Peptide Treatment for Inflammation and Fibrosis
20180125919 ยท 2018-05-10
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K47/10
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K9/0078
HUMAN NECESSITIES
International classification
A61K47/10
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
Abstract
The invention is directed to peptides which inhibit phosphorylation of an amino phosphoacceptor domain of C/EBP? and their use for treating inflammation and fibrosis.
Claims
1. An isolated peptide comprising the amino acid sequence Lys-Ala-Val-Asp, wherein at least one amino acid is D-amino acid and wherein said peptide is capable of inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein-? (C/EBP?) at Threonine 266 (Thr 266).
2. The peptide of claim 1, wherein the Ala and/or Val within the amino acid sequence Lys-Ala-Val-Asp is D-amino acid.
3. The peptide of claim 1, wherein said peptide is capable of selectively inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein-? (C/EBP?) at Threonine 266 (Thr 266).
4. The peptide of claim 1, wherein said peptide is capable of inhibiting activation of myofibroblasts and/or macrophage inflammasome.
5. The peptide of claim 1, wherein said peptide is between four amino acids and eight amino acids long.
6.-9. (canceled)
10. The peptide of claim 1, wherein said peptide consists of amino acid sequence selected from the group consisting of Lys-Ser-Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser-Asp (SEQ ID NO: 3), Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser (SEQ ID NO: 4), and Ala-Lys-Lys-Ala-Val-Asp-Lys-His (SEQ ID NO: 5).
11. The peptide of claim 1, wherein said peptide further comprises polyethylene glycol (PEG).
12. The peptide of claim 1, wherein said peptide further comprises a linker of acid (Ac) or mercaptopropionic acid (Mpr).
13. (canceled)
14. The peptide of claim 1, wherein said peptide is a cyclic peptide.
15. The peptide of claim 1, wherein said peptide is selected from the group consisting of: Lys-DAla-DVal-Asp, Ac-Lys-DAla-DVal-Asp, Mpr-Lys-DAla-DVal-Asp, PEG-Lys-DAla-DVal-Asp, PEG-Ac-Lys-DAla-DVal-Asp, PEG-Mpr-Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp, Ac-Lys-DAla-Val-Asp, Mpr-Lys-DAla-Val-Asp, PEG-Lys-DAla-Val-Asp, PEG-Ac-Lys-DAla-Val-Asp, PEG-Mpr-Lys-DAla-Val-Asp, Lys-Ala-DVal-Asp, Ac-Lys-Ala-DVal-Asp, Mpr-Lys-Ala-DVal-Asp, PEG-Lys-Ala-DVal-Asp, PEG-Mpr-Lys-Ala-DVal-Asp, and PEG-Mpr-Lys-Ala-DVal-Asp, wherein the carboxy terminal group of the peptide is OH, OCH.sub.3, or NH.sub.2 group.
16.-17. (canceled)
18. The peptide of claim 1, wherein said peptide has the structure as shown in formula (I): ##STR00004##
19. A pharmaceutical composition comprising one or more peptide(s) of claim 1 and a pharmaceutically acceptable carrier.
20.-26. (canceled)
27. A method for treating a tissue fibrotic disease in a subject in need thereof comprising administering to the subject an effective amount of one or more peptides of claim 1.
28. The method of claim 27, wherein said disease is associated with liver injury, liver inflammation and/or liver fibrosis.
29. The method of claim 27, wherein said disease is liver cirrhosis or liver fibrosis of any etiology.
30. The method of claim 28, wherein the disease is selected from the group consisting of non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), alcoholic fatty liver disease, alcoholic steatohepatitis, hepatic steatosis, autoimmune hepatitis, chronic hepatitis C, chronic hepatitis B, primary biliary cirrhosis, secondary biliary cirrhosis, sclerosing cholangitis, alpha-1-antitrypsin deficiency, Wilson's disease, and biliary atresia.
31. The method of claim 27, wherein said disease is associated with lung injury, lung inflammation and/or lung fibrosis.
32. (canceled)
33. The method of claim 27, wherein said disease is associated with kidney injury, kidney inflammation and/or kidney fibrosis.
34. (canceled)
35. The method of claim 27, wherein the disease is selected from the group consisting of skin fibrosis secondary to burns, keloids, hypertrophic post-surgical wounds, scleroderma, esophageal or gastro-intestinal fibrosis secondary to corrosive materials, esophageal or gastro-intestinal fibrosis secondary to inflammatory diseases, fibrosis secondary to ischemic diseases, peritoneal fibrosis, pancreatic fibrosis, post-radiation fibrosis, cardiac fibrosis secondary to infarcts, brain fibrosis secondary to ischemia or infarcts, post-traumatic brain fibrosis, post-traumatic muscle fibrosis, and synovial/joint fibrosis.
36. A method for treating an inflammatory disease in a subject in need thereof comprising administering to the subject an effective amount of one or more peptides of claim 1.
37. The method of claim 36, wherein said disease is selected from the group consisting of alcoholic liver disease, non-alcoholic steato-hepatitis (NASH), autoimmune hepatitis, chronic hepatitis C, chronic hepatitis B, primary biliary cirrhosis, secondary biliary cirrhosis, sclerosing cholangitis, alpha-1-antitrypsin deficiency, Wilson's disease, biliary atresia, idiopathic pulmonary fibrosis, radiation-induced pneumonitis, chronic obstructive pulmonary disease, lung emphysema, lung chronic infections and/or inflammation, glomerulonephritis, interstitial-tubular fibrosis, skin inflammation secondary to burns, scleroderma, psoriasis, inflammatory bowel diseases, esophageal injury and/or inflammation, esophageal or gastro-intestinal inflammation post-radiation, inflammatory cardiomyopathy, brain inflammation post-trauma, Alzheimer's disease, encephalitis, meningitis, myositis, and arthritis.
38.-41. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
[0058] As used in this specification and the appended claims, the singular forms a, an and the include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to a construct includes a combination of two or more nucleic acid constructs, and the like.
[0059] As used herein, the term subject refers to humans, mammals and/or veterinary animals (e.g., cats, dogs, cows, horses, sheep, pigs, etc.), and experimental animal models. In certain embodiments, the subject refers to a human patient, including both genders in adult and child populations.
[0060] In the context of the present invention insofar as it relates to any of the disease conditions recited herein, the terms treat, treatment, and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition. Within the meaning of the present invention, the term treat also denotes to arrest, delay the onset (i.e., the period prior to clinical manifestation of a disease) and/or reduce the risk of developing or worsening a disease. The terms treat, treatment, and the like regarding a state, disorder or condition may also include (1) preventing or delaying the appearance of at least one clinical or sub-clinical symptom of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; or (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or sub-clinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or sub-clinical symptoms.
[0061] The practice of the present invention employs, unless otherwise indicated, conventional techniques of statistical analysis, molecular biology (including recombinant techniques), microbiology, cell biology, and biochemistry, which are within the skill of the art. Such tools and techniques are described in detail in e.g., Sambrook et al. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y.; Ausubel et al. eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Bonifacino et al. eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coico et al. eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, N.J.; Coligan et al. eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc.: Hoboken, N.J.; and Enna et al. eds. (2005) Current Protocols in Pharmacology, John Wiley and Sons, Inc.: Hoboken, N.J. Additional techniques are explained, e.g., in U.S. Pat. No. 7,912,698 and U.S. Patent Appl. Pub. Nos. 2011/0202322 and 2011/0307437.
[0062] Peptides of the Invention, Compositions and Administration
[0063] The invention provides therapeutic peptides that are designed to block one phosphorylation on one molecular protein target in liver, lung, kidney, and/or other scar tissue to prevent and/or inhibit activation and production of myofibroblasts and/or macrophages so as to inhibit liver, lung, and/or other scar tissue inflammation and/or fibrosis. Since the peptides of the invention are nonessential to other mechanistic processes, they are highly specific and effective, while minimizing any potential off-target toxicity.
[0064] In certain embodiments, the invention provides therapeutic peptides that have high efficacy against the molecular target preventing activation of myofibroblasts and inhibiting liver, lung, and kidney fibrosis. In other embodiments, the invention further provides that by regulating the activation of the inflammasome in inflammatory macrophages and activate myofibroblasts, phosphorylated C/EBP?-Phospho-Thr266 (human homologue of mouse C/EBP?-Thr217) plays a major role in liver, lung, and kidney inflammation and injury. C/EBP?-Phospho-Thr217 signaling that is evolutionarily conserved (identical in human C/EBP?-Phospho-Thr266) modulates macrophage inflammasome activity and liver injury induced by different acting hepatotoxins. In certain embodiments, the therapeutic peptides also block activation of myofibroblasts through apoptotic mechanism, preventing progression and allowing regression of fibrosis of the scar tissue.
[0065] This invention provides therapeutic peptides which are designed to block phosphorylation on one protein, a single event critical to liver, lung, kidney, and/or other scar tissue production and nonessential to other mechanistic processes. Therefore, the candidate drugs are highly specific and effective, while minimizing any potential off-target toxicity. In certain embodiments, the invention provides that by regulating the activation of the inflammasome in liver lung, and/or kidney macrophages, phosphorylated C/EBP?-Thr217 plays a major role in liver, lung, and/or kidney inflammation and injury. C/EBP?-Phospho-Thr217 signaling that is evolutionarily conserved (identical in human C/EBP?-Phospho-Thr266) modulates macrophage inflammasome activity and liver, lung, and/or kidney injury induced by different acting hepato-kidney, and/or lung toxins.
[0066] In certain embodiments, the peptides of the invention have been shown to stimulate apoptosis and block fibrogenesis, preventing progression and inducing regression of liver, lung, kidney, and/or other tissue inflammations and/or fibrosis. In certain embodiments, the peptides of the invention also show high efficacy against the molecular target, e.g., phosphorylation of C/EBP3-Thr217 in activated liver, lung, and/or kidney myofibroblasts and/or macrophages, preventing activation of myofibroblasts and/or macrophages and inhibiting liver, lung and/or kidney inflammations and fibrogenesis.
[0067] In one aspect, the invention provides an isolated peptide comprising the amino acid sequence Lys-Ala-Val-Asp, wherein at least one amino acid is D-amino acid and wherein said peptide is capable of inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein-? (C/EBP?) at Threonine 266 (Thr 266) or mouse C/EBP? at Thr 217. For examples of human and mouse C/EBP? sequences see, e.g., human: GenBank Gene ID 1051; mouse: GenBank Gene ID 12608.
[0068] In one embodiment, the Ala and/or Val within the amino acid sequence Lys-Ala-Val-Asp is D-amino acid. In one embodiment, the peptide is capable of selectively inhibiting phosphorylation of human CCAAT/Enhancer Binding Protein-? (C/EBP?) at Threonine 266 (Thr 266). In one embodiment, the peptide is capable of inhibiting activation of myofibroblasts and/or macrophage inflammasome. In one embodiment, the peptide is between four amino acids and eight amino acids long. In one embodiment, the peptide comprises the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp and Lys-Ala-DVal-Asp. In one embodiment, the peptide consists of the amino acid sequence selected from the group consisting of Lys-DAla-DVal-Asp, Lys-DAla-Val-Asp and Lys-Ala-DVal-Asp. In one embodiment, the peptide comprises the amino acid sequence Lys-DAla-DVal-Asp. In one embodiment, the peptide consists of the amino acid sequence Lys-DAla-DVal-Asp. In one embodiment, the peptide consists of amino acid sequence selected from the group consisting of Lys-Ser-Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-Hi s-Ser-Asp (SEQ ID NO: 3), Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser (SEQ ID NO: 4), and Ala-Lys-Lys-Ala-Val-Asp-Lys-His (SEQ ID NO: 5) (e.g., peptides wherein the Ala and/or Val within the amino acid motif Lys-Ala-Val-Asp is D-amino acid). In one embodiment, the peptide further comprises polyethylene glycol (PEG). In one embodiment, the peptide further comprises a linker of acid (Ac) or mercaptopropionic acid (Mpr) or trimethyl lock (TML) lactonization (see, e.g., Greenwald, Journal of Controlled Release. 74, 2001, 159-171). In one embodiment, the carboxy terminal group of the peptide is OH, OCH.sub.3, or NH.sub.2 group. In one embodiment, the peptide is a cyclic peptide.
[0069] In one embodiment, the peptide is selected from the group consisting of:
Lys-DAla-DVal-Asp,
Ac-Lys-DAla-DVal-Asp,
Mpr-Lys-DAla-DVal-Asp,
PEG-Lys-DAla-DVal-Asp,
PEG-Ac-Lys-DAla-DVal-Asp,
PEG-Mpr-Lys-DAla-DVal-Asp,
Lys-DAla-Val-Asp,
Ac-Lys-DAla-Val-Asp,
Mpr-Lys-DAla-Val-Asp,
PEG-Lys-DAla-Val-Asp,
PEG-Ac-Lys-DAla-Val-Asp,
PEG-Mpr-Lys-DAla-Val-Asp,
Lys-Ala-DVal-Asp,
Ac-Lys-Ala-DVal-Asp,
Mpr-Lys-Ala-DVal-Asp,
PEG-Lys-Ala-DVal-Asp,
PEG-Mpr-Lys-Ala-DVal-Asp, and
PEG-Mpr-Lys-Ala-DVal-Asp,
[0070] wherein the carboxy terminal group of the peptide is OH, OCH.sub.3, or NH.sub.2 group.
[0071] In one embodiment, the peptide is selected from the group consisting of Lys-DAla-DVal-Asp, Ac-Lys-DAla-DVal-Asp, Mpr-Lys-DAla-DVal-Asp, PEG-Lys-DAla-DVal-Asp, PEG-Ac-Lys-DAla-DVal-Asp, and PEG-Mpr-Lys-DAla-DVal-Asp, wherein the carboxy terminal group of the peptide is OH, OCH.sub.3, or NH.sub.2 group.
[0072] In one embodiment, the peptide is selected from the group consisting of Lys-DAla-DVal-Asp-NH2, Ac-Lys-DAla-DVal-Asp-NH2, Mpr-Lys-DAla-DVal-Asp-NH2, PEG-Lys-DAla-DVal-Asp-NH2, PEG-Ac-Lys-DAla-DVal-Asp-NH2, and PEG-Mpr-Lys-DAla-DVal-Asp-NH2.
[0073] In one embodiment, the peptide has the structure as shown in formula (I):
##STR00002##
[0074] In addition to the above-disclosed peptides, the invention also encompasses C/EBP?-Ala-217 amino acids 1 to 296 (mouse), C/EBP?-Ala-217 fragment amino acids 216 to 253 (mouse), and C/EBP?-Ala-217 amino acids 1 to 285 (mouse) (e.g., obtained based on GenBank Gene ID 12608 with Ala in position 217). Corresponding human sequences and fragments are also encompassed and can be obtained based on a human C/EBP? sequence with Ala in position 266 (e.g., based on GenBank Gene ID 1051 with Ala in position 266).
[0075] The peptides of the invention can be modified, e.g., by the use of hetero-bifunctional linkers. Non-limiting examples of end groups for heterobifunctional PEGs are maleimide, vinyl sulfones, pyridyl disulfide, amine, carboxylic acids, and NHS esters (see, e.g., Veronese, Francesco M. peptide and protein PEGylation: a review of problems and solutions. Biomaterials 22.5 (2001): 405-417). The peptides of the invention may employ third generation Pegylation agents that are, e.g., branched, Y-shaped or comb-shaped (see, e.g., Ryan, Sinead M; Mantovani, Giuseppe; Wang, Xuexuan; Haddleton, David M; Brayden, David J (2008). Advances in PEGylation of important biotech molecules: Delivery aspects. Expert Opinion on Drug Delivery 5 (4): 371-83). The peptides of the invention can be multimerized and/or cyclized (e.g., PolyPeptide Group).
[0076] Useful delivery technologies for the peptides of the invention include, e.g., LAR-depot microsphere polymer matrix (Midatech Pharma) and Protected Graft Copolymer (PGC?) technology (PharmaIN).
[0077] The peptides of the invention can be modified in various ways to improve their pharmacokinetic and other properties. Peptides can be modified at the amino (N?) terminus, and/or carboxy (C?) terminus and/or by replacement of one or more of the naturally occurring genetically encoded amino acids with an unconventional amino acid, modification of the side chain of one or more amino acid residues, peptide phosphorylation, and the like.
[0078] Amino terminus modifications include methylation (e.g., NHCH.sub.3 or N(CH.sub.3).sub.2), acetylation (e.g., with acetic acid or a halogenated derivative thereof such as ?-chloroacetic acid, ?-bromoacetic acid, or ?-iodoacetic acid), adding a benzyloxycarbonyl (Cbz) group, or blocking the amino terminus with any blocking group containing a carboxylate functionality defined by RCOO or sulfonyl functionality defined by RSO.sub.2, where R is selected from alkyl, aryl, heteroaryl, alkyl aryl, and the like, and similar groups. One can also incorporate a desamino acid at the N-terminus (so that there is no N-terminal amino group) to decrease susceptibility to proteases or to restrict the conformation of the peptide compound.
[0079] Carboxy terminus modifications include replacing the free acid with a carboxamide group or forming a cyclic lactam at the carboxy terminus to introduce structural constraints. One can also cyclize the peptides of the invention, or incorporate a desamino or descarboxy residue at the termini of the peptide, so that there is no terminal amino or carboxyl group, to decrease susceptibility to proteases or to restrict the conformation of the peptide. C-terminal functional groups of the compounds of the present invention include amide, amide lower alkyl, amide di(lower alkyl), lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.
[0080] One can replace the naturally occurring side chains of the 20 genetically encoded amino acids (or the stereoisomeric D-amino acids) with other side chains, for instance with groups such as alkyl, lower alkyl, cyclic 4-, 5-, 6-, to 7-membered alkyl, amide, amide lower alkyl, amide di(lower alkyl), lower alkoxy, hydroxy, carboxy and the lower ester derivatives thereof, and with 4-, 5-, 6-, to 7-membered heterocyclic. For example, proline analogues in which the ring size of the proline residue is changed from 5 members to 4, 6, or 7 members can be employed. Cyclic groups can be saturated or unsaturated, and if unsaturated, can be aromatic or non-aromatic. Heterocyclic groups preferably contain one or more nitrogen, oxygen, and/or sulfur heteroatoms. Examples of such groups include the furazanyl, furyl, imidazolidinyl, imidazolyl, imidazolinyl, isothiazolyl, isoxazolyl, morpholinyl (e.g. morpholino), oxazolyl, piperazinyl (e.g., 1-piperazinyl), piperidyl (e.g., 1-piperidyl, piperidino), pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridyl, pyrimidinyl, pyrrolidinyl (e.g., 1-pyrrolidinyl), pyrrolinyl, pyrrolyl, thiadiazolyl, thiazolyl, thienyl, thiomorpholinyl (e.g., thiomorpholino), and triazolyl. These heterocyclic groups can be substituted or unsubstituted. Where a group is substituted, the substituent can be alkyl, alkoxy, halogen, oxygen, or substituted or unsubstituted phenyl.
[0081] Common examples of conventional amino acid replacements include stereoisomers (e.g., D-amino acids) and unnatural amino acids such as, for example, L-ornithine, L-homocysteine, L-homoserine, L-citrulline, 3-sulfino-L-alanine, N-(L-arginino)succinate, 3,4-dihydroxy-L-phenylalanine, 3-iodo-L-tyrosine, 3,5-diiodo-L-tyrosine, triiodothyronine, L-thyroxine, L-selenocysteine, N-(L-arginino)taurine, 4-aminobutylate, (R,S)-3-amino-2-methylpropanoate, a,a-disubstituted amino acids, N-alkyl amino acids, lactic acid, ?-alanine, 3-pyridylalanine, 4-hydroxyproline, O-phosphoserine, N-methylglycine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, nor-leucine, and other similar amino acids and imino acids. A general method for site-specific incorporation of unnatural amino acids into proteins and peptides is described in Noren et al., Science, 244:182-188 (April 1989).
[0082] One can also readily modify peptides by phosphorylation, and other methods (e.g., as described in Hruby, et al. (1990) Biochem J. 268:249-262).
[0083] The peptide compounds of the invention also serve as structural models for non-peptidic compounds with similar biological activity. Those of skill in the art recognize that a variety of techniques are available for constructing compounds with the same or similar desired biological activity as the lead peptide compound, but with more favorable activity than the lead with respect to solubility, stability, and susceptibility to hydrolysis and proteolysis (see, e.g., Morgan and Gainor (1989) Ann. Rep. Med. Chem. 24:243-252). These techniques include replacing the peptide backbone with a backbone composed of phosphonates, amidates, carbamates, sulfonamides, secondary amines, and N-methylamino acids.
