Small molecule conjugates for intracellular delivery of biologically active compounds

09968647 ยท 2018-05-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides novel compounds and conjugates of these compounds useful for the delivery of biologically active substances. Further novel design criteria for chemically stabilized siRNA particular useful when covalently attached to a delivery polymer to achieve in vivo mRNA knock down are disclosed therein.

Claims

1. A conjugate prepared by a process comprising conjugating an oligonucleotide with a compound of formula (III): ##STR00095## wherein the oligonucleotide is a single-stranded antisense oligonucleotide with at least one-naturally occurring nucleic acid nucleotide; and where the non-naturally occurring nucleotide is locked nucleic acid (LNA).

2. The conjugate of claim 1 wherein the oligonucleotide comprises a C-6 aminolinker.

3. A pharmaceutical composition comprising a conjugate according to claim 1.

Description

SHORT DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (Ia) and a delivery polymer in vivo.

(2) FIG. 2 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (Ia) and a delivery polymer in vivo.

(3) FIG. 3 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (Ia) and a delivery polymer in vivo.

(4) FIG. 4 shows Co-Administration of siRNA-conjugates comprising the compounds of formula (I) or (Ia) and a delivery polymer in vivo.

(5) FIG. 5a shows antisense strand mediated gene silencing with fully 2-modified siRNAs. COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-AT. The knockdown activity of the siRNAs was assessed by measuring renilla versus firefly luciferase activity from the reporter construct. siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs.

(6) FIG. 5b shows sense strand mediated gene silencing with fully 2-modified siRNAs. COS7 cells were cotransfected with EGFP-directed siRNAs at 3 nM and psiCHECK2-ST. The knockdown activity of the siRNAs was assessed by measuring luciferase expression from the reporter construct. siRNAs were sorted by knockdown activity of unmodified (2-19-2) reference siRNAs.

(7) FIG. 6a shows reduction of serum FVII activity in non-human primates upon intravenous injection of various 2-modified siRNAs covalently attached to a delivery polymer.

(8) FIG. 6b shows the development of the prothrombin time in non-human primates upon treatment with 2-modified siRNAs covalently conjugated to a delivery polymer.

(9) The invention will be more fully understood by reference to the following examples. They should not, however, be construed as limiting the scope of the invention.

EXAMPLES

Example 1

Step 1: 3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy]-propylamine

(10) ##STR00013##

(11) The title amine was prepared from its nitrile precursor according to a literature protocol [Lollo et al , WO2001/070415].

Step 2: N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy]-propyl}-succinamic acid

(12) ##STR00014##

(13) In a 2 L round-bottomed flask, 3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propan-1-amine (21.15 g, 47.7 mmol, Eq: 1.00) and Huenig's base (12.3 g, 16.6 ml, 95.3 mmol, Eq: 2.00) were combined with AcOEt (845 ml) to give a colorless solution. Dihydrofuran-2,5-dione (4.77 g, 47.7 mmol, Eq: 1.00) in THF (42 ml) was added and the reaction mixture was stirred at ambient temperature overnight=>white suspension. All volatiles were removed i. v., the residue dissolved in CH2Cl2, the organic layer washed with NH4Cl and brine, dried over Na2SO4, and evaporated to dryness. The crude product was dissolved in CH3CN/H2O and lyophilized to yield 29.8 g of the title compound as fluffy powder. MS (ISP): (M-H) 542.5.

Step 3: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-Dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-1-oxohexan-2-ylamino)-3-(4-nitrophenyl)-1-oxopropan-2-yl)succinamide

(14) ##STR00015##

(15) In a 10 mL round-bottomed flask, the above prepared 4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanoic acid (106 mg, 184 ?mol, Eq: 1.00), (S)-2-((S)-2-amino-3-(4-nitrophenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenylmethylamino)hexanamide (132 mg, 184 ?mol, Eq: 1.00), HOAt (25.0 mg, 184 ?mol, Eq: 1.00) and EDC hydrochloride (35.3 mg, 184 ?mol, Eq: 1.00) were mixed together in CH2Cl2 (1.8 ml) to give a yellow solution. Huenig'sBase (47.5 mg, 64.2 ?l, 368 ?mol, Eq: 2.00) was added and the reaction stirred at ambient temperature overnight. TLC indicated the consumption of starting material. All volatiles were removed i. V. and the crude product purified by flash chromatography SiO2/7% MeOH/0.1% NEt3 in CH2Cl2 to produce 128 mg of the title compound as light yellow solid. MS: expected mass: 1240.7552, found mass: 1240.7518.

Step 4

(16) ##STR00016##

(17) In a 10 mL round-bottomed flask, the above prepared N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13 -dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-1-oxohexan-2-ylamino)-3-(4-nitrophenyl)-1-oxopropan-2-yl)succinamide (126 mg, 101 ?mol, Eq: 1.00) and Huenig's base (39.3 mg, 53.2 ?l, 304 ?mol, Eq: 3.00) were combined with CH2Cl2 (1.4 ml) and DMF (1.0 ml) to give a yellow suspension; bis(4-nitrophenyl) carbonate (46.3 mg, 152 ?mol, Eq: 1.50) was added and the reaction allowed to proceed overnight. The mixture was poured onto crashed ice, extracted 2? with AcOEt, washed with H2O, dried over Na2SO4, and evaporated to dryness. After trituration with ?10 ml of diethyl ether, 99 mg of the title product was obtained as an off-white solid. MS: expected mass: 1405.7614, found mass: 1405.7518.

(18) The necessary dipeptide building block for step 3 was prepared as follows:

Step a: (S)-2-[(S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-(4-nitro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid

(19) ##STR00017##

(20) In a 25 mL round-bottomed flask, (S)-2-amino-6-((4-methoxyphenyl)diphenylmethyl-amino)hexanoic acid (Bioconjugate Chem. 2002, 13, 855-869, 968 mg, 2.31 mmol, Eq: 1.00) was dissolved in CH2Cl2 (20 ml) to give a light yellow solution. Huenig's base (897 mg, 1.21 ml, 6.94 mmol, Eq: 3.00) and trimethylchlorosilane (528 mg, 621 ?l, 4.86 mmol, Eq: 2.10) were added and the reaction mixture was stirred for 15 min.

(21) In a second 50 mL round-bottomed flask,(S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(4-nitrophenyl)propanoic acid (1 g, 2.31 mmol, Eq: 1.00) was dissolved in DMF (20 ml) to give a colorless solution. Huenig's base (359 mg, 485 ?l, 2.78 mmol, Eq: 1.20) and TPTU [125700-71-2] (687 mg, 2.31 mmol, Eq: 1.00) were added and the reaction mixture was stirred for 20. The solution from the first flask containing the corresponding silyl ester monosilylamine was added and the reaction was stirred for another 3 hours. The mixture was poured onto crashed ice/NH.sub.4Cl, extracted 2? with AcOEt, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. Flash chromatography SiO2/10% MeOH/0.1% NEt3 in CH2Cl2 afforded 1.38 g of the title compound as brownish foam. MS (ISP): (M+H) 833.5, (M+Na) 855.4.

Step b: [(S)-1-((S)-1-(4-Hydroxymethyl-phenylcarbamoyl)-5-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-pentylcarbamoyl)-2-(4-nitro-phenyl)-ethyl]-carbamic acid 9H-fluoren-9-ylmethyl ester

(22) ##STR00018##

(23) In a 250 mL pear-shaped flask, the above synthesized (S)-2-((S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(4-nitrophenyl)propanamido)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanoic acid (1.38 g, 1.66 mmol, Eq: 1.00), (4-aminophenyl)methanol (204 mg, 1.66 mmol, Eq: 1.00), HOAt (226 mg, 1.66 mmol, Eq: 1.00) and EDC hydrochloride (318 mg, 1.66 mmol, Eq: 1.00) were dissolved in CH2Cl2 (16.6 ml) to give a yellow solution. Huenig's base (428 mg, 579 ?l, 3.31 mmol, Eq: 2.00) was added and the reaction allowed to proceed overnight. The mixture was poured onto crashed ice/NH.sub.4Cl (pH?7), extracted 2? with AcOEt, washed with H.sub.2O, dried over Na.sub.2SO.sub.4, and evaporated to dryness. The crude product was triturated with diethyl ether (1?50 mL); the resultant solid was filtered off and dried to yield 1.214 g of the title compound as light-brown solid. MS (ISP): (M+H) 938.7.

Step c: (S)-2-[(S)-2-Amino-3-(4-nitro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide

(24) ##STR00019##

(25) In a 50 mL round-bottomed flask, the above prepared [(S)-1-((S)-1-(4-hydroxymethyl-phenylcarbamoyl)-5-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-pentylcarbamoyl)-2-(4-nitro-phenyl)-ethyl]-carbamic acid 9H-fluoren-9-ylmethyl ester (1.214 g, 1.29 mmol, Eq: 1.001) was combined with THF (19 ml) to give a brown solution. At 0?, diethylamine (1.77 g, 2.49 ml, 24.2 mmol, Eq: 18.70) was added. The reaction was stirred at ambient temperature for 3h when MS indicated the disappearance of the starting material. All volatiles were evaporated i. V.; ensuing flash chromatography SiO2/0.1% NEt3 in CH2Cl2=>10% MeOH/0.1% NEt3 in CH2Cl2, followed by a second flash chromatography SiO2/5% MeOH/0.1% NEt3 in CH2Cl2 afforded 502 mg of the title compound as light brown foam. MS: expected mass: 715.337, found mass: 715.3362.

Example 2

O-Benzyl-N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-tyrosyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(26) ##STR00020##

(27) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-benzyloxy-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H -fluoren-9-yl)methoxy)carbonylamino)-3-(4-(benzyloxy)phenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1466.8182, found mass: 1466.8136.

Example 3

N-[4-({3-[(3Beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-4-cyano-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(28) ##STR00021##

(29) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-cyano-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(4-cyanophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1385.7716, found mass: 1385.7696.

Example 4

3,4-Dichloro-N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(30) ##STR00022##

(31) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(3,4-dichloro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(3,4-dichlorophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1428.6984, found mass: 1428.695.

Example 5

4-Chloro-N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(32) ##STR00023##

(33) Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-(4-chlorophenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)-carbonylamino)-3-(4-chlorophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1394.7373, found mass: 1394.7342.

Example 6

4-{[(2S)-2-{[(2S)-2-[(4-{[3-({(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl}oxy)propyl]amino}-4-oxobutanoyl)amino]-3-(naphthalen-1-yl)propanoyl]amino}-6-{[(4-methoxyphenyl)(diphenyl)methyl]amino}hexanoyl]amino}benzyl 4-nitrophenyl carbonate (non-preferred name)

(34) ##STR00024##

(35) Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-naphthalen-1-yl-propionylamino)-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(naphthalen-1-yl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1410.792, found mass: 1410.7918.

Example 7

N-[4-({3-[(3Beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-4-fluoro-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(36) ##STR00025##

(37) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(4-fluoro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(4-fluorophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1378.7669, found mass: 1378.7609.

Example 8

N-[4-({3-[(3Beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-2-fluoro-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(38) ##STR00026##

(39) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-Amino-3-(2-fluoro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(2-fluorophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1378.7669, found mass: 1378.7689.

Example 9

N-[4-({3-[(3Beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-3 -fluoro-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(40) ##STR00027##

(41) Was prepared in analogy to Example 1, but using in step 3 (S)-2-[(S)-2-amino-3-(3-fluoro-phenyl)-propionylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)-hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(3-fluorophenyl)propanoic acid as described above in steps a]-c]. MS: expected mass: 1378.7669, found mass: 1378.7659.

Example 10

Step 1: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(4-fluorophenyl)-4-((S)-1-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-1-oxohexan-2-ylamino)-4-oxobutan-2-yl)succinamide

(42) ##STR00028##

(43) In a 10 mL round-bottomed flask, the above prepared 4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanoic acid (109 mg, 188 ?mol, Eq: 1.00), (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide (132 mg, 188 ?mol, Eq: 1.00), HOAt (25.6 mg, 188 ?mol, Eq: 1.00) and EDC hydrochloride (36.1 mg, 188 ?mol, Eq: 1.00) were mixed together in CH2Cl2 (2 ml) to give a yellow solution. Huenig'sBase (48.7 mg, 64.1 ?l, 377 ?mol, Eq: 2.00) was added and the reaction stirred at ambient temperature overnight. TLC indicated the consumption of starting material. All volatiles were removed i. V. and the crude product purified by flash chromatography SiO2/5% MeOH/0.1% NEt3 in CH2Cl2 to yield 197 mg of the title compound as off-white solid. MS: expected mass: 1227.7763, found mass: 1227.7714.

Step2: 4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-4-(4-fluorophenyl)butanamido)-6-((4-methoxyphenyl)diphenylmethylamino)hexanamido)-benzyl 4-nitrophenyl carbonate

(44) ##STR00029##

(45) In a 10 mL round-bottomed flask, the above prepared N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(4-fluorophenyl)-4-((S)-1-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-1-oxohexan-2-ylamino)-4-oxobutan-2-yl)succinamide (196 mg, 160 ?mol, Eq: 1.00) and Huenig's base (61.9 mg, 81.4 ?l, 479 ?mol, Eq: 3.00) were combined with CH2Cl2 (1.6 ml) and DMF (0.8 ml) to give a yellow suspension; bis(4-nitrophenyl) carbonate (72.8 mg, 239 ?mol, Eq: 1.50) was added and the reaction allowed to proceed at ambient temperature overnight. The mixture was poured onto crashed ice/NH4Cl (pH ?6), extracted 2? with AcOEt, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. After trituration with AcOEt/heptane one obtained 123 mg of the title compound as light yellow solid. MS: expected mass: 1392.7825, found mass: 1392.7819.

(46) The necessary dipeptidic building block for step 1 was prepared as follows:

Step a: (S)-2-[(S)-3-(9H-Fluoren-9-ylmethoxycarbonylamino)-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid

(47) ##STR00030##

(48) In a 25 mL round-bottomed flask, (S)-2-amino-6-((4-methoxyphenyl)diphenylmethyl-amino)hexanoic acid (Bioconjugate Chem. 2002, 13, 855-869, 1040 mg, 2.48 mmol, Eq: 1.00) was dissolved in CH2Cl2 (12.5 ml) to give a pale yellow solution. Huenig's base (961 mg, 1.27 ml, 7.44 mmol, Eq: 3.00) and trimethylchlorosilane (566 mg, 621 ?l, 5.21 mmol, Eq: 2.10) were added and the reaction mixture was stirred at ambient temperature for 20 min.

(49) In a second 50 mL round-bottomed flask, (S)-3-(((9H-fluoren-9-yl)methoxy)carbonyl-amino)-4-(4-fluorophenyl)butanoic acid (1040 mg, 2.48 mmol, Eq: 1.00) was dissolved in DMF (12.5 ml) to give a colorless solution. Huenig's base (385 mg, 506 ?l, 2.98 mmol, Eq: 1.20) and TPTU [125700-71-2] (737 mg, 2.48 mmol, Eq: 1.00) were added and the reaction mixture was stirred for 15 min. The solution from the first flask containing the corresponding silyl ester monosilylamine was added and the reaction was stirred for another 3 hours at ambient temperature. The mixture was poured onto crashed ice/NH.sub.4Cl, extracted 2? with AcOEt, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. Flash chromatography SiO2/5% MeOH/0.1% NEt3 in CH2Cl2 afforded 2.10 g of the title compound as yellow foam. MS (ISP): (M+H) 820.6.

Step b: {(S)-2-(4-Fluoro-phenyl)-1-[((S)-1-(4-hydroxymethyl-phenylcarbamoyl)-5-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-pentylcarbamoyl)-methyl]-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester

(50) ##STR00031##

(51) In a 250 mL pear-shaped flask, the above synthesized {(S)-2-(4-fluoro-phenyl)-1-[((S)-1-(4-hydroxymethyl-phenylcarbamoyl)-5-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-pentylcarbamoyl)-methyl]-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester (2.10 g, 2.56 mmol, Eq: 1.00), (4-aminophenyl)methanol (315 mg, 2.55 mmol, Eq: 1.00), HOAt (349 mg, 2.56 mmol, Eq: 1.00) and EDC hydrochloride (491 mg, 2.56 mmol, Eq: 1.00) were dissolved in CH2Cl2 (12.5 ml). Huenig's base (662 mg, 871 ?l, 5.21 mmol, Eq: 2.00) was added and the reaction allowed to proceed overnight. The mixture was poured onto crashed ice/NH.sub.4Cl (pH ?7), extracted 2 x with AcOEt, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. The crude product was triturated with diethyl ether (1?50 ml); the resultant solid was filtered off and dried to yield 0.796 g of the title compound as light-brown solid. MS (ISP): (M+H) 925.6.

Step c: (S)-2-[(S)-3-Amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide

(52) ##STR00032##

(53) In a 50 mL round-bottomed flask, the above prepared {(S)-2-(4-fluoro-phenyl)-1-[((S)-1-(4-hydroxymethyl-phenylcarbamoyl)-5-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-pentylcarbamoyl)-methyl]-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester (793 mg, 857 ?mol, Eq: 1.001) was combined with THF (12 ml) to give a brownish solution. At 0?, diethylamine (1.13 g, 1.59 ml, 15.4 mmol, Eq: 18) was added. The reaction was stirred at ambient temperature overnight. The mixture was poured onto crashed ice/NH.sub.4Cl (pH ?7), extracted 2? with AcOEt, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. Flash chromatography SiO2/10% MeOH/0.1% NEt3 in CH2Cl2 yielded 500 mg of the title compound as off-white solid. MS: expected mass: 702.3581, found mass: 702.3578.

Example 11

4-((S)-2-((S)-3-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-4-phenylbutanamido)-6-((4-methoxyphenyl)diphenylmethylamino)hexanamido)benzyl 4-nitrophenyl carbonate

(54) ##STR00033##

(55) Was prepared in analogy to Example 10, but using in step 1 (S)-2-((S)-3-amino-4-phenylbutanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide as coupling partner. The former was prepared from (S)-3-(((9H-fluoren-9-yl)methoxy)carbonylamino)-4-phenylbutanoic acid as described above in steps a]-c]. MS: expected mass: 1374.792, found mass: 1374.7877.

