Storage stable recombinant lentiviral vector preparation

Abstract

Herein is provided a recombinant lentiviral vector preparation, in which the preparation comprises: a) an effective dose of the recombinant lentiviral vector; b) a histidine hydrochloride buffer for keeping a pH value of the preparation in the range of 6.0-8.0; and c) a carbohydrate.

Claims

1. A storage stable recombinant lentiviral vector preparation, wherein said preparation comprises: a) an effective dose of a recombinant lentiviral vector, wherein said recombinant lentiviral vector is a simian immunodeficiency virus (SIV) vector or a human immunodeficiency virus (HIV) vector and wherein said SIV or HIV vector is coated with vesicular stomatitis virus G protein; b) a histidine hydrochloride buffer at a concentration of 1-50 mM for maintaining recombinant lentiviral vector stability and keeping a pH value of said preparation in the range of 6.0-8.0; and c) a sugar selected from the group consisting of glucose, fructose, trehalose, and sucrose.

2. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector further comprises any one sequence selected from the group consisting of the central polypurine tract, the post-transcriptional regulatory element of woodchuck hepatitis virus, the constitutive transport element, the RNA transport element, and the accessory gene Vpx of HIV-1 virus.

3. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector is said recombinant HIV.

4. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector is said recombinant SIV vector, and said SIV vector comprises a human pigment epithelium-derived factor gene or small RNA fragments interfering with replication of HIV virus.

5. The recombinant lentiviral vector preparation according to claim 1, wherein dosage of said recombinant lentiviral vector is 210.sup.6-210.sup.10 Tu/ml.

6. The recombinant lentiviral vector preparation according to claim 5, wherein the dosage of said recombinant lentiviral vector is 510.sup.6-210.sup.10 Tu/ml.

7. The recombinant lentiviral vector preparation according to claim 1, wherein the pH value of said preparation is in the range of 6.5-7.4.

8. The recombinant lentiviral vector preparation according to claim 7, wherein the pH value of said preparation is 7.2.

9. The recombinant lentiviral vector preparation according to claim 1, wherein the molar concentration of histidine hydrochloride is in the range of 10-50 mmol/L.

10. The recombinant lentiviral vector preparation according to claim 9, wherein the molar concentration of histidine hydrochloride is 10 mmol/L.

11. The recombinant lentiviral vector preparation according to claim 1, wherein said sugar is trehalose.

12. The recombinant lentiviral vector preparation according to claim 1, wherein said sugar is in the range of 2-10% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation.

13. The recombinant lentiviral vector preparation according to claim 12, wherein said sugar is in the range of 5-10% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation.

14. The recombinant lentiviral vector preparation according to claim 13, wherein said sugar is 10% or 5% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation.

15. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation comprises: a) a recombinant SIV vector comprising the human pigment epithelium-derived factor gene at a dosage of 510.sup.6-510.sup.8 Tu/ml; b) 10 mmol/L of the histidine hydrochloride buffer for keeping the pH value of said preparation in the range of 7.2; and c) trehalose at a concentration of 10% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

16. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation comprises: a) a recombinant SIV vector comprising the human pigment epithelium-derived factor gene at a dosage of 510.sup.6-510.sup.8 Tu/ml; b) 10 mmol/L of the histidine hydrochloride buffer for keeping the pH value of said preparation in the range of 7.2; and c) glucose at a concentration of 5% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

17. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises an isosmotic agent, and the osmolality of the recombinant lentiviral vector preparation comprising the isosmotic agent is 0.6%-2.7% of sodium chloride solution.

18. The recombinant lentiviral vector preparation according to claim 17, wherein said isosmotic agent is NaCl.

19. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises 2 mmol/L of MgCl.sub.2.

20. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises a surface active agent at a concentration of 0.005-0.015% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

21. The recombinant lentiviral vector preparation according to claim 20, wherein said surface active agent is Tween-20, Tween-80, or polyoxyethylene hydrogenated castor oil RH-40.

22. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises a preserving agent at a final concentration of 0.001-1.0% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

23. The recombinant lentiviral vector preparation according to claim 22, wherein said preserving agent is phenol at a concentration of 0.5-1.0% by percent weight in volume on the basis of aqueous solution of phenol.

24. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises at least one of mannitol or glycerol.

25. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises at least one of human serum albumin or bovine serum albumin.

26. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises at least one of histidine, glycine, alanine, or lysine.

27. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises an antioxidant at a concentration of 0.01-1.0% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

28. The recombinant lentiviral vector preparation according to claim 27, wherein said antioxidant is (a) sodium sulfite or sodium bisulphite at a concentration of 0.1-0.2% by percent weight in volume on the basis of the recombinant lentiviral vector preparation, or (b) sodium thiosulfate at a concentration of 0.1% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

29. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises (a) dimethyl sulphoxide at a concentration of 5-50% by percent weight in volume or (b) polyprene at a concentration of 2-20% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation.

30. The recombinant lentiviral vector preparation according to claim 1, wherein said recombinant lentiviral vector preparation further comprises a cytokine required for growth of hematopoietic stem cells or peripheral blood monocytes, at a concentration of 5-10% by percent weight in volume on the basis of the recombinant lentiviral vector preparation.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 at 37 C.;

(2) FIG. 2 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 at 25 C.;

(3) FIG. 3 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 at 4 C.;

(4) FIG. 4 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 at 20 C.;

(5) FIG. 5 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 at 80 C.;

(6) FIG. 6 represents the curves of the stabilities of Formulas 2, 6 and Comparable examples 1-4 under the condition of freeze-thaw cycles.

DETAILED EMBODIMENTS

(7) The recombinant lentiviral vector preparation provided in the present invention comprises:

(8) a) an effective dose of the recombination lentiviral vector,

(9) b) a histidine hydrochloride buffer for keeping a pH value of the preparation in the range of 6.0-8.0, and

(10) c) a carbohydrate.

(11) A viral vector in the present invention refers to a virus particle which lacks self-replication ability and has a capability of introducing a nucleic acid molecule into a host. A lentiviral vector refers to a viral vector derived from a primate immunodeficiency virus. The lentiviral vector comprises genetic information required for packaging, transfection, and stable integration which is the main component of the lentiviral vector system. A lentiviral vector carrying an exogenous genes is packaged into an infectious virus particles via virus packaging with the aid of the lentiviral packaging plasmids and cell-lines. The infectious virus particles infects a cell or a vital tissue to achieve expression of the exogenous gene in the cell or the vital tissue. A recombinant viral vector refers to a viral vector constructed by gene recombinant technologies. The recombination viral vector comprises a viral vector constructed by using a DNA encoding the viral genome and a packaging cell.