[0084] The present invention also provides conjugates of the disclosed peptide monomers. Thus, according to a preferred embodiment, the monomeric peptides of the present invention are dimerized or oligomerized, thereby enhancing their biological activity.
[0085] In one embodiment, the peptide monomers of the invention may be oligomerized using the biotin/streptavidin system. Biotinylated analogs of peptide monomers may be synthesized by standard techniques. For example, the peptide monomers may be C-terminally biotinylated. These biotinylated monomers are then oligomerized by incubation with streptavidin [e.g., at a 4:1 molar ratio at room temperature in phosphate buffered saline (PBS) or HEPES-buffered RPMI medium (Invitrogen) for 1 hour]. In a variation of this embodiment, biotinylated peptide monomers may be oligomerized by incubation with any one of a number of commercially available anti-biotin antibodies [e.g., goat anti-biotin IgG from Kirkegaard & Perry Laboratories, Inc. (Washington, D.C.)].
[0086] Linkers.
[0087] In other embodiments, the peptide monomers of the invention can be dimerized by covalent attachment to at least one linker moiety. The linker (L.sub.K) moiety can be a C.sub.1-12 linking moiety optionally terminated with one or two NH linkages and optionally substituted at one or more available carbon atoms with a lower alkyl substituent (e.g., NHRNH wherein R is a lower (C.sub.1-6) alkylene substituted with a functional group such as a carboxyl group or an amino group, such as, for example, a lysine residue or a lysine amide).
[0088] In an additional embodiment, polyethylene glycol (PEG) may serve as the linker L.sub.K that dimerizes two peptide monomers: for example, a single PEG moiety may be simultaneously attached to the N-termini of both peptide chains of a peptide dimer.
[0089] In yet another additional embodiment, the linker (L.sub.K) moiety is preferably, but not necessarily, a molecule containing two carboxylic acids and optionally substituted at one or more available atoms with an additional functional group such as an amine capable of being bound to one or more PEG molecules. Such a molecule can be depicted as:
CO(CH.sub.2).sub.nX(CH.sub.2).sub.mCO
[0090] where n is an integer from 0 to 10, m is an integer from 1 to 10, X is selected from O, S, N(CH.sub.2).sub.pNR.sub.1, NCO(CH.sub.2).sub.pNR.sub.1, and CHNR.sub.1, R.sub.1 is selected from H, Boc, Cbz, etc., and p is an integer from 1 to 10.
[0091] Linkers can be incorporated into the peptide during peptide synthesis. For example, where a linker L.sub.K moiety contains two functional groups capable of serving as initiation sites for peptide synthesis and a third functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety, the linker may be conjugated to a solid support. Thereafter, two peptide monomers may be synthesized directly onto the two reactive nitrogen groups of the linker L.sub.K moiety in a variation of the solid phase synthesis technique.
[0092] In alternate embodiments where a peptide dimer is dimerized by a linker L.sub.K moiety, said linker may be conjugated to the two peptide monomers of a peptide dimer after peptide synthesis. Such conjugation may be achieved by methods well established in the art. In one embodiment, the linker contains at least two functional groups suitable for attachment to the target functional groups of the synthesized peptide monomers. For example, a linker with two free amine groups may be reacted with the C-terminal carboxyl groups of each of two peptide monomers. In another example, linkers containing two carboxyl groups, either preactivated or in the presence of a suitable coupling reagent, may be reacted with the N-terminal or side chain amine groups, or C-terminal lysine amides, of each of two peptide monomers.
[0093] Spacers.
[0094] A peptide monomer or dimer may further comprise one or more spacer moieties. Such spacer moieties may be attached to a peptide monomer or to a peptide dimer (e.g., such spacer moieties may be attached to the linker L.sub.K moiety that connects the monomers of a peptide dimer). For example, such spacer moieties may be attached to a peptide via the carbonyl carbon of a lysine linker, or via the nitrogen atom of an iminodiacetic acid linker. Such a spacer may connect a peptide to an attached water soluble polymer moiety or a protecting group.
[0095] In one embodiment, the spacer moiety is a C.sub.1-12 linking moiety optionally terminated with NH linkages or carboxyl (COOH) groups, and optionally substituted at one or more available carbon atoms with a lower alkyl substituent. In one embodiment, the spacer is RCOOH wherein R is a lower (C.sub.1-6) alkylene optionally substituted with a functional group such as a carboxyl group or an amino group that enables binding to another molecular moiety. For example, the spacer may be a glycine (G) residue, or an amino hexanoic acid.
[0096] In other embodiments, the spacer is NHRNH wherein R is a lower (C.sub.1-6) alkylene substituted with a functional group such as a carboxyl group or an amino group that enables binding to another molecular moiety. For example, the spacer may be a lysine (K) residue or a lysine amide (KNH.sub.2, a lysine residue wherein the carboxyl group has been converted to an amide moiety CONH.sub.2).
[0097] A spacer can be incorporated into the peptide during peptide synthesis. For example, where a spacer contains a free amino group and a second functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety, the spacer may be conjugated to the solid support. Thereafter, the peptide may be synthesized directly onto the spacer's free amino group by standard solid phase techniques.
[0098] For example, a spacer containing two functional groups is first coupled to the solid support via a first functional group. Next a linker L.sub.K moiety having two functional groups capable of serving as initiation sites for peptide synthesis and a third functional group (e.g., a carboxyl group or an amino group) that enables binding to another molecular moiety is conjugated to the spacer via the spacer's second functional group and the linker's third functional group. Thereafter, two peptide monomers may be synthesized directly onto the two reactive nitrogen groups of the linker L.sub.K moiety in a variation of the solid phase synthesis technique. For example, a solid support coupled spacer with a free amine group may be reacted with a lysine linker via the linker's free carboxyl group.
[0099] In alternate embodiments where the peptide compounds contain a spacer moiety, said spacer may be conjugated to the peptide after peptide synthesis. Such conjugation may be achieved by methods well established in the art. In one embodiment, the linker contains at least one functional group suitable for attachment to the target functional group of the synthesized peptide. For example, a spacer with a free amine group may be reacted with a peptide's C-terminal carboxyl group. In another example, a linker with a free carboxyl group may be reacted with the free amine group of a peptide's N-terminus or of a lysine residue. In yet another example, a spacer containing a free sulfhydryl group may be conjugated to a cysteine residue of a peptide by oxidation to form a disulfide bond.
[0100] Water Soluble Polymer Moieties.
[0101] The peptide monomers, dimers, or multimers of the invention may further comprise one or more water soluble polymer moieties. Preferably, these polymers are covalently attached to the peptide compounds of the invention. Included with the below description, the U.S. patent application Ser. No. 10/844,933 and International Patent Application No. PCT/US04/14887, filed May 12, 2004, are incorporated by reference herein in their entirety.
[0102] In recent years, water-soluble polymers, such as polyethylene glycol (PEG), have been used for the covalent modification of peptides of therapeutic and diagnostic importance. Attachment of such polymers is thought to enhance biological activity, prolong blood circulation time, reduce immunogenicity, increase aqueous solubility, and enhance resistance to protease digestion (see, e.g., J. M. Harris, Ed., Biomedical and Biotechnical Applications of Polyethylene Glycol Chemistry, Plenum, New York, 1992; Knauf, et al. (1988) J. Biol. Chem. 263; 15064; Tsutsumi, et al. (1995) J. Controlled Release 33:447; Kita, et al. (1990) Drug Des. Delivery 6:157; Abuchowski, et al. (1977) J. Biol. Chem. 252:582; Beauchamp, et al. (1983) Anal. Biochem. 131:25; Chen, et al. (1981) Biochim. Biophy. Acta 660:293).
[0103] The water soluble polymers useful for the peptide compounds of the invention may be, for example, polyethylene glycol (PEG), copolymers of ethylene glycol/propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic anhydride copolymer, polyaminoacids (either homopolymers or random copolymers), poly(n-vinyl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers, polypropylene oxide/ethylene oxide copolymers, and polyoxyethylated polyols.
[0104] The water soluble polymer may be of any molecular weight, and may be branched or unbranched. A preferred PEG for use in the present invention comprises linear, unbranched PEG having a low molecular weight. It is understood that in a given preparation of PEG, the molecular weights will typically vary among individual molecules. Some molecules will weight more, and some less, than the stated molecular weight. Such variation is generally reflect by use of the word about to describe molecular weights of the PEG molecules.
[0105] Peptides, peptide dimers and other peptide-based molecules of the invention can be attached to water-soluble polymers (e.g., PEG) using any of a variety of chemistries to link the water-soluble polymer(s) to the receptor-binding portion of the molecule (e.g., peptide+spacer). A typical embodiment employs a single attachment junction for covalent attachment of the water soluble polymer(s) to the receptor-binding portion, however in alternative embodiments multiple attachment junctions may be used, including further variations wherein different species of water-soluble polymer are attached to the receptor-binding portion at distinct attachment junctions, which may include covalent attachment junction(s) to the spacer and/or to one or both peptide chains. In some embodiments, the dimer or higher order multimer will comprise distinct species of peptide chain (i.e., a heterodimer or other heteromultimer). By way of example and not limitation, a dimer may comprise a first peptide chain having a PEG attachment junction and the second peptide chain may either lack a PEG attachment junction or utilize a different linkage chemistry than the first peptide chain and in some variations the spacer may contain or lack a PEG attachment junction and said spacer, if PEGylated, may utilize a linkage chemistry different than that of the first and/or second peptide chains. An alternative embodiment employs a PEG attached to the spacer portion of the receptor-binding portion and a different water-soluble polymer (e.g., a carbohydrate) conjugated to a side chain of one of the amino acids of the peptide portion of the molecule.
[0106] A wide variety of polyethylene glycol (PEG) species may be used for PEGylation of the receptor-binding portion (peptides+spacer). Substantially any suitable reactive PEG reagent can be used. In preferred embodiments, the reactive PEG reagent will result in formation of a carbamate or amide bond upon conjugation to the receptor-binding portion. Suitable reactive PEG species include, but are not limited to, those which are available for sale in the Drug Delivery Systems catalog (2003) of NOF Corporation (Yebisu Garden Place Tower, 20-3 Ebisu 4-chome, Shibuya-ku, Tokyo 150-6019) and the Molecular Engineering catalog (2003) of Nektar Therapeutics (490 Discovery Drive, Huntsville, Ala. 35806). For example and not limitation, the following PEG reagents are often preferred in various embodiments: mPEG2-NHS, mPEG2-ALD, multi-Arm PEG, mPEG(MAL)2, mPEG2(MAL), mPEG-NH2, mPEG-SPA, mPEG-SBA, mPEG-thioesters, mPEG-Double Esters, mPEG-BTC, mPEG-ButyrALD, mPEG-ACET, heterofunctional PEGs (NH2-PEG-COOH, Boc-PEG-NHS, Fmoc-PEG-NHS, NHS-PEG-VS, NHS-PEG-MAL), PEG acrylates (ACRL-PEG-NHS), PEG-phospholipids (e.g., mPEG-DSPE), multiarmed PEGs of the SUNBRITE series including the GL series of glycerine-based PEGs activated by a chemistry chosen by those skilled in the art, any of the SUNBRITE activated PEGs (including but not limited to carboxyl-PEGs, p-NP-PEGs, Tresyl-PEGs, aldehyde PEGs, acetal-PEGs, amino-PEGs, thiol-PEGs, maleimido-PEGs, hydroxyl-PEG-amine, amino-PEG-COOH, hydroxyl-PEG-aldehyde, carboxylic anhydride type-PEG, functionalized PEG-phospholipid, and other similar and/or suitable reactive PEGs as selected by those skilled in the art for their particular application and usage.
[0107] The number of polymer molecules attached may vary; for example, one, two, three, or more water soluble polymers may be attached to a peptide of the invention. The multiple attached polymers may be the same or different chemical moieties (e.g., PEGs of different molecular weight). In some cases, the degree of polymer attachment (the number of polymer moieties attached to a peptide and/or the total number of peptides to which a polymer is attached) may be influenced by the proportion of polymer molecules versus peptide molecules in an attachment reaction, as well as by the total concentration of each in the reaction mixture. In general, the optimum polymer versus peptide ratio (in terms of reaction efficiency to provide for no excess unreacted peptides and/or polymer moieties) will be determined by factors such as the desired degree of polymer attachment (e.g., mono, di-, tri-, etc.), the molecular weight of the polymer selected, whether the polymer is branched or unbranched, and the reaction conditions for a particular attachment method.
[0108] There are a number of PEG attachment methods available to those skilled in the art (see, e.g., Goodson, et al. (1990) Bio/Technology 8:343; EP 0 401 384; Malik, et al., (1992) Exp. Hematol. 20:1028-1035; PCT Pub. No. WO 90/12874; U.S. Pat. No. 5,757,078; and U.S. Pat. No. 6,077,939). For example, activated PEG may be covalently bound to amino acid residues via a reactive group, such as a free amino group in N-terminal amino acid residues and lysine (K) residues or a free carboxyl group in C-terminal amino acid residues. Sulfhydryl groups (e.g., as found on cysteine residues) may also be used as a reactive group for attaching PEG. In addition, enzyme-assisted methods for introducing activated groups (e.g., hydrazide, aldehyde, and aromatic-amino groups) specifically at the C-terminus of a polypeptide have been described (Schwarz, et al. (1990) Methods Enzymol. 184:160; Rose, et al. (1991) Bioconjugate Chem. 2:154; Gaertner, et al. (1994) J. Biol. Chem. 269:7224).
[0109] For example, PEG molecules may be attached to peptide amino groups using methoxylated PEG (mPEG) having different reactive moieties. Such polymers include mPEG-succinimidyl succinate, mPEG-succinimidyl carbonate, mPEG-imidate, mPEG-4-nitrophenyl carbonate, and mPEG-cyanuric chloride. Similarly, PEG molecules may be attached to peptide carboxyl groups using methoxylated PEG with a free amine group (mPEG-NH.sub.2).
[0110] Where attachment of the PEG is non-specific and a peptide containing a specific PEG attachment is desired, the desired PEGylated compound may be purified from the mixture of PEGylated compounds. For example, if an N-terminally PEGylated peptide is desired, the N-terminally PEGylated form may be purified from a population of randomly PEGylated peptides (i.e., separating this moiety from other monoPEGylated moieties).
[0111] Site-specific PEGylation at the N-terminus, side chain, and C-terminus can be performed through (i) solid-phase synthesis (see, e.g., Felix, et al. (1995) Int. J. Peptide Protein Res. 46:253) or (ii) attaching a peptide to extremities of liposomal surface-grafted PEG chains in a site-specific manner through a reactive aldehyde group at the N-terminus generated by sodium periodate oxidation of N-terminal threonine (see, e.g., Zalipsky, et al. (1995) Bioconj. Chem. 6:705; this method is limited to polypeptides with N-terminal serine or threonine residues), or (iii) via a hydrazone, reduced hydrazone, oxime, or reduced oxime bond is described in U.S. Pat. No. 6,077,939.
[0112] In one method, selective N-terminal PEGylation may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, a carbonyl group containing PEG is selective attached to the N-terminus of a peptide. For example, one may selectively N-terminally PEGylate the protein by performing the reaction at a pH which exploits the pK.sub.a differences between the ?-amino groups of a lysine residue and the ?-amino group of the N-terminal residue of the peptide. By such selective attachment, PEGylation takes place predominantly at the N-terminus of the protein, with no significant modification of other reactive groups (e.g., lysine side chain amino groups). Using reductive alkylation, the PEG should have a single reactive aldehyde for coupling to the protein (e.g., PEG proprionaldehyde may be used).
[0113] Site-specific mutagenesis is a further approach which may be used to prepare peptides for site-specific polymer attachment. By this method, the amino acid sequence of a peptide is designed to incorporate an appropriate reactive group at the desired position within the peptide. For example, WO 90/12874 describes the site-directed PEGylation of proteins modified by the insertion of cysteine residues or the substitution of other residues for cysteine residues.
[0114] Where PEG is attached to a spacer or linker moiety, similar attachment methods may be used. In this case, the linker or spacer contains a reactive group and an activated PEG molecule containing the appropriate complementary reactive group is used to effect covalent attachment. In preferred embodiments the linker or spacer reactive group contains a terminal amino group (i.e., positioned at the terminus of the linker or spacer) which is reacted with a suitably activated PEG molecule to make a stable covalent bond such as an amide or a carbamate. Suitable activated PEG species include, but are not limited to, mPEG-para-nitrophenylcarbonate (mPEG-NPC), mPEG-succinimidyl carbonate (mPEG-SC), and mPEG-succinimidyl propionate (mPEG-SPA). In other preferred embodiments, the linker or spacer reactive group contains a carboxyl group capable of being activated to form a covalent bond with an amine-containing PEG molecule under suitable reaction conditions. Suitable PEG molecules include mPEG-NH.sub.2 and suitable reaction conditions include carbodiimide-mediated amide formation or the like.
[0115] The peptides of the invention may be prepared by classical methods known in the art. These standard methods include exclusive solid phase synthesis, automated solid phase synthesis, partial solid phase synthesis methods, fragment condensation, classical solution synthesis, and recombinant DNA technology (See, e.g., Merrifield J. Am. Chem. Soc. 1963 85:2149 and Merrifield et al., 1982, Biochemistry, 21:502).
[0116] A preferred method for peptide synthesis is solid phase synthesis. Solid phase peptide synthesis procedures are well-known in the art (see, e.g., Stewart, Solid Phase Peptide Syntheses, Freeman and Co.: San Francisco, 1969; 2002/2003 General Catalog from Novabiochem Corp, San Diego, USA; Goodman, Synthesis of Peptides and Peptidomimetics, Houben-Weyl, Stuttgart 2002). In solid phase synthesis, synthesis is typically commenced from the C-terminal end of the peptide using an ?-amino protected resin. A suitable starting material can be prepared, for instance, by attaching the required ?-amino acid to a chloromethylated resin, a hydroxymethyl resin, a polystyrene resin, a benzhydrylamine resin, or the like. One such chloromethylated resin is sold under the trade name BIO-BEADS SX-1 by Bio Rad Laboratories (Richmond, Calif.). The preparation of the hydroxymethyl resin has been described (Bodonszky, et al. (1966) Chem. Ind. London 38:1597). The benzhydrylamine (BHA) resin has been described (Pietta and Marshall, 1970, Chem. Commun., 650), and the hydrochloride form is commercially available from Beckman Instruments, Inc. (Palo Alto, Calif.). For example, an ?-amino protected amino acid may be coupled to a chloromethylated resin with the aid of a cesium bicarbonate catalyst, according to the method described by Gisin (1973, Helv. Chim. Acta 56:1467).
[0117] After initial coupling, the ?-amino protecting group is removed, for example, using trifluoroacetic acid (TFA) or hydrochloric acid (HCl) solutions in organic solvents at room temperature. Thereafter, ?-amino protected amino acids are successively coupled to a growing support-bound peptide chain. The ?-amino protecting groups are those known to be useful in the art of stepwise synthesis of peptides, including: acyl-type protecting groups (e.g., formyl, trifluoroacetyl, acetyl), aromatic urethane-type protecting groups [e.g., benzyloxycarboyl (Cbz) and substituted Cbz], aliphatic urethane protecting groups [e.g., t-butyloxycarbonyl (Boc), isopropyloxycarbonyl, cyclohexyloxycarbonyl], and alkyl type protecting groups (e.g., benzyl, triphenylmethyl), fluorenylmethyl oxycarbonyl (Fmoc), allyloxycarbonyl (Alloc), and 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)ethyl (Dde).