Example 12

4-({N-2-[(3S)-4-(4-chlorophenyl)-3-{[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]amino}butanoyl]-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-L-lysyl}amino)benzyl 4-nitrophenyl carbonate

(56) ##STR00034##

(57) Was prepared in analogy to example 10, but using in step 1 (S)-2-((S)-3-amino-4-(4-chlorophenyl)butanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)-diphenylmethylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide as coupling partner. The former was prepared from (S)-3-(((9H-fluoren-9-yl)methoxy)carbonylamino)-4-(4-chlorophenyl)-butanoic acid as described above in steps a]-c]. MS (ISP): (M+H) 1409.9.

Example 13

N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-O-methyl-L-tyrosyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(58) ##STR00035##

(59) Was prepared in analogy to Example 1, but using in step 3 (S)-2-((S)-2-amino-3-(4-methoxyphenyl)propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)-diphenylmethylamino)hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. The former was prepared from (S)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-3-(4-methoxyphenyl)propanoic acid as described above in steps a]-c] of example 1. MS (ISP): (M+H) 1391.9.

Example 14

N-[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-D-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-D-lysinamide

(60) ##STR00036##

(61) Was prepared in analogy to example 1, but using in step 3 (R)-2-((R)-2-amino-3-phenyl-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenylmethylamino)-hexanamide instead of (S)-2-((S)-2-amino-3-(4-nitrophenyl)-propanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide as coupling partner. This building block was synthesized from (R)-2-(((9H-fluoren-9-yl)methoxy)carbonylamino)-6-aminohexanoic acid and (R)-2-amino-6-((4-methoxyphenyl)-diphenylmethylamino)hexanoic acid (see Bioconjugate Chem. 2002, 13, 885-869) as described above in steps a]-c]. MS: expected mass: 1360.7763, found mass: 1360.7774.

Example 15

4-({N?2?-[(3S)-3-{[4-({3-[(3Beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]amino}-4-(4-cyanophenyl)butanoyl]-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-L-lysyl}amino)benzyl 4-nitrophenyl carbonate

(62) ##STR00037##

(63) Was prepared in analogy to example 10, but using in step 1 (S)-2-((S)-3-amino-4-(4-cyanophenyl)butanamido)-N-(4-(hydroxymethyl)phenyl)-6-((4-methoxyphenyl)diphenyl-methylamino)hexanamide instead of (S)-2-[(S)-3-amino-4-(4-fluoro-phenyl)-butyrylamino]-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide as coupling partner. The former was prepared from (S)-3-(((9H-fluoren-9-yl)methoxy)carbonylamino)-4-(4-cyanophenyl)butanoic acid as described above in steps a]-c]. MS: expected mass: 1399.7872, found mass: 1399.7857.

Example 16

N-[4-({3-[(3beta)-cholest-5-en-3-yl oxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(64) ##STR00038##

Step 1: (S)-2-((S)-2-Amino-3-phenyl-propionylamino)-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide

(65) ##STR00039##

(66) The building block (S)-2-((S)-2-amino-3-phenyl-propionylamino)-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide was prepared in analogy to the procedure described in Bioconjugate Chem., Vol. 13, No.4, 2002, 855-869 MS (ISP): (M+H) 671.5

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-6-((4-methoxyphenyl)diphenylmethylamino)-1-oxohexan-2-ylamino)-1-oxo-3-phenylpropan-2-yl)succinamide

(67) ##STR00040##

(68) TPTU [125700-71-2](233 mg, 784 ?mol, Eq: 1.00) was added to a solution of N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy]-propyl}-succinamic acid (see example 1, step 2) (426 mg, 0.784 mmol, Eq: 1.00) and Huenig's base (304 mg, 411 ?l, 2.35 mmol, Eq: 3) in DMF (10 ml). After 3 minutes (S)-2-((S)-2-amino-3-phenyl-propionylamino)-6-{[(4-methoxy-phenyl)-diphenyl-methyl]-amino}-hexanoic acid (4-hydroxymethyl-phenyl)-amide (step 1) was added TLC at t=1 h showed the reaction was complete. The solvent was removed under reduced pressure. The remaining residue was taken up in ethyl acetate and extracted with NaHCO.sub.3 half sat. solution (1?), potassium hydrogen phthalate solution 0.05M (2?), water (1?) and brine (1?). The organic extract was dried over MgSO.sub.4 and concentrated under reduced pressure. The crude material was purified by flash chromatography to obtain the titled product (682 mg, 513, ?mol) as a light brown solid. MS (ISP): (M+H) 1196.8

(69) Step 3: H?nig's base (465 mg, 629 ?l, 3.6 mmol, Eq: 6) was added to a solution of the previous alcohol (718 mg, 600 ?mol, Eq: 1.00) and bis(4-nitrophenyl) carbonate (548 mg, 1.8 mmol, Eq: 3) in THF (20 ml). The yellow solution was stirred overnight at room temperature. The solvent was removed under reduced pressure. The remaining residue was triturated with diethyl ether. The solid was collected by filtration, washed with ether and dried under reduced pressure to obtain the title compound (800 mg, 529 ?mol) as a light brown solid. MS (ISP): (M+H) 1361.9

Example 17

Step 1 (S)-2-[(S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-phenyl-propionylamino]-hexanoic acid

(70) ##STR00041##

(71) Commercially available L-Fmoc-Phe-OSu (0.969 g, 2.00 mmol, Eq: 1.00) was suspended in a 1:1 v/v mixture of 1,2-dimethoxyethane and water (17 ml) and treated at 0? C. with L-norleucine (0.275 g, 2.10 mmol, Eq: 1.05) and NaHCO.sub.3 (0.185 g, 2.20 mmol, Eq: 1.10). The cooling bath was removed and the reaction allowed to proceed at ambient temperature for 14 h. The mixture was poured onto crashed ice/citric acid (pH ?3), extracted 2? with ethyl acetate, washed with H2O and brine, dried over Na2SO4, and evaporated to dryness. Flash chromatography SiO2/AcOEt yielded 0.870 mg of the title compound as white solid. MS (ISP): (M+H) 501.2.

Step 2: {(S)-1-[(S)-1-(4-Hydroxymethyl-phenylcarbamoyl)-pentylcarbamoyl]-2-phenyl-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester

(72) ##STR00042##

(73) In a pear-shaped flask, the above synthesized (S)-2-[(S)-2-(9H-fluoren-9-ylmethoxy-carbonylamino)-3-phenyl-propionylamino]-hexanoic acid (10.72 g, 21 mmol, Eq: 1.00), (4-aminophenyl)methanol (2.717 g, 22 mmol, Eq: 1.03), and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) (7.994 g, 32 mmol, Eq: 1.50) were dissolved in CH2Cl2 (320 ml) and stirred overnight under a balloon of Ar. The mixture was poured onto crashed ice/NH.sub.4Cl, extracted 2? with AcOEt, washed with H2O, dried over Na2SO4, and the volume reduced to ?300 ml. The precipitate was filtered off and dried to give 5.25 g of the title compound as light-brown solid. MS (ISP): (M+H) 606.3.

Step 3: (S)-2-((S)-2-Amino-3-phenyl-propionylamino)-hexanoic acid (4-hydroxymethyl-phenyl)-amide

(74) ##STR00043##

(75) In a round-bottomed flask, the above prepared {(S)-1-[(S)-1-(4-hydroxymethyl-phenylcarbamoyl)-pentylcarbamoyl]-2-phenyl-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester (4.738 g, 7.822 mmol, Eq: 1.0) was dissolved in CH.sub.2Cl.sub.2 (28 ml). At 0?, diethylamine (28 ml, 19.80 g, 271 mmol, Eq: 35) was added and the reaction mixture stirred at ambient temperature overnight. All volatiles were evaporated i. V.; ensuing flash chromatography SiO2/CH2Cl2/10% MeOH, followed by crystallization from AcOEt, yielded 2.116 g of the title compound as light brown crystals. MS (ISP): (M+H) 384.2.

Step 4: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-174(R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-1-oxohexan-2-ylamino)-1-oxo-3-phenylpropan-2-yl)succinamide

(76) ##STR00044##
was prepared therewith in analogy to example 16 step 2. MS (ISP): (M+H) 909.7 (M+Na) 931.8.

Step 5: N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-norleucinamide

(77) ##STR00045##

(78) was prepared therewith in analogy to example 16 step 3. MS expected mass: 1073.6453, found mass 1073.642

Example 18

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]glycinamide

(79) ##STR00046##

Step 1: Addition of FMOC-4-Aminobenzylalcohol to the 2-chlorotrityl resin

(80) ##STR00047##

(81) 2-Chlorotrityl chloride resin (Novabiochem 01-64-0114, 100-200 mesh), 1% DVB (18 g, 21.6 mmol, Eq: 1.00) was swollen in DCM/DMF=1/1 (300 mL) for ten minutes. The resin was drained and a solution of FMOC-4-aminobenzyl alcohol (14.9 g, 43.2 mmol, Eq: 2) and pyridine (6.83 g, 6.99 ml, 86.4 mmol, Eq: 4) in DCM/DMF=1/1 (300 mL) was added. The mixture was shaken overnight. The resin was drained and capped with a solution of 10% H?nig's Base in methanol (300 mL). The resin was washed with DNIF and DCM and dried over night with HV to obtain 21.7 g resin. Determination of the load resulted in 0.41 mmoL/g.

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-1-oxopropan-2-yl)succinamide

(82) ##STR00048##

(83) The resin from step 1(1 g, 410 ?mol, Eq: 1.00) was prewashed with DMF (2?) and treated with piperidine/DMF=1/4 (10 mL) for 5 and 10 minutes. The resin was washed alternately with DMF and IPA (3?10 mL). A solution of Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4), TPTU (487 mg, 1.64 mmol, Eq: 4) and Huenig's base (636 mg, 859 ?l, 4.92 mmol, Eq: 12) in DMF (10 mL) was stirred for 5 minutes and then shaken with the resin for one hour. The resin was washed alternately with DNIF and isopropyl alcohol (3?).

(84) The following Fmoc cleavages and subsequent couplings of Fmoc-Ala-OH (511 mg, 1.64 mmol, Eq: 4) and N-{3-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy]-propyl}-succinamic acid (example 1, step 2) (892 mg, 1.64 mmol, Eq: 4) were performed accordingly. The dried peptide resin was stirred for about 2?30 min in TFA 1%/DCM (2?20 mL). The reaction mixture was filtered and the resin was washed with DCM. The filtrates were pooled and the solvents evaporated under vacuum. The crude material was triturated with diethyl ether (2?). After purification by flash chromatography, the product (84 mg, 97.3 ?mol) was obtained as a white solid. MS expected mass: 776.5452, found mass 776.5455

(85) Step 3: The above prepared alcohol N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-1-oxopropan-2-yl)succinamide [RO5545270] (70 mg, 90.1 ?mol, Eq: 1.00) and bis(4-nitrophenyl) carbonate (137 mg, 450 ?mol, Eq: 5) under Argon at room temperature were dissolved in DMF (4 ml) and treated with Huenig's base (34.9 mg, 47.2 ?l, 270 ?mol, Eq: 3). and the mixture was allowed to react overnight. The solvent was removed in vacuo. The resulting solid was triturated with diethylether. The solid was collected by filtration and washed with diethyl ether. The product was dried in vacuo to obtain the title compound (84 mg, 80.2 ?mol) as a light brown solid. MS expected mass:941.5514, found mass 941.5518

Example 19

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-methioninamide

(86) ##STR00049##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(87) ##STR00050##

(88) was prepared in analogy to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-174(R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-4-(methylthio)-1-oxobutan-2-ylamino)-4-methyl-1-oxopentan-2-yl)succinamide

(89) ##STR00051##

(90) was prepared in analogy to example 18, step 2, using Fmoc-Met-OH (609 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids. The product (208 mg, 210 ?mol) was obtained as a light yellow solid. MS (ISP): (M+H) 893.6183

(91) Step 3: was prepared in analogy to example 18, step 3. After purification on silica gel, the title compound (161 mg, 137 ?mol) was obtained as light brown solid. MS expected mass:1057.6174, found mass 1057.6184

Example 20

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N?1?-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-aspartamide

(92) ##STR00052##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(93) ##STR00053##

(94) was performed in analogy to example 18, step 1

Step 2: (S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-4-methylpentanamido)-N1-(4-(hydroxymethyl)phenyl)succinamide

(95) ##STR00054##

(96) Was prepared in analogy to example 18, step 2, using Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids. The product (87 mg, 89.4 ?mol) was obtained as a light yellow solid. MS expected mass:875.6136, found mass 875.6133

Step 3: The titled compound was prepared in analogy to example 18, step 3. After purification on silica gel (87 mg, 89.4 ?mol) the title compound was obtained as light brown solid. MS expected mass:1040.6198, found mass 1040.6188

Example 21

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N?1?-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-aspartamide

(97) ##STR00055##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(98) ##STR00056##

(99) was performed in analogy to example 18, step 1

Step 2: (S)-2-((S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)propanamido)-N1-(4-(hydroxymethyl)phenyl)succinamide

(100) ##STR00057##

(101) Was prepared in analogy to example 18, step 2, using Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) and Fmoc-Ala-OH (511 mg, 1.64 mmol, Eq: 4) as amino acids. The product (140 mg, 159 ?mol) was obtained as light yellow solid. MS (ISP): (M+H) 834.8 (M+Na) 856.7.

(102) Step 3: The title compound was prepared in analogy to example 18, step 3. After purification on silica gel (169 mg, 152 ?mol) it was obtained as light brown solid. MS expected mass:998.5729, found mass 998.5739

Example 22

N?2?-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-asparaginyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]glycinamide

(103) ##STR00058##

Step 1: Addition of FMOC-4-Aminobenzylalcohol to the 2-chlorotrityl resin

(104) ##STR00059##

(105) Was performed in analogy to example 18, step 1

Step 2: (S)-2-(4-(3-((3 S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-N1-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethyl)succinamide

(106) ##STR00060##

(107) Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Asn-OH (581 mg, 1.64 mmol, Eq: 4) as amino acids. The product (140 mg, 162 ?mol) was obtained as white solid. MS expected mass:819.551, found mass 819.5503

(108) Step 3: The title compound was obtained in analogy to example 18, step 3 (176 mg, 161 ?mol) as light brown solid. MS expected mass:984.5572, found mass 984.5489

Example 23

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]glycinamide

(109) ##STR00061##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(110) ##STR00062##

(111) Was performed in analogy to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-1-oxo-3-phenylpropan-2-yl)succinamide

(112) ##STR00063##

(113) Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) as amino acids. The product (259 mg, 288 ?mol) was obtained as white solid. MS expected mass:852.5765, found mass 852.5754

(114) Step 3: The title compound was obtained in analogy to example 18, step 3. (280 mg, 247 ?mol) as light brown solid. MS expected mass:1017.5827, found mass 1017.5775

Example 24

N-[4-({3-[(3beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]glycinamide

(115) ##STR00064##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(116) ##STR00065##

(117) Was performed in analogy to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-(2-(4-(hydroxymethyl)phenylamino)-2-oxoethylamino)-4-methyl-1-oxopentan-2-yl)succinamide

(118) ##STR00066##

(119) Was prepared in analogy to example 18, step 2, using Fmoc-Gly-OH (488 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids. The product (240 mg, 278 ?mol) was obtained as a light yellow solid. MS expected mass:818.5921, found mass 818.5921

(120) Step 3: The title compound was prepared in analogy to example 18, step 3. After purification on silica gel, it (194 mg, 177 ?mol) was obtained as light yellow solid. MS expected mass:983.5983 found mass 983.6004

Example 25

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-phenylalaninamide

(121) ##STR00067##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(122) ##STR00068##

(123) Was performed in analogy to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-174(R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-1-oxo-3-phenylpropan-2-ylamino)-4-methyl-1-oxopentan-2-yl)succinamide

(124) ##STR00069##

(125) Was prepared in analogy to example 18, step 2, using Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) and Fmoc-Leu-OH (580 mg, 1.64 mmol, Eq: 4) as amino acids. The product (153 mg, 151 ?mol) was obtained as light yellow solid. MS expected mass:908.6391 found mass 908.637.

(126) Step 3: The title compound was prepared in analogy to example 18, step 3. After purification on silica gel, it (117 mg, 98 ?mol) was obtained as white solid. MS expected mass:1073.6453 found mass 1073.646

Example 26

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-phenylalaninamide

(127) ##STR00070##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(128) ##STR00071##

(129) Was performed in analogy to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-1-oxo-3-phenylpropan-2-ylamino)-1-oxo-3-phenylpropan-2-yl)succinamide

(130) ##STR00072##

(131) Was prepared in analogy to example 18, step 2, with Fmoc-Phe-OH (635 mg, 1.64 mmol, Eq: 4) as amino acid. The product (240 mg, 204 ?mol) was obtained as light yellow solid. MS expected mass:942.6234 found mass 942.6218

(132) Step 3: The title compound was prepared analogously to example 18, step 3. After purification on silica gel, it (190 mg, 154 ?mol) was obtained as white solid. MS expected mass:1107.6296 found mass 1107.6287

Example 27

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-leucyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-leucinamide

(133) ##STR00073##

Step 1: Addition of FMOC-4-aminobenzylalcohol to the 2-chlorotrityl resin

(134) ##STR00074##

(135) Was performed analogously to example 18, step 1

Step 2: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-4-methyl-1-oxopentan-2-ylamino)-4-methyl-1-oxopentan-2-yl)succinamide

(136) ##STR00075##

(137) Was prepared in analogy to example 18, step 2, with Fmoc-Leu-OH (1.59 g, 4.5 mmol, Eq: 3) as amino acid. The product (254 mg, 284 ?mol) was obtained as white solid. MS expected mass: 874.6547 found mass 874.6527.