(12) The recombinant lentiviral vector in the present invention can further be pseudotyped with VSV-G. Pseudotyped with VSV-G refers to the envelope of recombinant lentiviral vector comprises VSV-G protein, a surface glycoprotein of vesicular stomatitis virus (VSV). The VSV-G protein may derive from any one of the VSV strains. For example, without being limited, VSV-G protein from the Indiana serotype strain can be used (J. Virology 39: 519-528 (1981)). Furthermore, VSV-G protein may be a derivative of the naturally occurring protein which is a modified protein obtained by substitution, deletion, and/or addition of one or more amino acids. VSV-G pseudotyped vector can be prepared by co-existing of VSV-G protein with the virus during the production of the virus. For example, a virus particle produced by a packaging cell can be pseudotyped with VSV-G by transfecting the packaging cell with a VSV-G expression vector and inducing to express the VSV-G gene integrated into the host's chromosomal DNA, or by expressing the VSV-G in the packaging cell. The VSV-G protein is a glycoprotein which can form a stable trimmer in the cell membrane, thus the vector particle will not be disrupted during purification and can be concentrated by centrifugation into the vector particle with a high concentration (Yang, Y. et al, Hum Gene Ther: September, 6(9), 1203-13. 1995). Preferably, the recombinant lentiviral vector is a lentiviral vector coated with vesicular stomatitis virus G protein.

(13) The recombinant lentiviral vector in the present invention can further comprise an envelope protein from other viruses. For example, the envelope protein is preferably from a virus which can infect a human cell. The envelope protein includes, but is not limited to, for example the amphotropic retrovirus envelope protein and so on. As the amphotropic retrovirus envelope protein, for example, the envelope protein from murine leukemia virus (MuMLV) 4070A strain can be employed. Additionally, the envelope protein from MuMLV 10A1 can also be used (e.g. pCL-10A1 (Imgenex) (Naviaux, R, K. et. al., J. Virol. 70:5701-5705 (1996)). Furthermore, the examples of the proteins from the family of Herpesviridae include gB of herpes simplex virus, gD of herpes simplex virus, gH of herpes simplex virus, gp85 of herpes simplex virus, gp350 of EB virus and gp220 of EB virus, etc. the examples of the proteins from the family of Hepadnaviruses include S protein of Hepatitis B virus and so forth. The envelope protein can also be formed by fusion of a glycoprotein of measles virus and other single-chain antibodies (Funke S. et al., Mol Ther 16:1427-36, 2008; Frecha C. et al., Blood, 114:3173-80, 2009).

(14) A lentiviral vector is generally packaged by transient transfection or packaging with cell lines. For example, the human cell strain used as a packaging cell in the transient transfection includes 293 cell, 293T cell, 293FT cell, 293LTV cell, 293EBNA cell and other clones isolated from 293 Cell; SW480 cell, u87MG cell, HOS cell, C8166 cell, MT-4 cell, Molt-4 cell, HeLa cell, HT1080 cell, and TE671 cell, etc. The simian cell strain used as a packaging cell is, for example, COS1 cell, COS7 cell, CV-1 cell, BMT10 cell and the like. Moreover, calcium phosphate and PEI are commonly used as transfection reagents, and some other transfection reagents such as Lipofectamine 2000, FuGENE and S93 fectin are often used.

(15) Some lentiviral packaging cell lines, e.g. the most commonly used stable cell-lines generated with Env glycoprotein, VSVG protein or HIV-1 gag-pol protein, are also used in packaging a lentivirus.

(16) For safety, the lentiviral vector system is used on large scale in the form of separated genomes, i.e., genes with different accessory functions are localized in different plasmids. Currently, there are a four plasmid system (where the gag-pol gene, Rev gene, VSVG gene, and SIN transfer gene are located in four different plasmids respectively), a three plasmid system (where the gene encoding for Rev is removed and the gag-pol gene of the gag-pol plasmid uses preferred codons in a human cell) and a two plasmid system (where the accessory genes essential for packaging of lentiviral vector are located in the same plasmid and these accessory genes are the single-copy gene sequence, and the other plasmid is a transgenic plasmid). Also, systems comprising more than four plasmids are in use.

(17) The recombinant lentiviral vector preparation mentioned in the present invention can essentially be completely purified. The purification methods comprise using known purification/separation processes, such as filtration with a filter, ion exchange chromatography, ultra-filtration, molecular sieve, nuclease digestion, and filter sterilization. Generally, a high speed centrifugal process is also used on small-scale preparation. For example, the vector can be deposited and concentrated by filtration of the vector suspension with a 0.45 m filter and centrifugation at 4 C. at 4,2500g for 90 min.

(18) Preferably, the recombinant lentiviral vector is a primate recombinant lentiviral vector, i.e., a recombinant human immunodeficiency virus vector (HIV), a recombinant simian immunodeficiency virus vector (SIV), or a non-primate recombinant lentiviral vector, i.e., a recombinant equine infectious anemia virus (EIVA), a recombinant feline immunodeficiency virus (FIV), or a recombinant caprine arthritis-encephalitis virus (CAEV).

(19) Preferably, the recombinant lentiviral vector is a recombinant human immunodeficiency virus vector or a recombinant simian immunodeficiency virus vector. A simian immunodeficiency virus (SIV) vector mentioned in the present invention refers to a vector in which the sequences essential for the functions of the viral vector are those derived from SIV genome. The sequences essential for the functions of the viral vector in the present invention refer to the sequences of the R region of 5LTR, U5 region, the packaging signal (), RRE, the U3 and R regions excluding the promoter region of 3LTR by starting from the 5 terminus in sequence. A SIV vector in the present invention can also be modified, so long as it falls within the above-mentioned definition. For example, other sequences derived from SIV or non-SIV can also be comprised in the vector, so long as the sequences essential for the functions of the viral vector is derived from SIV. With respect to the most appropriate sequence that can be comprised in the vector, it may be cPPT (central polypurine tract), internal promoter (CMV), or woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

(20) In the present invention, the simian immunodeficiency virus includes all SIV strains and sub-types thereof. Examples of an isolated SIV strain include, but is not limited to, SIVagm, SIVcpz, SIVmac, SIVmnd, SIVsm, SIVsnm, and SIVsyk, etc.

(21) A human immunodeficiency virus (HIV) vector in the present invention refers to a vector in which the sequences essential for the functions of the viral vector are those derived from HIV genome. Among them, the HIV-1 vector contains HIV cis-acting sequences required for packaging, reverse transcription and integration and has a multi-cloning site under the control of a heterologous promoter and a gene of interest inserted at the site. The HIV-1 cis-acting sequences on the vector plasmid typically comprise the LTRs at both ends, a splicing site, and the packaging signal LP, etc. A HIV vector in the present invention can also be modified, so long as it falls within the above-mentioned definition. For example, other sequences derived from HIV or non-HIV can also be comprised in the vector, so long as the sequences essential for the functions of the viral vector is derived from HIV. With respect to the most appropriate sequence that can be comprised in the vector, it may be cPPT (central polypurine tract), internal promoter (CMV), woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).

(22) In the present invention, the human immunodeficiency virus includes all HIV strains and sub-types thereof. HIV includes two types of viral strains: HIV-1 and HIV-2. HIV-1 is divided into M, O, N sub-type groups. M sub-type group includes sub-types A, A2, B, C, D, E, F1, F2, G, H, J, K, while O and N sub-types is scarcely seen. HIV-2 includes A, B, C, D, E, F, G sub-types. HIV-2 has biological properties similar to those of HIV-1, but has less virulence.

