METHOD, COMPOSITION AND KIT FOR FLUORESCENT QUANTITATIVE PCR, AND USE THEREOF

Abstract

The present invention relates to the field of molecular biology detection, more particularly to a method for fluorescent quantitative PCR. The method includes: 1) mixing an upstream and downstream primer pair, a fluorescent probe, and a PCR amplification reagent; and 2) carrying out the fluorescent quantitative PCR, where the fluorescent probe has two quenching groups, in which a first quenching group is located at a 3′ end and a second quenching group is labeled on a T base and is 10-15 nt apart from the first quenching group. Using the method for fluorescent quantitative PCR, background signals in the fluorescent quantitative PCR can be reduced; furthermore, the sensitivity of PCR can be improved, the occurrence of false negatives in detection can be reduced, and the amplification efficiency of the fluorescent quantitative PCR can also be improved.

Claims

1. A method for fluorescent quantitative PCR, comprising: 1) mixing an upstream and downstream primer pair, a fluorescent probe, and a PCR amplification reagent; and 2) carrying out the fluorescent quantitative PCR, wherein the fluorescent probe has two quenching groups, in which a first quenching group is located at a 3′ end and a second quenching group is labeled on a T base and is 10-15 nt apart from the first quenching group.

2. The method according to claim 1, wherein an additional additive is also mixed in step 1) of the method, and the additional additive is any one or more of formamide, SDS, and Proclin antibiotics.

3. The method according to claim 2, wherein the additional additive is SDS and Proclin 300, which has a final concentration of 0.01% to 0.05% (v/v) after being added to a PCR reaction solution.

4. The method according to claim 2, wherein the additional additive has a pH value between 7.0 and 8.8.

5. The method according to claim 1, wherein the fluorescent probe has a length of 18-35 bp.

6. The method according to claim 1, wherein the fluorescent probe has a Tm value of 55-70° C.

7. The method according to claim 1, wherein the fluorescent probe has a GC content not exceeding 60%.

8. The method according to claim 1, wherein the PCR amplification reagent comprises DNA polymerase, dNTP, and a PCR buffer.

9. The method according to claim 1, wherein the first quenching group and the second quenching group are the same quenching group.

10. A method for one-step fluorescent quantitative PCR, comprising: 1) mixing a sample releasing agent, an upstream and downstream primer pair, a fluorescent probe, a PCR amplification reagent, and a sample; and 2) carrying out the fluorescent quantitative PCR, wherein the fluorescent probe has two quenching groups, in which a first quenching group is located at a 3′ end and a second quenching group is labeled on a T base and is 10-15 nt apart from the first quenching group; and the method comprises no purification and/or extraction steps of nucleic acid.

11. A composition for fluorescent quantitative PCR, comprising an upstream and downstream primer pair, a fluorescent probe, and a PCR amplification reagent, wherein the fluorescent probe has two quenching groups, in which a first quenching group is located at a 3′ end and a second quenching group is labeled on a T base and is 10-15 nt apart from the first quenching group.

12. The composition according to claim 11, wherein the composition further comprises an additional additive, and the additional additive is any one or more of formamide, SDS, and Proclin antibiotics.

13. The composition according to claim 12, wherein the additional additive is SDS and Proclin 300, which has a final concentration of 0.01% to 0.05% (v/v) after being added to a PCR reaction solution.

14. The composition according to claim 12, wherein the additional additive has a pH value between 7.0 and 8.8.

15. The composition according to claim 11, wherein the fluorescent probe has a length of 18-35 bp.

16. The composition according to claim 11, wherein the fluorescent probe has a Tm value of 55-70° C.

17. The composition according to claim 11, wherein the fluorescent probe has a GC content not exceeding 60%.

18. The composition according to claim 11, wherein the PCR amplification reagent comprises DNA polymerase, dNTP, and a PCR buffer.

19. The composition according to claim 11, wherein the first quenching group and the second quenching group are the same quenching group.

20. A kit for fluorescent quantitative PCR, wherein the kit comprises the composition according to claim 11.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0050] FIG. 1 to FIG. 6 show detection results of the composition of the present invention and the compositions of comparative examples for the detection of SARS-CoV-2.

DETAILED DESCRIPTION

[0051] Hereinafter, the present invention is described in detail with reference to specific embodiments and examples, and the advantages and various effects of the present invention may be more clearly presented therefrom. It should be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the present invention, instead of limiting the present invention.

