of the present invention and a fertile Diplotaxis tenuifolia plant, the following pairs of markers are particularly suitable: the oligo primers MF2_M13F and MF2_R (SEQ ID No 4 and 5 respectively), which can produce a 193 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers MF8_M13F and MF8_R (SEQ ID No 16 and 17 respectively), which can produce a 264 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers MF8_MF7_M13F and MF7_R (SEQ ID No 14 and 15 respectively), which can produce a 180 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers MF9_M13F and MF9_R (SEQ TD No 18 and 19 respectively), which can produce a 319 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers MF3_M13F and MF3_R (SEQ ID No 6 and 7 respectively), which can produce a 303 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers MF6_M13F and MF6_R (SEQ ID No 12 and 13 respectively), which can produce a 183 base pair amplification fragment, characteristic of the chloroplastic genome of Raphanus sativus; the oligo primers 37 and 38 (SEQ ID No 22 and 23 respectively), which can produce a 512 base pair amplification fragment, characteristic of the mitochondrial genome of Raphanus sativus CMS (Ogura); the primers TRNAFM-610U and TRNAFM-987L (SEQ ID No 24 and 25 respectively), which can produce a 401 base pair amplification fragment, characteristic of the mitochondrial genome of Raphanus sativus CMS (Ogura).
BIBLIOGRAPHY
(142) Cao J. and Earle, E. D. Plant Cell Report 21:789-796 (2003). Chu C. C The N-medium and its application to anther culture of Cereal crops Proc. Symp. Plant Tissue culture, Peking 43 (1978). Chu C. C et al Establishment of an efficient medium for anther culture of Rice through comparative experiments on the nitrogen sources, Scienta Sinic, 18, 659 (1975). Flannery M. L. et al. Plastid genome characterization in Brassica and Brassicaceae using a new set of nine SSRs. Theor Appl Genet 113:1221-1231 (2006). Matsuzawa et al. Male sterility in alloplasmic Brassica rapa L. carrying Eruca sativa cytoplasm. Plant Breeding 118, 82-84 (1999). Murashige, T. and Skoog F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant 15, 473 (1962) Rahman, M. H. Optimum age of siliques for rescue of hybrid embryos from crosses between Brassica oleracea, B. rapa and B. carinata. Canadian Journal of Plant Science 84 (4): 965-969 (2004). Woo Bang, S. et al. (2003). Production of Intergeneric Hybrids between the C3-C4 Intermediate Species Diplotaxis tenuifolia (L.) DC. and Raphanus sativus L. Breeding Sciences 53: 231-236