(23) The recombinant lentiviral vector can be a SIV or HIV vector carrying any gene of interest. Preferably, the recombinant lentiviral vector is any one of the following virus vectors: a recombinant simian immunodeficiency virus vector carrying the human pigment epithelium-derived factor gene, a recombinant human immunodeficiency virus vector carrying the human pigment epithelium-derived factor gene, a recombinant simian immunodeficiency virus vector carrying small RNA fragments interfering with the replication of HIV virus, and a recombinant human immunodeficiency virus vector carrying small RNA fragments interfering with the replication of HIV virus.

(24) The recombinant lentiviral vector can be a recombinant simian immunodeficiency virus vector or a recombinant human immunodeficiency virus vector carrying gene of epidermal growth factor EGF, fibroblast growth factor FGF2, ciliary neurotrophic factor CNTF, GDNF, BDNF, LEDGF, EPO, NT-3, NT-4, and/or RdCVF, etc.

(25) Pigment epithelium-derived factor (PEDF), is a member of the serine protease superfamily, which has highly conserved sequence and unique molecular structure. PEDF is becoming a hotspot in the studies due to possessing a variety of functions such as nerve nutrition, suppression of neovascularization, anti-tumor, etc. Function of PEDF in suppression of neovascularization is particularly important. PEDF plays a key role in retinitis pigmentosa, retinal detachment, retina ischemic disorder. The lentiviral vectors provide a particularly suitable way for drug delivery because they enable introduced exogenous genes to be integrated stably into the chromosome in the dividing cells and to allow persistent expression in the host.

(26) A recombinant simian immunodeficiency virus vector carrying the pigment epithelium-derived factor gene of the present invention (SIV-PEDF vector) refers to a recombination SIV vector carrying a PEDF gene. The SIV-PEDF vector of the present invention is independent of species or structures, so long as it falls within the above-mentioned definition. The SIV-PEDF vector can be a SIV-PEDF vector having any one of base sequences mentioned in Pat. Appl. No. 200680012882.7.

(27) A recombinant human immunodeficiency virus vector carrying the pigment epithelium-derived factor gene of the present invention (HIV-PEDF vector) refers to a recombination HIV vector carrying a PEDF gene.

(28) Preferably, the recombinant lentiviral vector is a recombinant simian immunodeficiency virus vector or a recombinant human immunodeficiency virus vector carrying small RNA fragments interfering with the replication of HIV virus. The small RNA fragments interfering with the replication of HIV virus (abbreviated herein as siHIV) may be selected from one or more of SEQ ID Nos. 1-9 mentioned in ZL02156785.9.

(29) Preferably, the recombinant lentiviral vector carries some single-copy genes, e.g. RPE65 and the like. Mutation and deletion in these genes typically lead to some hereditary diseases. A better therapeutic effect will be attained by re-infusing the particular stem cells, which is infected with the lentiviral vector carrying some correct genes, into the patient's body.

(30) Preferably, the recombinant lentiviral vector also carries the central polypurine tract and/or the post-transcriptional regulatory element of woodchuck hepatitis virus. Furthermore, the gene transfer vector DNA has better be modified to increase the efficiency in introduction and expression of PEDF gene. The examples of increasing the efficiency in introduction include the HIV vectors or SIV vectors into which cPPT, WPRE, constitutive transport element CTE, RNA transport element RTE or accessory gene Vpx from HIV-1 virus can be introduced.

(31) Among the sequences, cPPT is a sequence originally present in the SIV genome. In the HIV virus, cPPT had been noted long before in a report (P. Charneau et al., J. Virol 65:2415-2431, 1991) that the efficiency in gene introduction is increased because the transfer of the vector genome into the cell nucleus is accelerated after introducing the cPPT into a HIV vector (A. Sirven et al., Blood 96: 4103-4110, 2000). WPRE is a factor having a function of increasing the efficiency of gene expression (U.S. Pat. No. 6,284,469: RNA export element and methods of use). It had been reported that introduction of both factors of cPPT and WPRE into other lentiviral vectors can further increase the effects of each other (SC. Barry et al., Hum. Gene Ther. 12:1103-1108, 2001).

(32) In the SIV vector carrying a PEDF gene of the present invention, cPPT can be localized in the same manner as that in a typical lentiviral vector. For example, cPPT can be localized between the promoter and the exogenous gene, or at upstream of the RRE sequence, preferably at upstream of the above-mentioned non-LTR promoter driving transcription of the carried gene. WPRE can be localized at down-stream of the carried gene of interest such as PEDF or FGF2 gene.

(33) Said recombinant lentiviral vector also carries accessory gene Vpx. The accessory gene Vpx helps increasing the transduction efficiency for myeloid cells, such as monocytes, macrophages, dendritic cells, etc. (Goujon C. et al., Gene Ther 13:991-994 (2006); Goujon C. et al., J Virol 82:12335-45 (2008); Muhlebach M. D. et al., Mol Ther 12:1206-16, (2005); Wolfrum N. et al., Virology 364:330-41, (2007)).

(34) The recombinant lentiviral vector also carries the CTE sequence capable of replacing the REV and RRE sequences (von Gegerfelt A. S. and Felber B. K., Virology 232:291-299, 1997; Zolotukhin A. S. et al., J Virol. 68:7944-7952).

(35) The dosage of the recombinant lentiviral vector is 210.sup.6-210.sup.10 transducing unit/milliliter (Tu/ml). The dosage of the recombinant lentiviral vector is 510.sup.6-210.sup.10 Tu/ml. Preferably, the dosage of the recombinant lentiviral vector is 510.sup.6-510.sup.8 Tu/ml, and the preferred dosage is 510.sup.6-210.sup.7 Tu/ml.

(36) The pH value of the preparation is in the range of 6.5-7.4. The pH value of the preparation is 7.2.

(37) The molar concentration of histidine hydrochloride is in the range of 1-50 mmol/L. The molar concentration of histidine hydrochloride is in the range of 10-50 mmol/L. The molar concentration of histidine hydrochloride is 10 mmol/L.

(38) The carbohydrate is at least one selected from a monosaccharide and a non-reducing disaccharide. It is more preferable that the carbohydrate is at least one selected from glucose, fructose, trehalose and sucrose. Percent weight in volume for the carbohydrate is in the range of 2-10% (w/v), on the basis of the recombinant lentiviral vector preparation. It is more preferable that percent weight in volume for the carbohydrate is in the range of 5-10% (w/v), on the basis of the recombinant lentiviral vector preparation. It is most preferable that percent weight in volume for the carbohydrate is 10% (w/v) or 5% (w/v), on the basis of the recombinant lentiviral vector preparation.

(39) The recombinant lentiviral vector preparation comprises:

(40) a) the recombinant simian immunodeficiency virus vector carrying the human pigment epithelium-derived factor gene at a dosage of 210.sup.6-210.sup.10 Tu/ml;

(41) b) 10 mmol/L of the histidine hydrochloride buffer for keeping the pH value of said preparation in the range of 7.2; and

(42) c) trehalose at a concentration of 10% by percent weight in volume (w/v) on the basis of the recombinant lentiviral vector preparation.

(43) Wherein the dosage of component a) in the recombinant lentiviral vector preparation is preferably 510.sup.6-510.sup.8 Tu/ml, more preferably 510.sup.7-510.sup.8 (Tu/ml).