Example 1. The Fluorescent Probe Having Two Quenching Groups of the Present Invention Improves the Sensitivity of PCR

[0052] In order to evaluate the application of a double quenching design method of a probe in the present invention, the influence on PCR was investigated. The double quenching design method with the probe of the present invention was compared with a probe having a single quenching group in a PCR amplification reagent. On the premise of not changing the primer sequences and amplification components, the nucleic acid detection of weakly positive samples by different probe designs in the same PCR amplification system was investigated. The comparison method was to use a clinically diagnosed positive low-concentration respiratory syncytial virus (RSV) sample for detection, and the same sample was detected 10 times to verify the positive detection efficiency of the sample. The specific components of each group are shown in Table 1.

TABLE-US-00001 TABLE 1 Specific components of different probe design schemes Amplifi- Amplifi- cation cation Control scheme 1 of scheme 2 of amplifi- the present the present cation invention invention scheme Upstream GCAAATATGGAAACATACGTGAACA primer (SEQ ID NO: 1) sequence Downstream RGATGAYTGGAACATRGGCACC primer (SEQ ID NO: 2) sequence Taqman 5′-FAM- 5′-FAM- 5′-FAM- probe CAGCWGCTGT CAGCWGCTGTG CAGCWGCTGTG sequence GTAT(T- TATGT(T- TATGTGGAGCC BHQ1)GTGGA BHQ1)GGAGCC YTCGTGA-3′- GCCYTCGTGA- YTCGTGA-3′- BHQ1 (SEQ 3′BHQ1 BHQ1 (SEQ ID NO: 5) (SEQ ID NO: ID NO: 4) 3) Upstream 10 pmol primer dosage Downstream 10 pmol primer dosage Probe 5 pmol dosage Mg.sup.2+ 2 pmol dNTPs 2 pmol Enzyme 4 μL mixture PCR buffer 24.65 μL Sample 20 μL dosage Total 50 μL reaction volume

[0053] In the above-mentioned comparison experiments, the double quenching design of the probe was investigated, especially the comparison between the design at different base positions and the probe having a single quenching group. The test results show (Table 2) that the probe designs of amplification scheme 1 and amplification scheme 2 of the present invention can significantly improve the detection efficiency for low-concentration RSV samples compared with the conventionally designed comparative amplification scheme without double quenching. However, compared with the amplification method 1/2 of the present invention, although a second quenching group is designed on different bases, there is almost no difference in the influence on the amplification detection efficiency, and there is no significant difference in the detection efficiency of the 10 samples. The experimental results of this group show that for the design of two quenching groups on the same probe, the designs at different positions have no significant difference in detection efficiency.

TABLE-US-00002 TABLE 2 Amplification comparison results of different amplification procedures for 10 low-concentration nucleic acid samples Amplification 35.14 35.65 34.98 36.02 36.54 3579 35.15 36.74 36.54 35.27 scheme 1 of the present invention Amplification 35.15 35.31 35.69 36.46 36.93 35.82 35.25 36.47 36.75 35.46 scheme 2 of the present invention Control 38.84 38.18 38.12 NoCt NoCt 37.89 37.95 38.86 NoCt 39.12 amplification scheme

Example 2. The Fluorescent Probe Having Two Quenching Groups and Additional Additives of the Present Invention Improve the Sensitivity of PCR

[0054] In order to evaluate the application of the double-quenching probe and its PCR amplification reagent components (0.02% of formamide (v/v), 0.03% of SDS (w/v) and 0.01% of Proclin 300 (v/v)) in the present invention, the same probe design principle was employed to compare and modify the fluorescent probe design of respiratory syncytial virus (RSV), and on the premise that the base sequence of the probe remained unchanged, nucleic acid detection of weakly positive samples in the same PCR amplification system was performed using the double quenching group scheme of the present invention and the conventional probe design (5′-FAM specific probe sequence-3′-BHQ1). The comparison method was step-by-step gradient dilution of a clinically diagnosed positive RSV sample: 10-fold dilution (1:9, v/v), 100-fold dilution (1:99, v/v), and 1,000-fold dilution (1:999, v/v), and 10,000-fold dilution (1:9,999, v/v). The detection method was a nucleic acid extraction-free direct amplification detection method for the sample. The method adopted was direct amplification for the sample in sample: sample releasing agent: qPCR reaction solution =10:10:30 (v/v/v) with a total volume of 50 μL. The amplification procedure is shown in Table 3. The specific components of each group are shown in Table 4.