[0118] The side chain protecting groups (typically ethers, esters, trityl, PMC (2,2,5,7,8-pentamethyl-chroman-6-sulphonyl), and the like) remain intact during coupling and is not split off during the deprotection of the amino-terminus protecting group or during coupling. The side chain protecting group must be removable upon the completion of the synthesis of the final peptide and under reaction conditions that will not alter the target peptide. The side chain protecting groups for Tyr include tetrahydropyranyl, tert-butyl, trityl, benzyl, Cbz, ZBrCbz, and 2,5-dichlorobenzyl. The side chain protecting groups for Asp include benzyl, 2,6-dichlorobenzyl, methyl, ethyl, and cyclohexyl. The side chain protecting groups for Thr and Ser include acetyl, benzoyl, trityl, tetrahydropyranyl, benzyl, 2,6-dichlorobenzyl, and Cbz. The side chain protecting groups for Arg include nitro, Tosyl (Tos), Cbz, adamantyloxycarbonyl mesitoylsulfonyl (Mts), 2,2,4,6,7-pentamethyldihydrobenzofurane-5-sulfonyl (Pbf), 4-methoxy-2,3,6-trimethyl-benzenesulfonyl (Mtr), or Boc. The side chain protecting groups for Lys include Cbz, 2-chlorobenzyloxycarbonyl (2-Cl-Cbz), 2-bromobenzyloxycarbonyl (2-Br-Cbz), Tos, or Boc.
[0119] After removal of the ?-amino protecting group, the remaining protected amino acids are coupled stepwise in the desired order. Each protected amino acid is generally reacted in about a 3-fold excess using an appropriate carboxyl group activator such as 2-(1H-benzotriazol-1-yl)-1,1,3,3 tetramethyluronium hexafluorophosphate (HBTU) or dicyclohexylcarbodimide (DCC) in solution, for example, in methylene chloride (CH.sub.2Cl.sub.2), N-methyl pyrrolidone, dimethyl formamide (DMF), or mixtures thereof.
[0120] After the desired amino acid sequence has been completed, the desired peptide is decoupled from the resin support by treatment with a reagent, such as trifluoroacetic acid (TFA) or hydrogen fluoride (HF), which not only cleaves the peptide from the resin, but also cleaves all remaining side chain protecting groups. When a chloromethylated resin is used, hydrogen fluoride treatment results in the formation of the free peptide acids. When the benzhydrylamine resin is used, hydrogen fluoride treatment results directly in the free peptide amide. Alternatively, when the chloromethylated resin is employed, the side chain protected peptide can be decoupled by treatment of the peptide resin with ammonia to give the desired side chain protected amide or with an alkylamine to give a side chain protected alkylamide or dialkylamide. Side chain protection is then removed in the usual fashion by treatment with hydrogen fluoride to give the free amides, alkylamides, or dialkylamides. In preparing the esters of the invention, the resins used to prepare the peptide acids are employed, and the side chain protected peptide is cleaved with base and the appropriate alcohol (e.g., methanol). Side chain protecting groups are then removed in the usual fashion by treatment with hydrogen fluoride to obtain the desired ester. The resultant peptide can be further purified using HPLC.
[0121] These procedures can also be used to synthesize peptides in which amino acids other than the 20 naturally occurring, genetically encoded amino acids are substituted at one, two, or more positions of any of the compounds of the invention. Synthetic amino acids that can be substituted into the peptides of the present invention include, but are not limited to, N-methyl, L-hydroxypropyl, L-3, 4-dihydroxyphenylalanyl, ? amino acids such as L-? ?-hydroxylysyl and D-? ?-methylalanyl, L-?-methylalanyl, ? amino acids, and isoquinolyl. D-amino acids and non-naturally occurring synthetic amino acids can also be incorporated into the peptides of the present invention.
[0122] In addition to chemical synthesis, the peptides of the present invention may be synthesized by employing recombinant DNA technology by expressing one or more polynucleotide comprising a peptide coding region. Thus, provided herein are isolated polynucleotides that encode the peptides of the present invention as well as recombinant vectors and host cells (both eukaryotic and prokaryotic) that have been genetically modified to express or overexpress the peptides of the present invention.
[0123] In one embodiment, the invention provides isolated polynucleotides comprising nucleotide sequences encoding the peptides of the invention.
[0124] Expression may be achieved in any conventional expression system known in the art by isolating a DNA fragment encoding the peptide of interest and cloning into an expression vector.
[0125] Useful compounds of the present invention are not limited to peptides incorporating natural and/or non-natural amino acids. The invention also encompasses various peptidomimetics such as, e.g., peptoids (a class of peptidomimetics whose side chains are appended to the nitrogen atom of the peptide backbone, rather than to the ?-carbons). A number of non-peptide molecules having similar functional properties to the peptides of the invention can be developed to incorporate disparate chemical functional groups within a single molecule. These molecules are often referred to as scaffolding molecules, or scaffolds, since they can accommodate a wide range of chemical functionality and can be designed to present the chemical functional groups in a wide array of relative geometric orientations in space. Molecular scaffold systems include, but are not limited to, carbohydrates (see, e.g., Tamaruya et al., Angew Chem. Int. Ed. Engl., 2004, 43(21):2834-7), peptide nucleic acids (PNA's), (see, e.g., Peptide Nucleic Acids: Protocols and Applications, 2nd ed., Peter E. Nielsen, ed., Horizon Bioscience, 2004) and molecules not derived from biological precursors (see, e.g., Savinov and Austin, Org. Lett., 2002, 4(9):1419-22). The incorporation of this diverse a set of chemistries may require chemical protection of reactive functionality during synthesis. These techniques are well known in the art and can be found in references such as T. W. Green, P. G. M. Wuts, Protective Groups in Organic Synthesis, Wiley-Interscience, New York, 1999.
[0126] Peptides and their derivatives disclosed herein may be formulated as compositions together with a pharmaceutically acceptable carrier (such as an adjuvant or vehicle) and/or excipient, and/or diluents. Compositions of this invention may include pharmaceutically acceptable salts of the components therein. Pharmaceutically acceptable salts include the acid addition salts (formed with the free amino groups of the peptide) that are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, tartaric, mandelic and the like. Salts formed with the free carboxyl groups can be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine and the like.
[0127] Pharmaceutically acceptable carriers are familiar to those skilled in the art and can include sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous solution saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E. W. Martin. For compositions formulated as liquid solutions, acceptable carriers and diluents include saline and sterile water, and may optionally include antioxidants, buffers, bacteriostats, and other common additives. The compositions can also be formulated as pills, capsules, granules, or tablets which may contain, in addition to a peptide of this invention, diluents, dispersing and surface active agents, binders, and lubricants. Proper formulation is dependent upon the route of administration chosen.
[0128] The optimal therapeutically effective amount of a compound or composition of this invention may be determined experimentally, taking into consideration the exact mode of administration, the form in which the drug is administered, the indication toward which the administration is directed, the subject involved (e.g., body weight, health, age, sex, etc.), and the preference and experience of the physician or veterinarian in charge.
[0129] The efficacy of the peptides and compositions of this invention can be determined using the in vitro and in vivo assays described in the Examples section, below.
[0130] Following methodologies which are well-established in the art, effective doses and toxicity of the peptides and compositions of the present invention, which performed well in in vitro tests, can be determined in studies using small animal models (e.g., mice, rats or dogs) in which they have been found to be therapeutically effective and in which these drugs can be administered by the same route proposed for the human trials.
[0131] For any pharmaceutical composition used in the methods of the invention, dose-response curves derived from animal systems can be used to determine testing doses for administration to humans. In safety determinations for each composition, the dose and frequency of administration should meet or exceed those anticipated for use in any clinical trial.
[0132] As disclosed herein, the dose of the compound in the compositions of the present invention is determined to ensure that the dose administered continuously or intermittently will not exceed an amount determined after consideration of the results in test animals and the individual conditions of a patient. A specific dose naturally varies (and is ultimately decided according to the judgment of the practitioner and each patient's circumstances) depending on the dosage procedure, the conditions of a patient or a subject animal such as age, body weight, sex, sensitivity, feed, dosage period, drugs used in combination, seriousness of the disease, etc.
[0133] Toxicity and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical procedures in experimental animals, e.g., by determining the LD.sub.50 (the dose lethal to 50% of the population) and the ED.sub.50 (the dose therapeutically effective in 50% of the population). The dose ratio between therapeutic and toxic effects is the therapeutic index and it can be expressed as the ratio ED.sub.50/LD.sub.50.
[0134] All known peptide delivery methods can be used to deliver the peptides of the present invention to the target tissues. The specific type of delivery useful for a given peptide is determined by its specific size, flexibility, conformation, biochemical properties of constituent amino acids, and amino acid arrangement. Peptide composition also determines, in part, the degree of protein binding, enzymatic stability, cellular sequestration, uptake into non-target tissue, clearance rate, and affinity for protein carriers. Other aspects independent of peptide composition must also be considered, such as cerebral blood flow, diet, age, sex, species (for experimental studies), dosing route, and effects of existing pathological conditions.
[0135] The peptides and/or the pharmaceutical composition comprising the peptides of the invention can be administered to a subject (e.g., human or animal) in need via various administration routes, including, but not limited to, systemic administration, inhalation, topical, sublingual, oral, intranasal, and/or direct instillation (e.g, intratracheal instillation for lung treatment). Moreover, the peptides of the invention can be formulated for any suitable administration, with or without any pharmaceutically acceptable carrier, excipients, solvents, and/or solutions, and in certain proper dosage.
[0136] Examples of delivery methods useful for obtaining effective tissue delivery of the peptides of the invention (and effective passage through the blood-brain-barrier [BBB] in case of brain tissues), include, without limitation (reviewed, e.g., in Witt and Davis, AAPS Journal, 2006; 8(1): E76-E88.):
(i) invasive procedures (e.g., direct injection [e.g., using an external pump or i.v. line], transient osmotic opening, shunts, and biodegradable implants);
(ii) pharmacologically-based approaches to increase the tissue delivery by chemical modification of the peptide molecule itself, or by the attachment or encapsulation of the peptide in a substance that increases permeability, stability, bioavailability, and/or receptor affinity; in addition, modification of a peptide structure and/or addition of constituents (e.g., lipophilicity enhancers, polymers, antibodies) may enhance local peptide concentration in the target tissue;
(iii) physiologic-based strategies which exploit various carrier mechanisms; these strategies can be combined, dependent of the nature of a given peptide, creating hybrid peptides, resulting in synergistic delivery and end-effect.
[0137] Specific examples of peptide modifications and methods useful for improving delivery of the peptides of the invention include, without limitation, lipidization (e.g., methylation, dimethylation, or halogenation of constituent amino acids or acylation or alkylation of the N-terminal amino acid), structural modification to enhance stability (e.g., use of D-amino acids, N-acylation, or cyclization, e.g., via a disulfide-bridge or via a hydrazide bridge), glycosylation (e.g., adding simple sugars such as, e.g., glucose or xylose), increasing affinity for nutrient transporters (e.g., adding hexose or large neutral amino acid carriers which facilitate delivery of substrates to the brain), forming a prodrug by conjugating a peptide to a molecule with a known transporter activity or to a lipophilicity enhancer, which is cleaved at or near the site of action (e.g., using esterification [with, e.g., aromatic benzoyl esters or branched chain tertiary butyl esters] or amidation of amino, hydroxyl, or carboxylic acid-containing peptides; also, redox system-mediated delivery to the brain may be facilitated using conjugation to a methyldihydropyridine carrier and subsequent oxidation by NADH-linked dehydrogenases in the brain, which results in a quaternary ammonium salt, which does not cross back through the BBB endothelium), vector-based delivery (e.g., by coupling a peptide to a substance that increases the affinity to and transport across biological membranes via receptor-mediated or absorptive-mediated endocytosis followed by peptide release via enzymatic cleavage [e.g., conjugation of a peptide to murine monoclonal antibody (OX26) to the transferrin or conjugation to cationized albumin to increase brain uptake]), cationization to increase membrane entry via absorptive-mediated endocytosis, and polymer conjugation/encapsulation (e.g., conjugation to poly(ethylene glycol) [PEG] or poly(styrene maleic acid) or encapsulation via micro- or nano-particles [e.g., polymeric nanoparticles ranging in size between 10 and 1000 nm, which have a polysorbate overcoating such as, e.g., polysorbate-80], liposomes [e.g., surface-modified long-circulating liposomes grafted with a flexible hydrophilic polymer such as, e.g., PEG and/or liposomes composed of a phospholipid bilayer such as, e.g., pluronic copolymer P85, that act as a carrier for both hydrophilic and hydrophobic peptides], micelles [e.g., stable polymeric micelles prepared from amphiphilic PEG-phospholipid conjugates], or cell ghosts). Reviewed in Torchilin and Lukyanov, D D T, 2003, 8(6): 259-266; Egleton and Davis, NeuroRx, 2005, 2: 44-53; Witt and Davis, AAPS Journal, 2006; 8(1): E76-E88.
[0138] Regardless of the delivery method used, an important aspect of the present invention is to keep the size of the resulting delivered peptide sufficiently small (e.g., by using cleavable conjugates).
[0139] Oral Delivery.
[0140] Contemplated for use herein are oral solid dosage forms, which are described generally in Remington's Pharmaceutical Sciences, 18th Ed. 1990 (Mack Publishing Co. Easton Pa. 18042) at Chapter 89, which is herein incorporated by reference. Solid dosage forms include tablets, capsules, pills, troches or lozenges, cachets, pellets, powders, or granules. Also, liposomal or proteinoid encapsulation may be used to formulate the present compositions (as, for example, proteinoid microspheres reported in U.S. Pat. No. 4,925,673). Liposomal encapsulation may be used and the liposomes may be derivatized with various polymers (e.g., U.S. Pat. No. 5,013,556). A description of possible solid dosage forms for the therapeutic is given by Marshall, K. In: Modern Pharmaceutics Edited by G. S. Banker and C. T. Rhodes Chapter 10, 1979, herein incorporated by reference. In general, the formulation will include a peptide of the invention (or chemically modified forms thereof) and inert ingredients which allow for protection against the stomach environment, and release of the biologically active material in the intestine.
[0141] Also contemplated for use herein are liquid dosage forms for oral administration, including pharmaceutically acceptable emulsions, solutions, suspensions, and syrups, which may contain other components including inert diluents; adjuvants such as wetting agents, emulsifying and suspending agents; and sweetening, flavoring, and perfuming agents.
[0142] As discussed above, the peptides may be chemically modified so that oral delivery of the derivative is efficacious. Generally, the chemical modification contemplated is the attachment of at least one moiety to the component molecule itself, where said moiety permits (a) increase in peptide stability (e.g., by inhibition of proteolysis) and (b) efficient uptake into the blood stream from the stomach or intestine. As discussed above, common delivery-improving peptide modifications include PEGylation or the addition of moieties such as propylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, polyproline, poly-1,3-dioxolane and poly-1,3,6-tioxocane (see, e.g., Abuchowski and Davis (1981) Soluble Polymer-Enzyme Adducts, in Enzymes as Drugs. Hocenberg and Roberts, eds. (Wiley-Interscience: New York, N.Y.) pp. 367-383; and Newmark, et al. (1982) J. Appl. Biochem. 4:185-189).
[0143] For oral formulations, the location of release may be the stomach, the small intestine (the duodenum, the jejunum, or the ileum), or the large intestine. One skilled in the art has available formulations which will not dissolve in the stomach, yet will release the material in the duodenum or elsewhere in the intestine. Preferably, the release will avoid the deleterious effects of the stomach environment, either by protection of the peptide (or derivative) or by release of the peptide (or derivative) beyond the stomach environment, such as in the intestine.
[0144] To ensure full gastric resistance a coating impermeable to at least pH 5.0 is essential. Examples of the more common inert ingredients that are used as enteric coatings are cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, and Shellac. These coatings may be used as mixed films.
[0145] A coating or mixture of coatings can also be used on tablets, which are not intended for protection against the stomach. This can include sugar coatings, or coatings which make the tablet easier to swallow. Capsules may consist of a hard shell (such as gelatin) for delivery of dry therapeutic (i.e. powder), for liquid forms a soft gelatin shell may be used. The shell material of cachets could be thick starch or other edible paper. For pills, lozenges, molded tablets or tablet triturates, moist massing techniques can be used.
[0146] The peptide (or derivative) can be included in the formulation as fine multiparticulates in the form of granules or pellets of particle size about 1 mm. The formulation of the material for capsule administration could also be as a powder, lightly compressed plugs, or even as tablets. These therapeutics could be prepared by compression.
[0147] Colorants and/or flavoring agents may also be included. For example, the peptide (or derivative) may be formulated (such as by liposome or microsphere encapsulation) and then further contained within an edible product, such as a refrigerated beverage containing colorants and flavoring agents.
[0148] One may dilute or increase the volume of the peptide (or derivative) with an inert material. These diluents could include carbohydrates, especially mannitol, lactose, anhydrous lactose, cellulose, sucrose, modified dextrans and starch. Certain inorganic salts may be also be used as fillers including calcium triphosphate, magnesium carbonate and sodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress, and Avicel.
[0149] Disintegrants may be included in the formulation of the therapeutic into a solid dosage form. Materials used as disintegrates include but are not limited to starch, including the commercial disintegrant based on starch, Explotab. Sodium starch glycolate, Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin, orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may all be used. The disintegrants may also be insoluble cationic exchange resins. Powdered gums may be used as disintegrants and as binders. and can include powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.
[0150] Binders may be used to hold the peptide (or derivative) agent together to form a hard tablet and include materials from natural products such as acacia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) could both be used in alcoholic solutions to granulate the peptide (or derivative).
[0151] An antifrictional agent may be included in the formulation of the peptide (or derivative) to prevent sticking during the formulation process. Lubricants may be used as a layer between the peptide (or derivative) and the die wall, and these can include but are not limited to; stearic acid including its magnesium and calcium salts, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be used such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycol of various molecular weights, Carbowax 4000 and 6000.
[0152] Glidants that might improve the flow properties of the drug during formulation and to aid rearrangement during compression might be added. The glidants may include starch, talc, pyrogenic silica and hydrated silicoaluminate.
[0153] To aid dissolution of the peptide (or derivative) into the aqueous environment a surfactant might be added as a wetting agent. Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate. Cationic detergents might be used and could include benzalkonium chloride or benzethomium chloride. The list of potential nonionic detergents that could be included in the formulation as surfactants are lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerol monostearate, polysorbate 20, 40, 60, 65 and 80, sucrose fatty acid ester, methyl cellulose and carboxymethyl cellulose. These surfactants could be present in the formulation of the protein or derivative either alone or as a mixture in different ratios.
[0154] Additives which potentially enhance uptake of the peptide (or derivative) are for instance the fatty acids oleic acid, linoleic acid and linolenic acid.
[0155] Controlled release oral formulations may be desirable. The peptide (or derivative) could be incorporated into an inert matrix which permits release by either diffusion or leaching mechanisms, e.g., gums. Slowly degenerating matrices may also be incorporated into the formulation. Some enteric coatings also have a delayed release effect. Another form of a controlled release is by a method based on the Oros therapeutic system (Alza Corp.), i.e. the drug is enclosed in a semipermeable membrane which allows water to enter and push drug out through a single small opening due to osmotic effects.
[0156] Other coatings may be used for the formulation. These include a variety of sugars which could be applied in a coating pan. The peptide (or derivative) could also be given in a film coated tablet and the materials used in this instance are divided into 2 groups. The first are the nonenteric materials and include methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and the polyethylene glycols. The second group consists of the enteric materials that are commonly esters of phthalic acid.
[0157] A mix of materials might be used to provide the optimum film coating. Film coating may be carried out in a pan coater or in a fluidized bed or by compression coating.
[0158] Parenteral Delivery.
[0159] Preparations according to this invention for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, or emulsions. Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils, such as olive oil and corn oil, gelatin, and injectable organic esters such as ethyl oleate. Such dosage forms may also contain adjuvants such as preserving, wetting, emulsifying, and dispersing agents. They may be sterilized by, for example, filtration through a bacteria retaining filter, by incorporating sterilizing agents into the compositions, by irradiating the compositions, or by heating the compositions. They can also be manufactured using sterile water, or some other sterile injectable medium, immediately before use.
[0160] Administration by Inhalation and Intranasal Administration.