(44) The recombinant lentiviral vector preparation comprises:

(45) a) a recombinant simian immunodeficiency virus vector carrying the human pigment epithelium-derived factor gene at a dosage of 210.sup.6-210.sup.10 Tu/ml;

(46) b) 10 mmol/L of a histidine hydrochloride buffer for keeping the pH value of said preparation in the range of 7.2; and

(47) c) glucose at a concentration of 5% by percent weight in volume (w/v) on the basis of the recombinant lentiviral vector preparation.

(48) wherein the dosage of component a) in the recombinant lentiviral vector preparation is preferably 510.sup.6-510.sup.8 Tu/ml, more preferably 510.sup.7-510.sup.8 Tu/ml.

(49) The recombinant lentiviral vector preparation further comprises an isosmotic agent. The NaCl isosmotic equivalent of the isosmotic agent corresponds to 0.6%-2.7% of sodium chloride solution. The osmolality tolerable for the eye corresponds to 0.6%-2% of sodium chloride solution; 0.45%-2.7% of sodium chloride solution is tolerable for intra-muscular injection; the osmolality specified in the Chinese Pharmacopoeia is 0.9-1.1, corresponding to 0.8%-1.1% of sodium chloride solution; the osmolality of the serum is typically about 285 mosm/kg and varies in the range of approximately 275-300 mosm/L corresponding to 0.83%-0.91% of NaCl solution. The isosmotic agent is NaCl. Keeping the recombinant lentiviral vector under isosmotic concentrations is advantageous for long-term storage of the virus preparations and for avoiding disintegration of the viral vector due to the low osmotic pressure; on the other hand, the isosmotic virus preparation can be delivered into human body in a painless or substantial painless way and is easy to be assimilated by the human body.

(50) The recombinant lentiviral vector preparation further comprises 2 mmol/L MgCl.sub.2.

(51) The recombinant lentiviral vector preparation further comprises a surface-active agent at a concentration of 0.005-0.015% by percent weight in volume (w/v), on the basis of the recombinant lentiviral vector preparation. The surface-active agent is at least one selected from of Tween-20, Tween-80, and polyoxyethylene hydrogenated castor oil RH-40.

(52) The recombinant lentiviral vector preparation further comprises a preserving agent at a final concentration of 0.001-1.0% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation. The preserving agent is phenol at a concentration of 0.5-1.0% by percent weight in volume (w/v), on the basis of aqueous solution of phenol.

(53) The recombinant lentiviral vector preparation further comprises mannitol. The content of mannitol is 0.5-30% by volume, preferably 5-25%, on the basis of the recombinant lentiviral vector preparation. The major role of mannitol in the preparation is to prevent effectively proteins from denaturation and protect the viral coat proteins from deactivation when the preparation is stored at a low temperature. On the other hand, if the preparation is to be formulated into a lyophilized dosage form, mannitol acts as a skeleton, favorable for shaping as well as accelerating redissolution; if the preparations is to be formulated into a tablet, mannitol as a excipient provides the performance including no hygroscopicity, rapid desiccation, good stability, excellent palatability, and good granulating property for the tablet.

(54) The recombinant lentiviral vector preparation further comprises glycerol. The content of glycerol is 5-30% by volume, preferably 10-30%, on the basis of the recombinant lentiviral vector preparation. Since glycerol has three alcoholic hydroxyl groups and superior water-solubility, it can increase the stability of the lentiviral vector preparation in the histidine hydrochloride buffer. Moreover, glycerol has a certain degree of amphiphilicity to form a protective layer for the amino acid residues on the lentiviral vector envelope protein, thus increasing the stability of the lentiviral vector to some degree. Furthermore, glycerol as an isosmotic adjusting agent, a winterizing agent, a taste-masking agent is a safest excipient and favorable for shaping of the lentiviral vector preparation by freeze-drying if the preparation is to be formulated into a lyophilized dosage form.

(55) Said recombinant lentiviral vector preparation further comprises human serum albumin and/or bovine serum albumin. Percent weight in volume for the albumin is 0.5-5%, preferably 1-3%, on the basis of the recombinant lentiviral vector preparation. Human serum albumin has affinity for the envelope glycoprotein of the lentiviral vector, in particular for VSVG envelope protein, therefor increasing the stability of the lentiviral vector preparation.

(56) The recombinant lentiviral vector preparation further comprises at least one of histidine, glycine, alanine and lysine. Preferably, 0.1 mM-10 mM of histidine is comprised. Amino acids can increase tension between the envelope protein of the lentiviral vector, especially the VSVG envelope protein and histidine hydrochloride buffer, and therefor increase the degree of hydration of the envelope protein of the lentiviral vector, so that the stability of the preparation is enhanced. When the preparation is to be formulated into a lyophilized dosage form, higher viral activities will be maintained due to amino acids which increase the degree of hydration of the envelope protein of the lentiviral vector and alleviate the damage of mechanic shear to the envelope protein to facilitate crystallization of the lentiviral vector and to reduce aggregation of the lentiviral vector during lyophilization.

(57) The recombinant lentiviral vector preparation further comprises an antioxidant at a concentration of 0.01-1.0% by percent weight in volume (w/v), on the basis of the recombinant lentiviral vector preparation. The antioxidant is sodium sulfite or sodium bisulphite at a concentration of 0.1-0.2% by percent weight in volume (w/v), on the basis of the recombinant lentiviral vector preparation, or sodium thiosulfate at a concentration of 0.1% by percent weight in volume (w/v), on the basis of the recombinant lentiviral vector preparation.

(58) The recombinant lentiviral vector preparation further comprises dimethyl sulfoxide (DMSO) at a concentration of 5-50% or polyprene at a concentration of 2-20% by percent weight in volume, on the basis of the recombinant lentiviral vector preparation. DMSO or polyprene can increase the infection efficiency and the stability of the preparation.

(59) The recombinant lentiviral vector preparation further comprises the cytokines required for growth of hematopoietic stem cells or peripheral blood monocytes, at a concentration of 5-10% by percent weight in volume on the basis of the recombinant lentiviral vector preparation. These cytokines increase the concentration and the stability of the preparations. For example, the cytokines are granulocyte colony stimulating factor, IL-3, IL-7, IL-11, SCF, G-SCF, GM-SCF and the like.

(60) when a recombinant lentiviral vector preparation in the present invention is administered by injection or when non-biocompatible ingredients of recombinant lentiviral vector in the present invention have been removed according to the subject's condition in vivo, the injection dose can be common one in the field, up to 300 microliters, typically 1-200 microliters, preferably 50-150 microliters; if the preparation is injected into the subretinal space in human being, a single injection dosage for each of the eyes is 50-150 microliters, preferably 100 microliter. The effective dosage administered to a human subject is typically 210.sup.6-210.sup.10 Tu/individual.

(61) The present invention will be further illustrated in combination with the following examples. The reagents and culture media used in the present invention are commercially available products unless specifically specified.