(138) Step 3: The title compound was prepared in analogy to example 18, step 3. After purification on silica gel it was obtained as white solid (178 mg, 168 ?mol). MS expected mass:1039.6609 found mass 1039.6588

Example 28

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-alanyl-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-alaninamide

(139) ##STR00076##

Step 1: {(S)-1-[(S)-1-(4-Hydroxymethyl-phenylcarbamoyl)-ethylcarbamoyl]-ethyl}-carbamic acid 9H-fluoren-9-ylmethyl ester

(140) ##STR00077##

(141) A solution of Fmoc-Ala-Ala-OH (1 g, 2.61 mmol, Eq: 1.00) and (4-aminophenyl)methanol (483 mg, 3.92 mmol, Eq: 1.5) in THF (20 ml) was treated with EEDQ (970 mg, 3.92 mmol, Eq: 1.5). The solution was stirred over night at room temperature. The mixture was diluted with 10% 2-propanol/ethyl acetate (100 mL) and the solution was washed with KHSO4 5%/K2SO4 10% (2?), water (1?) and brine (1?), dried over MgSO4 and evaporated in vacuo. The residue was sonicated in diethyl ether for several minutes and the solid was collected by filtration to obtain the product (1.27 g, 1.2 mmol) as light brown solid. MS (ISP): (M+H) 488.3

Step 2: (S)-2-Amino-N-[(5)-1-(4-hydroxymethyl-phenylcarbamoyl)-ethyl]-propionamide

(142) ##STR00078##

(143) The compound was prepared in analogy to example 1 step c to obtain the product (245 mg, 877 ?mol) as light yellow solid. MS (ISP): (M+H) 266.3, (M+Na) 288.2 (2M+H) 531.3

Step 3: N1-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propyl)-N4-((S)-1-((S)-1-(4-(hydroxymethyl)phenylamino)-1-oxopropan-2-ylamino)-1-oxopropan-2-yl)succinamide

(144) ##STR00079##

(145) The compound was prepared in analogy to example 16 step 2 (165 mg, 198 ?mol) as light brown solid. MS expected mass: 790.5608, found mass 790.5587.

(146) Step 4: The title compound was prepared in analogy to example 18, step 3. After purification on silica gel it was obtained as white solid (99 mg, 98.4 ?mol). MS expected mass: 955.567, found mass 955.5651.

Example 29

N-[4-({3-[(3beta)-cholest-5-en-3-yloxy]propyl}amino)-4-oxobutanoyl]-L-isoleucyl-N?1?-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-aspartamide

(147) ##STR00080##

Step 1: (S)-2-[(2S,3S)-2-(9H-Fluoren-9-ylmethoxycarbonylamino)-3-methyl-pentanoylamino]-succinamic acid

(148) ##STR00081##

(149) 2-Chlorotrityl chloride resin (5 g, 7.5 mmol, Eq: 1.00) was swollen in DCM and then treated with a solution of Fmoc-Asn(Trt)-OH (8.95 g, 15.0 mmol, Eq: 2) and Huenig's base (3.88 g, 5.1 ml, 30.0 mmol, Eq: 4) in DCM overnight. The resin was washed with DCM and capped with a solution of 10% Huenig's base in methanol. Coupling of Fmoc-Ile-OH (5.3 g, 15.0 mmol, Eq: 2) with TPTU (4.46 g, 15.0 mmol, Eq: 2) and Huenig's base (3.88 g, 5.1 ml, 30.0 mmol, Eq: 4) according to standard solid phase peptide synthesis. The product was cleaved from the resin with a cocktail of TFA/Water/triisopropylsilane (95/2.5/2.5 v/v/v) for two hours at room temperature. The resin was filtered and the filtrate was concentrated under reduced pressure to a small volume. After trituration with diethyl ether, the product was filtered and dried in vacuum to obtain the product (2.85 g, 5.79 mmol) as white solid. MS expected mass: 467.2056, found mass 467.2056

Step 2: {(1S,2S)-1-[2-Carbamoyl-1-((S)-4-hydroxymethyl-phenylcarbamoyl)-ethylcarbamoyl]-2-methyl-butyl}-carbamic acid 9H-fluoren-9-ylmethyl ester

(150) ##STR00082##

(151) The compound was prepared in analogy to example 28 step 1 (620 mg, 336 ?mol) as light yellow solid.

Step 3: (S)-2-((2S,3S)-2-Amino-3-methyl-pentanoylamino)-N*1*-(4-hydroxymethyl-phenyl)-succinamide

(152) ##STR00083##

(153) The compound was prepared in analogy to example 1 step c (100 mg, 228 ?mol) as light yellow solid.

Step 4: (S)-2-((2S,3S)-2-(4-(3-((3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-((R)-6-methylheptan-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxy)propylamino)-4-oxobutanamido)-3-methylpentanamido)-N1-(4-(hydroxymethyl)phenyl)succinamide

(154) ##STR00084##

(155) The compound was prepared in analogy to example 16 step 2 (89 mg, 91.4 ?mol) as light yellow solid.

(156) Step 5: The compound from the previous step was reacted to the title compound analogously to example 18, step 3. After purification on silica gel, it (42 mg, 36.3 ?mol) was obtained as a light brown solid. MS expected mass: 1040.6198, found mass 1040.6177

Example 30

N-[4-({3-[(3beta)-cholest-5-en-3 -yloxy]propyl}amino)-4-oxobutanoyl]-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-D-lysinamide

(157) ##STR00085##

(158) The compound was prepared in analogy to example 16 step 1, starting with Fmoc-D-Lys(Boc)-OH, (158 mg, 116 ?mol) as light brown solid. MS (ISP): (M+H) 1362.8 (M+Na) 1383.8

Example 31

N-{15-[(3beta)-cholest-5-en-3-yloxy]-4,15-dioxo-8,11-di oxa-5,14-diazapentadecan-1-oyl}-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(159) ##STR00086##

(160) The title compound was prepared analogous to example 16 using a cholesterol-oligo-PEG derivative in step 2 of the synthesis. MS (ISP): (M+H) 1479.8

(161) The necessary cholesterol-PEG intermediate N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-ethoxy}-ethoxy)-ethyl]-succinamic acid for step 2 was prepared as follows:

Step a: {2-[2-(2-Amino-ethoxy)-ethoxy]-ethyl}-carbamic acid (3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester

(162) ##STR00087##

(163) A solution of cholesteryl chloroformate (1 g, 2.23 mmol) in 25 mL dichloromethane was added dropwise under stirring to a solution of 2,2-(ethylenedioxy)bis-(ethylamine) (495 mg, 3.34 mmol) in 75 mL dichloromethane. The reaction was stirred overnight at room temperature. The reaction was diluted with dichloromethane and extracted with water. The organic extract was dried over anhydrous MgSO4 dihydrate, filtered and evaporated. After purification on amino-modified silica gel (eluent: MeCl2.fwdarw.MeCl2/MeOH=975:25 v/v) the product (615 mg) was obtained as a white, waxy solid. MS (ISP): (M+H) 561.5

Step b: N-[2-(2-{2-[(3S,8S,9S,10R,13R,14S,17R)-17-((R)-1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-ethoxy}-ethoxy)-ethyl]-succinamic acid

(164) ##STR00088##

(165) The amine from step a (480 mg, 0.856 mmol) and triethylamine (0.13 mL, 0.94 mmol) were dissolved in 5 mL dichloromethane. After adding succinic anhydride (90 mg, 0.9 mmol) the solution was stirred overnight at room temperature. TLC check showed still some starting material. More succinic anhydride (20 mg, 0.2 mmol) was added. After stirring the reaction for another 3 hours at room temperature, it was diluted with dichloromethane and washed with a 5% KHSO4/10% K2SO4 mixture. The organic extract was dried over anhydrous MgSO4-dihydrate, filtered and evaporated in vacuo to obtain the desired acid (490 mg, 0.667 mmol). MS (ISP): (M+H) 661.5

Example 32

(166) N-{30-[(3beta)-cholest-5-en-3-yloxy]-4,30-dioxo-8,11,14,17,20,23,26-heptaoxa-5,29-diazatriacontan-1-oyl}-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(167) ##STR00089##

(168) The title compound was prepared analogous to example 16 using a cholesterol-PEG derivative in step 2 of the synthesis. MS (ISP): (M+H) 1699.9

(169) The necessary cholesterol-PEG intermediate 1-[(3beta)-cholest-5-en-3-yloxy]-1,27-dioxo-5,8,11,14,17,20,23-heptaoxa-2,26-diazatriacontan-30-oic acid for step 2 was prepared as follows:

Step a: tert-butyl [25-({(3S,8S,9S,10R,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl}oxy)-25-oxo-3,6,9,12,15,18,21-heptaoxa-24-azapentacos-1-yl]carbamate

(170) ##STR00090##

(171) Cholesteryl chloroformate (476 mg, 1.06 mmol) and triethylamine (155 uL, 1.113 mmol) were dissolved in 5 mL dichloromethane. Then a solution of alpha-amino-omega-boc-amino-octa(ethylene glycol) (497 mg, 1.06 mmol) dissolved in 1 mL dichloromethane was added. The solution was stirred over night at room temperature and diluted with dichloromethane and extracted with a KHSO4 5%/K2SO4 10% aqueous mixture. The organic extract was dried over anhydrous MgSO4, filtered and evaporated in vacuo. After purification on silica gel (eluent: MeCl2/MeOH=975:25.fwdarw.95:5 v/v) the product (530 mg, 0.571 mmol) was obtained as a colorless oil. MS (ISP): (M+NH4) 898.7

Step b: 1-[(3beta)-cholest-5-en-3-yloxy]-1,27-dioxo-5,8,11,14,17,20,23-heptaoxa-2,26-diazatriacontan-30-oic acid

(172) ##STR00091##

(173) The previous Boc derivative (450 mg, 0.511 mmol) was dissolved in HCl 4M in dioxane (10.2 mL, 40.9 mmol). The solution was stirred at room temperature for 40 min. The solvent was removed in vacuo and the remaining white solid was dissolved in 5 mL dichloromethane and treated with triethylamine (32 uL, 0.229 mmol) and succinic anhydride (11.5 mg, 0.114 mmol) overnight. More succinic anhydride (11 mg, 0.11 mmol, 0.2 equiv.) was added and after 60 min the reaction was diluted with dichloromethane and washed with KHSO4 5%/K2SO4 10% buffer. The organic extract was dried over MgSO4 anhydrous, filtered and evaporated to obtain 390 mg of the desired product. MS (ISP): (M+H) 881.7

Example 33

N-{66-[(3beta)-cholest-5-en-3-yloxy]-4,66-dioxo-8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59,62-nonadecaoxa-5,65-diazahexahexacontan-1-oyl}-L-phenylalanyl-N?6?-[(4-methoxyphenyl)(diphenyl)methyl]-N-[4-({[(4-nitrophenoxy)carbonyl]oxy}methyl)phenyl]-L-lysinamide

(174) ##STR00092##

(175) The title compound was prepared analogous to example 16 using a cholesterol-PEG derivative in step 2 of the synthesis. MS (ISP): (M+H) 2228.1

(176) The necessary cholesterol-PEG intermediate 1-[(3beta)-cholest-5-en-3-yloxy]-1,63-dioxo-5,8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59-nonadecaoxa-2,62-diazahexahexacontan-66-oic acid for step 2 was prepared as follows:

Step a: (3beta)-cholest-5-en-3-yl (59-amino-3,6,9,12,15,18,21,24,27,30,33,36,39,42,45,48,51,54,57 nonadecaoxanonapentacont-1-yl)carbamate

(177) ##STR00093##

(178) Alpha, omega-bis-amino 20(ethylene glycol) (538 mg, 0.6 mmol) and triethylamine (92 uL, 0.66 mmol) were dissolved in 15 mL dry dichloromethane. A solution of cholesteryl chloroformate (270 mg, 0.6 mmol) in 2 mL dry dichloromethane was added dropwise at room temperature. The solution was stirred overnight, then concentrated in vacuo to a small volume and purified directly on silica gel (eluent: MeCl2/MeOH=95:5.fwdarw.9:4.fwdarw.4:1 v/v) to obtain the product (350 mg, 0.254 mmol) as a waxy solid. MS (ISP): (M+H) 1309.9

Step b: 1-[(3beta)-cholest-5-en-3-yloxy]-1,63-dioxo-5,8,11,14,17,20,23,26,29,32,35,38,41,44,47,50,53,56,59-nonadecaoxa-2,62-diazahexahexacontan-66-oic acid

(179) ##STR00094##

(180) The amine from step a (329 mg, 0.251 mmol), succinic anhydride (26.4 mg, 0.264 mmol) and triethylamine (40 uL, 0.286 mmol) were dissolved in 5 mL dry dichloromethane. After adding more triethylamine (40 uL, 0.286 mmol), the solution (pH>8) was stirred overnight at room temperature. The reaction was diluted with dichloromethane and washed twice with a KHSO.sub.4 5%/K.sub.2SO.sub.4 10% aqueous mixture. The organic extract was dried over anhydrous MgSO.sub.4, filtered and evaporated to obtain the product (260 mg, 0.175 mmol) as a colorless, waxy solid. MS (ISP): (M+NH4) 1408.9

Example 34

General Procedure for the Preparation of RNA Conjugates

(181) Materials

(182) Dimethyl sulfoxide (DMSO), N,N-Dii sopropylethylamine (DIPEA) and sodium acetate solution (3 M, pH 5.2) were purchased from Sigma Aldrich Chemie GmbH (Traufkirchen, Germany).

(183) Triethylammonium acetate (TEAA) (2.0 M, pH 7.0) and Acetonitrile (ACN, HPLC quality) for RP-HPLC were purchased from Biosolve (Valkenswaard, Netherlands).

(184) Ethanol (EtOH, p.a.) was purchased from Merck (Darmstadt, Germany). Purified water from a Optilab HF (Membra Pure, Germany) system was used.

(185) Resource RPC 3 mL column (10?0.64 cm; 15 ?m particle size) was purchased from GE Healthcare (Freiburg, Germany).

(186) HPLC purification was accomplished using an AKTA Explorer 100 system (GE Healthcare).

(187) Synthesis of Amino-Modified RNA

(188) RNA equipped with a hexylaminolinker at the 5-end of the sense strand was produced by standard phosphoramidite chemistry on solid phase at a scale of 1215 ?mol using an ?KTA Oligopilot 100 (GE Healthcare, Freiburg, Germany) and controlled pore glass as solid support (Prime Synthesis, Aston, Pa., USA). RNA containing 2-O-methyl nucleotides were generated employing the corresponding phosphoramidites, 2-O-methyl phosphoramidites and TFA-hexylaminolinker amidite (Sigma-Aldrich, SAFC, Hamburg, Germany). Cleavage and deprotection as well as purification was achieved by methods known in the field (Wincott F., et al, NAR 1995, 23,14, 2677-84).

(189) The amino-modified RNA was characterized by anion exchange HPLC (purity: 96.1%) and identity was confirmed by ESI-MS ([M+H]1+ calculated: 6937.4; [M+H] 1+measured: 6939.0.

(190) TABLE-US-00001 Sequence: 5-(NH2C6)GGAAUCuuAuAuuuGAUCcAsA-3;
u, c: 2-O-methyl nucleotides of corresponding RNA nucleotides, s: phosphorothioate.

(191) General Experimental Conjugation Procedure

(192) The title compounds of examples 1-33 were coupled via the amino-modified RNA according the following procedure:

(193) RNA equipped with a C-6 aminolinker at the 5-end (16.5 mg, 1 equivalent) is dissolved in 500 ?L DMSO and 150 ?L water. The p-Nitrophenylcarbonate derivative (10 equivalents) dissolved in 1 mL DMSO is added followed by 8 ?L DIPEA. The reaction mixture is shaken at 35? C. in the dark and monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV). Once the reaction is gone to completion the RNA conjugate is precipitated using sodium acetate (3 M) in EtOH at ?20? C. For examples lacking a MIVIT protecting group in the dipeptide motif the corresponding conjugates are purified using the conditions described above. Pure fractions are pooled and the material is precipitated using sodium acetate/EtOH to give the desired RNA conjugate.

(194) RNA conjugates containing a MMT protecting group in the dipeptide sequence are further processed according to the procedure given below.

(195) General Procedure for MMT Cleavage

(196) The crude RNA conjugate pellet is dissolved in 500 ?L water and 1.5 mL sodium acetate buffer (3 M, pH 5.2 or 0.1M, pH 4.0). The solution is shaken for 2 days at 30? C. The reaction mixture is monitored using RP-HPLC (Resource RPC 3 mL, buffer: A: 0.1M TEAA in water, B: 0.1M TEAA in 95% ACN, gradient: 3% B to 100% B in 20 CV). After complete cleavage of the MIVIT protecting group the RNA conjugate is directly purified using the conditions just mentioned above. Pure fractions are pooled and the desired conjugate is precipitated using sodium acetate/EtOH.

(197) As a control a RNA conjugate lacking the dipeptide motif was synthesized. For this purpose cholesterol was attached to the 5-end via a linker described in the literature (Nature Biotech, 2007, 25, 1149). This conjugate is referred to as non-cleavable.

(198) All the RNA conjugates were analyzed by RP HPLC for purity and identity was confirmed by ESI MS (negative mode). Briefly, RP-HPLC was performed on a Dionex Ultimate system (Dionex, Idstein, Germany) equipped with a XBridge C.sub.18 column (2.5?50 mm, 2.5 ?m particle size, Waters, Eschborn, Germany) at 65? C. column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and in 95% methanol as eluent B (1% B to 18% B in 30 minutes). UV detection was recorded at 260 nm. For mass spectrometric analysis a ThermoFinnigan LCQ DecaXP ESI-MS system with micro-spray source and ion trap detector was coupled online to the HPLC system.

(199) Examples of specific compounds of formula (IIa) are disclosed in table 1. The resulting compounds are referred to di-peptide containing cholesterol siRNA conjugates, wherein the specific di-peptide containing cholesterol siRNA conjugates are further referred to as Title compound example X-(NHC6)-(siRNA sequence) and siRNA with Title compound of Example X.

(200) siRNA Preparation

(201) TABLE-US-00002 Antisense sequence: 5-uuGGAUcAAAuAuAAGAuUCcscsU-3

(202) u, c: 2-O-methyl nucleotides of corresponding RNA nucleotides, s: phosphorothioate

(203) The di-peptide containing cholesterol siRNA conjugates directed against the apolipoprotein B mRNA were generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heated in a water bath at 80-85? C. for 3 minutes and cooled to room temperature over a period of 3-4 hours. Duplex formation was confirmed by native gel electrophoresis.