[0161] The present invention encompasses any delivery device that is suitable for administration by inhalation or intranasal administration of the compositions of the invention. Preferably, such means administers a metered dosage of the composition. The composition of the present invention may be packed in any appropriate form or container as long as a means is provided to deliver the composition to the oral or lung or nasal mucosa. Non-limiting examples of useful delivery devices include, e.g., instillation catheters, droppers, unit-dose containers, squeeze bottles pump sprays, airless and preservative-fee sprays, compressed air nebulizers, metered-dose inhalers, insufflators and pressurized metered dose inhalers. For administration of a liquid in drop form, compositions of the invention can be placed in a container provided with a conventional dropper/closure device, e.g. comprising a pipette or the like, preferably delivering a substantially fixed volume of composition/drop. For administration of an aqueous solution as a spray, the aqueous solution may be dispensed in spray form by a variety of methods known to those skilled in the art. For example, such compositions will be put up in an appropriate atomising device, e.g. in a pump-atomiser, or the like. The atomising device will be provided with appropriate means, such as a spray adaptor for delivery of the aqueous spray to the naris. Preferably it will be provided with means ensuring delivery of a substantially fixed volume of composition/actuation (i.e. per spray-unit). Examples of nasal sprays include nasal actuators produced by Ing. Erich Pfeiffer GmbH, Radolfzell, Germany (see U.S. Pat. No. 4,511,069, U.S. Pat. No. 4,778,810, U.S. Pat. No. 5,203,840, U.S. Pat. No. 5,860,567, U.S. Pat. No. 5,893,484, U.S. Pat. No. 6,227,415, and U.S. Pat. No. 6,364,166. Additional aerosol delivery forms may include, e.g., compressed air-, jet-, ultrasonic-, and piezoelectric nebulizers. Alternatively the spray may be bottled under pressure in an aerosol device. The propellant may be a gas or a liquid (e.g. a fluorinated and/or chlorinated hydrocarbon). The spray composition may be suspended or dissolved in a liquid propellant. Stabilizing and/or suspending agents and/or co-solvents may be present. A dry powder may be readily dispersed in an inhalation device as described in U.S. Pat. No. 6,514,496 and Garcia-Arieta et al., Biol. Pharm. Bull. 2001; 24: 1411-1416. If desired a powder or liquid may be filled into a soft or hard capsule or in a single dose device adapted for nasal administration. The powder may be sieved before filled into the capsules such as gelatine capsules. The delivery device may have means to break open the capsule. The powdery nasal composition can be directly used as a powder for a unit dosage form. The contents of the capsule or single dose device may be administered using e.g. an insufflator. Preferably it will be provided with means ensuring dosing of a substantially fixed amount of composition.
[0162] In another embodiment, the composition of the invention can be provided as a nasal insert having the peptide(s) of the invention. The insert may be retained in the naris, but flushed by the nasal mucus, and may be designed to release the Peptide, fragment or derivative of the invention at the same place in the naris. Suitable nasal insert types include nasal plugs, tampons and the like. Further examples of nasal inserts, their characteristics and preparation are described in EP 490806.
[0163] Delivery devices are important not only for delivering the peptides of the invention, but also for providing an appropriate environment for storage. This would include protection from microbial contamination and chemical degradation. The device and formulation should be compatible so as to avoid potential leaching or adsorption. The delivery device (or its packaging) can be optionally provided with a label and/or with instructions for use.
[0164] The peptides of the invention can be administered using any standard administration route and technique known in the art. The peptides can also be delivered using a vector (such as a viral vector) with the ability to express a peptide of this invention.
[0165] Therapeutic Applications of the Peptides of the Invention
[0166] Fibrotic diseases that could be targeted by the peptides of invention include, but not limited to, liver diseases, including but not limited to, liver cirrhosis and fibrosis of any etiology (alcoholic; non-alcoholic steato-hepatitis; autoimmune hepatitis; chronic hepatitis C; chronic hepatitis B; primary biliary cirrhosis; secondary biliary cirrhosis; sclerosing cholangitis; alpha-1-antitrypsin deficiency; Wilson's disease; biliary atresia); lung diseases, including but not limited to, idiopathic pulmonary fibrosis; radiation-induced pneumonitis; chronic obstructive pulmonary disease; emphysema; secondary to chronic infections and inflammation; kidney diseases, including but not limited to, glomerulonephritis and interstitial-tubular fibrosis; skin diseases, including but not limited to, secondary to burns; keloids; hypertrophic post-surgical wounds; scleroderma; esophageal-gastro-intestinal, including but not limited to, secondary to corrosive materials; secondary to inflammatory diseases (inflammatory bowel diseases; esophageal injury and inflammation); secondary to ischemic disease; peritoneal fibrosis; pancreatic fibrosis; post-radiation; cardiac-vascular diseases secondary to infarcts; brain diseases secondary to ischemia/infarcts; post-trauma; and musculoskeletal diseases, including but not limited to, posttraumatic muscular fibrosis and synovial/joint fibrosis.
[0167] Inflammatory diseases that could be targeted by the peptides of invention include, but not limited to, liver diseases, including but not limited to, liver inflammation diseases including but not limited to, alcoholic liver disease; non-alcoholic steato-hepatitis; autoimmune hepatitis; chronic hepatitis C; chronic hepatitis B; primary biliary cirrhosis; secondary biliary cirrhosis; sclerosing cholangitis; alpha-1-antitrypsin deficiency; Wilson's disease; biliary atresia; lung inflammation associated with Idiopathic pulmonary fibrosis; radiation-induced pneumonitis; chronic obstructive pulmonary disease; emphysema; secondary to chronic infections and inflammation; kidney inflammation associated with glomerulonephritis; interstitial-tubular fibrosis; skin inflammation secondary to burns; scleroderma; psoriasis; esophageal-gastro-Intestinal secondary to inflammatory diseases (Inflammatory bowel diseases; esophageal injury and inflammation); post-radiation; Inflammatory cardiomyopathy; brain inflammation (post-trauma; Alzheimer disease; encephalitis; meningitis); musculoskeletal inflammation due to myositis and arthritis.
[0168] Peptides of the invention can be used as part of combination treatments with various other treatments known for the specific diseases which are being targeted.
The Therapeutic Target and its Potential Clinical Relevance for Liver Fibrosis
[0169] Activation of liver myofibroblasts (of different origins) is responsible for the development of liver fibrosis in chronic liver diseases (13; 15; 19; 20), and remarkably, the clearance of myofibroblasts by apoptosis would allow recovery from liver injury and reversal of liver fibrosis (7; 20; 24). There is agreement among liver experts that inhibiting or reversing myofibroblastic activation of different cellular origins is critical for the treatment of liver fibrosis (7; 15; 19; 20; 24). Finally, blocking the progression of liver fibrosis would decrease development of primary liver cancer since the majority of hepatocellular carcinomas arise in cirrhotic livers (34).
[0170] The rationales for developing the therapeutic peptides of the invention are provided as follows: a) activation of myofibroblasts is responsible for the development of liver fibrosis in chronic liver diseases of all causes (13; 15; 19; 20); b) inhibition of myofibroblastic activity by apoptosis would allow recovery from liver injury and potentially reversal of liver fibrosis (7; 20; 24); c) phosphorylated C/EBP?-Thr217 is indispensable for the survival of activated liver myofibroblasts by binding to the inactive procaspase 8 complex and preventing its self-cleavage and activation (4); d) phosphorylation of C/EBP?-Thr217 in activated liver myofibroblasts is important for the progression of liver fibrosis. This was determined using classical human hepatotoxin-induced liver injury and fibrosis models in mice (15; 24; 38), and primary mouse and human liver myofibroblasts (4; 6; 7; 23; 27); e) phosphorylation of C/EBP?-Thr217 in activated liver myofibroblasts is also important in other animal models that mimic other causes of human liver injury-fibrosis (acute Fas- and chronic dimethylnitrosamine-induced liver injury and fibrogenesis); f) phosphorylation of human C/EBP?-Thr266 (the homologous human phosphoacceptor) in activated liver myofibroblasts also occurs in human liver fibrosis (7) and in activated primary human myofibroblasts in culture (7); g) Mice expressing the non-phosphorylatable C/EBP?-Ala217 transgene are refractory to the induction of myofibroblasts' activation and proliferation by different hepatotoxins (4; 7); h) the non-phosphorylatable C/EBP?-Ala217 is present within the death receptor complex II, with active caspase 8, and is linked to apoptosis of activated liver myofibroblasts in transgenic mice (4; 7; 9); i) blocking phosphorylation of C/EBP?-Thr217 with the C/EBP?-Ala217 transgene or by C/EBP? gene knock-out decreases the fibrotic response of the liver to acute and chronic injury (4; 7); j) the decreased fibrotic response of the liver to hepatotoxins in C/EBP?-ko mice suggests that the important target of RSK phosphorylation in activated liver myofibroblasts is C/EBP?-Thr217 rather than other phosphoacceptors in c-Fos, CREB, CBP or other proteins (4; 44; 45; 46; 52); k) the peptide prevents the phosphorylation of C/EBP?-Thr217 (the molecular target) in myofibroblasts activated in culture by a collagen type 1 matrix or by liver injury in mice (4); and 1) the therapeutic lead and two alternate peptides stimulate apoptosis of liver myofibroblasts following their activation in culture by a collagen type 1 matrix or by liver injury in mice and block active fibrogenesis, preventing progression and inducing regression of liver fibrosis; m) the peptides stimulates apoptosis of activated liver myofibroblasts and reversal of fibrosis in a chronic animal model of cirrhosis (7); and n) the therapeutic lead compound also has very high efficacy against the molecular target, preventing activation of myofibroblasts and inhibiting liver fibrosis.
The Therapeutic Target and its Potential Clinical Relevance for Liver Inflammation
[0171] Activation of liver macrophages (of different origins) is responsible for the development of liver inflammation in acute and chronic liver diseases. Excessive liver injury and inflammation associated with liver diseases induced by viral, toxic, immunologic, and metabolic diseases (13), results in liver dysfunction and in chronic conditions in the potential deposition of scar tissue and the development of cirrhosis (15). Amplification of liver injury can be mediated by macrophages (14, 40).
[0172] Expression of genes required for Inflammasome activation is indispensable for macrophage activation and Inflammasome function. C/EBP? appears to be an important signaling molecule for macrophages because its expression is dramatically increased during differentiation of these cells, and it is induced by macrophage modulators (LPS, IL-1, G-CSF, TGF?, vitamin D, retinoic acid) (Akira et al., 1990) {Friedman, 2007 2075/id}. Upon activation and differentiation of macrophages, C/EBP? can regulate the expression of inflammatory cytokines and chemokines, which are linked to the Inflammasome activation {Friedman, 2007 2075/id}. In addition, expression of a dominant inhibitor of C/EBP DNA-binding sites {Iwama, 2002 2077/id} or a targeted deletion of C/EBP? results in impaired macrophage differentiation {Sebastian, 2006 2079/id}.
[0173] Phosphorylation of the CCAAT/Enhancer Binding Protein (C/EBP)-3 by ribosomal S-kinase (RSK), which is activated directly by extracellular-regulated kinase (ERK)-1/2 phosphorylation, plays an essential role in the ERK/Mitogen Activated Protein Kinase (MAPK) signaling pathway regulating cell survival (Buck et al., Mol Cell 4:1087, 1999; Buck et al., Mol Cell 8: 807-16, 2001; Buck and Chojkier, PLOS One 2: e1372, 2007). Expression of the phosphorylation-mutant C/EBP?-Glu217, which mimics phosphorylated C/EBP?-Thr217 in biological assays (Trautwein et al., Nature 364: 544-547, 1993), was sufficient to rescue macrophage injury induced by Anthrax lethal toxin (Buck and Chojkier, Am J Physiol Cell Physiol 293: C1788-96, 2007).
The Therapeutic Target and its Potential Clinical Relevance for Lung Inflammation and Fibrosis
[0174] Activation of LMF is responsible for the development of lung fibrosis in IPF (11; 14; 15). Phosphorylated C/EBP?-Thr217 facilitates survival of activated LMF by binding to the inactive procaspase 8 complex and preventing its self-cleavage and activation (6). Phosphorylation of C/EBP?-Thr217 in activated LMF is critical for the progression of lung fibrosis. This was determined by using classical Bleomycin-induced lung fibrosis models in mice, primary mouse and human LMF in tissue culture and cell-free systems (5; 6). Phosphorylation of human C/EBP?-Thr266 in activated LMF occurs in human lung fibrosis of IPF (5). Mice expressing the non-phosphorylatable C/EBP?-Ala217 transgene are refractory to the induction of LMF activation and proliferation by Bleomycin (5). The non-phosphorylatable C/EBP?-Ala217 facilitates the death of activated LMF by binding to the inactive procaspase and inducing its self-cleavage and activation (5). The non-phosphorylatable C/EBP?-Ala217 dominant negative transgene was present within the death receptor complex II, with active caspase 8, and was linked to apoptosis of activated LMF in transgenic mice (3; 5; 6). Blocking phosphorylation of C/EBP?-Thr217 with the C/EBP?-Ala217 transgene or by C/EBP? gene knock-out decreases the fibrotic response of the lung (5; 25). The decreased fibrotic response of the lung to Bleomycin in C/EBP?-ko mice (25) suggests that the important target of RSK in activated LMF is C/EBP?-Thr217 rather than other RSK phosphoacceptors on c-Fos, CREB, CBP or other proteins. The inhibitory parent peptide prevents the phosphorylation of C/EBP?-Thr217 in LMF activated in culture by a collagen type 1 matrix or in vivo by lung injury (5).
[0175] Synthesis and analysis of therapeutic peptides of the invention containing non-naturally occurring amino acids with and without an N-terminal PEG-30 kDa are provided in the following
[0176] Amino acid sequences of these peptides are provided below:
TABLE-US-00001 Sequence TAGGGTGTGTTTAGGCGAAA(SEQIDNO:1) TCTGTTGCCTTCCTAATAAG(SEQIDNO:2) Lys-DAla-DVal-Asp-NH2 Ac-Lys-DAla-DVal-Asp-NH2 Mpr-Lys-DAla-DVal-Asp-NH2 PEG-Lys-DAla-DVal-Asp-NH2 PEG-Mpr-Lys-DAla-DVal-Asp-NH2 Lys-DAla-Val-Asp-NH2 Ac-Lys-DAla-Val-Asp-NH2 Mpr-Lys-DAla-Val-Asp-NH2 PEG-Lys-DAla-Val-Asp-NH2 PEG-Mpr-Lys-DAla-Val-Asp-NH2 Lys-Ala-DVal-Asp-NH2 Ac-Lys-Ala-DVal-Asp-NH2 Mpr-Lys-Ala-DVal-Asp-NH2 PEG-Lys-Ala-DVal-Asp-NH2 PEG-Mpr-Lys-Ala-DVal-Asp-NH2 Ac-Lys-Ala-Val-Asp-NH2(SEQIDNO:6) Ac-Lys-Ala-Val-Lys-CHO(SEQIDNO:7) DLys-Ala-DVal-Asp-NH2 DLys-Ala-Val-DAsp-NH2 Lys-Ser-Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser- Asp(SEQIDNO:3) Lys-Ala-Lys-Lys-Ala-Val-Asp-Lys-His-Ser (SEQIDNO:4) Ala-Lys-Lys-Ala-Val-Asp-Lys-His(SEQIDNO:5) acid linker(Ac); Mercaptopropionic acid linker (Mpr); D-amino acid
TABLE-US-00002 TABLE1 THERAPEUTICPEPTIDESFORTHETREATMENTOFLIVERFIBROSIS (EfficacyandSafety) Mouse Human ActivatedLiver Activated Myofibroblasts Liver Hepatocyte Mouse DeathCell(%) Myofibroblasts Toxicity Toxicity Efficacy PEPTIDE [20ng/ml] DeathCell(%) [20ng/ml] (invivo) [culture/mice] Parentpeptide 89.5 80.9 Notoxicity No: Excellentin Ac-Lys-Ala-Val- foundwhen 20mg/kg human/mice Asp-NH2(SEQ testedin Activated IDNO:6) primary Myofibroblasts mouseand andinmouse human modelsofliver hepatocytes fibrosis Leadtherapeutic 90.5 86.2 Notoxicity No: Excellentin peptide) foundwhen 20mg/kg human/mice Peg-30kDa-Lys testedin Activated DAla-DVal- primary Myofibroblasts Asp-NH2 mouseand andinmouse human modelsofliver hepatocytes fibrosis Alternate 79.9 67.9 Notoxicity No: Excellentin therapeutic foundwhen 20mg/kg human/mice peptide1 testedin Activated Peg-30kDa-Lys- primary Myofibroblasts DAla-Val-Asp- mouseand andinmouse NH2 human modelsofliver hepatocytes fibrosis Alternate 57.1 72.3 Notoxicity No: Excellentin therapeutic foundwhen 20mg/kg human peptide2 testedin Activated Peg-30kDa-Lys- primary Myofibroblasts Ala-DVal-Asp- mouseand andinmouse NH2 human modelsofliver hepatocytes fibrosis *DLys-Ala- N/A 30.6 N/A N/A N/A DVal-Asp-NH2 *DLys-Ala-Val- N/A 44.0 N/A N/A N/A DAsp-NH2
[0177] The parent peptide was developed based on the discovery of an important downstream specific MAPK pathway phosphorylation of C/EBP?-Thr217. Thus, the target, being the last step in an extensive signaling network could be blocked with fewer side effects. Indeed, mice expressing the dominant negative, full-length C/EBP?-Ala217 have a normal phenotype and are fertile.
[0178] The invention provides efficacy and safety of the therapeutic peptides. In certain embodiments, the invention provides that the three selected PEG-peptides were very effective in preventing the activation of primary human and mouse liver myofibroblasts in culture (see Table 1). Their efficacy was comparable to that of the parent peptide. Neither the parent peptide nor any of the three selected peptides induced hepatocyte injury to human or mouse cultured primary hepatocytes or to mice in vivo (at 100-fold the therapeutic dose) (Table 1).
[0179] Although no toxicity issues have been observed in mice with the parent compound, related peptides were developed using analog synthesis to improve the predictable pitfalls of potential immunogenicity, short half-life and limited bioavailability in humans (29; 39; 42). Multiple substitutions of amino acids were generated via analog synthesis after making a library based on the parent peptide (all 56 of 76 peptides that could be synthesized were tested). The selected PEG-peptides of the invention were the result of in vitro testing of all of the compounds within this library.
[0180] Assays were used in a step-wise manner to select the safest and most efficient peptides (including apoptosis assays in activated primary human liver myofibroblasts; cell-free caspase 8 activation assays; acute liver injury/fibrogenesis models; toxicology assays in highly differentiated, primary human hepatocyte cultures and in mice).
[0181] The invention is also described and demonstrated by way of the following examples. However, the use of these and other examples anywhere in the specification is illustrative only and in no way limits the scope and meaning of the invention or of any exemplified term. Likewise, the invention is not limited to any particular embodiments described here. Indeed, many modifications and variations of the invention may be apparent to those skilled in the art upon reading this specification, and such variations can be made without departing from the invention in spirit or in scope. It is, therefore, intended that the invention is to be limited only by the terms of the appended claims which cover all and full scope of such equivalent variations as fall within the true spirit and scope of the invention.
[0182] Throughout the specification various citations are referenced, and the entire content of each is hereby incorporated by reference. The following example is provided to describe the invention in more detail. It is intended to illustrate, not to limit the invention.
Example 1: Pilot Studies of In Vivo Efficacy and Safety of the Lead Therapeutic PEG-30 kDa-Peptide in Acute Liver Injury and Activation of Liver Myofibroblasts
[0183] To induce acute liver injury, a single dose of the human hepatotoxin Carbon Tetrachloride (CCl4) was administered to normal mice (4). Eight hours later, animals received an IP injection of the lead therapeutic PEG-30 kDa-peptide (5 ?g of the peptide linked [peptide to PEG at 1:60] to the PEG-30 kDa). Animals were sacrificed after 30 hr, at the peak of hepatocyte death as measured by ALT (a clinical end-point used routinely in clinical practice and by the FDA in the evaluation of liver toxicity in human drug studies) (16). Mice receiving only CCl4 had intense expression of ?-SMA in the liver, a main indicator of activated liver myofibroblasts (4;7), compared with the minor expression in mice receiving both CCl4 and the lead therapeutic PEG-peptide. There was severe acute liver injury in animals receiving CCl4 but mild-to-moderate injury in animals receiving both CCl4 and the lead therapeutic compound (
[0184] The therapeutic lead PEG peptide blocked the typical liver discoloration and granular appearance of severe liver injury induced by the hepatotoxin CCl4 and the livers of these treated mice were similar to control livers (
[0185] The lead PEG-30 kDa-peptide decreased the acute liver injury (
[0186] The other two alternative PEG Peptide 1 and Peptide 2 performed similarly to the lead PEG peptide in minimizing acute liver injury and activation of myofibroblasts. Thus, the early safety profile of the therapeutic peptides is very high in an acute mouse model of liver injury and activation of liver myofibroblasts.