PREPARATION EXAMPLE

Preparation Example 1. Preparation of a SIV Lentiviral Vector Carrying PEDF and Determination of Titer Thereof

(62) 1. Preparation of a SIV Lentiviral Vector Carrying PEDF

(63) a SIV gene transfer vector, a packaging vector, a rev expression vector, and a VSV-G expression vector were obtained with reference to the method in the patent CN200680012882 and the hPEDF fragment is introduced into the gene transfer vector. Among them, the obtained gene transfer vectors include three types, ie., a gene transfer vector with the cPPT fragment alone, a gene transfer vector with the WPRE fragment alone and a gene transfer vector with both cPPT and WPRE fragments.

(64) The cell line 293T cells derived from human fetal kidney cells were seeded at a cell density of approximate 110.sup.7 cell per plastic Petri dish having the diameter of 15 cm (cell density of 70-80% next day) and cultured in 20 ml of D-MEM culture medium (Gibco BRL) supplemented with 10% fetal bovine serum for 24 hrs. After 24 h of cultivation, the culture medium was replaced with 10 ml of OPTI-MEM culture medium (Gibco BRL), as transfected cells, it is ready for use.

(65) For one petri dish, 10 g of the gene transfer vector, 5 g of the packaging vector, 2 g of the rev expression vector and 2 g of VSV-G expression vector were dissolved in 1.5 ml of OPTI-MEM medium, and 40 l of PLUS Reagent reagent (Invitro Co.) was added. The resulting mixture was stirred and left at room temperature for 15 min. Adding the dilute solution which was obtain by diluting 60 l of LIPOFECT AMINE Reagent with 1.5 ml of OPTI-MEM medium was added, the resulting mixture was stirred and left at room temperature for 15 min. The resulting DNA-complex was dropped onto the cells in the above-described Petri dish having the diameter of 15 cm. The Petri dish was shook carefully to achieve uniform mixing, and then incubated in a incubator at 37 C., 5% CO.sub.2 for 3 hrs. 13 ml of D-MEM medium comprising 20% of fetal bovine serum was added into the above-mentioned petri dish and cultured.

(66) Next day after transfection, the D-MEM medium was replaced with 30 ml of a fresh DMEM medium containing 10% of fetal bovine serum. Two days after transfection, the supernatant was recovered and 20 ml of the fresh medium was added. The recovered supernatant was filtered with a 0.45 m filter and stored at 4 C. Three days after transfection, the supernatant was recovered, filtered with a 0.45 m filter and mixed with the recovered supernatant the day before. The mixture was concentrated with a high-speed centrifuge. The recovered suspensions were aliquoted among sterilized test tubes, and then centrifuged at 4 C. at 4,2500 g for 1 h. The centrifugation procedure was repeated twice to concentrate the vector suspension by 500-1000 times. The vector was deposited as a deposition and the deposition was dissolved with D-PBS. The concentrated vector was subjected to column chromatography (GE Healthcare, XK16/100, filler 4FF (Sepharose 4 Fast Flow), injection rate: 1.5 ml/min, bed height: 90 cm) and the first peak was collected. The collected samples were filtered with a 0.22 m filtration membrane and were aliquoted. A few of aliquots were used in titer determination, the others were stored at 80 C. until use.

(67) 2. Titer Determination

(68) The titer of the lentiviral vector includes a functional titer calculated by the number of the cells expressing the protein of the carried gene (Functional titer: TU/ml). The HEK293T cells were seeded at a certain density (210.sup.5/well) in a 24-well plate (BD company) and 0.5 ml of the mixture of the cell with D-MEM medium (Gibco BRL) containing 10% fetal bovine serum was added to each of wells. The 24-well plate was placed and cultured in a CO.sub.2 incubator at 37 C. for 24 h. The stock solution of the virus carrying both cPPT and WPRE fragments prepared as above and the negative control D-PBS were diluted with OPTI-MEM medium respectively. The 10-fold serial dilutions of the virus solution were marked as Dilution 1 ( 1/10 of the original concentration), Dilution 2 ( 1/10.sup.2 of the original concentration), Dilution 3 ( 1/10.sup.3 of the original concentration), Dilution 4 ( 1/10.sup.4 of the original concentration), and Dilution 5 ( 1/10.sup.5 of the original concentration) respectively. The 10-fold serial dilutions of the negative control were marked as Negative control 1-5 for use.

(69) Cells were rinsed with 0.5 ml/well of OPTI-MEM (Gibco BRL), with gentle manipulation for avoiding cell detachment. The diluted virus solution and the diluted negative control mentioned above were subsequently added to HEK293T cells, and the diluted virus solution and the negative control at different concentration are respectively in triplicates (200 L/well). The corresponding signs are marked clearly. The 24-well plates with the infective virus solution were placed and cultured in a CO.sub.2 incubator at 37 C. for cultivation. After 24 hrs, the plates were supplemented with a DMEM medium containing 20% fetal bovine serum (200 L/well). The plates were placed and cultured in a CO.sub.2 incubator at 37 C. for 24 hrs.

(70) Subsequently, a immunofluorescence detection was performed. Specifically, the supernatants were pipetted and discarded. The plates were rinsed with 500 l/well of D-PBS stored at 4 C. once. The D-PBS was pipetted and discarded. 500 L/well of cooled absolute ethanol (30 C.) was added and left at 4 C. for 10 min. The absolute ethanol was pipetted and discarded. The plate were dried at room temperature for 5 min. The cells were rinsed with 500 l/well of D-PBS of room temperature and 100 l/well of a primary antibody is added (Human Serpin F1/PEDF specific polyclonal goat IgG, R&D, Cat. No. AF1177, 1.5 g/ml). The plates were placed in an incubator at 37 C. for 1 h, with shaking once every 15 min. The primary antibody was pipetted and discarded, the cells were rinsed twice with 500 l/well of D-PBS of room temperature. The D-PBS was pipetted and discarded and 200 l/well of a secondary antibody was added (Alexa Flour 488 Rabbit Anti-goat IgG, Invitrogen, Cat. No. A-11078). The plates were then placed in the dark in the incubator at 37 C. for 1 h with shaking once every 15 min. The cells were rinsed twice with 500 l/well of D-PBS of room temperature and 300 l/well of D-PBS of room temperature (Dulbecco's Phosphate-Buffered Saline) was added. The plates were then placed at 4 C.

(71) Counting: the plates were observed with the 20 lens of a fluorescence microscope. The virus solution with the number of the fluorescent cells between 20 and 80 per visual field were selected as a sample, and the sample was photographed in the mode of selecting six points per well according to a pentagram format, i.e. five apexes of the pentagram and the central point of the pentagram for counting.

(72) The titer of the virus solution was calculate according to the following formula: titer of the virus solution (TU/ml)=the number of the fluorescent cells per visual fielddilution factor345.36.

(73) It was known from the above calculation that the titer of the virus solution was 210.sup.10 TU/ml wherein the virus solution is obtained through the expression vector carrying both cPPT and WPRE fragments constructed in the Preparation Example 1.

(74) According to the same method as the above, the titers of the virus solutions obtained through the expression vectors carrying cPPT fragment alone were determined to be 110.sup.8 TU/ml, and the titers of the virus solutions obtained through the expression vectors carrying WPRE fragment alone were determined to be 310.sup.8 TU/ml.