(204) All prepared di-peptide containing cholesterol siRNA conjugates are listed in table 2.

(205) TABLE-US-00003 TABLE 1 Di-peptide containing cholesterol siRNA conjugates (5 -3) and analytical data. Title compound Puri- from Mol Mol ty example mass mass (%) No. calc. exp. (RP) 16 (Title compound Ex 16)(NHC6) 7885.7 7887.5 94.4 GGAAUCuuAuAuuuGAUCcASA 31 (Title compound Ex 16)(NHC6) 8003.8 8003.3 97.3 GGAAUCuuAuAuuuGAUCcASA 33 (Title compound Ex 33)(NHC6) 8752.7 8752.4 97.6 GGAAUCuuAuAuuuGAUCcASA 32 (Title compound Ex 32)(NHC6) 8223.1 8226.5 97.3 GGAAUCuuAuAuuuGAUCcASA 17 (Title compound Ex 17)(NHC6) 7870.7 7873.5 90.6 GGAAUCuuAuAuuuGAUCcASA 30 (Title compound Ex 30)(NHC6) 7884.8 7888.8 95.2 GGAAUCuuAuAuuuGAUCcASA 27 (Title compound Ex 27)(NHC6) 7840.0 7840.0 94.8 GGAAUCuuAuAuuuGAUCcASA 28 (Title compound Ex 28)(NHC6) 7755.4 7754.9 93.2 GGAAUCuuAuAuuuGAUCcASA 29 (Title compound Ex 29)(NHC6) 7840.4 7839.9 87.2 GGAAUCuuAuAuuuGAUCcASA 1 (Title compound Ex 1)(NHC6) 7931.1 7935.2 98.2 GGAAUCuuAuAuuuGAUCcASA 2 (Title compound Ex 2)(NHC6) 7992.2 7995.0 96.7 GGAAUCuuAuAuuuGAUCcASA 3 (Title compound Ex 3)(NHC6) 7911.1 7913.8 98.2 GGAAUCuuAuAuuuGAUCcASA 4 (Title compound Ex 4)(NHC6) 7955.1 7958.5 98.0 GGAAUCuuAuAuuuGAUCcASA 5 (Title compound Ex 5)(NHC6) 7920.5 7923.9 97.2 GGAAUCuuAuAuuuGAUCcASA 6 (Title compound Ex 6)(NHC6) 7936.1 7939.6 98.5 GGAAUCuuAuAuuuGAUCcASA 7 (Title compound Ex 7)(NHC6) 7904.2 7905.5 95.1 GGAAUCuuAuAuuuGAUCcASA 8 (Title compound Ex 8)(NHC6) 7904.2 7908.7 98.8 GGAAUCuuAuAuuuGAUCcASA 9 (Title compound Ex 9)(NHC6) 7904.2 7906.7 98.7 GGAAUCuuAuAuuuGAUCcASA 10 (Title compound Ex 10)(NHC6) 7918.2 7921.0 95.4 GGAAUCuuAuAuuuGAUCcASA 11 (Title compound Ex 11)(NHC6) 7902.0 7901.5 98.7 GGAAUCuuAuAuuuGAUCcASA 12 (Title compound Ex 12)(NHC6) 7934.54 7936.5 94.4 GGAAUCuuAuAuuuGAUCcASA 13 (Title compound Ex 13)(NHC6) 7916.09 7917.9 96.5 GGAAUCuuAuAuuuGAUCcASA 14 (Title compound Ex 14)(NHC6) 7886.07 7888.3 94.9 GGAAUCuuAuAuuuGAUCcASA 24 (Title compound Ex 24)(NHC6) 7781.8 7783.4 97.2 GGAAUCuuAuAuuuGAUCcASA 23 (Title compound Ex 23)(NHC6) 7815.8 7817.3 95.2 GGAAUCuuAuAuuuGAUCcASA 22 (Title compound Ex 22)(NHC6) 7781.8 7783.9 90.5 GGAAUCuuAuAuuuGAUCcASA 26 (Title compound Ex 26)(NHC6) 7905.9 7907.0 96.4 GGAAUCuuAuAuuuGAUCcASA 25 (Title compound Ex 25)(NHC6) 7871.9 7873.2 96.1 GGAAUCuuAuAuuuGAUCcASA 20 (Title compound Ex 20)(NHC6) 7840.7 7840.0 95.9 GGAAUCuuAuAuuuGAUCcASA 19 (Title compound Ex 19)(NHC6) 7857.8 7856.6 97.3 GGAAUCuuAuAuuuGAUCcASA 18 (Title compound Ex 18)(NHC6) 7741.6 7741.1 93.9 GGAAUCuuAuAuuuGAUCcASA 21 (Title compound Ex 21)(NHC6) 7798.6 7797.8 87.6 GGAAUCuuAuAuuuGAUCcASA 15 (Title compound Ex 15)(NHC6) 7927.1 7926.8 97.2 GGAAUCuuAuAuuuGAUCcASA Key: lower case letters a, c, g, u, are 2-O-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower case s. (NHC6) is the aminohexyl linker incorporated at the 5-end of the sense strand.

(206) TABLE-US-00004 TABLE 2 Di-peptide containing cholesterol siRNA conjugates. The last entry (SEQ ID NO pair 266/154) represents a siRNA conjugate lacking the di-peptide motif Key: lower case letters a, c, g, u, are 2-O-Methyl nucleotides; A phosphorothioate linkages is symbolized with a lower cases. (NHC6) is the aminohexyl linker incorporated at the 5-end of the sense strand. SEQ ID SEQ ID No Sense sequence (5-3) No Antisense sequence (5-3) (Title compound Ex16)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 31)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 33)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 32)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 17)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 30)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 27)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 28)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 29)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 1)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 2)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 3)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 4)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 5)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 6)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 7)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 8)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 9)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 10)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 11)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 12)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 13)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 14)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 24)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 23)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 22)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 26)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 25)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 20)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 19)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 18)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 21)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA (Title compound Ex 15)(NHC6) 154 uuGGAUcAAAuAuAAGAuUCcscsU GGAAUCuuAuAuuuGAUCcAsA 266 (Chol)GGAAUCuuAuAuuuGAUC 154 uuGGAUcAAAuAuAAGAuUCcscsU cAsA

Example 35

In Vivo Experiments

(207) Co-Administration of Di-Peptide Containing Cholesterol siRNA Conjugates and Delivery Polymer In Vivo.

(208) Six to eight week old mice (strain C57BL/6 or ICR, ?18-20 g each) were obtained from Harlan Sprague Dawley (Indianapolis Ind.). Mice were housed at least 2 days prior to injection. Feeding was performed ad libitum with Harlan Teklad Rodent Diet (Harlan, Madison Wis.).

(209) Mice (n=3 per group) were injected with a mixture of 0.2 mL solution of delivery polymer and 0.2 ml di-peptide containing cholesterol siRNA conjugates. The injected dose was, unless otherwise stated, 15 mg/kg for the delivery polymer and 0.1 mg/kg with respect to the di-peptide containing cholesterol siRNA conjugates. Solutions were injected by infusion into the tail vein. 48 hours post injection serum ApoB levels were measured relative to isotonic glucose treated animals according to the procedure below.

(210) Serum ApoB Levels Determination.

(211) Mice were fasted for 4 h before serum collection by submandibular bleeding. Serum ApoB protein levels were determined by standard sandwich ELISA methods. Briefly, a polyclonal goat anti-mouse ApoB antibody and a rabbit anti-mouse ApoB antibody (Biodesign International) were used as capture and detection antibodies respectively. An HRP-conjugated goat anti-rabbit IgG antibody (Sigma) was applied afterwards to bind the ApoB/antibody complex. Absorbance of tetramethyl-benzidine (TMB, Sigma) colorimetric development was then measured by a Tecan Safire2 (Austria, Europe) microplate reader at 450 nm.

(212) In FIG. 1 various di-peptide containing cholesterol siRNA conjugates were benchmarked against the same siRNA conjugated to cholesterol but lacking the cleavable motif elaborated earlier in this section. The effect of this siRNA conjugate (SEQ ID NO pair 266/154, non-cleavable control) on serum ApoB levels was set to 1 in order to evaluate the influence of the di-peptide containing conjugates relative to the non-cleavable control. Substituting the initially used Phe-Lys motif (siRNA with Title compound of Example 16) with the corresponding D-amino acids (siRNA with Title compound of Example 14) or just replacing the Lys with the unnatural enantiomer (siRNA with Title compound of Example 30) yielded ApoB reduction less pronounced or equivalent to the non-cleavable control siRNA. Replacing Lys by Gly (siRNA with Title compound of Example 23) or Phe by p-Methoxyphenylalanine (siRNA with Title compound of Example 13) reduced the potency compared to siRNA with Title compound of Example 16. Other di-peptide motifs containing siRNA conjugates were shown to be as efficacious as the original Phe-Lys containing conjugate.

(213) FIG. 2 summarizes di-peptide containing cholesterol siRNA conjugates that were as efficacious or had improved efficacy compared to siRNA with Title compound of Example 16 consisting of the Phe-Lys motif All these conjugates were significantly more active compared to the non-cleavable cholesterol siRNA conjugate SEQ ID NO pair 266/154. The best performing di-peptide containing cholesterol siRNA conjugates had a fluorine modified phenyl ring in the Phy-Lys motif (siRNA with Title compound of Example 8, siRNA with Title compound Example 9) or had the phenylalanine substituted with beta-phenylalanine (siRNA with Title compound of Example 11) or a derivative thereof (siRNA with Title compound of Example 10).

(214) Since di-peptide containing cholesterol siRNA conjugates with di-peptide motifs consisting of D-amino acids are performing equal to the non-cleavable control conjugate it is conceivable that the other di-peptide sequences are indeed cleaved by a protease activity in vivo. However, given the broad acceptance of different amino acids and derivatives thereof it is likely that more than one enzyme is participating in the cleavage reaction as suggested in the literature (Bioconjugate Chem. 2002, 13, 855).

(215) As shown in FIG. 3, the incorporation of a Cathepsin cleavable di-peptide motif (in this case Phe-Lys, siRNA with Title compound of Example 16) between the siRNA and the small molecule ligand cholesterol boosts the potency of the siRNA conjugate compared to the straight cholesterol siRNA conjugate (SEQ ID NO pair 266/154). Further spacing of the cholesterol ligand from the di-peptide motif by means of PEG based linkers diminishes the potency proportional to the length of the PEG linker.

(216) In FIG. 4 the polymer dose was kept constant at 15 mg/kg. The siRNA dose was titrated and the effect on serum ApoB content was measured. The Di-peptide containing cholesterol siRNA conjugates containing the Phe-Lys (F-K) motif was significantly more potent compared to the control conjugate lacking the di-peptide sequence.

Example 36

2-Modified Oligoribonucleotide Synthesis

(217) Oligoribonucleotides were synthesized according to the phosphoramidite technology on solid phase. Depending on the scale either an ABI 394 synthesizer (Applied Biosystems) or an AKTA oligopilot 100 (GE Healthcare, Freiburg, Germany) was used. Syntheses were performed on a solid support made of controlled pore glass (CPG, 520 ?, with a loading of 75 ?mol/g, obtained from Prime Synthesis, Aston, Pa., USA). All 2-modified RNA phosphoramidites as well as ancillary reagents were purchased from SAFC (Hamburg, Germany). Specifically, the following 2-O-Methyl phosphoramidites were used: (5-O-dimethoxytrityl-N.sup.6-(benzoyl)-2-O-methyl-adenosine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, 5-O-dimethoxytrityl-N.sup.4-(acetyl)-2-O-methyl-cytidine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, (5-O-dimethoxytrityl-N.sup.2-(isobutyryl)-2-O-methyl-guanosine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite, and 5-O-dimethoxytrityl-2-O-methyl-uridine-3-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite. The 2-Deoxy-2-fluoro-phosphoramidites carried the same protecting groups as the 2-O-methyl RNA amidites. All amidites were dissolved in anhydrous acetonitrile (100 mM) and molecular sieves (3 ?) were added. To generate the 5-phosphate the 2-[2-(4,4-Dimethoxytrityloxy)ethylsulfonyl]ethyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite from Glen Research (Sterling, Va., USA) was used In order to introduce the C-6 aminolinker at the 5-end of the oligomers the 6-(Trifluoroacetylamino)-hexyl-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite from Thermo Fisher Scientific (Milwaukee, Wis., USA) was employed. The 5-modifications were introduced without any modification of the synthesis cycle. 5-Ethyl thiotetrazole (ETT, 500 mM in acetonitrile) was used as activator solution. Coupling times were 6 minutes. In order to introduce phosphorothioate linkages a 50 mM solution of 3-((Dimethylamino-methylidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT, obtained from AM Chemicals, Oceanside, Calif., USA) in anhydrous Acetonitrile/pyridine (1:1 v/v) was employed.

Example 37

Cleavage and Deprotection of Support Bound Oligomer.

(218) After finalization of the solid phase synthesis, the dried solid support was transferred to a 15 mL tube and treated with concentrated aqueous ammonia (Aldrich) for 18 hours at 40? C. After centrifugation the supernatant was transferred to a new tube and the CPG was washed with aqueous ammonia. The combined solutions were evaporated and the solid residue was reconstituted in buffer A (see below).

Example 38

Purification of Oligoribonucleotides

(219) Crude oligomers were purified by anionic exchange HPLC using a column packed with Source Q15 (GE Healthcare) and an AKTA Explorer system (GE Healthcare). Buffer A was 10 mM sodium perchlorate, 20 mM Tris, 1 mM EDTA, pH 7.4 (Fluka, Buchs, Switzerland) and contained 20% Acetonitrile and buffer B was the same as buffer A with the exception of 500 mM sodium perchlorate. A gradient of 22% B to 42% B within 32 column volumes (CV) was employed. UV traces at 280 nm were recorded Appropriate fractions were pooled and precipitated with 3M NaOAc, pH=5.2 and 70% Ethanol. Finally, the pellet was washed with 70% Ethanol.

Example 39

Annealing of Oligoribonucleotides to Generate siRNA

(220) Complementary strands were mixed by combining equimolar RNA solutions. The mixture was lyophilized and reconstituted with an appropriate volume of annealing buffer (100 mM NaCl, 20 mM sodium phosphate, pH 6.8) to achieve the desired concentration. This solution was placed into a water bath at 95? C. which was cooled to rt (room temperature) within 3 h.

Example 40

In Vitro Activity of siRNAs Devoid of 2-OH Residues

(221) In order to investigate if siRNAs lacking any 2-OH residues show potent in vitro knock down activity, we tested a panel of EGFP mRNA-targeted siRNAs with different 2-modification chemistries (SEQ ID pairs 31/32 to 149/150, and see Table 3 for examples). The siRNAs were screened for sense and antisense activity with the Dual-Glo? Luciferase Assay System (Promega) using the psiCHECK2 vector (Promega) in COS7 cells (DSMZ, Braunschweig, Germany, cat. No. ACC-60). To address the silencing activity conferred by sense and antisense strand we cloned each corresponding 19 mer target site sequence as separate psiCHECK2 construct (psiCHECK2-AT for anti sense activity, psiCHECK2-ST for sense activity) into the multiple cloning region located 3 to the translational stop codon of the synthetic Renilla luciferase. By using Lipofectamine 2000 (Invitrogen GmbH, Karlsruhe, Germany, cat. No. 11668-019) COS7 cells were co-transfected with vector construct and 3 nM of the corresponding siRNA complementary to the cloned target site. Successful siRNA-mediated silencing was determined 24 hours after transfection via the activity of the renilla luciferase normalized to firefly luciferase levels to take transfection efficiency into account (see FIG. 5a for antisense activity and FIG. 5b for sense activity).

(222) TABLE-US-00005 TABLE3 ExemplarysiRNAsequencesandchemical modificationsusedfordeterminationofinvitro knockdownactivitydependenton2- modifications.Referenceduplicesandselected examplesofcorrespondingmodification variantsusedinthisstudy.Xfindicatesa 2-fluoromodificationofthenucleotideX, smalllettersindicatea2-O-methyl modification,underlinedlettersindicate aDNAnucleotide,allothercapitalletters indicateribonucleotides.Theletterp indicates a5-phosphate. RNA duplices unmod 5-UGCCCAUCCUGGUCGAGCUTT-3 3-TTACGGGUAGGACCAGCUCGAp-5 F/OMe 5-UfgCfcCfaUfcCfuGfgUfcGfaGfcUfTsT-3 3-TsTaCfgGfgUfaGfgAfcCfaGfcUfcGfap-5 F/DNA 5-UfGCfCCfAUfCCfUGfGUfCGfAGfCUfTsT-3 3-TsTACfGGfGUfAGfGAfCCfAGfCUfCGfAp-5 DNA/OMe 5-UgCcCaUcCuGgUcGaGcUTsT-3 3-TsTaCgGgUaGgAcCaGcUcGap-5

(223) It was found that the 5 most potent modified siRNAs (?60% knock-down) were designed in an alternating 2-fluoro/2-O-methyls (2F/2-OMe) pattern. While conferring antisense activity, this chemistry fully eliminated the activity of the corresponding sense strands, as shown by lack or minimal renilla luciferase activity for all tested 2F/2-OMe variants.

(224) We concluded that such 2F/2-OMe pattern is promoting the siRNA's intended antisense strand activity while undesired off-target effects coming from the sense strand are fully suppressed. This design is specifically preferable for siRNAs, that come with the need for protection against 2O-directed nucleolytic cleavage.

Example 41

Detection of DNAse II-Sensitive Sites by In Vitro Assay

(225) An ion pairing (IP) reversed phase (RP) high performance liquid chromatography (HPLC) coupled to an electrospray ionization (ESI) mass spectrometry (MS) or an anion exchange (AEX)-HPLC based method was established to test the in vitro stability of selected single and double stranded RNAs.