Example 2: High Efficacy of the Lead Therapeutic Peptide in a Chronic Mouse Model of Liver Fibrosis
[0187] The therapeutic lead PEG-peptides underwent a systematic analysis of efficacy and safety in a classical chronic liver fibrosis model (7; 15; 24; 38). CCl4 (a human hepatotoxin) was administered to mice for 16-wk as a classical model of liver fibrosis (7). The three selected therapeutic PEG-peptides were administered once a week IP (7 ?g of peptide linked to PEG) starting at week 8, once severe liver fibrosis was already established. The efficacy of the three selected PEG peptides included quantitative analysis of liver fibrosis (7). CCl4 administration to mice for 16-wk induced liver cirrhosis (
[0188] Thus, this example provides that the lead therapeutic peptide having the amino acid sequence of Ac-Lys-D-Ala-D-Val-Asp-NH2 was highly effective in preventing progression and inducing regression of liver fibrosis after cirrhosis was established after administration of CCl.sub.4 for 8 weeks. The Ac-Lys-D-Ala-D-Val-Asp-NH2 was administered IP (7 ?g of peptide linked to PEG-30 kDa) once/week for an additional 4 or 8 weeks. The CCl.sub.4 administration continued for 4 or 8 weeks. The Ac-Lys-D-Ala-D-Val-Asp-NH2 peptide inhibited liver fibrosis by 8-fold.
[0189] In contrast, after cirrhosis was established on week-8, treatment with the parent peptide having the amino acid sequence of Ac-Lys-Ala-Val-Lys-CHO (SEQ ID NO: 7) that does not contain any D-amino acid for an additional 4 or 8 weeks (5 ?g IP, three times/week and for week 9, followed by 1 ?g IP, three times/week for weeks 10-12 or 10-16), while continuing to induce liver injury and fibrosis with CCl.sub.4. The parent peptide inhibited liver fibrosis by only 2 to 3-fold.
Example 3: Phosphorylation of C/EBP? on Thr217 in Mouse T-Cells is Induced and Associated with the Inflammatory Th1/Th17 Response to Bleomycin TreatmentInhibitory Effects of the C/EBP? Peptide
[0190] The results supporting that phosphorylation of mouse C/EBP? on Thr217 confers the Th1/Th17 phenotype have been obtained using freshly isolated, CD-4+ mouse lung T-cells. On day-7 after Bleomycin treatment, the purified lung T-cells from C/EBP?-wt mice expressed the IL-12R3 (a Th1 phenotype) or the IL-23R (a Th17 phenotype) and phosphorylation of endogenous C/EBP? on Thr217 (detected using specific antibodies that were developed against this epitope) (
Example 4: Th1/Th17 Cells are Induced and Associated with the Activation of Lung Myofibroblasts in Response to Bleomycin TreatmentEvidences from M1 Macrophage Ablation Experiments
[0191] On day-7 after Bleomycin treatment, the purified CD4+ mouse lung T-cells expressed IL-12R or IL-23R (a Th1/Th17 phenotype) and ?SMA (activated myofibroblasts). When mice received Bleomycin and Clodronate (a blocker of ATP production) liposomes (intracheally and IP) there was a preferential ablation of phagocytic M1 macrophages on day-7 (undetectable TNF?R2) and of Th1 (IL-12R)/Th17 (IL-23R) cells with induction of L-4R? (a Th2 phenotype) and markedly reduced ?SMA (activated myofibroblasts) (
Example 5: Isolation and Purification of T-Cells from Bleomycin-Treated Mice and their Ex Vivo Inhibition by the C/EBP? Peptide and Th2 Inducers
[0192] Approximately, 5 million CD4+ T-cells were isolated and purified from 165 mg of C/EBP?-wt mouse lung on day-7 after Bleomycin treatment using specific antibodies against surface receptors. Greater than 95% of the T-cells were Th1 or Th17. These Th1/Th17-cells were treated ex vivo for 4 hr with 10 ?g/ml of IL-4, IL-10 (Th2 inducers) or 100 pM C/EBP? peptide (an inhibitor of C/EBP?-Thr217 phosphorylation). The treatment by the Th2 inducers or C/EBP? peptide stimulated >50% apoptosis, suggesting that this is a plausible mechanism by which inhibition of C/EBP?-Thr217 phosphorylation blocks Th1/Th17 induction. This effect is congruent with the report of the protein/protein interaction between phosphorylated C/EBP?-Thr217/procaspase-8 and the inhibition of procaspe-8 cleavage and self-activation by the XEVD caspase inhibitory box created by the Thr-217 phosphorylation in C/EBP? (12). The stimulation of apoptosis of Th1/Th17 cells by Th2 inducers was unexpected (suggesting an up-regulation of IL-4 and IL-10 signaling pathways) and offers an exciting tool to analyze the Th1/Th17 regulation (
Example 6: Human Th1 and Th17 but not Th2 Cells Induce Proliferation of Human Lung Myofibroblasts in a Co-Culture SystemEvidence that Inhibition of C/EBP-?-Thr266 Phosphorylation Blocks Lung Inflammatory Cells
[0193] Primary human precursor CD-4+ T-cells cultured on glass were induced for 6 hr with IL-12 (Th1), IL-23 (Th17) or IL-4 (Th2). Also, precursor T-cells stimulated with Th1 and Th17 inducers were treated with the C/EBP? peptide (100 pM) for 6 hr in an attempt of preventing the Th1 and Th17 phenotypes. Primary lung myofibroblasts cultured on Collagen type 1 cover slips in a defined media without serum, were inserted into the T-cell cultures [into identical cover slip spaces] after the T-cell inducers were removed with fresh media (
Example 7: Human Th1/Th17 Cells are the Prevalent Phenotype in IPF
[0194] The clinical relevance of the experimental findings was confirmed by the presence of phosphorylated C/EBP?-Thr266 in lung Th1 and Th17 cells in IPF (
Example 8: Phosphorylation of C/EBP? on Thr266 is Induced and Necessary for the Th1/Th17 Response of Human CD4+ T-Cells to Inflammatory InducersEvidence that Inhibition of C/EBP-?-Thr266 Phosphorylation Blocks Lung Inflammatory Cells
[0195] Results supporting that phosphorylation of human C/EBP? on Thr266 confers the Th1/Th17 phenotype were obtained using freshly isolated, human CD-4+ human blood T-cells. After treatment with human recombinant IL-12 (a Th1 inducer), normal human blood CD-4+ T-cells expressed the IL-12R3 and T-Bet (a Th1 phenotype). When normal human CD-4+ T-cells were treated ex vivo with IL-23 (a Th17 inducer), they expressed the IL-23R (
Example 9: Isolation and Purification of T-Cells from Fresh IPF Lung Tissue and their Ex Vivo Response to the C/EBP?3 Peptide and Th2 Inducers
[0196] Approximately, 10 million CD4+ T-cells were isolated and purified from 0.5 mg of a fresh IPF lung biopsy using specific antibodies against surface receptors. Greater than 95% of the T-cells were Th1 or Th17, judging by their IL-12R and IL-23R markers (
[0197] In summary, Examples 3-9 above demonstrate that a) C/EBP?-Thr217 phosphorylation is necessary for the activation of human and mouse myofibroblasts. The novel peptides of the invention inhibit myofibroblast activation; b) C/EBP?-Thr217 phosphorylation is necessary for Bleomycin-induced activation of lung Th1 and Th17 cells; c) selective depletion of Th1 and Th17 cells, but not of Th2 cells, through ablation of phagocytic M1 macrophages prevents Bleomycin-induced activation of LMF and lung fibrosis; d) human Th1 and Th17 cells but not Th2 cells stimulate proliferation/activation of human LMF in co-culture; e) the clinical relevance of these findings was confirmed by the presence of phosphorylated C/EBP?-Thr266 in lung Th1 and Th17 cells in IPF lung tissue and in T-cells freshly isolated from IPF lung tissue; f) the lung T-cells in IPF are >95% Th1/Th17; and g) the C/EBP? peptide and Th2 inducers stimulate apoptosis of lung Th1/Th17 cells ex vivo freshly isolated from Bleomycin-treated mice or from IPF lung tissue.
Example 10: C/EBP?-Thr217 Phosphorylation Stimulates Macrophage Inflammasome Activation and Liver Injury
[0198] This example provides studies to investigate whether signaling through phosphorylation of C/EBP?-Thr217, a potential novel therapeutic target, is a major mechanism responsible for liver inflammation and injury through the activation of the inflammasome in liver macrophages. The effects of C/EBP?-Phospho-Thr217 signaling that is evolutionarily conserved (identical in human C/EBP?-Phospho-Thr266) on macrophage inflammasome activity and liver injury induced by hepatotoxins in mice and humans were studied.
[0199] Methods
[0200] Construction of C/EBP?-Ala217 and C/EBP?-Glu217 Mice
[0201] The Animal Protocol was approved by the VA San Diego Healthcare System's Veterinarian Medical Unit. Transgenic mice expressing either the C/EBP?-Ala217, a dominant negative, nonphosphorylatable mutation, or C/EBP?-Glu217, a dominant positive, phosphorylation mimic mutation of the C/EBP?-Thr217 phosphoacceptor, were generated as described previously.sup.27 and back-crossed to the parental wild-type inbreed FVB mice for >10 generations. The presence of the rsv gene was used to identify these transgenic mice by PCR. The primer sequences for the RSV PCR were custom designed (RSV.2271 sense TAGGGTGTGTTTAGGCGAAA (SEQ ID NO:1), and RSV.2510 antisense TCTGTTGCCTTCCTAATAAG (SEQ ID NO:2).
[0202] Animal Procedures
[0203] In the acute exposure to the hepatotoxins, C/EBP?-wt, C/EBP?-Ala217 and C/EBP?-Glu217 mice.sup.27 (23-27 g) each received intraperitoneal injections of CCl.sub.4 (70 ?l CCl.sub.4 and 30 ?l of mineral oil) or mineral oil (70 ?l saline and 30 ?l mineral oil), or Jo-2 Ab (Fas-L; 0.2 ?g/g body weight) or saline vehicle (50 ?l) only once. In other experiments, C/EBP?-wt mice (25 g) each received intraperitoneal injections of CCl.sub.4 (70 ?l CCl.sub.4 and 30 ?l of mineral oil) or mineral oil (70 ?l saline and 30 ?l mineral oil) once but after 8 hr animals received either 50 ?l saline (vehicle) or the cell permeant Ac-KAla217VD-CHO.sup.21 (American Peptide) (100 ?g IP). In these experiments, animals were sacrificed 30 hr after the last CCl.sub.4 injection or 8 hr after the Fas-L injection.
[0204] Macrophage Purification
[0205] The reported standards for in vitro experiments with macrophages were followed.sup.42. Adult C/EBP?-wt (yield 1.3?10.sup.5 macrophages per liver), C/EBP?-Ala217 (yield 2.2?10.sup.5 macrophages per liver), C/EBP?-Glu217 (yield 1.4?10.sup.5 macrophages per liver) and TGF? (yield 1.6?10.sup.5 macrophages per liver) mice of FVB background were used for the isolation of primary liver macrophages. Cells were prepared, by in situ perfusion and single-step density Nycodenz gradient (Accurate Chemical & Scientific, Westbury, N.Y.), as described previously.sup.43. Liver macrophages were isolated at density gradient of 13% and then affinity purified by magnetic beads linked to CD-11/CD-68 Antibodies (Miltenyl Biotechnology). No CSF-1 or supplements were used. An aliquot was plated on glass coverslips and allowed to sit 1 hr. at 37 C and then fixed with acetone: methanol. Liver macrophages were identified by their typical morphology, adherence to glass, and with antibodies against F-4/80 and CD-68. Purity of these preparations was greater than 95%. Aliquot of macrophages were cultured in RPMI 1640, 10% fetal bovine serum with L-glutamine, 25 ?M HEPES and Penicillin/Streptomycin. In some experiments, liver macrophages were treated for 8 hr. with TGF? (10 ?M).
[0206] Microscopy
[0207] Fluorescent labels were observed using antibodies against C/EBP?, RSKPhosphoSer380, F4/80, NOS-2 TLR4, NF?B, IRF8, MyD88, NALP3, TLR-5, IL-1R1 and ASC (Santa Cruz Biotechnology, Santa Cruz, Calif.), or C/EBP?-PhosphoThr217 in a Keyence fluorescent microscope fluorochromes utilized were Alexa 488, 750, 350, 647, and 594. At least 100 cells were analyzed per experimental point.sup.18, 21, 23, 27 TO-PRO-3 (Molecular Probes, Eugene, Oreg.) was used to analyze nuclear morphology. Fluorescence and bright-field imaging were quantified using the Keyence microscope BZ9000 analysis software programs. The inter-observer agreement was >90%.
[0208] Inflammation Genes
[0209] The liver macrophage expression of 86 inflammation genes was determined by using the RT.sup.2 Quantitative Real-Time PCR Array as described by the manufacturer (SABiosciences; Valencia, Calif.). Control and experimental freshly isolated liver macrophage samples were analyzed together with internal control samples for the RNA purification and amplification steps, as well as for housekeeping genes (?-actin), using the Bio-Rad iQ5 real-time PCR detection system (Bio-Rad, Hercules, Calif.).sup.21. Isolation of total RNA, treatment with DNase, precipitation with chloroform, and cDNA synthesis was performed using 1 ?g of total RNA as described for RT-PCR following the manufacturer's recommendations.
[0210] Immunoprecipitation and Immunoblots
[0211] Pre-cleared freshly isolated liver macrophage cell lysates were incubated for 2 hr. with purified C/EBP? antibodies followed by the addition of A/G+ agarose (Santa Cruz Biotechnology) for 12 hr. The immunoprecipitation reactions each contained 500 ?g of total protein and 2 ?g antibody (or purified IgG pre-immune serum as negative control). Immunoprecipitates were washed 3 times in 500 ml cell lysis buffer and resolved by SDS-PAGE, and C/EBP?-PhosphoThr2 7, TLR4, NF?B, IRF8, MyD88, NALP3, TLR-5, IL-1R1, ASC ?-actin, active caspase 3, IL-1?, and IL-18 detected by western blot, following the chemoluminescence protocol. (Perkin-Elmer, Shelton, Conn.) using specific antibodies.sup.18, 19, 21, 27. Negative samples were performed omitting the first antibody.
[0212] Human Livers
[0213] Anonymous, de-identified liver samples were obtained from 16 patients with acute liver injury secondary to Toxic Oil Syndrome and moderately severe liver injury.sup.35 and from 10 control subjects without liver disease (NDRI). The protocol was approved by the University of San Diego, San Diego Human Protection Program. Because all these samples were excess, standard of care and archival samples it was an exempted, non-consented IRB approved protocol.
[0214] Statistical Analysis
[0215] Results are expressed as mean (?SD or ?SE). Either the Student-t or the Wilcoxon Mann-Whitney tests were used to evaluate the differences of the means between groups for parametric and non-parametric populations, respectively, with a P value of <0.05 as significant.
[0216] Results
[0217] The modulation of Fas-L induced liver injury and inflammation by phosphorylated C/EBP?-Thr217 in mice
[0218] The degree of liver injury was determined after exposure to hepatotoxins (Fas and CCl.sub.4) in mice by quantitative histology and immunohistochemistry.sup.24, cell death assays.sup.23, and by measuring serum alanine aminotransferase (ALT) levels.sup.21, an indicator of liver injury used routinely in patient care as well as by the Food and Drug Administration in clinical drug studies.sup.25.
[0219] Fas-mediated IL-18 secretion by macrophages.sup.8 and injection of a Fas agonist antibody (Jo-2 Ab).sup.26 induces severe liver injury in mice. First, the data showed that mice expressing the dominant positive, phosphorylation mimic C/EBP?-Glu217 transgene were more susceptible than control C/EBP?-wt mice to liver injury induced by Fas-R activation with Jo-2 Ab, judging by the serum ALT levels (P<0.0001) (
[0220] Both hepatocytes and non-parenchymal liver cells, including macrophages, express the Fas receptor (CD95).sup.28. In this context, it was found that Fas-L also stimulated a greater infiltration of F4/80+ macrophage inflammatory cells in the livers of C/EBP?-Glu217 mice than in the livers of C/EBP?-wt mice (
[0221] Activation of Cultured Primary Liver Macrophages by TGF-? is Associated with Phosphorylation of C/EBP?-Thr217
[0222] The above experiments suggested that liver macrophages contribute to the amplification of liver injury induced by Fas-L in C/EBP?-Glu217 mice and are the general mechanism of injury in C/EBP?-wt mice, as reported for Fas-L and other animal models of liver injury.sup.4, 5, 6, 7, 8. Because expression of C/EBP? in macrophages is of great relevance to the maturation and function of these cells.sup.13, 14, 15, 16, 17, it was assessed whether phosphorylated C/EBP?-Thr217 modulates the polarization of inflammatory primary liver macrophages, isolated as reported previously.sup.23.
[0223] After treatment with TGF-?, an activator of the MAPK signaling.sup.18 and a classical inflammatory macrophage inducer.sup.17, freshly isolated cultured liver macrophages from C/EBP?-wt mice expressed activated RSK-phospho-Ser380 and phosphorylation of endogenous C/EBP? on Thr217.sup.18 (
[0224] Phosphorylation of C/EBP? on Thr217 is induced and necessary for the liver macrophage activation after hepatotoxin treatment in mice
[0225] To analyze whether phosphorylation of C/EBP? on Thr217 is induced and necessary for the liver macrophage activation by chemical liver injury, a single dose of CCl.sub.4, which is a classical and predictable hepatotoxin that induces oxidative stress in rodent and human livers.sup.21, 30, 31, was administered to C/EBP?-wt, TGF-?, C/EBP?-Glu217, and C/EBP?-Ala217 transgenic mice. Eight hours later, C/EBP?-wt mice received either an intraperitoneal injection of the cell permeant, dominant negative C/EBP? peptide (100 ?g) or vehicle (50 ?l saline). In earlier studies, it was found that this peptide dose provided adequate systemic and liver bioavailability in mice and blocked phosphorylation of C/EBP?-Thr217.sup.21, 27. Animals were sacrificed at 30 hr at the peak of liver injury.
[0226] CCl.sub.4 treatment induced a severe acute liver injury with architectural collapse in C/EBP?-wt mice but a mild-to-moderate injury in C/EBP?-Ala217 mice (
[0227] Acute administration of CCl.sub.4 stimulated ?20-fold macrophage infiltration of the liver in C/EBP?-wt mice after 30 hr. (P<0.005), as identified by the expression of F4/80 by quantitative microscopy.sup.23 (
[0228] The dominant negative peptide that blocks C/EBP?-Thr217 phosphorylation.sup.21 also inhibited the CCl.sub.4-induction of liver macrophage infiltration by ?60% (P<0.01) (
[0229] Macrophages are Induced and Necessary for the Liver Injury in Response to Hepatotoxin Treatment in Mice
[0230] To ascertain the role of macrophages in toxic liver injury with an alternative approach, C/EBP?-wt mice received Clodronate liposomes to deplete macrophages 24 hr. before the administration of the hepatotoxin.sup.5. These animals had a marked reduction in liver macrophages infiltration (?90%; P<0.005) (
[0231] Thirty-hours after CCl.sub.4 treatment, the CD-11/CD-68 mouse macrophages purified from livers of C/EBP?-wt mice expressed high levels of TLR5, MyD88 and TLR4 (
[0232] Phosphorylated C/EBP?-Thr217 Stimulates the Inflammasome Signal 1 Complex in Liver Macrophages in Mice
[0233] A priming stimulus (signal 1), acting through NF?B pathway, often precedes assembly of the inflammasome complex in order to upregulate the expression of pro-IL-1? and NALP3. Upon either ligand sensing or enzymatic activation within the cytosol (signal 2), the cytosolic sensors oligomerize to form an activation platform for caspase 1.sup.32.