(75) Preparation examples of the lentiviral vector preparation include, but are not limited to, the viral vector carrying both cPPT and WPRE fragments. The following lentiviral vector preparations can be any viral vector obtained by equivalent replacement or modification for the viral vector in the present invention.

Preparation Example 2. Preparation of a HIV Lentiviral Vector Carrying PEDF and Determination of Titer Thereof

(76) 2-1. Construction of the Recombination Lentivirus Gene Transfer Vector HIV-hPEDF

(77) The hPEDF CDS fragment was PCR amplified from cDNA of the human Retinal pigment epithelium cell strain ARPE-19 (purchased from American type culture collection, ATCC) as a template using the following primers:

(78) TABLE-US-00001 (SEQIDNO:1) hPEDF-Forword(forwardprimer): atgcaggccctggtgctactcc; (SEQIDNO:2) hPEDF-Reverse(reverseprimer): ttaggggcccctggggtccag.

(79) Cycling conditions for the PCR reaction were as follows: denaturation at 95 C. for 5 min, 40 cycles of 95 C., 30 s; 60 C., 1 min; 72 C., 45 s, final elongation at 72 C. for 10 min.

(80) The hPEDF fragment obtained by gel recovery was ligated into the pLenti6.3/V5-TOPO vector (Invitrogen) by TA cloning procedure following the manufacturer's instruction. The sequence of the ligated hPEDF fragment was verified by sequencing.

(81) 2-2. Large-Scale Preparation of the HIV Lentiviral Vector Carrying the hPEDF Sequence

(82) The HIV lentiviral vector carrying the hPEDF sequence was prepared on large-scale according to the method in the Preparation Example 1 and the titer of the HIV lentiviral vector was determined. The titer of the virus solution of HIV lentiviral vector carrying the hPEDF sequence was determined to be 210.sup.10 TU/ml.

Preparation Example 3. Preparation of the Lentiviral Vector Preparation

(83) (1) Preparation of the Lentiviral Vector Preparation of Formula 2

(84) 1. Preparing a preservation solution for the lentiviral vector: 150 ml of 10 mM histidine hydrochloride buffer was measured, 20 g of trehalose was added, the resulting mixture was stirred to mix well, and diluted with 10 mM histidine hydrochloride to 200 ml and the pH is adjusted to 7.2 for use.

(85) 2. Formulation of the Preparation of Formula 2

(86) 210.sup.10 TU/ml of the viral vector obtained in the Preparation Example 2 was diluted with D-PBS to 5.410.sup.7 Tu/ml, 1 ml of the dilution was pipetted into a labelled ultra-filtration tube and diluted with the above-mentioned preservation solution to 15 ml. After centrifugation at 4 C., 3000 rpm/min for 2-3 min, the supernatant was discarded and 3 ml of the remaining liquid was retained. The retained liquid was diluted with the above-mentioned preservation solution to 15 ml again and re-centrifuged one time at 3000 rpm/min. The final volume of the recombinant lentiviral vector preparation was restricted to be 1 ml.

(87) The preparation was filtered through a 0.22 m filtration membrane and aliquoted sterilely. Any one of the aliquots was titered immediately (within 20 min). All of the above experimental steps were performed on ice at 0 C. The remaining aliquots were flash frozen in liquid nitrogen and then directly stored at 80 C.

(88) 3. Determination of the Titer of the Preparation of Formula 2.

(89) Methods for titer determination is the same as that in Preparation Example 2 and the viral titer of the preparation was determined to be 5.410.sup.7 TU/ml. It shows that the viral titer of the preparation hardly decreases using this method.

(90) (2) Preparation of the Other Formulas in Table 1 and the Comparable Examples in Table 2

(91) The other formulas in Table 1 and the Comparable examples in Table 2 were prepared using the same procedure as in section (1), i.e., the ingredients except the buffer in the formulas were added to the buffer and mixed well. The mixture was diluted to a certain volume. The pH value was adjust to prepare the preservation solution for the viral vector. Then, the preservation solution was substituted for D-PBS to prepare the preparation.

(92) TABLE-US-00002 TABLE 1 Formula of the recombinant lentiviral vector preparation of the present invention histidine stabilizing lentiviral vector hydrochloride agent pH surface-active preservative anti-oxidant Formula number (Tu/ml) (mM) (w/v) others value agent (w/v) agent (w/v) (w/v) 1 2 10.sup.10 SIV-hPEDF 1 5% 6.0 trehalose 2 5.4 10.sup.7 SIV-hPEDF 10 10% 7.2 trehalose 3 2 10.sup.6 SIV-hPEDF 50 7% 7.4 trehalose 4 5 10.sup.6 SIV-hPEDF 1 2% 8.0 glucose 5 2 10.sup.6 SIV-hPEDF 25 3% 6.5 trehalose + 4% glucose 6 5.4 10.sup.7 SIV-hPEDF 10 5% 7.2 glucose 7 5 10.sup.8 SIV-hPEDF 10 5% 2 mM 7.2 sucrose MgCl.sub.2 8 5 10.sup.6 SIV-hPEDF 10 10% 2 mM 7.2 0.01% fructose MgCl.sub.2 Tween-80 9 5.4 10.sup.7 SIV-siHIV 50 10% 5% (w/v) 7.2 0.015% trehalose mannitol Tween-20 10 5 10.sup.6 SIV-siHIV 10 3% 1% 7.4 phenol trehalose + human 0.5% 5% serum glucose + albumin 2% sucrose 11 2 10.sup.6 HIV-hPEDF 10 10% 1% 7.2 0.005% phenol sodium trehalose glycine Tween-80 1.0% sulfite 0.1% 12 5 10.sup.6 HIV-hPEDF 10 5% 20% 7.2 sodium glucose dimethyl sulfite 0.2% sulfoxide 13 5 10.sup.6 HIV-hPEDF 10 5% 5% SCF 7.2 phenol sodium glucose 1.0% sulfite 0.2%

(93) Keeping the recombinant lentiviral vector under isosmotic condition is advantageous for long-term storage of the virus preparations and avoiding disintegration of the viral vector due to the low osmotic pressure, while the isosmotic virus preparation can be delivered in a painless or substantial painless way into human body and easy to be assimilated by the human body. In order to investigate the stability of the above-mentioned formulas, the above-mentioned recombinant lentiviral vector preparations of Formulas 4, 8, and 10 were randomly selected and adjusted with NaCl as the isosmotic agent to NaCl isosmotic equivalent of 0.6%-2.7% of sodium chloride solution.

(94) TABLE-US-00003 TABLE 2 Comparable Examples of the recombinant lentiviral vector preparation Comparable a. SIV-hPEDF of 5.4 10.sup.7 Tu/ml example 1 b. 10 mM hydroxymethyl aminomethane Tris c. 10% trehalose (w/v) d. 2 mM MgCl.sub.2 e. 0.01% Tween-80 f. pH 7.2 Comparable a. 5.4 10.sup.7 Tu/ml SIV-hPEDF example 2 b. D-PBS c. 10% trehalose (w/v) d. 0.01% Tween-80 e. pH 7.2 Comparable a. 5.4 10.sup.7 Tu/ml SIV-hPEDF example 3 b. 10 mM Tris c. 5% glucose (w/v) d. 2 mM MgCl.sub.2 e. 0.01% Tween-80 f. pH 7.2 Comparable a. 5.4 10.sup.7 Tu/ml SIV-hPEDF example 4 b. D-PBS c. 2.5% or 5% glucose (w/v) e. 0.01% Tween-80 f. pH 7.2

Effect Testing Example: The Active Titer Determination of Recombinant Lentivirus Preparations at Different Temperatures

(95) (1) Effect of Different Recombinant Lentiviral Vector Preparations on the Stability of the Recombination Lentivirus at 37 C.