TABLE-US-00003 TABLE 3 Amplification detection procedure for nucleic acid adopted in the present invention Step Temperature Time Number of cycles Reverse transcription 50° C. 30 min 1 Pre-denaturation 95° C.  1 min 1 Denaturation 95° C. 15 sec 40-45 Annealing, extension and 60° C. 30 sec fluorescence collection

TABLE-US-00004 TABLE 4 Specific components of different probe design schemes Amplification scheme of the present invention Control scheme Upstream GCAAATATGGAAACATA GCAAATATGGAAAC primer CGTGAACA (SEQ ID ATACGTGAACA sequence NO: 1) (SEQ ID NO: 1) Downstream RGATGAYTGGAACATRG RGATGAYTGGAACA primer GCACC (SEQ ID NO: TRGGCACC (SEQ sequence 2) ID NO: 2) Taqman 5′-FAM- 5′-FAM- probe CAGCWGCTGTGTAT(T- CAGCWGCTGTGTAT sequence BHQ1)GTGGAGCCYTCG GTGGAGCCYTCGTG TGA-3′-BHQ1 (SEQ A-3′-BHQ1 (SEQ ID NO: 3) ID NO: 5) Upstream 10 pmol primer dosage Downstream 10 pmol primer dosage Probe 5 pmol dosage Mg.sup.2+ 2 pmol dNTPs 2 pmol Enzyme 4 μL mixture Additive 0.03% (v/v) 0 group concen- tration PCR buffer 24.65 μL 24.65 μL Sample 20 μL dosage Total 50 μL reaction volume

[0055] The comparison results in Table 5 show that for the additive components in the PCR amplification system of the present invention, the sensitivity of the extraction-free amplification of the RSV sample is significantly improved. On the premise that the primer probe sequence and the main components of the PCR amplification system remain unchanged, the optimization of the quenching modification scheme of the probe greatly improves the nucleic acid detection capability.

TABLE-US-00005 TABLE 5 Sensitivity comparison detection scheme based on gradient dilution of the sample. Design scheme with Conventional the probe of the fluorescent present invention probe design scheme RSV sample RSV sample detection Ct value detection Ct value 10-fold dilution 29.64 31.89 of the sample 100-fold dilution 32.89 35.32 of the sample 1,000-fold dilution 36.07 38.03 of the sample 10,000-fold dilution 39.46 No Ct of the sample

Example 3. The Fluorescent Probe Having Two Quenching Groups and Additional Additives of the Present Invention Improve the Sensitivity of PCR

[0056] In order to evaluate the primer probe design scheme and the application of additive components (formamide, SDS and Proclin 300) in the present invention, comparative analysis was performed on a reagent component with the primer probe and PCR additive of the present invention and the conventional 3′-end single quenching group (BHQ1) without the primer probe scheme of the present invention. The comparison method was to use three SARS-CoV-2 nucleic acid samples (sample 01, sample 02, and sample 03) that were clinically diagnosed as positive to conduct a comparative test in the form of 45 μL of a PCR reaction solution +5μL of a nucleic acid sample. The real-time fluorescent quantitative PCR amplification detection procedure is shown in Table 3. The specific components of each group are shown in Table 6.

TABLE-US-00006 TABLE 6 Specific components of different probe design schemes Amplification scheme of the present invention Control scheme ORF lab ACAATGCGTTAGCTTACTA ACAATGCGTTAGCTT upstream CAAC (SEQ ID NO: 6) ACTACAAC (SEQ primer ID NO: 6) sequence ORF lab TCTAGCCCATTTCAAATCC TCTAGCCCATTTCAA downstream TG (SEQ ID NO: 7) ATCCTG (SEQ ID primer NO: 7) sequence ORF lab FAM-TAGGTTTGTACT(T- TAGGTTTGTACTTGC fluorescent BHQ1)GCATTGTTATCCG- ATTGTTATCCG probe BHQI (SEQ ID NO: 8) (SEQ ID NO: 9) sequence N gene AGTCCAGATGACCAAATTGGC upstream (SEQ ID NO: 10) primer sequence N gene ACTGAGATCTTTCATTTTACCGTCAC downstream (SEQ ID NO: 11) primer sequence N gene ACTACCGAAGAGCTACCAGACGA fluorescent (SEQ ID NO: 12) probe sequence Upstream 10 pmol primer dosage Downstream 10 pmol primer dosage Probe 5 pmol dosage Mg.sup.2+ 2 pmol dNTPs 2 pmol Enzyme 4 μL mixture Additive 0.03% (v/v) 0 group concen- tration PCR buffer 33.65 μL 33.65 μL Nucleic 5 μL acid dosage Total 50 μL reaction volume

[0057] From the comparison results of amplification in FIG. 1 to FIG. 6 and Table 7, on the premise of the same nucleic acid template dosage and primer probe dosage, just because of the change of the probe labeling mode and the necessary additive components, between the two, especially the amplification efficiency of the ORF 1ab gene based on FAM channel is significantly improved. Because the probe modification method of the present invention has obvious advantages in improving the detection sensitivity of nucleic acid reagents.