[0234] Thirty-hours after CCl.sub.4 treatment, the CD-11/CD-68 primary liver macrophages purified from C/EBP?-wt mice expressed phosphorylated C/EBP?-Thr217, which was co-expressed with critical components of the inflammasome signal 1 complex gene products, including TLR4, NF?B, IRF8 and MyD88 (
[0235] Phosphorylation of C/EBP?-Thr217 is required for the expression of the inflammasome signal 1 complex in liver macrophages induced by hepatotoxin treatment since it was blocked in the nonphosphorylatable C/EBP?-Ala217 transgenic mice (
[0236] To further delineate the physical association of phosphorylated C/EBP?-Thr217 with members of the inflammasome signal 1 complex in purified liver macrophages after hepatotoxin treatment, we immunoprecipitated C/EBP?, which was normalized by ?-actin for the immunoblots, and analyzed its associated proteins. It was found that phosphorylated C/EBP?-Thr217 or C/EBP?-Glu217, but not unphosphorylated C/EBP?-Thr217 or C/EBP?-Ala217, were physically associated with TLR4, NF?B, IRF8 and MyD88 in freshly isolated primary liver macrophages (
[0237] Phosphorylated C/EBP?-Thr217 Stimulates Expression of the Inflammasome Complex Signal 2 in Liver Macrophages in Mice
[0238] Given that activation of the inflammasome signal 2 pathway is essential for expression of several inflammatory cytokines.sup.1, 11, 33, the role of phosphorylated C/EBP?-Thr217 was analyzed on the inflammasome signal 2 pathway in liver macrophages. It was found that CCl.sub.4 treatment of C/EBP?-wt mice stimulated the expression of the inflammasome signal 2 proteins in liver macrophages (
[0239] To further delineate the physical association of phosphorylated C/EBP?-Thr217 with members of the inflammasome signal 2 complex in purified primary liver macrophages after hepatotoxin treatment, C/EBP? was immunoprecipitated and its associated proteins were analyzed. It was found that liver injury increased the physical association between inflammasome signal 2 complex proteins (NALP3, TLR-5, IL-1R1 and ASC) in liver macrophages with phosphorylated C/EBP?-Thr217 or C/EBP?-Glu217, but not with unphosphorylated C/EBP?-Thr217 or C/EBP?-Ala217 (
[0240] Phosphorylated C/EBP?-Thr217 Stimulates the Expression of Inflammasome Structural and Byproduct Genes in Liver Macrophages in Mice
[0241] It was found that freshly isolated liver macrophages from the phosphorylation mimic C/EBP?-Glu217 mice express an activated transcriptosome related to the Inflammasome when compared to C/EBP?-wt mice. This included the increased expression of inflammasome genes (ASC, IRF-1, IRF-4 IRF-5, TCAM-2, TRL-6, TRAF-6, Myo-D88, Nod-1 and Rel) as well as the increased expression of direct and indirect cytokine gene byproducts (IL-1?, IL-6, IL-15, IL-18 and TNF?).sup.1,11,33 (
[0242] Human Liver Injury Induced by the Toxic Oil Syndrome is Also Characterized by Phosphorylated C/EBP?-Thr217 Associated with the Inflammasome Complex in Liver Macrophages
[0243] The Toxic Oil Syndrome (TOS) that occurred in central and northwestern Spain in the summer of 1981 affected approximately 20,000 people, whom were afflicted with acute liver injury. The oxidative stress liver injury was induced in a dose-response manner by the olive oil contaminant 1, 2-dioleoyl ester of 3-(N-phenyl amino)-1, 2-propanediol.sup.34, 35. Liver biopsies from all 16 patients with TOS that were still available at the Universidad Complutense Medical Center, Madrid, Spain, were analyzed. These patients had a moderately severe acute liver injury as characterized by the elevated ALT and aspartate aminotransferase (AST) with a cholestastic component judging by the increased alkaline phosphatase and total bilirubin, when compared to normal individuals (Table 3). The degree of liver injury by histological analysis in these TOS patients correlated with both macrophage infiltration of the liver (
TABLE-US-00003 TABLE 3 Baseline demographic and clinical liver tests in subjects with Toxic Oil Syndrome (TOS). The values for serum aminotransferase (ALT; normal up to 40 IU/ml); aspartate aminotransferase (AST; normal up to 35 IU/ml); alkaline phosphatase (Alk. Phosphatase; normal up to 126 IU/ml); and total bilirubin (T. Bilirubin; normal up to 1.2 mg/dL) were increased in this cohort of patients afflicted by Toxic Oil Syndrome (N = 16). Values shown are mean (SE) or % as well as (95% Confidence Intervals (CI)). Parameters Mean (SE) or Numbers (%) 95% CI Age (years) 37.7 (3.7) 30.0 to 45.5 Gender (male) 8 (50%) N/A ALT (IU/mL) 277 (50) 171 to 382 AST (IU/mL( 138 (20) 94 to 181 Alk. Phosphatase (IU/mL) 454 (89) 264 to 644 T. bilirubin (mg/dL) 2.5 (0.8) 0.9 to 4.1
[0244] Because TOS is characterized by oxidative stress that results in an acute inflammatory liver injury, whether the livers of TOS afflicted patients had similar features to the CCl.sub.4 animal models with acute inflammatory liver injury was analyzed. Liver macrophages, characterized by the expression of specific markers as described above, in livers from patients with TOS expressed phosphorylated C/EBP?-Thr266 (the exact homologue of mouse Thr217) when compared to macrophages in normal livers (
[0245] Discussion
[0246] In these studies, the inventors found a novel role of phosphorylated C/EBP?-Thr217 in the activation of the inflammasome in liver macrophages, resulting in amplification of the liver injury induced by CCl.sub.4 or by Fas-L. C/EBP?-Thr217 phosphorylation is required for macrophage infiltration of the liver after a liver injury induced in mice by the oxidative stress hepatotoxin CCl.sub.4 or by Fas-L, and for macrophage activation in primary liver macrophage cultures (stimulated by TGF?, an inducer of C/EBP?-Thr217 phosphorylation.sup.18).
[0247] Remarkably, blocking the phosphorylation of C/EBP?-Thr217 by expressing a dominant negative non-phosphorylatible C/EBP?-Ala217 transgene in mice or by administering an inhibitory peptide of C/EBP? phosphorylation to C/EBP?-wt mice prevented the liver injury induced by CCl.sub.4 or by Fas-L. Inhibiting the phosphorylation of C/EBP?-Thr217 also ameliorated macrophage liver infiltration, expression and activation of the inflammasome multiprotein complex as well as the polarization of pro-inflammatory liver macrophages. It was previously shown that spleen macrophages in vivo in C/EBP?-Ala217 transgenic mice had increased caspase 3 expression (suggestive of activated apoptosis pathways) compared to control mice.sup.28. However, the inventors do not find any decrease in liver macrophage numbers in C/EBP?-Ala217 transgenic mice compared to control mice (
[0248] Specifically, phosphorylation of C/EBP?-Thr217 in liver macrophages was required for stimulating the expression of the multiprotein complex inflammasome signal 1 (NF?B, IRF8, the adaptor protein MyD88 and TLR4) and of the inflammasome signal 2 pathway (NALP3, TLR5, IL-1R1 and the adaptor protein ASC).sup.1, 11, 33 Phosphorylated C/EBP?-Thr217, but not unphosphorylated C/EBP?-Thr217, was also found to be physically associated with the inflammasome multiprotein complex signal 1 and signal 2.
[0249] The central component of an inflammasome is a member of the NALP family, and this protein associates with the adaptor protein apoptosis-associated speck-like protein (ASC), which in turn recruits pro-inflammatory-caspase precursors (such as pro-caspase-1).sup.36 NALP3, which the inventors found in their model of inflammasome activation in liver macrophages, is able to form inflammasomes while mutations in the gene that encodes NALP3 (CIAS1) cause several auto-inflammatory disorders, indicating its physiological relevance.sup.36.
[0250] An acute oxidative stress liver injury with CCl.sub.4 in the phosphorylated mimic C/EBP?-Glu217 mice induced the expression of liver macrophage inflammasome genes (ASC, IRF-1, IRF-4 IRF-5, TCAM-2, TRL-6, TRAF-6, Myo-D88, Nod-1 and Rel) as well as the increased gene expression of direct and indirect cytokine inflammasome byproducts of liver macrophages (IL-1?, IL-6, IL-10, IL-15, IL-18, IL-23? and CXCL-3), a hallmark of inflammasome activation.sup.1, 11, 33, 37 In contrast, freshly isolated nonphosphorylatable C/EBP?-Ala217 liver macrophages from mice treated with CCl.sub.4 expressed an inhibited inflammasome transcriptosome when compared to freshly isolated liver macrophages from C/EBP?-wt mice treated with CCl.sub.4. This included the decreased expression of inflammasome genes (IRF-4, NALP-?, NALP-3, TCAM-2, TRL-1, TRL-3, TRL-5, TRL-6, TRL-7, TRL-8, TRL-9, Nod-1 and Rel) as well as the decreased gene expression of direct and indirect cytokine inflammasome byproducts (IL-1?, IL-6, IL-10, IL-15, IL-18, IL-23? and CXCL-3).
[0251] The C/EBP?-Ala217 mutant functions as a trans-dominant negative of the C/EBP?-Thr217 phosphorylation.sup.21. In contrast, the C/EBP?-Glu217 mutant functions as a trans-dominant positive of the C/EBP?-Thr217 phosphorylation.sup.18. In liver injury, phosphorylation of C/EBP?-Thr217 in macrophages may stimulate macrophage proliferation/survival as reported for the Anthrax lethal toxin.sup.23 and/or facilitates migration to and direct destruction or phagocytosis of the injured hepatocytes. CCl.sub.4 increased the liver macrophage infiltration by ?20-fold, while the macrophage stimulating factor TGF? in transgenic mice, which lack hepatocyte injury, did not increase macrophage liver infiltration. Macrophage infiltration is also observed in the livers of animals treated acutely with Fas-L, suggesting that regardless of the mechanisms of liver injury, the stimulation of C/EBP?-Thr217 phosphorylation in macrophages modulates the infiltration of the liver by these cells.
[0252] The Fas-L experiments are physiologically relevant since significant elevations of soluble Fas-L occur in patients with drug-induced liver injury or alcoholic liver disease.sup.38, 39. Acute FasL administration (acting on TNF superfamily receptors) induced greater macrophage infiltration, and liver injury in the phosphorylation mimic C/EBP?-Glu217 transgenic mice. Mice expressing the C/EBP?-Ala217 transgene were refractory to development of liver injury by Fas-L.
[0253] Modulation of macrophage activity by ablation also indicated the essential role of phosphorylated C/EBP?-Thr217 in macrophages for the induction of liver injury after hepatotoxin exposure. The inventors have reported that amplification of toxic liver injury is mediated by macrophages since TLR-4 ko mice were resistant to hepatotoxins and that reconstitution of bone marrow irradiated TLR-4 ko mice with TLR-4.sup.+/+ macrophages conferred susceptibility of these animals to hepatotoxins.sup.4. More recently, the role of macrophages has been confirmed in toxic liver injury using macrophage ablation.sup.5, in an experimental alcoholic liver injury model using an IL-1 receptor antagonist.sup.6, and in LPS/D-galactosamine induced liver injury using Adenosine-.sub.2A (A.sub.2A) receptor-ko mice.sup.7. Adenosine is required for sustained inflammasome activation via the A2A receptor and the HIF-1? pathway.sup.7. In addition, both A.sub.2A adenosine receptors and C/EBP? are required for IL-10 production by macrophages exposed to Escherichia coli.sup.40, suggesting a potential convergence of phosphorylated C/EBP?-Thr217 and the A.sub.2A signaling pathways in activated liver macrophages.
[0254] Therefore, the studies presented here characterized phosphorylated C/EBP?-Thr217 in macrophages as a novel and major signaling pathway in hepatotoxin-induced liver injury. Phosphorylated C/EBP?-Thr217 (human Thr266) may also play a major role in the macrophage inflammasome in liver injury induced by experimental and human alcoholic and non-alcoholic steatohepatitis (NASH).sup.1, 41. The findings presented herewith are consistent with the role of C/EBP? as a critical signaling protein for macrophages since expression of a dominant inhibitor of C/EBP? DNA-binding sites.sup.15 or of a targeted deletion of C/EBP? results in impaired macrophage differentiation.sup.16.
[0255] The features of a well characterized acute human oxidative stress liver injury, the Toxic Oil Syndrome (TOS), which was induced by a toxic contaminant, mimics and validates, at least in part, the findings with animal models of acute oxidative stress inflammatory liver injury. The findings in human acute liver injury due to TOS suggest that the findings in cellular and animal models may be applicable to some types of acute liver injury in humans. Studies to further understand these pathways in human acute liver injury may define whether or not phosphorylated C/EBP?-Thr266 in macrophages is pathogenic in those injuries.
[0256] In summary, the findings presented in this example provide a novel signaling mechanism through C/EBP?-Thr217 (human Thr266) for the inflammasome multiprotein complex activation in liver macrophages as a critical step for the development of liver inflammation and injury.sup.1. Liver inflammation and injury are major contributors to the morbidity and mortality of acute and chronic liver diseases in humans.sup.1, 2, 3, 41 Thus, IL-1? receptor antagonists.sup.6, A.sub.2A receptor antagonists.sup.7, and small molecule peptido mimetics, as targeted inhibitors of human C/EBP?-Thr266 phosphorylation, in liver macrophages are potential candidates for the prevention and treatment of inflammatory liver injury.
Example 11: High Efficacy of the Therapeutic PEG-30 kDa-Peptide in the Bleomycin Mouse Model of Lung Fibrosis Via Various Administration Routes
[0257] C/EBP?-wt mice received Bleomycin administration as described above. On day-10, once the fibrotic reaction is established, mice received i) PEG-30 kDa-Lys-DAla-DVal-Asp-NH.sub.2 intraperitoneally (IP) 10 ?g of peptide linked to PEG, on days 10, 17 and 24); or ii) peptide PEG-30 kDa-Lys-DAla-DVal-Asp-NH.sub.2 by inhalation (mean particle size 1.3 mwhich reaches efficiently the alveoli-, 800 ?g of peptide on days 10, 17 and 24; specific inhalation parameters are shown in Table 2). The peptide was administered for less than 1 hour a day [on days 10, 17, and 21] via nose-only inhalation of the test material aerosol at a nominal concentration of 1.0 mg/L [800 ?g/dose]; or iii) peptide PEG-30 kDa-Lys-DAla-DVal-Asp-NH.sub.2 by intratracheal instillation (40 ?g of peptide on days 10, 17 and 24).
TABLE-US-00004 TABLE 2 Aerosol Parameters of the Peptide Administration by Inhalation Solution Pari Pari Aerosol Peptoid Exposure Con- Con- Concen- Disperse Flow Concen- Inhaled Duration sumption sumption tration Rate Rate tration RMV Per day Per Day per day per day (mg/ml) (ml/min) (L/min) (mg/L) (L/min) (ug) (min) (ml) (mg) 31 0.25 5.5 1.00 0.022 800 36.3 12.1 374.7
[0258] Control groups received sterile water instead of Bleomycin; peptide IP; peptide by inhalation; or peptide by intratracheal instillation. Animals were sacrificed on day 27. The left lung was inflated with fixative, analyzed by trichrome stain and quantified in its entirety by the Odyssey Visualization microscopy software protocol to minimize analytical errors as described previously (Ramamoorthy et al., 2009, American Journal of Physiology, Endocrinology and Metabolism 297: e392-401). The right lung was snap frozen in liquid nitrogen and used for IMH, immunoblots and qRT-PCR. Treatment with the PEG-30 kDa-peptide IP, intratracheal instillation of the peptide (positive control), or the peptide by inhalation markedly reduced the degree of lung fibrosis; the expression of ?-SMA (a marker of activated myofibroblasts), which was co-localized with C/EBP?-Thr217 phosphorylation.
[0259] In addition, all treatments decreased lung inflammation as determined by the expression of IL-23R (a marker of Th-17 cells). Bleomycin increased lung fibrosis by >5-fold compared to control animals. In contrast, animals receiving PEG-30 kDa-peptide or the peptide by inhalation had a decrease in lung fibrosis of ?60% in just 14-day treatment with 3 doses on days 10, 17 and 24) (P<0.001) (
[0260] Thus, higher and prolonged doses in patients (corrected by FDA Tables and the Physiologically Based-PK analysis for patients with IPF) may be even more efficacious. In spite of the short 14-day treatment, all treatments improved the Tidal Volume by >35% (P<0.01) (
Example 12: Marked Increase in the Number of Activated Myofibroblasts and Expression of Phospho-C/EBP?Thr266 (Human Homologue of Mouse Phospho-C/EBP?Thr217) and Inflammation with Activated Macrophages in Kidney Fibrosis
[0261] Kidney biopsies from three patients with kidney fibrosis secondary to glomerulonephritis were analyzed. These biopsies showed extensive glomerular fibrosis with a marked increase in the number of activated myofibroblasts (indicated by the expression of ?-SMA) as well as the marked expression of Phospho-C/EBP?Thr266 (human homologue of mouse Phospho-C/EBP?Thr217) and inflammation with activated macrophages (indicated by F4/80) (
[0262] These findings indicate that the mechanisms leading to tissue fibrosis are the same in liver, lung and kidney, and point to a common mechanism involving activated myofibroblasts inflammatory macrophages and Phospho-C/EBP?Thr266 probably in all tissue fibrotic diseases. Therefore, the treatment of kidney fibrosis can also be feasible by targeting Phospho-C/EBP?-Thr266 with the PEG-30 kDa-peptide of the invention.
Example 13: The Intermediate Molecule Released from the PEG30 kDa-Mpr-Peptide In Vivo is Pharmacologically Active
[0263] The following shows the structure of the testing peptide, of which one of the lead molecules is the Mpr-linked PEG peptide (aka PEG-30 kDa-Mpr-peptide).
TABLE-US-00005 Physical TestArticle Form MW Ac-Lys-DAla-DVal-Asp-NH2 solid 473.52 Mpr-Lys-DAla-DVal-Asp-NH2 solid 518 (akaPEG-30kDa-Mprpeptide) PEGylated-peptide361332 solid ~30KDa
[0264] The chemical structure of PEGylated-peptide 361332 is presented below:
##STR00003##
[0265] Studies using the PEGylated-peptide 361332 are provided
TABLE-US-00006 Number Collection Test Admin. Mouse of Dose Samples Time Article Route Strain Animals (mg/kg).sup.a Collected Points PEGylate IV CD-1 4 7.5 Plasma, 4, 8, 24 d-peptide Liver and 361332 48 hours .sup.aDose reflects peptide equivalent of 7.5 mg/kg; n = 1 mouse per time point for this pilot study.
[0266] Levels of Peptide and MPR-Intermediate in Plasma Samples
TABLE-US-00007 Ac-Lys-Dala-Dval- Mpr-Lys-DAla-DVal- Time Asp-NH2Conc.(ng/mL) Asp-NH2Conc.(ng/mL) 4 65.8 1291 8 79.2 900 24 70.2 921 48 67.6 1523
[0267] The Mpr-peptide can also be a therapeutic as an additional formulation since it releases the active peptide. Therefore, it could be administered as an alternative formulation for the treatment of various tissue fibrotic diseases.