(96) The recombinant lentiviral vector preparations prepared in Examples 1-13 and Comparable examples 1-4 were taken out from the storage circumstance of 80 C. and immediately placed into a water bath of 37 C. The corresponding samples were placed at different time points (48 h, 36 h, 24 h, 0 h). All of the samples was subjected to the active titer determination at the same time. The Determination titer of the viral particles was performed according to the method in the preparation examples. The results were shown in Table 3 and FIG. 1 below.

(97) TABLE-US-00004 TABLE 3 The original Percent of the active Example active titers The active titer titer at 37 C. formulas or prior to at 37 C. for 48 h vs the comparable freeze-thaw for 48 h original active titers examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 7.42 10.sup.9 37.10 formula 1 Example 5.4 10.sup.7 2.38 10.sup.7 44.07 formula 2 Example 2 10.sup.6 7.40 10.sup.5 37.00 formula 3 Example 5 10.sup.6 1.88 10.sup.6 37.60 formula 4 Example 2 10.sup.6 7.20 10.sup.5 36.00 formula 4 Example 5.4 10.sup.7 2.15 10.sup.7 39.81 formula 6 Example 5 10.sup.8 1.85 10.sup.8 37.00 formula 7 Example 5 10.sup.6 1.80 10.sup.6 36.00 formula 8 Example 5.4 10.sup.7 2.01 10.sup.7 37.22 formula 9 Example 5 10.sup.6 1.85 10.sup.6 37.00 formula 10 Example 2 10.sup.6 7.34 10.sup.5 36.70 formula 11 Example 5 10.sup.6 1.84 10.sup.6 36.80 formula 12 Example 5 10.sup.6 1.79 10.sup.6 35.80 formula 13 Comparable 5.4 10.sup.7 1.00 10.sup.7 18.52 example 1 Comparable 5.4 10.sup.7 1.58 10.sup.7 29.26 example 2 Comparable 5.4 10.sup.7 7.20 10.sup.6 13.33 example 3 Comparable 5.4 10.sup.7 3.56 10.sup.6 6.59 example 4

(98) It can be seen form Table 3 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.

(99) (2) Effect of Different Recombinant Lentiviral Vector Preparations on the Stability of the Recombination Lentivirus at 25 C.

(100) The recombinant lentiviral vector preparations formulated in Examples 1-13 and Comparable examples 1-4 were taken out from the storage circumstance of 80 C. and immediately placed into a water bath of 25 C. The corresponding samples were placed at different time points (8 d, 4 d, 2 d, 0 h). All of the samples was subjected to the active titer determination at the same time. The Determination titer of the viral particles was performed according to the method in the preparation examples. The results were shown in Table 4 and FIG. 2 below.

(101) TABLE-US-00005 TABLE 4 The original Percent of the active Example active titers The active titers titers at 25 C. formulas or prior to at 25 C. for 8 d vs the comparable freeze-thaw for 8 d original active titers examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 .sup.1.25 10.sup.10 62.50 formula 1 Example 5.4 10.sup.7 4.00 10.sup.7 74.07 formula 2 Example 2 10.sup.6 1.27 10.sup.6 63.50 formula 3 Example 5 10.sup.6 3.21 10.sup.6 64.20 formula 4 Example 2 10.sup.6 1.26 10.sup.6 63.00 formula 4 Example 5.4 10.sup.7 3.7 10.sup.7 68.52 formula 6 Example 5 10.sup.8 3.17 10.sup.8 63.40 formula 7 Example 5 10.sup.6 3.10 10.sup.6 62.00 formula 8 Example 5.4 10.sup.7 3.44 10.sup.7 63.70 formula 9 Example 5 10.sup.6 3.14 10.sup.6 62.80 formula 10 Example 2 10.sup.6 1.21 10.sup.6 60.50 formula 11 Example 5 10.sup.6 2.98 10.sup.6 59.60 formula 12 Example 5 10.sup.6 2.89 10.sup.6 57.80 formula 13 Comparable 5.4 10.sup.7 2.00 10.sup.7 37.03 example 1 Comparable 5.4 10.sup.7 1.60 10.sup.7 29.63 example 2 Comparable 5.4 10.sup.7 1.30 10.sup.7 24.07 example 3 Comparable 5.4 10.sup.7 9.00 10.sup.6 16.67 example 4

(102) It can be seen form Table 4 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.

(103) (3) Effect of Different Recombinant Lentiviral Vector Preparations on the Stability of the Recombination Lentivirus at 4 C.

(104) The recombinant lentiviral vector preparations formulated in Examples 1-13 and Comparable examples 1-4 were taken out from the storage circumstance of 80 C. and immediately placed into a water bath of 4 C. The corresponding samples were placed at different time points (32 d, 16 d, 8 d, 0 h). All of the samples was subjected to the active titer determination at the same time. The results were shown in Table 5 and FIG. 3 below.

(105) TABLE-US-00006 TABLE 5 The original Percent of the active Example active titers the active titers titers at 4 C. formulas or prior to at 4 C. for 32 d vs the comparable freeze-thaw for 32 d original active titers examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 .sup.1.10 10.sup.10 55.00 formula 1 Example 5.4 10.sup.7 3.60 10.sup.7 66.67 formula 2 Example 2 10.sup.6 1.08 10.sup.6 54.00 formula 3 Example 5 10.sup.6 2.78 10.sup.6 55.60 formula 4 Example 2 10.sup.6 1.01 10.sup.6 50.50 formula 4 Example 5.4 10.sup.7 3.20 10.sup.7 59.26 formula 6 Example 5 10.sup.8 2.57 10.sup.8 51.40 formula 7 Example 5 10.sup.6 2.64 10.sup.6 52.8 formula 8 Example 5.4 10.sup.7 3.01 10.sup.7 55.74 formula 9 Example 5 10.sup.6 2.77 10.sup.6 55.40 formula 10 Example 2 10.sup.6 1.07 10.sup.6 53.5 formula 11 Example 5 10.sup.6 2.69 10.sup.6 53.8 formula 12 Example 5 10.sup.6 2.51 10.sup.6 50.20 formula 13 Comparable 5.4 10.sup.7 1.9 10.sup.7 35.19 example 1 Comparable 5.4 10.sup.7 1.5 10.sup.7 27.78 example 2 Comparable 5.4 10.sup.7 4.5 10.sup.6 8.33 example 3 Comparable 5.4 10.sup.7 3.0 10.sup.6 5.56 example 4

(106) It can be seen form Table 5 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.

(107) (4) Effect of Different Recombinant Lentiviral Vector Preparations on the Stability of the Recombination Lentivirus at 20 C.