TABLE-US-00007 TABLE 7 Comparison results of the amplification effects of the scheme of the present invention and the control scheme on three nucleic acid samples PCR reaction solution with Commercial PCR additives of the present invention reaction solution ORF lab gene N gene ORF lab gene N gene Sample 01 25.05 25.20 32.92 30.10 Sample 02 25.35 25.45 37.91 33.17 Sample 03 31.88 32.19 39.69 35.24

[0058] The comparison results in Table 7 show that for the probe modification and additive components in the present invention, the sensitivity of PCR is significantly improved. The detection capability of a kit is negatively correlated with the Cycle threshold (Ct) value, that is, at the same concentration, the smaller the Ct value is, the higher the detection capability is; the larger the Ct value is, the lower the detection capability is; and No Ct means no amplification. The probe modification and additives in the present invention can significantly improve the nucleic acid detection capability, but for different samples, there are differences between samples in the improvement effect of the PCR additives.

Example 4. The Fluorescent Probe Having Two Quenching Groups and Additional Additives of the Present Invention Improve the Sensitivity of One-Step PCR

[0059] In the process of clinical examination application, respiratory samples are highly infectious, such as SARS-CoV-2, SARS, MERS coronavirus, etc., as well as common influenza A and B viruses, all of which are highly pathogenic. Therefore, completing virus detection in a very short time can bring diagnosis results and treatment plans to patients as early as possible. The scheme of the double-quenching probe and the matched PCR amplification additive components in the present invention can also be used in the application of rapid sample detection. The main features of the procedure include two major aspects: the two are both directly amplifying the samples without nucleic acid processing, and are respectively: 1. on the premise of no nucleic acid extraction and purification, directly inactivating the collected samples by using a sample releasing agent with an inactivation function, and releasing the nucleic acid in the virus, and using the relevant PCR amplification reagent components for direct amplification detection; and 2. adopting a reverse transcription procedure and a PCR amplification procedure in a very short time to complete the detection of the virus and giving the detection result within 15-35 minutes. The detection method was a nucleic acid extraction-free direct amplification detection method for the sample. The method adopted was direct amplification for the sample in sample: sample releasing agent: qPCR reaction solution =10:10:30 (v/v/v) with a total volume of 50 μL. In order to compare the detection effects in rapid detection and conventional detection, this experimental scheme adopted the reaction conditions of the present invention under the rapid amplification procedure and the conventional amplification procedure, as well as the conventional probe design scheme under the conventional amplification procedure to compare the detection efficiency of low-concentration nucleic acid samples and negative samples of SARS-CoV-2.

TABLE-US-00008 TABLE 8 One-step PCR and conventional PCR in the scheme of the present invention Conventional amplification Rapid amplification procedure procedure Number Number Step Temperature Time of cycles Temperature Time of cycles Reverse 50° C. 30 min 1 50° C. 5 min 1 transcription Pre-denaturation 95° C.  1 min 1 95° C. 10 sec  1 Denaturation 95° C. 15 sec 40-45 95° C. 1 sec 40-45 Annealing, 60° C. 30 sec 60° C. 1 sec extension and fluorescence collection

TABLE-US-00009 TABLE 9 Amplification comparison results of different amplification procedures for 10 low-concentration nucleic acid samples Scheme of the 32.42 32.46 32.59 31.76 32.77 32.92 31.83 32.74 32.09 32.40 present invention Conventional amplification Scheme of the 33.15 32.84 32.16 32.56 32.98 33.23 33.75 32.47 32.95 32.63 present invention Rapid amplification Control scheme 35.84 36.18 36.28 35.98 36.32 35.45 36.74 36.12 36.29 36.83 Conventional amplification Control scheme 38.84 39.18 NoCt NoCt NoCt NoCt 38.74 39.42 NoCt NoCt Rapid amplification

[0060] As can be seen from the detection results of 10 low-concentration samples, all the low-concentration samples were detected using the scheme of the present invention. In addition, the detection result obtained using the rapid amplification solution was no different from that using the conventional amplification procedure. Therefore, the experimental results prove that the amplification detection scheme based on the double-quenching probe design can be used in both conventional qPCR amplification procedure and rapid qPCR amplification procedure, and there is no significant difference between the two different amplification procedures. The scheme of the present invention can be used for rapid detection of viruses. In the control scheme, the probe design and combination scheme without the conventional single quenching group of the present invention were adopted, and in the conventional amplification procedure, all 10 samples were detected, but the amplified Ct values were delayed. However, in the rapid amplification procedure, only four out of the 10 samples were detected to be positive, thus the detection capability was obviously low. Therefore, the comparison results show that the scheme of the present invention can be used for rapid nucleic acid diagnosis of RNA viruses.