(226) Method description: For stability analysis a 10 ?M solution of either single stranded or double stranded RNA was incubated at 37? C. in 5 mM sodium acetate buffer solution (pH 4.5) containing 0.8 or 8 units DNase II (from bovine spleen, Type V, Sigma Aldrich). The incubation reaction was stopped by adding a 100 mM triethyl ammonium acetate (TEAA) solution, shifting the pH to 7 and inactivating the DNase II enzyme. Analysis was done by either LC/MS combined with UV-detection or by AEX-HPLC with UV-detection. UV-detection traces at 260 nm were used for quantitative analysis, MS data served for cleavage site identification within the RNA sequence.

(227) A. IP-RP-HPLC was done employing a Waters XBridge C.sub.18 column (2.5?50 mm, 2.5 ?m particle size) at 65? C. column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.

(228) B. AEX-HPLC was performed on a Dionex DNA Pac200 column (4?250 mm) at 50? C. using a 20 mM phosphate buffer containing 10% ACN at pH=11. Eluent B contained 1 M NaBr in eluent A. A gradient from 25 to 62% B in 18 minutes was employed.

(229) TABLE-US-00006 TABLE4 DuplexesandtheremainingintactstrandsevaluatedfortheirstabilityagainstDNase II.Key:lowercaselettersa,c,g,u,are2-O-Methylnucleotides;Uppercaseletters A,C,G,Ufollowedbyf indicatesa2-fluoronucleotide.Lowercasep indicatesa 5-phosphate.(invdT)representsaninverteddeoxythimidine(3-3-linked).A phosphorothioatelinkagesissymbolizedwithalowercases.dTis deoxythimidine.(NHC6)istheaminohexyllinkerincorporatedatthe5-end ofthesensestrand. %Intact SEQ strand SEQ %Intact ID after6 ID strandafter NO Sensestrandsequence(5-3) hours NO Antisensestrandsequence(5-3) 6hours 157 GGAuGAAGuGGAGAuuAGud 0 158 ACuAAUCUCcACUUcAUCCd 0.1 TsdT TsdT 160 (NH2C6)GfgAfuGfaAfgUfgGfa 101 159 pasCfuAfaUfcUfcCfaCfuUfcAf 97 GfaUfuAfgUf(invdT) uCfc(invdT) 165 (NH2C6)GfcAfaAfgGfcGfuGfc 103 166 puGfaGfuUfgGfcAfcGfcCfuUfu 103 CfaAfcUfcAf(invdT) Gfc(invdT) 167 (NH2C6)GcAAAGGcGuGccAA 56 168 UGAGUUGGcACGCCUUUGC 49 cucAdTsdT dTsdT 169 (NH2C6)GGAUfCfAUfCfUfCf 64 170 GUfAAGACfUfUfGAGAUfGA 54 AAGUfCfUfUfACfdTsdT UfCfCfdTsdT 153 GGAAUCuuAuAuuuGAUCcAsA 0.1 154 uuGGAUcAAAuAuAAGAuUC 0.1 cscsU 173 (NH2C6)UfgAfcCfaCfaGfuCfg 102 174 pusUfuAfaUfcCfgAfcUfgUfgGf 102 GfaUfuAfaAf(invdT) uCfa(invdT) 175 (NH2C6)uGAccAcAGucGGAu 0.4 176 puUuAAUCCGACUGUGGucA 0.3 uAAAdTsdT dTsdT 175 (NH2C6)uGAccAcAGucGGAu 6 177 UUuAAUCCGACUGUGGUcA 3 uAAAdTsdT dTsdT

CONCLUSIONS

(230) A. RNA strands containing at least one 2-OH nucleotide (e.g. both strands of SEQ ID NO pair 157/158) are rapidly degraded via a cyclic pentavalent intermediate, leading to 2-3 cyclic phosphates at the 5-cleavage product. The formation of the pentavalent intermediate can be inhibited using nucleotides lacking a 2-OH group, like e.g. 2-deoxy, 2-OMe or 2-F.

(231) B. Additionally, RNA is degraded via a 5-exonucleolytic pathway, that is independent from the 2-modification on the 5-terminal nucleotides. This degradation pathway can be inhibited using 5-terminal non-nucleotide moieties, like e.g. a C6-aminolinker (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159 or SEQ ID NO 165 in SEQ ID NO pair 165/166) or a phosphorothioate at the first internucleotide linkage (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159).

(232) C. A 5-phosphate group slows down the exonucleolytic cleavage kinetics, but cannot fully block the degradation starting at this end (e.g. SEQ ID NO 160 in SEQ ID NO pair 160/159). This is most probably due to the cleavage of the 5-phosphate by either phosphatases or by an inherent phosphatase activity of the DNase II enzyme.

(233) D. The best protection for RNA strands was achieved with oligonucleotides containing no 2-OH nucleotide within the strand, starting with a 2-OMe nucleotide at the 5-end connected by a phosphorothioate linkage to the second nucleotide (e.g. SEQ ID NO 173 in SEQ ID NO pair 173/174). Other terminal non-2-OH nucleotides also protect against the 5-exo degradation, but to a lower extent compared to the 2-OMe modification (refer to Table 9)

Example 42

In Vivo Knock Down Activity of siRNAs Devoid of 2-OH Residues

(234) In vivo experiments were conducted with mice injected with Factor VII (FVII)-targeting siRNAs (SEQ ID NO pairs 179/166 and 180/168, see Table 5) co-administered with DPC-GalNac.

(235) TABLE-US-00007 TABLE5a SequencesofsiRNAsforinvivoexperiment.Key:lowercase lettersa,c,g,u,are2-O-Methylnucleotides;Uppercase lettersA,C,G,Ufollowedbyf indicatesa2-fluoro nucleotide.Lowercasep indicatesa5-phosphate. (invdT)representsaninverteddeoxythimidine(3-3-linked). Aphosphorothioatelinkagesissymbolizedwithalowercase s.dTisdeoxythimidine.(NHC6)istheaminohexyllinker incorporatedatthe5-endofthesensestrand.GalNAc referstothestructureinformula(IV). SEQID SEQID NOpair NOs Sequence5->3 179/166 179 GalNAc-(NHC6)-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 180/168 180 GalNAc-(NHC6)-GcAAAGGcGuGccAAcucAdTsdT 168 UGAGUUGGcACGCCUUUGCdTsdT

(236) A FVII siRNA with an alternating 2-OMe/2-F pattern on sense and antisense strand was generated with a 5-terminal 2-OMe nucleotide on the antisense and a 5-terminal 2-F strand on the sense strand. Both strands are protected by an inv(dT) at the 3-terminal overhang. The antisense strand was bearing a 5-phosphate group to maintain activity of the siRNA. The sense strand was conjugated to a GalNAc-palmitoyl construct at its 5end for targeting to hepatocytes by the asialyloglycoprotein-receptor. siRNA (2.5 mg/kg) was co-administered with GalNAc-targeted PBAVE (15 mg/kg) in mice.

(237) FVII mRNA measurements were done from liver homogenates using QuantiGene 1.0 branched DNA (bDNA) Assay Kit (Panomics, Fremont, Calif, USA, Cat-No: QG0004).

(238) At necropsy 1-2 g liver tissue was snap frozen in liquid nitrogen. Frozen tissue was powderized with mortar and pistil on dry ice. 15-25 mg of tissue was transferred to a chilled 1.5 mL reaction tube, 1 mL 1:3 Lysis Mixture prediluted in MilliQ water and 3.3 ?L Proteinase K(50 ?g/?L) was added and tissue was lysed by several seconds ultrasound sonication at 30-50% power (HD2070, Bandelin, Berlin, Germany). Lysates were stored at ?80? C. until analysis. For mRNA analysis lysate was thawed and digested with Proteinase K for 15 min at 1000 rpm in a thermomixer at 65? C. (Thermomixer comfort, Eppendorf, Hamburg, Germany). FVII and GAPDH mRNA levels were determined using QuantiGene 1.0 bDNA Assay Kit reagents according to the manufacturer's recommendations. FVII mRNA expression was analyzed using 20 ?L lysate and a mouse FVII probe set. GAPDH mRNA expression was analyzed using 40 ?L lysate and rattus norwegicus probe sets shown to be cross-react with mice (sequences of probe sets see above). As assay readout the chemiluminescence signal at end of the assay was measured in a Victor 2 Light luminescence counter (Perkin Elmer, Wiesbaden, Germany) as relative light units (RLU). The signal for FVII mRNA was divided by signal for GAPDH mRNA from the same lysate Values are reported as FVII mRNA expression normalized to GAPDH.

(239) Results demonstrate a 79% FVII mRNA knock down at 48 hours post dosing after administration of SEQ ID NO pair 179/166. In contrast, the 2-OH nucleotide bearing siRNA SEQ ID NO pair 180/168 showed no significant knock down (<25%), as shown in Table 5.

(240) TABLE-US-00008 TABLE 5b Results of in vivo knockdown studies Time SEQ ID NO pair 179/166 SEQ ID NO pair 180/168 [hour] Remaining mRNA [%] Remaining mRNA [%] 1 84 92 6 83 88 24 53 100 48 21 76

Example 43

Tissue Distribution of siRNAs Devoid of 2-OH Residues

(241) The siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-OO-GCAAAGGCGTGCCAACT, obtained from Panagene Inc, Korea) complementary to the antisense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 ?L and for tissue ?1 mg aliquots were injected onto the HPLC system.

(242) Liver tissue analysis of the stabilized siRNA lacking 2-OH nucleotide showed high concentrations of intact antisense strand in the liver in the ug/g range, but ?95% was present in the 5-dephosphorylated inactive form (see table IR.04). The resulting RNA with a terminal 2-OMe nucleotide is not prone for rephosphorylation in the cytoplasm by the phosphokinase hClp1 (see below). In contrast, the antisense strand of the 2-OH containing siRNA was completely degraded in the tissue within the first 6 hours post dosing.

(243) TABLE-US-00009 TABLE 6 Liver tissue analysis of the stabilized siRNA containing no 2-OH nucleotide SEQ ID NO pair 181/186 in SEQ ID NO pair 181/185 in Time Liver [ng/g] Liver [ng/g] [hour] ?5-Phosphat +5-Phosphat ?5-Phosphat +5-Phosphat 1 873 171 9 BDL 6 1351 106 BDL* BDL 24 1043 65 BDL BDL 48 1062 66 BDL BDL *BDL = below detection limit

Example 44

In Vitro Knock Down Activity of siRNAs with Optimized 5-Ends

(244) An additional in vitro screen for FVII siRNAs was conducted in order to identify siRNAs that may be intracellularly (re-)phosporylated at the antisense's 5-end to result in the RNAi-competent species All siRNAs from this screen are shown in Table 7. The alternating 2-OMe/2-F modification pattern was identical to the 1.sup.st generation design (without any 2-OH residues) with exception of various modifications at the first two nucleotides at the 5-end of the antisense strand. The two 5-terminal nucleotides of the antisense strand were generated as 2-F or 2-deoxy modified nucleotides in various combinations with and without an additional 5-phosphate or 5-phosphothioate. All siRNAs were screened in dose response (24 nM to 0.00037 nM in 4fold dilutions) for knock down activity after transfection of primary mouse hepatocytes (30000 cells per well; 96 well plate format) using Lipofectamine 2000 according to the manufacturer's instructions. Two siRNAs were comparable active to the parental duplex (SEQ ID NO pair 182/168); comparable active siRNAs: SEQ ID NO pairs 181/186 and 181/185) in terms of IC.sub.50 values, one with a 5-terminal 2-F and a phosphate group and one with two 5-terminal 2-deoxy nucleotides and a 5-phosphorothioate (see Table 7 for IC50 values). Both of them are ?5-6-fold more active compared to the siRNA (SEQ ID NO pair 181/166) used in the first animal experiment with the terminal 2-OMe nucleotide.

(245) TABLE-US-00010 TABLE7 IC50values SEQ SEQ ID ID IC50 NO Sensestrandsequence(5-3) NO Sensestrandsequence(5-3) (nM) 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.17 182 GcAAAGGcGuGccAAcucAdTsdT 168 UGAGUUGGcACGCCUUUGCdTsdT 0.228 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 189 psdTdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.228 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 187 psdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.554 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 188 pdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.631 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 189 pdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.702 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0.749 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 1.002 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 191 psUfGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 1.185 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 2.257 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 193 psUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 2.428 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 194 psdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT 3.208 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 195 usGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 3.974 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 196 uGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 4.235 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 197 dTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 4.235 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 198 psdTGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 4.704 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 5.341 183 (Chol)GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invd 190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 9.771

Example 45

In Vitro 5-Phosphorylation of siRNAs with Optimized 5-Termini

(246) All siRNAs without a 5-phosphate or 5-phosphorothioate listed in Table 7 were assessed for phosphorylation by hClp1 in a HeLa S100 cell extract.

(247) 5-phosphorylation s was analyzed from S100 HeLa extracts as described by Weitzer and Martinez (S. Weitzer and J. Martinez. hClp1: a novel kinase revitalizes RNA metabolism. Cell Cycle 6 (17):2133-2137, 2007). Directly after incubation of 1 ?M siRNAs in the S100 HeLa extract containing 5 mM ATP, the solution was analyzed by either IP-RP-HPLC or AEX-HPLC under denaturing conditions by injection of 5 ?L sample solution:

(248) A. IP-RP-HPLC was done employing a Waters XBridge C.sub.18 column (2.5?50 mm, 2.5 ?m particle size) at 65? C. column temperature. Gradient elution was performed using 100 mM hexafluoroisopropanol (HFIP) and 16 mM triethylamine in 1% methanol as eluent A and composition A in 95% methanol as eluent B. A gradient from 1% B to 18% B in 30 minutes was employed.

(249) B. AEX-HPLC was performed on a Dionex DNA Pac200 column (4?250 mm) at 50? C. using a 20 mM phosphate buffer containing 10% ACN at pH=11. Eluent B contained 1 M NaBr in eluent A. A gradient from 25 to 62% B in 18 minutes was employed.

(250) The ratio of 5-phosphorylation is calculated for each strand of a siRNA from the UV trace at 260 nm using the following equitation (PA is peak area):
%.sub.(5-phophorylation)=100*PA.sub.[5-phosphorylated strand]/(PA.sub.[5-phosphorylated strand]+PA.sub.[parent strand])

(251) In Table 8 is shown, that the antisense strand of an siRNA cannot be 5-phosphorylated, when a 2-OMe nucleotide is located at the 5-terminus (SEQ ID NO pair 181/196 and SEQ ID NO pair 181/195). In contrast the antisense strand is susceptible to 5-phosphorylation, when a 2-F, 2-deoxy or 2-OH nucleotide is incorporated at the 5-terminus (SEQ ID NO pair 181/195, SEQ ID NO pair 181/192, SEQ ID NO pair 181/197, SEQ ID NO pair 181/199 and SEQ ID NO pair 182/168). The two siRNAs, that were comparably active in the in vitro assay as the parental SEQ ID NO pair 182/168 (SEQ ID NO pair 181/186 and 181/185), are susceptible to 5-phosphorylation once the synthetically introduced 5-phosphate/5-PTO group is cleaved in vivo, e.g. by phosphatases.

(252) TABLE-US-00011 TABLE8 Percentageof5-phosphorylatedstrandafter 4hoursincubationinS100HeLacellextract.Key: lowercaselettersa,c,g,u,are2-O-Methyl nucleotides;UppercaselettersA,C,G,U followedbyf indicatesa2-fluoronucleotide. (invdT)representsaninverteddeoxythimidine (3-3-linked).Aphosphorothioatelinkage issymbolizedwithalowercases.dT isdeoxythimidine. SEQ ID sense5P NO Sensestrandsequence(5-3) [%] 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 52 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 53 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 44 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 42 181 GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 47 182 GcAAAGGcGuGccAAcucAdTsdT 31 184 GfcAfaAfgGfcGfuGfcCfaAfcUfcA 22 SEQ ID antisense NO Antisensestrandsequence(5-3) 5P[%] 196 uGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0 195 usGfaGfuUfgGfcAfcGfcCfnUfuGfc(invdT) 0 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 22 197 dTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 22 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 13 168 UGAGUUGGcACGCCUUUGCdTsdT 42 168 UGAGUUGGcACGCCUUUGCdTsdT 100

Example 46

In Vitro DNAse II-Stability of siRNAs with Optimized 5 Ends

(253) All antisense strands were screened for DNAse II stability as described in example 41. The two antisense strands present in the siRNAs that were comparable active to the parental duplex (SEQ ID NO 186 and SEQ ID NO pair 185 one with a 5-terminal 2-F and a phosphate group and one with two 5-terminal 2-deoxy nucleotides and a 5-phosphorthioate are stable towards DNAse II cleavage II (>70% intact strand after 20 hr incubation).

(254) TABLE-US-00012 TABLE9 InvitrostabilityofsiRNAstowardsDNaseIIafter20hoursincubation Sense Antisense SEQID SEQID NO NO Sequence(5-3) %intactstrand 181 192 UfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 11 181 197 dTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0 181 199 dTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 0 181 193 psUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 106 181 187 psdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 96 181 194 psdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 101 181 191 psUfGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 100 181 198 psdTGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 95 181 186 psdTdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 99 181 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 71 181 189 pdTsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 74 181 188 pdTsdGaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 64

Example 47

In Vivo Knock Down Activity of siRNAs with Optimized 5 Ends

(255) In order to evaluate if the in vitro improvement by optimized 5-ends transfers to the in vivo situation, we conducted further mouse experiments with GalNAc-palmitoyl conjugates of selected siRNAs (see Table 10). SiRNAs were administered as under identical conditions as described for the first mouse experiment (example 42, this patent application).

(256) For measurement of FVII levels, plasma samples from mice were prepared by collecting blood (9 volumes) by submandibular bleeding into microcentrifuge tubes containing 0.109 mol/L sodium citrate anticoagulant (1 volume) following standard procedures. FVII activity in plasma was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, Ohio) following manufacturer's recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.

(257) The siRNAs under investigation showed improved in vivo activity, fully correlating with the in vitro screening results. FVII activity in serum was reduced by more than 80% for both siRNAs 48 hours post dosing, compared to 49% using the first generation DNase II stable siRNA design (see Table 10). This result clearly underscores the importance of a 5-terminal nucleotide on the antisense strand that can be effectively phosphorylated, in case phosphatases in vivo cleave the synthetically generated 5-phosphate or 5-phosphothioate group. In case of a 5-terminal 2-OMe nucleotide as used in the first design or described in the literature as a more potent siRNA design based on in vitro comparison with canonical siRNAs. (Allerson et al. J. Med Chem. 2005, 48, 901-904), the cleavage of the synthetic phosphate in vivo would lead to a strong reduction in potency of the corresponding siRNA.