(108) The recombinant lentiviral vector preparations formulated in Examples 1-13 and Comparable examples 1-4 were taken out from the storage circumstance of 80 C. and immediately stored at 20 C. The corresponding samples were placed at different time points (360 d, 180 d, 90 d, 0 h). All of the samples was subjected to the active titer determination at the same time. The results were shown in Table 6 and FIG. 4 below.

(109) TABLE-US-00007 TABLE 6 The original Percent of the active Example active titers The active titers titers at 20 C. formulas or prior to at 20 C. for 360 d vs the comparable freezing-thawing for 360 d original active titers examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 .sup.1.08 10.sup.10 54.00 formula 1 Example 5.4 10.sup.7 3.54 10.sup.7 65.56 formula 2 Example 2 10.sup.6 1.07 10.sup.6 53.5 formula 3 Example 5 10.sup.6 2.77 10.sup.6 55.40 formula 4 Example 2 10.sup.6 9.84 10.sup.5 49.20 formula 4 Example 5.4 10.sup.7 3.12 10.sup.7 57.78 formula 6 Example 5 10.sup.8 2.55 10.sup.8 51.00 formula 7 Example 5 10.sup.6 2.54 10.sup.6 50.78 formula 8 Example 5.4 10.sup.7 3.00 10.sup.7 55.56 formula 9 Example 5 10.sup.6 2.72 10.sup.6 54.40 formula 10 Example 2 10.sup.6 1.05 10.sup.6 52.50 formula 11 Example 5 10.sup.6 2.65 10.sup.6 53.00 formula 12 Example 5 10.sup.6 2.49 10.sup.6 49.80 formula 13 Comparable 5.4 10.sup.7 1.00 10.sup.7 18.51 example 1 Comparable 5.4 10.sup.7 5.55 10.sup.6 10.28 example 2 Comparable 5.4 10.sup.7 1.65 10.sup.6 3.05 example 3 Comparable 5.4 10.sup.7 1.60 10.sup.6 2.96 example 4

(110) It can be seen form Table 6 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.

(111) (5) Effect of Different Recombinant Lentiviral Vector Preparations on the Stability of the Recombination Lentivirus at 80 C.

(112) The recombinant lentiviral vector preparations formulated in Examples 1-13 and Comparable examples 1-4 were stored at 80 C. for 0 h, 180 d, 360 d, and 720 d. All of the preparations was subjected to the active titer determination at the same time, i.e. taken out from 80 C. to a water bath of 37 C., thawed and then placed on ice for of the active titer determination. The results were shown in Table 7 and FIG. 5 below.

(113) TABLE-US-00008 TABLE 7 The original Percent of the active Example active titers The active titers titer at 80 C. formulas or prior to at 80 C. for 720 d vs the comparable freeze-thaw for 720 d original active titer examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 .sup.1.75 10.sup.10 87.50 formula 1 Example 5.4 10.sup.7 5.15 10.sup.7 95.37 formula 2 Example 2 10.sup.6 1.72 10.sup.6 86.00 formula 3 Example 5 10.sup.6 4.27 10.sup.6 85.40 formula 4 Example 2 10.sup.6 1.60 10.sup.6 80.00 formula 4 Example 5.4 10.sup.7 5.03 10.sup.7 93.15 formula 6 Example 5 10.sup.8 4.12 10.sup.8 82.40 formula 7 Example 5 10.sup.6 4.06 10.sup.6 81.20 formula 8 Example 5.4 10.sup.7 4.78 10.sup.7 88.52 formula 9 Example 5 10.sup.6 4.31 10.sup.6 86.20 formula 10 Example 2 10.sup.6 1.69 10.sup.6 84.50 formula 11 Example 5 10.sup.6 4.28 10.sup.6 85.60 formula 12 Example 5 10.sup.6 4.00 10.sup.6 80.00 formula 13 Comparable 5.4 10.sup.7 3.82 10.sup.7 70.74 example 1 Comparable 5.4 10.sup.7 3.51 10.sup.7 65.00 example 2 Comparable 5.4 10.sup.7 3.00 10.sup.7 55.56 example 3 Comparable 5.4 10.sup.7 2.70 10.sup.7 50.00 example 4

(114) It can be seen form Table 7 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.

(115) (6) Effect of the Repeated Freezing-Thawing on the Stabilities of the Different Recombinant Lentivirus Preparations.

(116) The recombinant lentiviral vector preparations formulated in Examples 1-13 and Comparable examples 1-4 were aliquoted sterilely. The titers of some of aliquots were immediately determined, known as the titers prior to freezing-thawing. Other aliquots were placed into liquid nitrogen for flash freezing and taken out after 10 min of flash freezing, and then placed in a water bath of 37 C. with shaking from time to time, and taken out from the water bath when the different preparations were observed to be full thawed. This was recorded as the first freezing-thawing. Again, these aliquots were placed immediately into liquid nitrogen for flash freezing and taken out after 10 min of flash freezing, and then placed in a water bath of 37 C. with shaking from time to time, and taken out from the water bath when the different preparations were observed to be full thawed. This was recorded as the second freezing-thawing. The freezing-thawing cycle was repeated subsequently up to five times and eight times. The titers of the samples prior to freezing-thawing, the samples undergoing freezing-thawing five times and the samples undergoing freezing-thawing eight times were determined. The results were shown in Table 8 and FIG. 6 below.

(117) TABLE-US-00009 TABLE 8 Percent of the active The original titer after eight Example active titers The active titers cycles of freezing- formulas or prior to after eight cycles thawing vs the comparable freeze-thaw of freezing-thawing original active titers examples (Tu/ml) (Tu/ml) (%) Example .sup.2 10.sup.10 .sup.1.66 10.sup.10 83.00 formula 1 Example 5.4 10.sup.7 5.00 10.sup.7 92.59 formula 2 Example 2 10.sup.6 1.62 10.sup.6 81.00 formula 3 Example 5 10.sup.6 4.00 10.sup.6 80.00 formula 4 Example 2 10.sup.6 1.60 10.sup.6 74.50 formula 4 Example 5.4 10.sup.7 4.70 10.sup.7 87.04 formula 6 Example 5 10.sup.8 3.92 10.sup.8 78.40 formula 7 Example 5 10.sup.6 3.84 10.sup.6 76.80 formula 8 Example 5.4 10.sup.7 4.48 10.sup.7 82.96 formula 9 Example 5 10.sup.6 4.10 10.sup.6 82.00 formula 10 Example 2 10.sup.6 1.59 10.sup.6 79.50 formula 11 Example 5 10.sup.6 4.04 10.sup.6 80.08 formula 12 Example 5 10.sup.6 3.68 10.sup.6 73.60 formula 13 Comparable 5.4 10.sup.7 3.30 10.sup.7 61.11 example 1 Comparable 5.4 10.sup.7 3.00 10.sup.7 55.56 example 2 Comparable 5.4 10.sup.7 1.20 10.sup.7 22.22 example 3 Comparable 5.4 10.sup.7 9.00 10.sup.6 16.67 example 4

(118) It can be seen form Table 5 that the stabilities of the Example formulas are better than the stabilities of the Comparable example formulas. Meanwhile, the Formulas of Example formula 2 and 6 is simple and have a stability much better than those of other Example formulas.