REFERENCES FOR LIVER INFLAMMATION AND FIBROSIS
[0268] 1. Bravo R, Frank R, Blundell P A and MacDonald-Bravo H. Cyclin/PCNA is the auxiliary protein of DNA polymerase-delta. Nature 326: 515-7, 1987. [0269] 2. Buck M, Turler H and Chojkier M. LAP (NF-IL6), a tissue-specific transcriptional activator, is an inhibitor of hepatoma cell proliferation. EMBO J 13: 851-860, 1994. [0270] 3. Buck M, Poli V, Chojkier M and Hunter T. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP? is required for hepatocyte proliferation induced by TGF?. Mol Cell 4:1087,1999. [0271] 4. Buck M, Poli V, Hunter T and Chojkier M. C/EBP? phosphorylation by RSK creates a functional XEXD caspase inhibitory box critical for cell survival. Mol Cell 8: 807-16, 2001. [0272] 5. Buck M, Zhang L, Hunter T and Chojkier M. Nuclear export of phosphorylated C/EBP? mediates the inhibition of albumin expression by TNF. EMBO J 20: 6712-23, 2001. [0273] 6. Buck M, Chojkier M. Signal Transduction in the Liver. Hepatology 37: 731-8, 2003. [0274] 7. Buck M, Chojkier M. A ribosomal S6K-mediated signal to C/EBP? is critical for the development of liver fibrosis. PLOS One 2: e1372, 2007. [0275] 8. Buck M, Chojkier M. C/EBP? phosphorylation rescues macrophage dysfunction and apoptosis induced by anthrax lethal toxin. Am J Physiol Cell Physiol 293: C1788-96, 2007. [0276] 9. Buck M and Chojkier M. C/EBP? Associates With Caspase 8 Complex Proteins and Modulates Apoptosis in Hepatic Stellate Cells. J Clin Gastroenterol 41: S295-99, 2007. [0277] 10. Buck M. Direct infection and replication of naturally occurring hepatitis C virus genotypes 1, 2, 3, and 4 in normal human hepatocyte cultures. PLOS One 3: 2660, 2008. [0278] 11. Buck M and Chojkier M. C/EBP?-Thr217 phosphorylation Signaling Contributes to the Development of Lung Injury and Fibrosis in Mice. PLOS One 2011. [0279] 12. Castilla R, R Gonzalez, D Fouad, E. Fraga and J Muntane. Dual Effect of Ethanol on Cell Death in Primary Culture of Human and Rat Hepatocytes. Alcohol & Alcoholism 39, 290-6, 2004. [0280] 13. Chung R and Podolsky D. Cirrhosis and its Complications. In: Harrison's Principles of Internal Medicine, New York: McGraw-Hill, 2005, p. 1754-1767 [0281] 14. Chojkier M. Regulation of liver-specific gene expression. In: Progress in Liver Diseases, edited by Boyer J and Ockner R. Orlando: W.B. Saunders, 1995, p. 37-61. [0282] 15. Chojkier, M. Regulation of collagen gene expression. In Liver growth and repair. 430-50; 1998. [0283] 16. Chojkier M. Troglitazone and liver injury: in search of answers. Hepatology 41: 237-246, 2005. PMID: 15657914 [0284] 17. Descombes P, Chojkier M, Lichtsteiner S, Falvey E and Schibler U. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4: 1541-51, 1990. [0285] 18. Friedman J R, Larris B, Le P P, Peiris T H, Arsenlis A, Schug J, Tobias J W, Kaestner K H, Greenbaum L E. Orthogonal analysis of C/EBP? targets in vivo during liver proliferation. Proc Natl Acad Sci USA. 2004; 101(35):12986-91. [0286] 19. Friedman S L. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J Biol Chem 275: 2247-2250, 2000. PMID: 10644669 [0287] 20. Friedman S L and Bansal M B. Reversal of hepatic fibrosisfact or fantasy? Hepatology 43: S82-S88, 2006. PMID: 16447275. [0288] 21. Gewolb J. Protecting the Liver From Itself. Science Now 4, 2001. [0289] 22. Gyrd-Hansen M & Pascal Meier. IAPs: from caspase inhibitors to modulators of NF-?B, inflammation and cancer Nature Reviews Cancer 10, 561-574 (August 2010) doi: 10.1038/nrc2889 [0290] 23. Houglum K, Lee K S and Chojkier M. Proliferation of hepatic stellate cells is inhibited by phosphorylation of CREB on Serine 133. J Clin Invest 99: 1322, 1997. [0291] 24. Iredale J. Stellate cell behavior during resolution of liver injury. Semin Liv Dis 21: 427-436, 2001. [0292] 25. Jimenez W, Pares A, Caballeria J, Heredia D, Bruguera M, Torres M, Rojkind M and Rodes J. Measurement of fibrosis in needle liver biopsies: evaluation of a colorimetric method. Hepatology 5: 815-818, 1985. PMID: 4029893 [0293] 26. Kim K, Keiichirou Morimura, Yatrik Shah, Qian Yang, Jerrold M. Ward and Frank J. Gonzalez Spontaneous development of liver tumors in the absence of the bile acid receptor farnesoid X receptor. Carcinogenesis (2007) 28 (5): 940-946. doi: 10.1093/carcin/bgl249. [0294] 27. Lee K S, Buck M, Houglum K and Chojkier M. Activation of hepatic stellate cells by TGF? and collagen type I is mediated by oxidative stress through c-myb expression. J Clin Invest 96: 2461-2468, 1995. PMID #7593635. [0295] 28. McKnight S L. McBindalla better name for CCAAT/enhancer binding proteins? Cell 107: 259-261, 2001. [0296] 29. Magzoub, M.; Gr?slund, A. Cell-penetrating peptides. Q Rev Biophys 37; 147-195; 2004. [0297] 30. Nakajima T, Kishimoto T, Akira S. Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. PNAS. 90:2207-11. 1993 [0298] 31. Patsch W, T Tamai, and G Schonfeld. Effect of fatty acids on lipid and apoprotein secretion and association in hepatocyte cultures. J Clin Invest. 1983; 72: 371-8. [0299] 32. Reducing Risks, Promoting Healthy Life. In: The World Health Report 2002, Geneva: World Health Organization, 2002, p. 1-230. [0300] 33. Report 04-5491. Executive Summary. In: Action Plan for Liver Disease Research, NIH, 2004, p. 1-6. [0301] 34. Report 04-5491. Liver Cancer. Action Plan for Liver Disease Research. 137-143. 2004. U.S. Department of Health and Human Services, NIH. [0302] 35. Report 04-5491. Chapter 2. In: Action Plan for Liver Disease Research, NIH, 2004, p. 39-43. [0303] 36. Rojas M, Lin Y Z. Controlling EGF-stimulated Ras activation in intact cells by a cell-permeable peptide mimicking phosphorylated EGF receptor. J Biol Chem. 271:27456-61.1996. [0304] 37. Roy S K, Hu J, Meng Q, Shapiro P S, Reddy S P, Platanias L C, Lindner D J, Johnson P F, Pritchard C, Pages G, Pouyssegur J and Kalvakolanu D V. MEKK1 plays a critical role in activating the transcription factor C/EBP-beta-dependent gene expression in response to IFN-gamma. Proc Natl Acad Sci USA 99: 7945-7950, 2002. PMID: 12048245 [0305] 38. Rudolph K, Chang S, Millard M, Schreiber-Agus N and DePinho R. Inhibition of experimental liver cirrhosis in mice by telomerase gene delivery. Science 287: 1253-1258, 2000. PMID: 10678830 [0306] 39. Sato, A. K.; Viswanathan, M.; Kent, R. B.; Wood, C. R. Therapeutic peptides: technological advances driving peptides into development. Curr. Opin. Biotech. 17; 638-42; 2006. [0307] 40. Trautwein C, Caelles C, van der Geer P, Hunter T, Karin M and Chojkier M. Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364: 544-547, 1993. [0308] 41. Trautwein C, Karin M, Hunter T and Chojkier M. PKA and C site-specific phosphorylations of LAP modulate its binding affinity to DNA-recognition elements. J Clin Inv 93: 2554-61, 1994. [0309] 42. Veronese, F. M. PEGylation, successful approach to drug delivery. Drug Disc Today 10; 1451-8; 2005. [0310] 43. Wegner M, Cao Z and Rosenfeld M G. Calcium-regulated phosphorylation within the leucine zipper of C/EBP. Science 256: 370-373, 1992. PMID: 1314426 [0311] 44. Yamamoto K K, Gonzalez G A, Biggs W H, III and Montminy M R. Phosphorylation-induced binding and transcriptional efficacy of nuclear factor CREB. Nature 334: 494-498, 1988. PMID: 290047. [0312] 45. Chen R H, Abate C, Blenis J. Phosphorylation of the c-Fos transrepression domain by mitogen-activated protein kinase and 90-kDa ribosomal S6 kinase. Proc Natl Acad Sci USA. 1993 Dec. 1; 90 (23):10952-6. [0313] 46. Manning G, Whyte D B, Martinez R, Hunter T, Sudarsanam S. The protein kinase complement of the human genome. Science. 2002; 298:1912-34. [0314] 47. Jhappan C, C. Stahle, R. N. Harkins, N. Fausto, G. H. Smith and G. T. Merlino. 1990. TGF overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell 61: 1137-1146. [0315] 48. Henzel W J, Watanabe C, Stults J T. Protein identification: the origins of peptide mass fingerprinting. J Am Soc Mass Spectrom. 2003; 14(9):931-42. [0316] 49. Olsen J V, Ong S E, Mann M. Trypsin cleaves exclusively C-terminal to arginine and lysine residues. Mol Cell Proteomics. 2004; 3(6):608-14. [0317] 50. Sherman, Nicholas E.; Kinter, Michael (2000). Protein sequencing and identification using tandem mass spectrometry. New York: John Wiley. [0318] 51. Wible B. A., Peter Hawryluk, Eckhard Ficker, Yuri A. Kuryshev, Glenn Kirsch, Arthur M. Brown. HERG-Lite: A novel comprehensive high-throughput screen for drug-induced hERG risk. Journal of Pharmacological and Toxicological Methods 52 (2005) 136-145. [0319] 52. Johnson S. A., Tony Hunter. Kinomics: methods for deciphering the kinome. Nature Methods 2, 17-25 (2005). [0320] 53. Sinz M, Gillian Wallace, and Jasminder Sahi. Current Industrial Practices in Assessing CYP450 Enzyme Induction: Preclinical and Clinical. AAPS J. 2008; 10(2): 391-400. [0321] 54. Bernardi M, Calandra S, Colantoni A, Trevisani F, Raimondo M L, Sica G, Schepis F, Mandini M, Simoni P, Contin M, Raimondo G. Q-T interval prolongation in cirrhosis: prevalence, relationship with severity, and etiology of the disease and possible pathogenetic factors. Hepatology. 1998; 27(1):28-34. [0322] 55. Baker M P, and Jones T D. Identification and removal of immunogenicity from therapeutic proteins. Curr Opin Drug Discov Devel. (2007) 10:219. [0323] 56. Perry L C A, Jones T D, and Baker M P. New approaches to prediction of immune responses to therapeutic proteins during pre-clinical development. Drugs R D (2008) 9 (6): 385.
REFERENCES CITED FOR LUNG INFLAMMATION AND FIBROSIS
[0324] 1. Akira S, Isshiki H, Sugita T, Tanabe O, Kinoshita S, Nishio Y, Nakajima T, Hirano T and Kishimoto T. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. EMBO J 9: 1897-1906, 1990. [0325] 2. Barron L and Wynn T A. Fibrosis is regulated by Th2 and Th17 responses and by dynamic interactions between fibroblasts and macrophages. Am J of Phys-Gastroint. and Liver Physiology 300: 723-728, 2011. [0326] 3. Bedossa P, Houglum K, Trautwein C, Holstege A and Chojkier M. Stimulation of collagen 1(I) gene expression is associated with lipid peroxidation in hepatocellular injury. A link to tissue fibrosis? Hepatology 19: 1262-1271, 1994. [0327] 4. Berberich-Siebelt F, Berberich I, Andrulis M, Santner-Nanan B, Jha M K, Klein-Hessling S, Schimpl A and Serfling E. SUMOylation interferes with CCAAT/Enhancer-binding protein-mediated c-myc repression, but not IL-4 activation in T-cells. J Immunol 176: 4851, 2006. [0328] 5. Bravo R, Frank R, Blundell P A and MacDonald-Bravo H. Cyclin/PCNA is the auxiliary protein of DNA polymerase-delta. Nature 326: 515-517, 1987. [0329] 6. Buck M. Targeting ribosomal S-6 kinase for the prevention and treatment of liver injury and liver fibrosis. Drug News Perspect 21: 301-306, 2008. [0330] 7. Buck M and Chojkier M. A ribosomal S-6 kinase-mediated signal to C/EBP is critical for the development of liver fibrosis. PLOS One 2: e1372, 2007. [0331] 8. Buck M and Chojkier M. C/EBP(beta) phosphorylation rescues macrophage dysfunction and apoptosis induced by anthrax lethal toxin. Am J Physiol Cell Physiol 293: C1788-C1796, 2007. [0332] 9. Buck M and Chojkier M. Signal Transduction in the Liver: C/EBP Modulates Cell Proliferation and Survival. Hepatology 37: 731-738, 2003. [0333] 10. Buck M and Chojkier M. Muscle wasting and dedifferentiation induced by oxidative stress in a murine model of cachexia is prevented by inhibitors of nitric oxide synthesis and antioxidants. EMBO J 15:1753-65, 1996. [0334] 11. Buck M and Chojkier M. C/EBP-Thr217 phosphorylation Signaling Contributes to the Development of Lung Injury and Fibrosis in Mice. PLOS One 2011. [0335] 12. Buck M, Poli V, Hunter T and Chojkier M. C/EBP phosphorylation by RSK creates a functional XEXD caspase inhibitory box critical for cell survival. Mol Cell 8: 807-816, 2001. [0336] 13. Buck M, Poli V, van der Geer P, Chojkier M and Hunter T. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP is required for hepatocyte proliferation induced by TGF. Mol Cell 4: 1087-92, 1999. [0337] 14. Buck M, Turler H and Chojkier M. LAP (NF-IL6), a tissue-specific transcriptional activator, is an inhibitor of hepatoma cell proliferation. EMBO J 13: 851-860, 1994. [0338] 15. Buck M, Zhang L, Hunter T and Chojkier M. Nuclear export of phosphorylated C/EBP mediates the inhibition of albumin expression by TNF. EMBO J 20: 6712-6723, 2001. [0339] 16. Chojkier M and Fierer J. D-galactosamine hepatotoxicity is associated with endotoxin sensitivity and mediated by lymphoreticular cells in mice. Gastroenterology 88: 115-121, 1985. [0340] 17. Chojkier M. Regulation of collagen gene expression. In: Liver growth and repair, edited by Strain A and Diehl A. London: Chapman & Hall, 1998, p. 430-450. [0341] 18. Crystal R G, Bitterman P B, Mossman B, Schwarz M I, Sheppard D, Almasy L, Chapman H A, Friedman S L, King T E, Jr., Leinwand L A, Liotta L, Martin G R, Schwartz D A, Schultz G S, Wagner C R and Musson R A. Future Research Directions in IPF: Am J Respir Crit Care Med 166: 236-46, 2002. [0342] 19. Cutroneo K R, White S L, Phan S H and Ehrlich H P. Therapies for bleomycin induced lung fibrosis through regulation of TGF-beta1 induced collagen gene expression. Journal of Cellular Physiology 211: 585-589, 2007. [0343] 20. Degryse A L, Xu X C, Tanjore H, Polosukhin V V, Jones B, Mc Mahon F B, Ortiz C, Blackwell T S and Lawson W E. TGF Signaling In Epithelium Regulates Bleomycin Induced Alveolar Injury And Fibroblast Recruitment. Am J Respir Crit Care Med 183: A6144, 2011. [0344] 21. Descombes P, Chojkier M, Lichtsteiner S, Falvey E and Schibler U. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4: 1541-1551, 1990. [0345] 22. Fichtner-Fiegl S, Strober W, Kawakami K, Puri R K and Kitani A. IL-13 signaling through the IL-1? receptor is involved in induction of TGF-1 production and fibrosis. Nature Medicine 12: 99-106, 2006. [0346] 23. Franchi L, Eigenbros T, Munoz-Planillo R and Nunez G. The Inflammasome: A caspase-1 activation platform regulating immune responses and disease pathogenesis. Nat Immunol 10: 241, 2009. [0347] 24. Garantziotis S, Steele M P and Schwartz D A. Pulmonary fibrosis: thinking outside of the lung. J Clin Invest 114: 319-321, 2004. [0348] 25. Green D and Reed J. Mitochondria and apoptosis. Science 281: 1309-1312, 1998. [0349] 26. Hardie W D, Glasser S W and Hagood J S. Emerging concepts in the pathogenesis of lung fibrosis. Am J Pathol 175: 3-16, 2009. [0350] 27. He W, Zhang L, Ni A, Zhang Z, Mirotsou M, Mao L, Pratt R E and Dzau V J. Exogenously administered secreted frizzled related protein 2 (Sfrp2) reduces fibrosis and improves cardiac function in a rat model of myocardial infarction. PNAS 2010. [0351] 28. Hilgendorff A, Doerner M, Rawer D, Leick J, Trotter A, Ebsen M, Ruppert C, G?nther A, Gortner L and Reiss I. Effects of a recombinant surfactant protein-C-based surfactant on lung function and pulmonary surfactant system in a model of meconium aspiration syndrome. Crit Care Med 134: 203-210, 2006. [0352] 29. Homer R J, Elias J A, Lee C G and Herzog E. Modern concepts on the role of inflammation in pulmonary fibrosis. Archives of Pathology & Laboratory Medicine 135: 780-788, 2011. [0353] 30. Houglum K, Lee K S and Chojkier M. Proliferation of hepatic stellate cells is inhibited by phosphorylation of CREB on Serine 133. J Clin Invest 99: 1322-1389, 1997. [0354] 31. Hu B, Ullenbruch M R, Jin H, Gharaee-Kermani M and Phan S H. An essential role of CCAAT/enhancer binding protein beta in bleomycin-induced pulmonary fibrosis. J Pathol 211: 455-462, 2007. [0355] 32. Huh J R, Leung M W L, Huang P, Ryan D A, Krout M R, Malapaka R, Chow J, Manel N, Ciofani M, Kim S V, Cuesta A, Santori F R, Lafaille J J, Xu H E, Gin D Y, Rastinejad F and Littman D R. Digoxin and its derivatives suppress Th17 cell differentiation by antagonizing RORyt activity. Nature 472: 486-490, 2011. [0356] 33. Jakubzick C, Choi E S, Joshi B H, Keane M P, Kunkel S L, Puri R K and Hogaboam C M. Therapeutic Attenuation of Pulmonary Fibrosis Via Targeting of IL-4- and IL-13-Responsive Cells. J Immunol 171: 2684-2693, 2003. [0357] 34. Jenner R G, Townsend M J, Jackson I, Sun K, Bouwman R D, Young R A, Glimcher L H and Lord G M. The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes. Proc Natl Acad Sci USA 106: 17876-17881, 2009. [0358] 35. Kabelitz D. Expression and function of Toll-like receptors in T lymphocytes. Curr Opin Imm 19:39-45, 2007. [0359] 36. Kamei Y, Xu L, Heinzel T, Torchia J, Kurokawa R, Gloss B, Lin S C, Heyman R A, Rose D W, Glass C K and Rosenfeld M G. A CBP integrator complex mediates transcriptional activation and AP-1 inhibition by nuclear receptors. Cell 85: 403-414, 1996. [0360] 37. Karpel J P, Aldrich T K, Mitsudo S and Norin A J. Lung Lymphocytes in Bleomycin-Induced Pulmonary Disease. Lung 167: 163-172, 1989. [0361] 38. Kelley J. Cytokines of the lung. American Review of respiratory disease 141: 765-788, 1990. [0362] 39. Kinoshita S M and Taguchi S. NF-IL6 (C/EBPbeta) induces HIV-1 replication by inhibiting cytidine deaminase APOBEC3G. Proc Natl Acad Sci USA 105: 15022-15027, 2008. [0363] 40. K?nigshoff M, Kramer M, Balsara N, Wilhelm J, Amarie O V, Jahn A, Rose F, Fink L, Seeger W, Schaefer L, G?nther A and Eickelberg O. WNT 1-inducible signaling protein-1 mediates pulmonary fibrosis in mice and is upregulated in humans with idiopathic pulmonary fibrosis. J Clin Invest 119: 772-787, 2009. [0364] 41. Kowenz-Leutz E, Twamley G, Ansieau S and Leutz A. Novel mechanism of C/EBP beta (NF-M) transcriptional control: activation through derepression. Genes Dev 8: 2781-2791, 1994. [0365] 42. Lee F, Hagler J, Chen Z and Maniatis T. Activation of the I kappa B alpha kinase complex by MEKK1, a kinase of the JNK pathway. Cell 88: 213-222, 1997. [0366] 43. Li B, Tournier C, Davis R J and Flavell R A. Regulation of IL-4 expression by the transcription factor JunB during T helper cell differentiation. EMBO J 18: 420-432, 1999. [0367] 44. Li M, Krishnaveni M S, Li C, Zhou B, Xing Y, Banfalvi A, Li A, Lombardi V, Akbari O, Borok Z and Minoo P. Epithelium-specific deletion of TGF-? receptor type II protects mice from bleomycin-induced pulmonary fibrosis. Journal of Clinical Investigation 121: 277-287, 2011. [0368] 45. Magzoub M and Graslund A. Cell-penetrating peptides: [corrected] from inception to application. Q Rev Biophys 37: 147-195, 2004. [0369] 46. Maitra A, Shen F, Hanel W, Mossman K, Tocker J, Swart D and Gaffen S L. Distinct functional motifs within the IL-17 receptor regulate signal transduction and target gene expression. Proc Natl Acad Sci USA 104: 7506-7511, 2007. [0370] 47. Martinon F, Burns K and Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Molecular Cell 10: 417-426, 2002. [0371] 48. Matsusaka T, Fujikawa K, Nishio Y, Mukaido N, Matsushima K, Kishimoto T and Akira S. Transcription Factors NF-IL6 and NF-kappa B Synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. PNAS 90: 10193-10197, 1999. [0372] 49. McGeachy M J and Cua D J. Th17 Cell Differentiation: The Long and Winding Road. Immunity 28: 445-453, 2008. [0373] 50. McGuirk P and Mills K H G. Pathogen-specific regulatory T cells provoke a shift in the Th1/Th2 paradigm in immunity to infectious diseases. Trends Immunol 23: 450-455, 2002. [0374] 51. McKnight S L. McBindalla better name for CCAAT/enhancer binding proteins? Cell 107: 259-261, 2001. [0375] 52. Meneghin A and Hogaboam C M. Infectious disease, the innate immune response, and fibrosis. J Clin Invest 117: 530-538, 2007. [0376] 53. Mombaerts, Peter, lacomini, John, Johnson, Randall S., Herrup, Karl, Tonegawa, Susumu, and Papaioannou, Va. E. RAG-1-deficient mice have no mature B and T lymphocytes. Cell 68, 869-77. 