(258) TABLE-US-00013 TABLE10 InvivoknockdownactivityofsiRNAswithoptimized5ends.Key:lowercaseletters a,c,g,u,are2-O-Methylnucleotides;UppercaselettersA,C,G,Ufollowedby f indicatesa2-fluoronucleotide.Lowercasep indicatesa 5-phosphate.(invdT)representsaninverteddeoxythimidine(3-3-linked). Aphosphorothioatelinkageissymbolizedwithalowercases.(NHC6)isthe aminohexyllinkerincorporatedatthe5-endofthesensestrand.GalNAcrefers tothestructureinformula(IV). % SEQ SEQ remaining ID ID FVIIin NO Sensestrandsequence(5-3) NO Antisensestrandsequence(5-3) serum 179 GalNAc-(NH2C6)- 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 27 GfcAfaAfgGfcGfuGfcCfaAfcU fcAf(invdT) 179 GalNAc-(NH2C6)- 190 pusGfaGfuUfgGfcAfcGfcCfnUfuGfc(invdT) 51 GfcAfaAfgGfcGfuGfcCfaAfcU fcAf(invdT) 179 GalNAc-(NH2C6)- 185 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 17 GfcAfaAfgGfcGfuGfcCfaAfcU fcAf(invdT) 179 GalNAc-(NH2C6)- 186 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 13 GfcAfaAfgGfcGfuGfcCfaAfcU fcAf(invdT)

Example 48

In Vitro Knock Down Activity of siRNAs with Optimized 3 Ends

(259) To further increase activity of the DNase II stable siRNAs an SAR study of the 3-overhang was performed. Various combinations of invdT, dTinvdT or dTsdT on either the sense or the anti sense strand 3-overhang were applied to Aha1- and EGFP-targeting siRNAs (see Tables 11 and 12, respectively) and were pairwise compared for composition of both 3ends in most potent siRNAs. All siRNAs were screened in dose response (24 nM to 0.00037 nM in 4-fold dilutions) for knock down activity after transfection of primary mouse hepatocytes (30000 cells/well; 96 well plate format) using Lipofectamine2000 according to the manufacturer's instructions.

(260) TABLE-US-00014 TABLE11 InvitroknockdownactivityofEGFP-targetingsiRNAswithdifferent3-ends. SEQ SEQ IDNO Sensestrandsequence(5-3) IDNO Antisensestrandsequence(5-3) IC50(nM 45 GCUGGAGUUCGUGACCGCCdTdT 46 GGCGGUCACGAACUCCAGCdTdT 1,0490 212 GcuGGAGuucGuGAccGccdTsdT 225 GGCGGUcACGAACUCcAGCdTsdT #N/A 201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 221 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0.4377 201 gcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.1479 211 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 223 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0.5833 203 gcUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 214 dGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.2166 204 GfcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 224 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0.9100 204 GfcUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 215 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.2241 207 GfcUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 218 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0.3474 206 GfcUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 215 pGfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.2392 205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 220 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0.4251 205 GfscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 216 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.2349 210 GfscUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 222 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0.5230 209 GfscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 216 GfsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.4937 200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 217 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfc(invdT) 0.2643 200 gscUfgGfaGfuUfcGfuGfaCfcGfcCf(invdT) 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.0936 208 gscUfgGfaGfuUfcGfuGfaCfcGfcCfdT(invdT) 219 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdT(invdT) 0.3776 202 gscUfgGfaGfuUfcGfuGfaCfcGfcCfdTsdT 213 pdGsGfcGfgUfcAfcGfaAfcUfcCfaGfcdTsdT 0.1569

(261) TABLE-US-00015 TABLE12 InvitroknockdownactivityofAha1-targetingsiRNAswithdifferent3-ends. SEQ SEQ IDNO Sensestrandsequence(5-3) IDNO Antisensestrandsequence(5-3) IC50(nM 157 GGAuGAAGuGGAGAuuAGudTsdT 158 ACuAAUCUCcACUUcAUCCdTsdT 0.094 234 GfgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 246 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfc(invdT) 0.081 234 GfgAfuGfaAfgUfgGfaGfaUfuAfgUf 240 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.036 233 GfgAfuGfaAfgUfgGfaGfaUfuAfgUfdT(invdT) 239 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT(invdT) 0.034 236 GfgAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 240 AfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.040 231 GfsgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 241 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfc(invdT) 0.037 231 GfsgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 267 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.030 229 GfsgAfuGfaAfgUfgGfaGfaUfuAfgUfdT(invdT) 268 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT(invdT) 0.024 228 GfsfAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 267 pAfsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.021 232 ggAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 245 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfc(invdT) 0.060 232 ggAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 238 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.030 237 ggAfuGfaAfgUfgGfaGfaUfuAfgUfdT(invdT) 244 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT(invdT) 0.045 230 ggAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 238 dAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.025 227 gsgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 243 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfc(invdT) 0.045 227 gsgAfuGfaAfgUfgGfaGfaUfuAfgUf(invdT) 266 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.015 235 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfdT(invdT) 242 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdT(invdT) 0.039 226 gsgAfuGfaAfgUfgGfaGfaUfuAfgUfdTsdT 266 pdAsCfuAfaUfcUfcCfaCfuUfcAfuCfcdTsdT 0.014

(262) It was found, that siRNAs with 2 nucleotide dTsdT-overhangs on the antisense strand performed always better than those with a single invdT overhang at the antisense's 3-end (while sense strands were the same). Further benefitial was the combination with a sense strand modified with a single invdT-overhang as 3overhang.

Example 49

In Vivo Knock Down Activity of siRNAs in Non-Human Primates

(263) Preparation of DPCs and Dosing

(264) DPCs were prepared by covalently attaching polymer 149 RAFT to the indicated siRNA targeting coagulation Factor VII (siF7) at 4:1 wt:wt ratio (polymer:siRNA) through a disulfide linkage and then modifying the polymer-siRNA conjugate with a 2:1 wt:wt mixture of CDM-PEG:CDM-NAG at a 7? wt:wt ratio (CDM:polymer). Cynomolgous monkeys were dosed with 1 mg/kg DPC (polymer weight) and 0.25 mg/kg of the indicated siRNA. One animal received DPC containing siF7 SEQ ID NO pair 151/152, two animals received DPC containing siF7 SEQ ID NO pair 253/254), #1 and #2), and two animals received DPC containing SEQ ID NO pair 251/255, #1 and #2). F7 values were normalized to the average of the two pre-dose values. Animals receiving DPCs containing SEQ ID NO pair 253/254 or SEQ ID NO pair 251/255 had greater levels of F7 knockdown and longer PT than the animal receiving SEQ ID NO pair 251/252.

(265) DPC Injection Procedure

(266) For each injection procedure, animals were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg) and moved to a procedure room. In the procedure room, animals were placed on a water jacketed heating pad and the injection site was shaved and prepped with an antiseptic. An intravenous catheter (20 to 22 gauge) was inserted into a systemic vein (cephalic or small saphenous) and the DPC solution was infused (2 ml/kg) slowly over 1 to 2 minutes. A pulse oximeter was used to monitor the heart rate and oxygen saturation during and immediately following the injection procedure. Each injection procedure took about 20 minutes to perform. After injection the catheter was removed and gentle

(267) pressure was applied to the venipuncture site. Animals were taken back to their cages and given an IM injection of the reversal drug atipamezole (antisedan) (0.10 to 0.15 mg/kg). Animals were monitored until they regained normal activity.

(268) Blood Collection Procedure

(269) Blood samples (1-5 ml) were obtained for the measurement of gene inhibition (F7 activity, coagulation time), blood chemistries, and markers of liver damage (CBC, chemistry panel, ALT, cytokines, complement). For these blood collection procedures, animals were given an IM injection containing a combination of ketamine (up to 7 mg/kg) and dexmedetomidine (up to 0.03 mg/kg). Once sedated, animals were moved on to a portable procedure table and a 22 gauge needle and syringe were used to collect blood from the femoral vein. Immediately after the blood collection, pressure was applied to the venipuncture site and the blood was divided into the appropriate sample tubes for each blood test. Animals were then given an IM injection of the reversal drug atipamezole (antisedan) (0.10 to 0.15 mg/kg) and returned to their cage. No more than 20% of total blood volume was drawn in any 30-day period (estimated blood volume=60 ml/kg). Each blood collection procedure took about 10 minutes to perform.

(270) Factor VII (F7) Activity Measurements

(271) Blood samples from non-human primates were prepared by filling serum separator tubes with whole blood and allowing the blood to clot at room temperature for at least 20 minutes. After clotting, blood tubes were centrifuged for 3 minutes at 9000 rpm, aliquoted into eppendorf tubes, and stored at ?20? C. until assayed. F7 activity in serum was measured with a chromogenic method using a BIOPHEN VII kit (Hyphen BioMed/Aniara, Mason, Ohio) following manufacturer's recommendations. Absorbance of colorimetric development was measured using a Tecan Safire2 microplate reader at 405 nm.

(272) Coagulation Tests (Protime, Partial Protime and Fibrinogen)

(273) Blood samples from non-human primates were prepared by completely filling sodium citrate tubes (BD Vacutainer) with whole blood and gently mixing to prevent clot formation. Tubes were transported to a clinical testing lab within one hour and coagulation assays were performed within 4 hours from the time of collection.

(274) TABLE-US-00016 TABLE13 FVIISiRNAusedforNHPexperiment:Key:lowercaselettersa,c,g,u,are2- O-Methylnucleotides;UppercaselettersA,C,G,Ufollowedbyf indicates a2-fluoronucleotide.Lowercasep indicatesa5-phosphate. (invdT)representsaninverteddeoxythimidine(3-3-linked). Aphosphorothioatelinkagesissymbolizedwithalowercase s.dTisdeoxythimidine. SEQID SEQID NO Sensestrandsequence(5-3) NO Antisensestrandsequence(5-3) 251 (NH2C6)GfuUfgGfuGfaAfuGfgAfgCfuC 252 pCfsUfgAfgCfuCfcAfuUfcAfcCfaAfc faGf(invdT) (invdT) 253 (NH2C6)GfgUfcCfuGfuUfgUfuGfgUfgA 254 pAfsUfuCfaCfcAfaCfaAfcAfgGfaCfc faUf(invdT) dTsdT 251 (NH2C6)GfuUfgGfuGfaAfuGfgAfgCfuC 255 pCfsUfgAfgCfuCfcAfnUfcAfcCfaAfc faGf(invdT) dTsdT

(275) Changing from an single nucleotide (invdT)-3-overhang on both strands to an asymmetric siRNA design with a 3-(invdT) overhang on the sense strand and a dTsdT overhang on the antisense strand, but otherwise constant modification pattern lead to a more pronounced serum FVII reduction and a significantly prolonged duration of this effect in non-human primates (see FIG. 6a). This observation is supported by an expected biologic consequence, namely a more pronounced effect on the prothrombin time corresponding to the extent of Factor 7 reduction (see FIG. 6b).

Example 50

In Vivo Knock Down Activity of siRNAs with Cleavable RNA Linkers

(276) In Table 14 the in vivo efficacy based on FVII protein inhibition in serum was compared using cholesterol or the GalNAc-palmitoyl siRNA conjugate in the same sequence context in mice. The in vivo experiment was conducted as described in example 42. FVII inhibition was strongly decreased for the cholesterol conjugated siRNAs containing no 2-OH nucleotide compared to the GalNAc-palmitoyl conjugated counterparts (SEQ ID NO pair 179/166 vs. 179/190, SEQ ID NO pair 257/264 vs. SEQ ID NO pair 179/262, SEQ ID NO pair 257/263 vs. SEQ ID NO pair 179/163 and SEQ ID NO pair 257/166 vs. (SEQ ID NO pair 179/166). In contrast for a 2-OH containing siRNA the cholesterol conjugate lead to higher FVII inhibition compared to the GalNAc-palmitoyl derivative (SEQ ID NO pair 180/168 vs. SEQ ID NO pair 258/168).

(277) The small molecule ligands GalNAc-palmitoyl and cholesterol used in the described in vivo experiment are connected to the siRNA via a non-cleavable linker to the 5-end of the sense strand. In case the sense strand exhibit 2-OH nucleotides the ligand is still cleavable by nucleases (e.g. DNase II in the endosomal or lysosomal compartment). The cleavage reaction releases the free siRNA that is then released into the cytoplasm by the endosomal perturbing activity of the delivery polymer.

(278) For siRNAs lacking a 2-OH nucleotide in the sense strand, the ligands are stably connected to the duplex, as no enzymatic (nuclease/protease/esterase etc.) or chemical mechanism triggers the cleavage of the ligand. Therefore, fully stable cholesterol conjugated siRNA can be trapped in cell membranes due to the membrane interaction of the lipophilic cholesterol ligand. Even high concentrations of the siRNA in the tissue is not sufficient for effective release of the siRNA into in the cytoplasm. In contrast, the less lipophilic GalNAc-palmitoyl conjugated siRNA can be released into the cytoplasm, due to a less pronounced interaction with cell membranes. For this reason a stable, non-cleavable GalNAc-palmitoyl siRNA conjugate is more efficacious compared to a cholesterol conjugated to the same siRNA.

(279) Developing cleavable linker constructs would help to circumvent the issue of membrane trapping for stably conjugated cholesterol siRNA. Using disulfide linker chemistry is described as an attractive possibility to introduce a defined cleavage site but cleavage is most probably restricted to the reducing environment of specific organelles within the cell (PNAS, 2006, 103, 13872). As cleavage is expected to be slow in the endosomal/lysosomal compartment most of the cholesterol-disulfide conjugated siRNA can still be trapped in membranes as described for the non-cleavable cholesterol conjugates.

(280) TABLE-US-00017 TABLE14 %FVII SEQID SEQID activityin Conjugate NOpair NO Sequence5.fwdarw.3 serum custom character 179/166 179 GalNAc-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 27 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 179/190 179 GalNAc-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 51 190 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 179/262 179 GalNAc-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 17 262 pUfsGfaGfuUfgGfcAfcGfcUCfuUfuGfc(invdT) 179/263 179 GalNAc-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 13 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 180/168 180 GalNAc-NH2C6-GcAAAGGcGuGccAAcucAdTsdT 86 168 UGAGUUGGcACGCCUUUGCdTsdT Cholesterol 257/166 257 Cholesterol-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 48 166 puGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 257/190 257 Cholesterol-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 93 190 pusGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 257/264 257 Cholesterol-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 63 264 pUfsGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 257/263 257 Cholesterol-NH2C6-GfcAfaAfgGfcGfuGfcCfaAfcUfcAf(invdT) 41 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGfc(invdT) 258/168 258 Cholesterol-NH2C6-GcAAAGGcGuGccAAcucAdTsdT 50 168 UGAGUUGGcACGCCUUUGCdTsdT

(281) In addition to the well-established disulfide cleavable linker chemistry another possibility is the generation of defined cleavage sites by using 2-OH nucleotides at certain positions. Introduction of 2-OH nucleotides at selective positions is a new approach to achieve cleavage of the conjugates from RNA strands. The 2-OH nucleotides can either be implemented by adding single stranded overhangs with at least one 2-OH-nucleotide at the 3- or 5-end of the RNA strand or by using 2-OH nucleotides within the duplex region of an siRNA. The enzymatic activity of nucleases present in the endosome/lysosome cleaves selectively at this positions. In a first design the cholesterol was connected to the sense strand via a single stranded overhang containing 3 2-OH nucleotides (AUC) at the 5-terminus.

(282) Cholesterol conjugated siRNAs comparing various cleavable linker chemistries are shown in Table 15. All siRNAs have the identical sequence context, just the linker chemistry was altered. Cholesterol was connected to the sense strand via single stranded overhang comprised of a three 2 -OH nucleotides (AUC)to the 5-terminus. When co-administered with a delivery polymer this siRNA (SEQ ID NO pair 260/263) lead to 77% FVII down modulation in serum in mice, compared to only 60% when using the identical siRNA with a stably attached cholesterol (SEQ ID NO pair 257/263). The same siRNA with a cholesterol conjugated via a linker according to formula Ia to the 5-terminus of the sense strand (SEQ ID NO pair 261/263) lead to 93% FVII activity reduction in serum. All results were achieved by co-administration of 15 mg/kg of a delivery polymer with 2.5 mg/kg of the cholesterol conjugated siRNA in mice.

(283) TABLE-US-00018 TABLE15 InvivocomparisonofvariouslinkerchemistriesforcholesterolconjugatedsiRNAs SEQ SEQ ID ID %FVIIactivity NO Sensestrandsequence(5-3) NO Antisensestrandsequence(5-3) inserum 257 Chol-(NH2C6)- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuG 40 GfcAfaAfgGfcGfuGfcCfaAfcUfcA fc(invdT) f(invdT) 259 Chol-C6SSC6- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuG 22 GfcAfaAfgGfcGfuGfcCfaAfcUfcA fc(invdT) f(invdT) 260 Chol-AUC- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuG 23 GfcAfaAfgGfcGfuGfcCfaAfcUfcA fc(invdT) f(invdT) 261 Chol-Cathepsin- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuG 7 GfcAfaAfgGfcGfuGfcCfaAfcUfcA fc(invdT) f(invdT)

(284) These results indicate that the use of a cleavable linker improves the in vivo potency of siRNAs containing no 2-OH nucleotide. The cleavable linker can either comprised of 2-OH containing nucleotides, a di-peptide cleavage motive or a disulfide linker chemistry. All cleavable linker constructs improve the in vivo potency in a co-administration setup of a cholesterol conjugated siRNAs with a slow endosomal release delivery polymer.