Example 5. The Fluorescent Probe Having Two Quenching Groups and Additional Additives of the Present Invention Improve the Sensitivity of PCR

[0061] In order to evaluate the application of the double-quenching probe and its PCR amplification reagent components (Formamide, SDS and Proclin 300) in the present invention, the same probe design principle was employed to compare and modify the fluorescent probe design of respiratory adenovirus (ADV), and on the premise that the base sequence of the probe remained unchanged, nucleic acid detection of weakly positive samples in the same PCR amplification system was performed by comparing the amplification schemes of the double quenching group scheme of the present invention and the control scheme.

[0062] The designs of the four schemes are (as shown in Table 11):

[0063] the scheme of the present invention: an amplification reagent containing a double-quenching fluorescent probe and additive components

[0064] control scheme 1: a conventional amplification reagent only containing a double-quenching fluorescent probe

[0065] control scheme 2: an amplification reagent containing a single-quenching fluorescent probe and an additive

[0066] control scheme 3: a conventional amplification reagent only containing a single-quenching fluorescent probe

[0067] The comparison method was step-by-step gradient dilution of a clinically diagnosed positive ADV sample: 10-fold dilution (1:9, v/v), 100-fold dilution (1:99, v/v), and 1,000-fold dilution (1:999, v/v). The detection method was a nucleic acid extraction-free direct amplification detection method for the sample. The method adopted was direct amplification for the sample in sample: sample releasing agent: qPCR reaction solution =10:10:30 (v/v/v) with a total volume of 50 μL. The amplification procedure is shown in Table 10.

TABLE-US-00010 TABLE 10 Amplification detection procedure for nucleic acid adopted in the present invention. Conventional amplification Rapid amplification procedure procedure Number of Number of Step Temperature Time cycles Temperature Time cycles Pre-denaturation 95° C. 1 min 1 95° C. 10 sec  1 Denaturation 95° C. 15 sec 40-45 95° C. 3 sec 40-45 Annealing, extension 60° C. 30 sec 60° C. 5 sec and fluorescence collection

TABLE-US-00011 TABLE 11 Specific components of different probe design schemes Scheme of the present Control Control Control invention scheme 1 scheme 2 scheme 3 Upstream TGRAARAGGTAGTTGAGBGTGG (5′-3′) primer sequence (SEQ ID NO: 13) Downstream GYAACKCCCAGTTTTTCAACTTYG (5′-3′) primer sequence (SEQ ID NO: 14) Probe sequence 5′-FAM- 5′-FAM- CYGTGGAYTTCT CYGTGGAYTT ACGA(BHQ1)RG CTACGARGCC CCATGGA-3′- ATGGA-3′- BHQ1 (SEQ ID BHQ1( SEQ NO: 15) ID NO: 15) Upstream 10 pmol primer dosage Downstream 10 pmol primer dosage Probe dosage 5 pmol Mg.sup.2+ 2 pmol dNTPs 2 pmol Enzyme mixture 4 μL Additive group 0.03% 0 0.03% 0 concentration (v/v) (v/v) PCR buffer 24.65 μL Sample dosage 20 μL Total reaction 50 μL volume

[0068] The comparison results in Table 12 show that there is a significant improvement in the sensitivity of extraction-free amplification of the ADV sample, and the amplification efficiency of the present invention is the best and obviously superior to the schemes based on conventional fluorescent probe design and conventional PCR amplification reagent components.

[0069] In addition, the comparison results in Table 12 also prove that the optimization effect of the additives on the two quenching groups is significantly better than that on the single quenching group. In the double quenching group system, the increase of the Ct value by the additive is greater than 1 (having an order of magnitude difference, a difference of 1 in Ct value is equivalent to a difference of one time the template amount), and in the single quenching group system, the increase of the Ct value by the additive is less than 0.5 (essentially equivalent to no increase).

TABLE-US-00012 TABLE 12 Sensitivity comparison detection solution based on gradient dilution of the sample Scheme of the Control Control Control present scheme scheme scheme invention 1 2 3 Conventional ADV detection Ct value qPCR procedure Sample 29.64 30.89 32.14 32.65 Rapid amplifi- ADV detection Ct value cation procedure Sample 29.76 30.93 32.65 33.02

REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0070] The contents of the electronic sequence listing (CU692SequenceListing.xml; Size: 14,136 bytes; and Date of Creation: Aug. 17, 2022) is herein incorporated by reference in its entirety.