1992. [0377] 54. Moore B B and Hogaboam C M. Murine models of pulmonary fibrosis. Am J Physiol Lung Cell Mol Physiol 294: L152-L160, 2008. [0378] 55. Mullen A C, High F A, Hutchins A S, Lee H W, Villarino A V, Livingston D M, Kung A L, Cereb N, Yao T P, Yang S Y and Reiner S L. Role of T-bet in Commitment of TH1 Cells Before IL-12-Dependent Selection. Science 292: 1907-1910, 2001. [0379] 56. Murray P J and Wynn T A. Protective and pathogenic functions of macrophage subsets. Nat Rev Immunol 11: 723-737, 2011. [0380] 57. Nakajima T, Kinoshita S, Sasagawa T, Sasaki K, Naruto M, Kishimoto T and Akira S. Phosphorylation at threonine-235 by a ras-dependent mitogen-activated protein kinase cascade is essential for transcription factor NF-IL6. Proc Natl Acad Sci USA 90: 2207-2211, 1993. [0381] 58. Nguyen T L. Targeting RSK: an overview of small molecule inhibitors. Anti-Cancer Agents Med Chem 8: 710-716, 2008. [0382] 59. Olson A L, Swigris J J, Lezotte D C, Norris J M, Wilson C G and Brown K K. Mortality from pulmonary fibrosis increased in the United States from 1992 to 2003. Am J Respir Crit Care Med 176: 277-284, 2007. [0383] 60. Orens J B, Estenne M, Arcasoy S, Conte J V, Corris P, Egan J J, Egan T, Keshavjee S, Knoop C, Kotloff R, Martinez F J, Nathan S, Palmer S, Patterson A, Singer L, Snell G, Studer S, Vachiary J L, Gianville A R. J Heart Lung Transplant 25: 745-755, 2006. [0384] 61. Palombella V J, Rando O J, Goldberg A L and Maniatis T. The ubiquitin-proteasome pathway is required for processing the NF-kB 1 precursor protein and the activation of NF-kB. Cell 78: 773-785, 1994. [0385] 62. Pantelidis P, Fanning G C, Wells A U, Welsh K I and du Bois R M. Analysis of tumor necrosis factor-alpha, lymphotoxin-alpha, tumor necrosis factor receptor II, and interleukin-6 polymorphisms in patients with idiopathic pulmonary fibrosis. Am J Respir Crit Care Med 163: 1432-1436, 2001. [0386] 63. Pardo A, Gibson K, Cisneros J, Richards T J, Yang Y, Becerril C, Yousem S, Herrera I, Ruiz V, Selman Ms and Kaminski N. Up-Regulation and Profibrotic Role of Osteopontin in Human Idiopathic Pulmonary Fibrosis. PLoS Med 2: e251, 2005. [0387] 64. Pedroza M, Schneider D J, Karmouty-Quintana H, Coote J, Shaw S, Corrigan R, Molina J G, Alcorn J L, Galas D, Gelinas R and Blackburn M R. Interleukin-6 contributes to inflammation and remodeling in a model of adenisone mediated lung injury. PLOS One 6: e22667, 2011. [0388] 65. Phillipps R J, Burdick M J, Hong K, Lutz M A, Murray L A, Xue Y Y, Belperio J A, Keane M P and Strieter R M. Circulating fibrocytes traffic to the lungs in response to CXCL 12 and mediate fibrosis. J Clin Invest 114: 438-446, 2004. [0389] 66. Pulendran B, Tang H and Manicassamy S. Programming dendritic cells to induce TH2 and tolerogenic responses. Nature Immunology 11: 647-655, 2010. [0390] 67. Raghu G, Weycker D, Edelsberg J, Bradford W Z and Oster G. Incidence and prevalence of idiopathic pulmonary fibrosis. Am J Res Critical Care Med 174: 810-816, 2006. [0391] 68. Ramamoorthy S, Donohue M and Buck M. Decreased Jun-D and myogenin expression in muscle wasting of human cachexia. American J of Physiology, Endocrinology and Metabolism 297: e392-401, 2009. [0392] 69. Rosati M, Valentin A, Patenaude D J and Pavlakis G N. CCAT-Enhancer-binding protein beta (C/EBP beta) activates CCR5 promotor: increased C/EBP beta and CCR5 in T lymphocytes from HIV-1-infected individuals. J Immunol 167: 1654-1662, 2001. [0393] 70. Ruddy M J, Wong G C, Liu X K, Yamamoto H, Kasayama S, Kirkwood K L and Gaffen S L. Functional Cooperation between Interleukin-17 and Tumor Necrosis Factor-is Mediated by CCAAT/Enhancer-binding Protein Family Members. The Journal of Biological Chemistry 279: 2559-2567, 2004. [0394] 71. Ruffell D, Mourkioti F, Gambardella A, Kirstetter. P, Lopez R G, Rosenthal N and Nerlov C. A CREB-C/EBPbeta cascade induces M2 macrophage-specific gene expression and promotes muscle injury repair. PNAS 106: 17475-17480, 2009. [0395] 72. Sato A K, Viswanathan M, Kent R B and Wood C R. Therapeutic peptides: technological advances driving peptides into development. Curr Opin Biotech 17: 638-642, 2006. [0396] 73. Schreck R, Rieber P and Baeuerle P A. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kB transcription factor and HIV-1. EMBO J 10: 2247-2258, 1991. [0397] 74. Schrier D J, Phan S H and McGarry B M. The effects of the nude (nu/nu) mutation on bleomycin-induced pulmonary fibrosis. A biochemical evaluation. The American Rev of Respiratory Disease 127: 614-617, 1983. [0398] 75. Schwabe R F and Sakurai H. IKK phosphorylates p65 at S468 in transactivation domain 2. FASEB J 19: 1758-1760, 2005. [0399] 76. Screpanti I, Musiani P, Bellavia D, Cappelletti M, Aiello F B, Maroder M, Frati L, Modesti A, Gulino A and Poli V. Inactivation of the IL-6 Gene Prevents Development of Multicentric Castleman's Disease in C/EBP[3-deficient Mice. Journal of Experimental Medicine 184: 1561-1566, 1996. [0400] 77. Selman M, King T E and Pardo A. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann Intern Med 134: 136-151, 2001. [0401] 78. Shen F, Li N, Gade P, Kalvakolanu D V, Weibley T, Doble B, Woodgett J R, Wood T D and Gaffen S L. IL-17 Receptor signaling inhibits C/EBPbeta by sequential phosphorylation of the regulatory 2 domain. Sci Signal 2: ra8, 2009. [0402] 79. Smith J A, Poteet-Smith C, Xu Y, Errington T M, Hecht S M and Lannigan D A. Identification of the first specific inhibitor of p90 ribosomal S6 kinase (RSK) reveals an unexpected role for RSK in cancer cell proliferation. Cancer Res 65: 1027-1034, 2005. [0403] 80. Solt L A, Kumar N, Nuhant P, Wang Y, Lauer J L, Liu J, Istrate M A, Kamenecka T M, Roush W R, Vidovic D, Schurer S C, Xu J, Wagoner G, Drew P D, Griffin P R and Burris T P. Suppression of TH17 differentiation and autoimmunity by a synthetic ROR ligand. Nature 472: 491-494, 2011. [0404] 81. Spierings D, McStay G, Saleh M, Bender C, Chipuk J, Maurer U and Green D. Connected to death: the (unexpurgated) mitochondrial pathway of apoptosis. Science 310: 66-67, 2005. [0405] 82. Stein B and Baldwin A. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kB. Mol Cell Biol 13: 7191-7198, 1993. [0406] 83. Stein B, Cogswell P and Baldwin A, Jr. Functional and physical associations between NF-kB and C/EBP family members: Rel domain-bZIP interaction. Mol Cell Biol 13: 3964-3974, 1993. [0407] 84. Szabo S J, Kim S T, Costa G L, Zhang X, Fathman C G and Glimcher L H. A Novel Transcription Factor, T-bet, Directs Th1 Lineage Commitment. Cell 100: 655-669, 2000. [0408] 85. Takeshita F, Suzuki K, Sasaki S, Ishii N, Klinman D M and Ishii K J. Transcriptional Regulation of the Human TLR9 Gene. J Immunol 173: 2552-2561, 2004. [0409] 86. Trautwein C, Caelles C, van der Geer P, Hunter T, Karin M and Chojkier M. Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364: 544-547, 1993. [0410] 87. Trautwein C, van der Geer P, Karin M, Hunter T and Chojkier M. Protein kinase A and C site-specific phosphorylations of LAP (NF-IL6) modulate its binding affinity to DNA-recognition elements. J Clin Invest 93: 2554-2561, 1994. [0411] 88. Trujillo G, Meneghin A, Flaherty K R, Sholl L M, Myers J L, Kazerooni E A, Gross B H, Oak S R, Coelho A L, Evanoff H, Day E, Toews G B, Joshi A D, Schaller M A, Waters B, Jarai G, Westwick J, Kunkel S L, Martinez F J and Hogaboam C M. TLR9 Differentiates Rapidly from Slowly Progressing Forms of Idiopathic Pulmonary Fibrosis. Science Translational Medicine 2: 57ra82, 2010. [0412] 89. Veronese F M and Pasut G. PEGylation, successful approach to drug delivery. Drug Discov Today 10: 1451-1458, 2005. [0413] 90. Wegner M, Cao Z and Rosenfeld M G. Calcium-regulated phosphorylation within the leucine zipper of C/EBP. Science 256: 370-373, 1992. [0414] 91. Wilson M S, Elnekave E, Mentink-Kane M M, Hodges M G, Pesce J T, Ramalingam T R, Thompson R W, Kamanaka M, Flavell R A, Keane-Myers A, Cheever A W and Wynn T A. IL-13Ra2 and IL-10 coordinately suppress airway inflammation, airway-hyperreactivity, and fibrosis in mice. Journal of Clinical Investigation 117: 2941-2951, 2007. [0415] 92. Wilson M S, Madala S K, Ramalingam T R, Gochuico B R, Rosas I O, Cheever A W and Wynn T A. Bleomycin and IL-1-mediated pulmonary fibrosis is IL-17A dependent. Journal of Experimental Medicine 207: 535-552, 2010. [0416] 93. Yang D D, Conze D, Whitmarsh A J, Barrett T, Davis R J, Rinctn M and Flavell R A. Differentiation of CD4+ T Cells to Th1 Cells Requires MAP Kinase JNK2. Immunity 9: 575-585, 1998. [0417] 94. Zhang K, Gharaee-Kermani M, McGarry B, Remick D and Phan S H. TNF-alpha-mediated lung cytokine networking and eosinophil recruitment in pulmonary fibrosis. Journal of Immunology 158: 954-959, 1997. [0418] 95. Zheng W-P and Flavell R A. The Transcription Factor GATA-3 Is Necessary and Sufficient for Th2 Cytokine Gene Expression in CD4 T Cells. Cell.
REFERENCES FOR MACROPHAGE INFLAMMASOME ACTIVATION AND LIVER INJURY
[0419] 1. Szabo, G. & Petrasek, J. Inflammasome activation and function in liver disease. Nature Reviews Gastroenterology & Hepatology 12, 387-400 (2015). [0420] 2. Chung, R. & Podolsky, D. Cirrhosis and its Complications. Harrison's Principles of Internal Medicine. McGraw-Hill: New York, 1754-1767 (2005). [0421] 3. Chojkier, M. Regulation of collagen gene expression. Liver Growth and Repair. Chapman & Hall: London, 430-450 (1998). [0422] 4. Chojkier, M. & Fierer, J. D-Galactosamine hepatotoxicity is associated with endotoxin sensitivity and mediated by lymphoreticular cells in mice. Gastroenterology 88, 115-121 (1985). [0423] 5. Duffield, J. S. et al. Selective depletion of macrophages reveals distinct, opposing roles during liver injury and repair. J Clin. Invest. 115, 56-65 (2005). [0424] 6. Petrasek, J. et al. IL-1 receptor antagonist ameliorates inflammasome-dependent alcoholic steatohepatitis in mice. The Journal of Clinical Investigation 122, 3476-3489 (2012). [0425] 7. Ouyang, X. et al. Adenosine is required for sustained inflammasome activation via the A2A receptor and the HIF-la pathway. Nat Commun. 4, 1-18 (2013). [0426] 8. Tsutsui, H. et al. Caspase-1-Independent, Fas/Fas Ligand-Mediated IL-18 Secretion from Macrophages Causes Acute Liver Injury in Mice. Immunity 11, 359-367 (1999). [0427] 9. Diehl, A. M. Neighborhood watch orchestrates liver regeneration. Nature Medicine 18., 497-499 (2012). [0428] 10. Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Molecular Cell 10, 417-426 (2002). [0429] 11. Franchi, L., Eigenbrod, T., Munoz-Planillo, R. & Nunez, G. The inflammasome: a caspase-1-activation platform that regulates immune responses and disease pathogenesis. Nat. Immunol. 10, 241-247 (2009). [0430] 12. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E. & Schibler, U. LAP, a novel member of the C/EBP gene family, encodes a liver-enriched transcriptional activator protein. Genes Dev 4, 1541-1551 (1990). [0431] 13. Akira, S. et al. A nuclear factor for IL-6 expression (NF-IL6) is a member of a C/EBP family. The EMBO Journal 9, 1897-1906 (1990). [0432] 14. Poli, V., Mancini, F. P. & Cortese, R. IL6-DBP, a nuclear protein involved in interleukin-6 signal transduction, defines a new family of leucine zipper proteins related to C/EBP. Cell 63, 643-653 (1990). [0433] 15. Iwama, A. et al. Reciprocal roles for CCAAT/enhancer binding protein (C/EBP) and PU.1 transcription factors in Langerhans cell commitment. J. Exp. Med. 195, 547-558 (2002). [0434] 16. Sebastian, T. & Johnson, P. F. Stop and go: anti-proliferative and mitogenic functions of the transcription factor C/EBPb. Cell Cycle 5, 953-957 (2006). [0435] 17. Friedman, A. D. Transcriptional control of granulocyte and monocyte development. Oncogene 26, 6816-6828 (2007). [0436] 18. Buck, M., Poli, V., van der Geer, P., Chojkier, M. & Hunter, T. Phosphorylation of rat serine 105 or mouse threonine 217 in C/EBP beta is required for hepatocyte proliferation induced by TGF alpha. Mol Cell 4, 1087-1092 (1999). [0437] 19. Buck M, C. M. C/EBP? Associates With Caspase 8 Complex Proteins and Modulates Apoptosis in Hepatic Stellate Cells. J Clin Gastroenterol 41, S295-S299 (2001). [0438] 20. Buck, M. & Chojkier, M. Signal Transduction in the Liver: C/EBPb Modulates Cell Proliferation and Survival. Hepatology 37, 731-738 (2003). [0439] 21. Buck, M. & Chojkier, M. A ribosomal S-6 kinase-mediated signal to C/EBP-beta is critical for the development of liver fibrosis. PLoS One 2, e1372 (2007). [0440] 22. Trautwein, C. et al. Transactivation by NF-IL6/LAP is enhanced by phosphorylation of its activation domain. Nature 364, 544-547 (1993). [0441] 23. Buck, M. & Chojkier, M. C/EBP(beta) phosphorylation rescues macrophage disfunction and apoptosis induced by anthrax lethal toxin. Am J Physiol Cell Physiol 293, C1788-C1796 (2007). [0442] 24. Ramamoorthy, S., Donohue, M. & Buck, M. Decreased Jun-D and myogenin expression in muscle wasting of human cachexia. Am J Physiol Endocrinol Metab 297, E392-401 (2009). [0443] 25. Chojkier, M. Troglitazone and liver injury: in search of answers. Hepatology 41, 237-246 (2005). [0444] 26. Ogasawara, J. et al. Lethal effect of the anti-Fas antibody in mice. Nature 364, 806-809 (1993). [0445] 27. Buck, M., Poli, V., Hunter, T. & Chojkier, M. C/EBPbeta phosphorylation by RSK creates a functional XEXD caspase inhibitory box critical for cell survival. Mol Cell 8, 807-816 (2001). [0446] 28. Malhi, H. & Gores, G. J. Cellular and Molecular Mechanisms of Liver Injury. Gastroenterology 134, 1641-1654 (2008). [0447] 29. Cieslik, K., Zhu, Y. & Wu, K. K. Salicylate Suppresses Macrophage Nitric-oxide Synthase-2 and Cyclo-oxygenase-2 Expression by Inhibiting CCAAT/Enhancer-binding Protein-beta Binding via a Common Signaling Pathway. Journal of Biological Chemistry 277, 49304-49310 (2002). [0448] 30. Rudolph, K. L., Chang, S., Millard, M., Schreiber-Agus, N. & Depinho, R. A. Inhibition of experimental liver cirrhosis in mice by telomerase gene delivery. Science 287, 1253-1258 (2000). [0449] 31. Julien, B. et al. Antifibrogenic role of the cannabinoid receptor CB2 in the liver. Gastroenterology 128, 742-755 (2005). [0450] 32. Walsh, J. G., Muruve, D. A. & Power, C. Inflammasomes in the CNS. Nature Reviews Neuroscience 15, 84-97 (2014). [0451] 33. Martinon, F., Mayor, A. & Tschopp, J. The Inflammasomes: Guardians of the Body. Annual Review of Immunology 27, 229-265 (2009). [0452] 34. Tabuenca, J. M. Toxic-allergic syndrome caused by ingestion of rapeseed oil denatured with aniline. The Lancet 318, 567-568 (1981). [0453] 35. Solis-Herruzo, J. A. et al. Hepatic injury in the toxic epidemic syndrome caused by ingestion of adulterated cooking oil. Hepatology 4, 131-139 (1984). [0454] 36. Dadley-Moore, D. Switching on the inflammasome. Nature Reviews Immunology 6, 88-89 (2006). [0455] 37. Lamkanfi, M. Emerging inflammasome effector mechanisms. Nat Rev Immunol 11, 213-220 (2011). [0456] 38. Ryo, K. et al. Significance of Fas antigen-mediated apoptosis in human fulminant hepatic failure. Am J Gastroenterol 95, 2047-2055 (2000). [0457] 39. Taieb, J., Mathurin, P., Poynard, T., Gougerot-Pocidalo, M. A. & Chollet-Martin, S. Raised plasma soluble Fas and Fas-ligand in alcoholic liver disease. Lancet 351, 1930-1931 (1998). [0458] 40. Cs?ka, B. et al. A2A adenosine receptors and C/EBPbeta are crucially required for IL-10 production by macrophages exposed to Escherichia coli. Blood 110, 2685-2695 (2007). [0459] 41. Mehal, W. Z. The Inflammasome in Liver Injury and Non-Alcoholic Fatty Liver Disease. Digestive Diseases 32, 507-515 (2014). [0460] 42. Murray, Peter J. et al. Macrophage Activation and Polarization: Nomenclature and Experimental Guidelines. Immunology 41, 14-20 (2014). [0461] 43. Brenner D A, Alcorn J M, Feitelberg S P, Leffert H L, Chojkier M. Expression of collagen genes in the liver. Mol Biol Med. 7, 105-15 (1990).
[0462] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within the scope of the appended claims.
[0463] All patents, applications, publications, test methods, literature, and other materials cited herein are hereby incorporated by reference in their entirety as if physically present in this specification.