Example 51

In Vitro Serum Stability of siRNAs with Cleavable Linkers

(285) The stability of the cleavable linker was evaluated in an in vitro stability assay. The cholesterol conjugated sense strands were incubated in 90% mouse serum at 37? C. for various time points. The incubation reaction was stopped by addition of proteinase K in a sodium dodecyl sulfate (SDS) containing buffer- The treatment degrades all proteins and enzymes without interfering with the RNA strand integrity. 25 ?L of this solution was directly injected onto a AEX-HPLC system connected to a UV detector at 260nm. AEX-HPLC was performed on a Dionex DNA Pac200 column (4?250 mm) at 75? C. using a 20 mM Tris buffer containing 50% ACN at pH=8. 800 mM NaBr in eluent B serves as eluent salt. A gradient from 25 to 62% B in 18 minutes was employed.

(286) The cholesterol containing single stranded RNA elutes from the HPLC column as a broad peak at 260 nm. After cleavage of the cholesterol, sharp symmetric peaks are observed at lower retention time. Cleavage rate of cholesterol was determined by the following equitation (PA=Peak Area):
%.sub.(free RNA)=100*PA.sub.[free RNA]/(PA.sub.[free RNA]+PA.sub.[cholesterol conjugated RNA])

(287) In vitro it was shown, that the 3nt nucleotide (AUC)-overhang is quantitatively cleaved in less than 1 hour in 90% mouse serum. The cleavage occurs 3 to the two pyrimidine nucleotides in the overhang, leading to two distinct cleavage metabolites (peak areas of metabolites were summarized for data evaluation). In contrast, the di-peptide containing linker according to formula 1a, the disulfide and the stably linked cholesterol are fully stable in mouse serum.

Example 52

Tissue Distribution of siRNAs with Cleavable Linkers

(288) The siRNA concentration in the liver tissue samples was determined using a proprietary oligonucleotide detection method as described in WO2010043512. Briefly, the siRNA quantification is based on the hybridization of a fluorescently (Atto-425) labeled PNA-probe (Atto425-OO-TGAGTTGGCACGCCTTT obtained from Panagene Inc, Korea) complementary to the sense strand of the siRNA duplex, followed by AEX-HPLC based separation. Quantification was done by fluorescence detection against an external calibration curve that was generated from a dilution series of the two FVII siRNA used in the in vivo experiment (see example 42). For plasma samples between 0.2 to 2 ?L and for tissue ?1 mg aliquots were injected onto the HPLC system.

(289) In Table 16 results from liver tissue analysis are shown. When analyzing the siRNA content it was found, that the sense strand that is present in liver tissue, is quantitatively cleaved from cholesterol when using either the di-peptide linker motive or the 3 nt 5-overhang with the unmodified linker sequence AUC. In contrast, only 15% of the disulfide linked siRNA that is present in the liver is cleaved from cholesterol within the first 48 hours post dosing and nothing of the stably attached cholesterol is cleaved from the siRNA.

(290) When comparing the absolute amounts of cholesterol-free siRNA in liver tissue similar amounts were found for the disulfide linker and for the RNA AUC-linker, nicely correlating with equal FVII serum activity 48 hours post dosing The lower FVII activity achieved with the di-peptide linked cholesterol siRNA fully correlates with the higher absolute amount of the cleaved cholesterol-free siRNA.

(291) The total amount of cholesterol siRNA conjugate equipped with an (AUC)-linker on the sense strand delivered into the liver is ?6-fold lower as compared to the stably or the disulfide attached cholesterol and ?3-fold lower compared to the di-peptide conjugated cholesterol siRNA. The reduced tissue presence can be attributed to the fact that the AUC-linker is not only a substrate for intracellular nucleases, but also for nucleases present in circulation as shown in the in vitro incubation with mouse serum. When the cholesterol ligand is cleaved from the siRNA already in circulation the resulting siRNA is prone to renal clearance and is rapidly excreted into urine without delivery into tissue.

(292) TABLE-US-00019 TABLE16 Total %sense SEQ SEQ siRNA cleaved ID ID inLiver ligandin NO Sensestrandsequence(5-3) NO Antisensestrandsequence(5-3) [ng/g] liver 257 Chol-(NH2C6)- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGf 5837 0 GfcAfaAfgGfcGfuGfcCfaAfcU c(invdT) fcAf(invdT) 259 Chol-C6SSC6- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGf 4357 14.8 GfcAfaAfgGfcGfuGfcCfaAfcU c(invdT) fcAf(invdT) 260 Chol-AUC- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGf 912 96.1 GfcAfaAfgGfcGfuGfcCfaAfcU c(invdT) fcAf(invdT) 261 Chol-Cathepsin- 263 psdTdGfaGfuUfgGfcAfcGfcCfuUfuGf 2760 99.8 GfcAfaAfgGfcGfuGfcCfaAfcU c(invdT) fcAf(invdT)
In the following tables siRNAs used in the examples are summarized:

(293) TABLE-US-00020 TABLE17 Coresequences SEQIDNO Sensestrandsequence(5-3) SEQIDNO Antisensestrandsequence(5-3) 1 ACAUGAAGCAGCACGACUU 2 AAGUCGUGCUGCUUCAUGU 3 GCCCGACAACCACUACCUG 4 CAGGUAGUGGUUGUCGGGC 5 CGAGAAGCGCGAUCACAUG 6 CAUGUGAUCGCGCUUCUCG 7 AUAUCAUGGCCGACAAGCA 8 UGCUUGUCGGCCAUGAUAU 9 ACAAGCUGGAGUACAACUA 10 UAGUUGUACUCCAGCUUGU 11 GCAGCUCGCCGACCACUAC 12 GUAGUGGUCGGCGAGCUGC 13 CGUCCAGGAGCGCACCAUC 14 GAUGGUGCGCUCCUGGACG 15 GCUGGAGUUCGUGACCGCC 16 GGCGGUCACGAACUCCAGC 17 CCACCCUGACCUACGGCGU 18 ACGCCGUAGGUCAGGGUGG 19 CGACUUCAAGGAGGACGGC 20 GCCGUCCUCCUUGAAGUCG 21 UUCAAGAUCCGCCACAACA 22 UGUUGUGGCGGAUCUUGAA 23 GGCAACUACAAGACCCGCG 24 CGCGGGUCUUGUAGUUGCC 25 CCGGCAAGCUGCCCGUGCC 26 GGCACGGGCAGCUUGCCGG 27 UGCCCAUCCUGGUCGAGCU 28 AGCUCGACCAGGAUGGGCA 29 CAAGUUCAGCGUGUCCGGC 30 GCCGGACACGCUGAACUUG 151 GGAAUCUUAUAUUUGAUCCAA 152 UUGGAUCAAAUAUAAGAUUCCCU 155 GGAUGAAGUGGAGAUUAGU 156 ACUAAUCUCCACUUCAUCC 161 GCAAAGGCGUGCCAACUCA 162 UGAGUUGGCACGCCUUUGC 161 GCAAAGGCGUGCCAACUCA 178 TGAGUUGGCACGCCUUUGC 161 GCAAAGGCGUGCCAACUCA 256 TGAGUUGGCACGCCUUUGC 163 GGAUCAUCUCAAGUCUUAC 164 GUAAGACUUGAGAUGAUCC 171 UGACCACAGUCGGAUUAAA 172 UUUAAUCCGACUGUGGUCA 247 GUUGGUGAAUGGAGCUCAG 248 CUGAGCUCCAUUCACCAAC 249 GGUCCUGUUGUUGGUGAAU 250 AUUCACCAACAACAGGACC

(294) TABLE-US-00021 TABLE18 Mappingofcoresequencesandmodifiedsequence Coresequences Modifiedsequences SEQ SEQ SEQ SEQ ID Sensestrand ID Antisensestrand ID Sensestrand ID Antisensestrand NO sequence(5-3) NO sequence(5-3) NO sequence(5-3) NO sequence(5-3) 1 ACAUGAAGC 2 AAGUCGUGC 31 ACAUGAAGCAG 32 AAGUCGUGCUGCU AGCACGACUU UGCUUCAUGU CACGACUUdTdT UCAUGUdTdT 1 ACAUGAAGC 2 AAGUCGUGC 61 AfcAfuGfaAfgCfa 62 paAfgUfcGfuGfcUfg AGCACGACUU UGCUUCAUGU GfcAfcGfaCfuUfd CfuUfcAfuGfudTsdT TsdT 1 ACAUGAAGC 2 AAGUCGUGC 91 dAcdAudGadAgdC 92 padAgdTcdGudGcdTg AGCACGACUU UGCUUCAUGU adGcdAcdGadCud dCudTcdAudGudTsdT TdTsdT 1 ACAUGAAGC 2 AAGUCGUGC 121 AfdCAfdTGfdAAf 122 pdAAfdGUfdCGfdTG AGCACGACUU UGCUUCAUGU dGCfdAGfdCAfdC fdCUfdGCfdTUfdCAf GfdACfdTUfdTsdT dTGfdTdTsdT 3 GCCCGACAA 4 CAGGUAGUG 33 GCCCGACAACC 34 CAGGUAGUGGUU CCACUACCUG GUUGUCGGGC ACUACCUGdTdT GUCGGGCdTdT 3 GCCCGACAA 4 CAGGUAGUG 63 GfcCfcGfaCfaAfcC 64 pcAfgGfuAfgUfgGfu CCACUACCUG GUUGUCGGGC faCfuAfcCfuGfdTs UfgUfcGfgGfcdTsdT dT 3 GCCCGACAA 4 CAGGUAGUG 93 dGcdCcdGadCadA 94 pcdAgdGudAgdTgdG CCACUACCUG GUUGUCGGGC cdCadCudAcdCud udTgdTcdGgdGcdTsdT GdTsdT 3 GCCCGACAA 4 CAGGUAGUG 123 GfdCCfdCGfdACf 124 pdCAfdGGfdTAfdGU CCACUACCUG GUUGUCGGGC dAAfdCCfdACfdT fdGGfdTUfdGUfdCG AfdCCfdTGfdTsdT fdGGfdCdTsdT 5 CGAGAAGCG 6 CAUGUGAUC 35 CGAGAAGCGCG 36 CAUGUGAUCGCGC CGAUCACAUG GCGCUUCUCG AUCACAUGdTdT UUCUCGdTdT 5 CGAGAAGCG 6 CAUGUGAUC 65 CfgAfgAfaGfcGfc 66 pcAfuGfuGfaUfcGfc CGAUCACAUG GCGCUUCUCG GfaUfcAfcAfuGfd GfcUfuCfuCfgdTsdT TsdT 5 CGAGAAGCG 6 CAUGUGAUC 95 dCgdAgdAadGcdG 96 pcdAudGudGadTcdG CGAUCACAUG GCGCUUCUCG cdGadTcdAcdAud cdGcdTudCudCgdTsdT GdTsdT 5 CGAGAAGCG 6 CAUGUGAUC 125 CfdGAfdGAfdAGf 126 pdCAfdTGfdTGfdAU CGAUCACAUG GCGCUUCUCG dCGfdCGfdAUfdC fdCGfdCGfdCUfdTCf AfdCAfdTGfdTsdT dTCfdGdTsdT 7 AUAUCAUGG 8 UGCUUGUCG 37 AUAUCAUGGCC 38 UGCUUGUCGGCCA CCGACAAGCA GCCAUGAUAU GACAAGCAdTdT UGAUAUdTdT 7 AUAUCAUGG 8 UGCUUGUCG 67 AfuAfuCfaUfgGfc 68 puGfcUfuGfuCfgGfc CCGACAAGCA GCCAUGAUAU CfgAfcAfaGfcAfd CfaUfgAfuAfudTsdT TsdT 7 AUAUCAUGG 8 UGCUUGUCG 97 dAudAudCadTgdG 98 pudGcdTudGudCgdG CCGACAAGCA GCCAUGAUAU cdCgdAcdAadGcd cdCadTgdAudAudTsdT AdTsdT 7 AUAUCAUGG 8 UGCUUGUCG 127 AfdTAfdTCfdAUf 128 pdTGfdCUfdTGfdTCf CCGACAAGCA GCCAUGAUAU dGGfdCCfdGAfdC dGGfdCCfdAUfdGAf AfdAGfdCAfdTsdT dTAfdTdTsdT 9 ACAAGCUGG 10 UAGUUGUAC 39 ACAAGCUGGAG 40 UAGUUGUACUCCA AGUACAACUA UCCAGCUUGU UACAACUAdTdT GCUUGUdTdT 9 ACAAGCUGG 10 UAGUUGUAC 69 AfcAfaGfcUfgGfa 70 puAfgUfuGfuAfcUfc AGUACAACUA UCCAGCUUGU GfuAfcAfaCfuAfd CfaGfcUfuGfudTsdT TsdT 9 ACAAGCUGG 10 UAGUUGUAC 99 dAcdAadGcdTgdG 100 pudAgdTudGudAcdT AGUACAACUA UCCAGCUUGU adGudAcdAadCud cdCadGcdTudGudTsdT AdTsdT 9 ACAAGCUGG 10 UAGUUGUAC 129 AfdCAfdAGfdCUf 130 pdTAfdGUfdTGfdTA AGUACAACUA UCCAGCUUGU dGGfdAGfdTAfdC fdCUfdCCfdAGfdCUf AfdACfdTAfdTsdT dTGfdTdTsdT 11 GCAGCUCGC 12 GUAGUGGUC 41 GCAGCUCGCCG 42 GUAGUGGUCGGC CGACCACUAC GGCGAGCUGC ACCACUACdTdT GAGCUGCdTdT 11 GCAGCUCGC 12 GUAGUGGUC 71 GfcAfgCfuCfgCfc 72 pgUfaGfuGfgUfcGfg CGACCACUAC GGCGAGCUGC GfaCfcAfcUfaCfdT CfgAfgCfuGfcdTsdT sdT 11 GCAGCUCGC 12 GUAGUGGUC 101 dGcdAgdCudCgdC 102 pgdTadGudGgdTcdG CGACCACUAC GGCGAGCUGC cdGadCcdAcdTad gdCgdAgdCudGcdTsdT CdTsdT 11 GCAGCUCGC 12 GUAGUGGUC 131 GfdCAfdGCfdTCf 132 pdGUfdAGfdTGfdGU CGACCACUAC GGCGAGCUGC dGCfdCGfdACfdC fdCGfdGCfdGAfdGC AfdCUfdACfdTsdT fdTGfdCdTsdT 13 CGUCCAGGA 14 GAUGGUGCG 43 CGUCCAGGAGC 44 GAUGGUGCGCUCC GCGCACCAUC CUCCUGGACG GCACCAUCdTdT UGGACGdTdT 13 CGUCCAGGA 14 GAUGGUGCG 73 CfgUfcCfaGfgAfg 74 pgAfuGfgUfgCfgCfu GCGCACCAUC CUCCUGGACG CfgCfaCfcAfuCfdT CfcUfgGfaCfgdTsdT sdT 13 CGUCCAGGA 14 GAUGGUGCG 103 dCgdTcdCadGgdA 104 pgdAudGgdTgdCgdC GCGCACCAUC CUCCUGGACG gdCgdCadCcdAud udCcdTgdGadCgdTsdT CdTsdT 13 CGUCCAGGA 14 GAUGGUGCG 133 CfdGUfdCCfdAGf 134 pdGAfdTGfdGUfdGC GCGCACCAUC CUCCUGGACG dGAfdGCfdGCfdA fdGCfdTCfdCUfdGGf CfdCAfdTCfdTsdT dACfdGdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 45 GCUGGAGUUCG 46 GGCGGUCACGAAC CGUGACCGCC GAACUCCAGC UGACCGCCdTdT UCCAGCdTdT 15 GCUGGAGUU 16 GGCGGUCAC 75 GfcUfgGfaGfuUfc 76 pgGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd AfcUfcCfaGfcdTsdT TsdT 15 GCUGGAGUU 16 GGCGGUCAC 105 dGcdTgdGadGudT 106 pgdGcdGgdTcdAcdG CGUGACCGCC GAACUCCAGC cdGudGadCcdGcd adAcdTcdCadGcdTsdT CdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 135 GfdCUfdGGfdAGf 136 pdGGfdCGfdGUfdCA CGUGACCGCC GAACUCCAGC dTUfdCGfdTGfdA fdCGfdAAfdCUfdCCf CfdCGfdCCfdTsdT dAGfdCdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 200 gscUfgGfaGfuUfc 213 pdGsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) aAfcUfcCfaGfcdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 201 gcUfgGfaGfuUfcG 214 dGsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC fuGfaCfcGfcCf(invdT) AfcUfcCfaGfcdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 202 gscUfgGfaGfuUfc 213 pdGsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd aAfcUfcCfaGfcdTsdT TsdT 15 GCUGGAGUU 16 GGCGGUCAC 203 gcUfgGfaGfuUfcG 214 dGsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC fuGfaCfcGfcCfdTs AfcUfcCfaGfcdTsdT dT 15 GCUGGAGUU 16 GGCGGUCAC 204 GfcUfgGfaGfuUfc 215 pGfsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) aAfcUfcCfaGfcdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 205 GfscUfgGfaGfuUfc 216 GfsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) AfcUfcCfaGfcdTsdT 15 GCUGGAGUU 16 GGCGGUCAC 206 GfcUfgGfaGfuUfc 215 pGfsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd aAfcUfcCfaGfcdTsdT TsdT 15 GCUGGAGUU 16 GGCGGUCAC 200 gscUfgGfaGfuUfc 217 pdGsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) aAfcUfcCfaGfc(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 207 GfcUfgGfaGfuUfc 218 pGfsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd aAfcUfcCfaGfcdT(invdT) T(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 208 gscUfgGfaGfuUfc 219 pdGsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd aAfcUfcCfaGfcdT(invdT) T(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 205 GfscUfgGfaGfuUfc 220 GfsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) AfcUfcCfaGfc(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 201 gcUfgGfaGfuUfcG 221 dGsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC fuGfaCfcGfcCf(invdT) AfcUfcCfaGfc(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 209 GfscUfgGfaGfuUfc 216 GfsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd AfcUfcCfaGfcdTsdT TsdT 15 GCUGGAGUU 16 GGCGGUCAC 210 GfscUfgGfaGfuUfc 222 GfsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCfd AfcUfcCfaGfcdT(invdT) T(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 211 gcUfgGfaGfuUfcG 223 dGsGfcGfgUfcAfcGfa CGUGACCGCC GAACUCCAGC fuGfaCfcGfcCfdT(invdT) AfcUfcCfaGfcdT(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 204 GfcUfgGfaGfuUfc 224 pGfsGfcGfgUfcAfcGf CGUGACCGCC GAACUCCAGC GfuGfaCfcGfcCf(invdT) aAfcUfcCfaGfc(invdT) 15 GCUGGAGUU 16 GGCGGUCAC 45 GCUGGAGUUCG 46 GGCGGUCACGAAC CGUGACCGCC GAACUCCAGC UGACCGCCdTdT UCCAGCdTdT 15 GCUGGAGUU 16 GGCGGUCAC 212 GcuGGAGuucGuG 225 GGCGGUcACGAAC CGUGACCGCC GAACUCCAGC AccGccdTsdT UCcAGCdTsdT 17 CCACCCUGA 18 ACGCCGUAG 47 CCACCCUGACC 48 ACGCCGUAGGUCA CCUACGGCGU GUCAGGGUGG UACGGCGUdTdT GGGUGGdTdT 17 CCACCCUGA 18 ACGCCGUAG 77 CfcAfcCfcUfgAfc 78 paCfgCfcGfuAfgGfuC CCUACGGCGU GUCAGGGUGG CfuAfcGfgCfgUfd faGfgGfuGfgdTsdT TsdT 17 CCACCCUGA 18 ACGCCGUAG 107 dCcdAcdCcdTgdA 108 padCgdCcdGudAgdG CCUACGGCGU GUCAGGGUGG cdCudAcdGgdCgd udCadGgdGudGgdTs TdTsdT dT 17 CCACCCUGA 18 ACGCCGUAG 137 CfdCAfdCCfdCUf 138 pdACfdGCfdCGfdTA CCUACGGCGU GUCAGGGUGG dGAfdCCfdTAfdC fdGGfdTCfdAGfdGG GfdGCfdGUfdTsdT fdTGfdGdTsdT 19 CGACUUCAA 20 GCCGUCCUCC 49 CGACUUCAAGG 50 GCCGUCCUCCUUG GGAGGACGGC UUGAAGUCG AGGACGGCdTdT AAGUCGdTdT 19 CGACUUCAA 20 GCCGUCCUCC 79 CfgAfcUfuCfaAfg 80 pgCfcGfuCfcUfcCfuU GGAGGACGGC UUGAAGUCG GfaGfgAfcGfgCfd fgAfaGfuCfgdTsdT TsdT 19 CGACUUCAA 20 GCCGUCCUCC 109 dCgdAcdTudCadA 110 pgdCcdGudCcdTcdCu GGAGGACGGC UUGAAGUCG gdGadGgdAcdGgd dTgdAadGudCgdTsdT CdTsdT 19 CGACUUCAA 20 GCCGUCCUCC 139 CfdGAfdCUfdTCf 140 pdGCfdCGfdTCfdCU GGAGGACGGC UUGAAGUCG dAAfdGGfdAGfdG fdCCfdTUfdGAfdAGf AfdCGfdGCfdTsdT dTCfdGdTsdT 21 UUCAAGAUC 22 UGUUGUGGC 51 UUCAAGAUCCG 52 UGUUGUGGCGGA CGCCACAACA GGAUCUUGAA CCACAACAdTdT UCUUGAAdTdT 21 UUCAAGAUC 22 UGUUGUGGC 81 UfuCfaAfgAfuCfc 82 puGfuUfgUfgGfcGfg CGCCACAACA GGAUCUUGAA GfcCfaCfaAfcAfdT AfuCfuUfgAfadTsdT sdT 21 UUCAAGAUC 22 UGUUGUGGC 111 dTudCadAgdAudC 112 pudGudTgdTgdGcdG CGCCACAACA GGAUCUUGAA cdGcdCadCadAcd gdAudCudTgdAadTsdT AdTsdT 21 UUCAAGAUC 22 UGUUGUGGC 141 UfdTCfdAAfdGAf 142 pdTGfdTUfdGUfdGG CGCCACAACA GGAUCUUGAA dTCfdCGfdCCfdA fdCGfdGAfdTCfdTUf CfdAAfdCAfdTsdT dGAfdAdTsdT 23 GGCAACUAC 24 CGCGGGUCU 53 GGCAACUACAA 54 CGCGGGUCUUGUA AAGACCCGCG UGUAGUUGCC GACCCGCGdTdT GUUGCCdTdT 23 GGCAACUAC 24 CGCGGGUCU 83 GfgCfaAfcUfaCfa 84 pcGfcGfgGfuCfuUfg AAGACCCGCG UGUAGUUGCC AfgAfcCfcGfcGfd UfaGfuUfgCfcdTsdT TsdT 23 GGCAACUAC 24 CGCGGGUCU 113 dGgdCadAcdTadC 114 pcdGcdGgdGudCudT AAGACCCGCG UGUAGUUGCC adAgdAcdCcdGcd gdTadGudTgdCcdTsdT GdTsdT 23 GGCAACUAC 24 CGCGGGUCU 143 GfdGCfdAAfdCUf 144 pdCGfdCGfdGGfdTC AAGACCCGCG UGUAGUUGCC dACfdAAfdGAfdC fdTUfdGUfdAGfdTUf CfdCGfdCGfdTsdT dGCfdCdTsdT 25 CCGGCAAGC 26 GGCACGGGC 55 CCGGCAAGCUG 56 GGCACGGGCAGCU UGCCCGUGCC AGCUUGCCGG CCCGUGCCdTdT UGCCGGdTdT 25 CCGGCAAGC 26 GGCACGGGC 85 CfcGfgCfaAfgCfu 86 pgGfcAfcGfgGfcAfg UGCCCGUGCC AGCUUGCCGG GfcCfcGfuGfcCfd CfuUfgCfcGfgdTsdT TsdT 25 CCGGCAAGC 26 GGCACGGGC 115 dCcdGgdCadAgdC 116 pgdGcdAcdGgdGcdA UGCCCGUGCC AGCUUGCCGG udGcdCcdGudGcd gdCudTgdCcdGgdTsdT CdTsdT 25 CCGGCAAGC 26 GGCACGGGC 145 CfdCGfdGCfdAAf 146 pdGGfdCAfdCGfdGG UGCCCGUGCC AGCUUGCCGG dGCfdTGfdCCfdC fdCAfdGCfdTUfdGCf GfdTGfdCCfdTsdT dCGfdGdTsdT 27 UGCCCAUCC 28 AGCUCGACC 57 UGCCCAUCCUG 58 AGCUCGACCAGGA UGGUCGAGCU AGGAUGGGCA GUCGAGCUdTdT UGGGCAdTdT 27 UGCCCAUCC 28 AGCUCGACC 87 UfgCfcCfaUfcCfu 88 paGfcUfcGfaCfcAfgG UGGUCGAGCU AGGAUGGGCA GfgUfcGfaGfcUfd faUfgGfgCfadTsdT TsdT 27 UGCCCAUCC 28 AGCUCGACC 117 dTgdCcdCadTcdCu 118 padGcdTcdGadCcdAg UGGUCGAGCU AGGAUGGGCA dGgdTcdGadGcdT dGadTgdGgdCadTsdT dTsdT 27 UGCCCAUCC 28 AGCUCGACC 147 UfdGCfdCCfdAUf 148 pdAGfdCUfdCGfdAC UGGUCGAGCU AGGAUGGGCA dCCfdTGfdGUfdC fdCAfdGGfdAUfdGG GfdAGfdCUfdTsdT fdGCfdAdTsdT 29 CAAGUUCAG 30 GCCGGACAC 59 CAAGUUCAGCG 60 GCCGGACACGCUG CGUGUCCGGC GCUGAACUUG UGUCCGGCdTdT AACUUGdTdT 29 CAAGUUCAG 30 GCCGGACAC 89 CfaAfgUfuCfaGfc 90 pgCfcGfgAfcAfcGfcU CGUGUCCGGC GCUGAACUUG GfuGfuCfcGfgCfd fgAfaCfuUfgdTsdT TsdT 29 CAAGUUCAG 30 GCCGGACAC 119 dCadAgdTudCadG 120 pgdCcdGgdAcdAcdG CGUGUCCGGC GCUGAACUUG cdGudGudCcdGgd cdTgdAadCudTgdTsdT CdTsdT 29 CAAGUUCAG 30 GCCGGACAC 149 CfdAAfdGUfdTCf 150 pdGCfdCGfdGAfdCA CGUGUCCGGC GCUGAACUUG dAGfdCGfdTGfdT fdCGfdCUfdGAfdAC CfdCGfdGCfdTsdT fdTUfdGdTsdT 151 GGAAUCUUA 152 UUGGAUCAA 153 GGAAUCuuAuAu 154 uuGGAUcAAAuAuA UAUUUGAUC AUAUAAGAU uuGAUCcAsA AGAuUCcscsU CAA UCCCU 151 GGAAUCUUA 152 UUGGAUCAA 265 (Chol)GGAAUCuu 154 uuGGAUcAAAuAuA UAUUUGAUC AUAUAAGAU AuAuuuGAUCcAsA AGAuUCcscsU CAA UCCCU 155 GGAUGAAGU 156 ACUAAUCUC 157 GGAuGAAGuGG 158 ACuAAUCUCcACU GGAGAUUAGU CACUUCAUCC AGAuuAGudTsdT UcAUCCdTsdT 155 GGAUGAAGU 156 ACUAAUCUC 160 (NH2C6)GfgAfuGf 159 pasCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC aAfgUfgGfaGfaUf CfuUfcAfuCfc(invdT) uAfgUf(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 226 gsgAfuGfaAfgUfg 266 pdAsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUfd aCfuUfcAfuCfcdTsdT TsdT 155 GGAUGAAGU 156 ACUAAUCUC 227 gsgAfuGfaAfgUfg 266 pdAsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC GfaGfaUruAfgUf(invdT) aCfuUfcAfuCfcdTsdT 155 GGAUGAAGU 156 ACUAAUCUC 228 GfsgAfuGfaAfgUf 267 pAfsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC gGfaGfaUfuAfgUf aCfuUfcAfuCfcdTsdT dTsdT 155 GGAUGAAGU 156 ACUAAUCUC 229 GfsgAfuGfaAfgUf 268 pAfsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC gGfaGfaUfuAfgUf aCfuUfcAfuCfcdT(invdT) dT(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 230 ggAfuGfaAfgUfgG 238 dAsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC faGfaUfuAfgUfdTs CfuUfcAfuCfcdTsdT dT 155 GGAUGAAGU 156 ACUAAUCUC 231 GfsgAfuGfaAfgUf 267 pAfsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC gGfaGfaUfuAfgUf aCfuUfcAfuCfcdTsdT (invdT) 155 GGAUGAAGU 156 ACUAAUCUC 232 ggAfuGfaAfgUfgG 238 dAsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC faGfaUruAfgUf(invdT) CfuUfcAfuCfcdTsdT 155 GGAUGAAGU 156 ACUAAUCUC 233 GfgAfuGfaAfgUfg 239 AfsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUfd CfuUfcAfuCfcdT(invdT) T(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 234 GfgAfuGfaAfgUfg 240 AfsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC GfaGfaUruAfgUf(invdT) CfuUfcAfuCfcdTsdT 155 GGAUGAAGU 156 ACUAAUCUC 231 GfsgAfuGfaAfgUf 241 pAfsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC gGfaGfaUfuAfgUf aCfuUfcAfuCfc(invdT) (invdT) 155 GGAUGAAGU 156 ACUAAUCUC 234 GfgAfuGfaAfgUfg 159 pasCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUf(invdT) CfuUfcAfuCfc(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 235 gsgAfuGfaAfgUfg 242 pdAsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUfd aCfuUfcAfuCfcdT(invdT) T(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 236 GfgAfuGfaAfgUfg 240 AfsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUfd CfuUfcAfuCfcdTsdT TsdT 155 GGAUGAAGU 156 ACUAAUCUC 227 gsgAfuGfaAfgUfg 243 pdAsCfuAfaUfcUfcCf GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUf(invdT) aCfuUfcAfuCfc(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 237 ggAfuGfaAfgUfgG 244 dAsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC faGfaUfuAfgUfdT CfuUfcAfuCfcdT(invdT) (invdT) 155 GGAUGAAGU 156 ACUAAUCUC 232 ggAfuGfaAfgUfgG 245 dAsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC faGfaUfuAfgUf(invdT) CfuUfcAfuCfc(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 234 GfgAfuGfaAfgUfg 246 AfsCfuAfaUfcUfcCfa GGAGAUUAGU CACUUCAUCC GfaGfaUfuAfgUf(invdT) CfuUfcAfuCfc(invdT) 155 GGAUGAAGU 156 ACUAAUCUC 157 GGAuGAAGuGG 158 ACuAAUCUCcACU GGAGAUUAGU CACUUCAUCC AGAuuAGudTsdT UcAUCCdTsdT 161 GCAAAGGCG 162 UGAGUUGGC 165 (NH2C6)GfcAfaAf 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC gGfcGfuGfcCfaAfc GfcCfuUfuGfc(invdT) UfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 167 (NH2C6)GcAAAG 168 UGAGUUGGcACGC UGCCAACUCA ACGCCUUUGC GcGuGccAAcucAd CUUUGCdTsdT TsdT 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 180 GalNAc-(NH2C6)- 168 UGAGUUGGcACGC UGCCAACUCA ACGCCUUUGC GcAAAGGcGuGcc CUUUGCdTsdT AAcucAdTsdT 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 185 pUfsGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 186 psdTdGaGfuUfgGfcA UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 187 psdTsGfaGfuUfgGfcA UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 188 pdTsdGaGfuUfgGfcA UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 189 pdTsGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 190 pusGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 191 psUfGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 192 UfsGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 193 psUfsGfaGfuUfgGfcA UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 194 psdTsdGaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) AfcGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 195 usGfaGfuUfgGfcAfcG UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 196 uGfaGfuUfgGfcAfcGf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 197 dTsGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 198 psdTGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 199 dTsdGaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 183 (Chol)GfcAfaAfgG 190 pusGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC fcGfuGfcCfaAfcUf GfcCfuUfuGfc(invdT) cAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 196 uGfaGfuUfgGfcAfcGf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 195 usGfaGfuUfgGfcAfcG UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) fcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 181 GfcAfaAfgGfcGfu 192 UfsGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 197 dTsGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) GfcCfuUfuGfc(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 181 GfcAfaAfgGfcGfu 199 dTsdGaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcAf(invdT) cGfcCfuUfuGfc(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 182 GcAAAGGcGuGcc 168 UGAGUUGGcACGC UGCCAACUCA ACGCCUUUGC AAcucAdTsdT CUUUGCdTsdT 161 GCAAAGGCG 162 UGAGUUGGC 184 GfcAfaAfgGfcGfu 168 UGAGUUGGcACGC UGCCAACUCA ACGCCUUUGC GfcCfaAfcUfcA CUUUGCdTsdT 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 190 pusGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 185 pUfsGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu cGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 178 TGAGUUGGC 179 GalNAc-(NH2C6)- 186 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 190 pusGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 179 GalNAc-(NH2C6)- 262 pUfsGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu cGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 179 GalNAc-(NH2C6)- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 257 Chol-(NH2C6)- 166 puGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 257 Chol-(NH2C6)- 190 pusGfaGfuUfgGfcAfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu GfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 257 Chol-(NH2C6)- 264 pUfsGfaGfuUfgGfcAf UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu cGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 257 Chol-(NH2C6)- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 162 UGAGUUGGC 258 Chol-(NH2C6)- 168 UGAGUUGGcACGC UGCCAACUCA ACGCCUUUGC GcAAAGGcGuGcc CUUUGCdTsdT AAcucAdTsdT 161 GCAAAGGCG 256 TGAGUUGGC 257 Chol-(NH2C6)- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 259 Chol-C6SSC6- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 260 Chol-AUC- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 261 Chol-Cathepsin- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 257 Chol-(NH2C6)- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 259 Chol-C6SSC6- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 260 Chol-AUC- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 161 GCAAAGGCG 256 TGAGUUGGC 261 Chol-Cathepsin- 263 psdTdGfaGfuUfgGfc UGCCAACUCA ACGCCUUUGC GfcAfaAfgGfcGfu AfcGfcCfuUfuGfc(invdT) GfcCfaAfcUfcAf(invdT) 163 GGAUCAUCU 164 GUAAGACUU 169 (NH2C6)GGAUfCf 170 GUfAAGACfUfUfGA CAAGUCUUAC GAGAUGAUCC AUfCfUfCfAAGUf GAUfGAUfCfCfdTsdT CfUfUfACfdTsdT 171 UGACCACAG 172 UUUAAUCCG 173 (NH2C6)UfgAfcCf 174 pusUfuAfaUfcCfgAfc UCGGAUUAAA ACUGUGGUCA aCfaGfuCfgGfaUfu UfgUfgGfuCfa(invdT) AfaAf(invdT) 171 UGACCACAG 172 UUUAAUCCG 175 (NH2C6)uGAccAc 176 puUuAAUCCGACU UCGGAUUAAA ACUGUGGUCA AGucGGAuuAAA GUGGucAdTsdT dTsdT 171 UGACCACAG 172 UUUAAUCCG 175 (NH2C6)uGAccAc 177 UUuAAUCCGACUG UCGGAUUAAA ACUGUGGUCA AGucGGAuuAAA UGGUcAdTsdT dTsdT 247 GUUGGUGAA 248 CUGAGCUCC 251 (NH2C6)GfuUfgGf 252 pCfsUfgAfgCfuCfcAf UGGAGCUCAG AUUCACCAAC uGfaAfuGfgAfgCf uUfcAfcCfaAfc(invdT) uCfaGf(invdT) 247 GUUGGUGAA 248 CUGAGCUCC 251 (NH2C6)GfuUfgGf 255 pCfsUfgAfgCfuCfcAf UGGAGCUCA AUUCACCAA uGfaAfuGfgAfgCf uUfcAfcCfaAfcdTsdT uCfaGf(invdT) 249 GGUCCUGUU 250 AUUCACCAA 253 (NH2C6)GfgUfcCf 254 pAfsUfuCfaCfcAfaCf GUUGGUGAAU CAACAGGACC uGfuUfgUfuGfgUf aAfcAfgGfaCfcdTsdT gAfaUf(invdT)