A MICROORGANISM OF THE GENUS ESCHERICHIA PRODUCING L-TRYPTOPHAN AND A METHOD FOR PRODUCING L-TRYPTOPHAN USING THE SAME

20180127792 ยท 2018-05-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a microorganism of the genus Escherichia producing more L-tryptophan by inactivating the activity of phosphatase.

    Additionally, the present disclosure relates to a method for producing L-tryptophan using the microorganism of the genus Escherichia.

    Claims

    1. A microorganism of the genus Escherichia producing L-tryptophan, wherein the activity of phosphatase comprising an amino acid sequence of SEQ ID NO: 1 is modified to be inactivated.

    2. The microorganism according to claim 1, wherein the microorganism of the genus Escherichia is Escherichia coli.

    3. A method for producing L-tryptophan, comprising: (i) culturing the microorganism of the genus Escherichia of claim 1 in a medium; and (ii) recovering L-tryptophan from the cultured medium or the cultured microorganism.

    4. A method for producing L-tryptophan, comprising: (i) culturing the microorganism of the genus Escherichia of claim 2 in a medium; and (ii) recovering L-tryptophan from the cultured medium or the cultured microorganism.

    Description

    BEST MODE

    [0009] An object of the present disclosure is to provide a microorganism of the genus Escherichia producing L-tryptophan.

    [0010] Another object of the present disclosure is to provide a method for producing L-tryptophan using the microorganism producing L-tryptophan.

    Solution to Problem

    [0011] In order to achieve the above object, in an aspect, the present disclosure provides a microorganism of the genus Escherichia producing L-tryptophan, wherein the activity of phosphatase comprising an amino acid sequence of SEQ ID NO: 1 is modified to be inactivated. For example, the microorganism of the genus Escherichia producing L-tryptophan may be a microorganism in which the L-tryptophan productivity is increased, compared with a microorganism of the genus Escherichia producing L-tryptophan in which the endogenous activity of phosphatase is not modified to be inactivated.

    [0012] As used herein, the term L-tryptophan refers to an aromatic L-amino acid, which is an -amino acid and an essential amino acid not synthesized in vivo having a chemical formula of C.sub.11H.sub.12N.sub.2O.sub.2. In order to increase L-tryptophan productivity in a microorganism, a method of continuously supplying a precursor, i.e., erythrose-4-phosphate (E4P), in tryptophan-producing strains; enhancing the expression of tktA genes to efficiently use energy; increasing the biosynthesis by blocking branch pathways in the biosynthetic pathway; or using less ATP, etc., has been conventionally used.

    [0013] As used herein, the term phosphatase may refer to a protein that catalyzes a reaction for removing a phosphate group from a substrate. The phosphatase of the present invention, which has an amino acid sequence of SEQ ID NO: 1, is a protein encoded by the gene, yidA. In addition, such phosphatase is designated as phosphosugar phosphatase (NCBI gene ID: 12933583) in the NCBI database (http://www.ncbi.nlm.nih.gov), and is also designated as sugar-phosphatase in the EcoCyc database (http://www.ecocyc.org). The protein catalyzes the decomposition of phosphosugar substrates into sugars and phosphoric acids. However, the relevance between the thus-described enzyme and the enhancement of the tryptophan production has not been clarified.

    [0014] The enzyme described above may include without limitation, in addition to the amino acid sequence represented by SEQ ID NO: 1, any amino acid sequence which has a homology of 70% or higher, specifically 80% or higher, more specifically 90% or higher, even more specifically 95% or higher, yet even more specifically 98% or higher, and yet even still more specifically 99% or higher, to the above amino acid sequence, as long as an enzyme exhibits an effect substantially the same as or corresponding to the enzyme above. Additionally, it is obvious that an enzyme variant having an amino acid sequence with a partial deletion, modification, substitution, or addition also belongs to the scope of the present disclosure, as long as an amino acid sequence has the homology described above and exhibits the effect corresponding to each enzyme.

    [0015] The genes encoding the phosphatase having an amino acid sequence of SEQ ID NO: 1 may be included without limitation, as long as these have a sequence capable of encoding the enzyme above, and can be represented as yidA genes. Specifically, the genes encoding the enzyme may also include without limitation, in addition to the nucleotide sequence represented by SEQ ID NO: 2, any gene sequence encoding the enzyme, which has a homology to 80% or higher, specifically 90% or higher, more specifically 95% or higher, even more specifically 98% or higher, and yet even more specifically 99% or higher, to the above nucleotide sequence, as long as the gene sequence encodes an enzyme which exhibits an effect substantially the same as or corresponding to the enzyme above. Additionally, it is obvious that any nucleotide sequence which has the homology described above can belong to the scope of the present disclosure, although the nucleotide sequence may have a partial deletion, modification, substitution, or addition therein.

    [0016] As used herein, the term homology refers to a percentage of identity between two polynucleotide or polypeptide moieties. Sequence correspondence from one moiety to another may be determined by a known technique in the art. For example, homology may be determined by directly aligning the sequence information (e.g., parameters such as score, identity, and similarity) on two polynucleotide molecules or two polypeptide molecules using a computer program (e.g., BLAST 2.0) that is readily available and capable of aligning sequence information. Additionally, homology between polynucleotides may be determined by hybridizing the polynucleotides under the condition for forming a stable double-strand in the homologous regions and then digesting the hybridized strand by a single-strand-specific nuclease to determine the size of digested fragments.

    [0017] As used herein, the term endogenous activity refers to an active state of an enzyme in a microorganism in a natural state or before modification.

    [0018] As used herein, the term modified to be inactivated refers to a case when the gene encoding an enzyme is not expressed at all and/or a case when the gene is expressed but exhibits no activity or a decrease in activity compared to that of the native strain or the strain before modification.

    [0019] The inactivation of the activity of an enzyme compared to its endogenous activity refers to a case where there is no activity or a decrease in activity of an enzyme in a microorganism compared with that originally possessed in its natural state or before modification. The decrease in activity refers to a concept including a case where the activity of an enzyme itself is lower than that of an enzyme originally possessed in a microorganism due to modification of the gene encoding the enzyme, a case where the level of overall enzyme activity in cells is lower than that of the native strain or that of the strain before modification due to inhibition of expression or inhibition of translation of the gene encoding the same, or a combined case thereof.

    [0020] The method of modifying such enzyme activity for inactivation may be achieved by various well-known methods in the art. Examples of the methods may include a method of substituting the gene encoding the enzyme on the chromosome with a gene mutated so that the enzyme activity can be reduced, including the case when the enzyme activity is eliminated; a method of deleting part or the entirety of the gene encoding the enzyme; a method of substituting the expression control sequence of the gene encoding the enzyme with a sequence having weak or no activity; a method of introducing a modification into the expression control sequence of the gene on the chromosome encoding the enzyme; a method of deleting part or the entirety of the gene on the chromosome encoding the enzyme; a method of introducing an antisense oligonucleotide (e.g., antisense RNA), which inhibits the translation from the mRNA into an enzyme by a complementary binding to the transcript of the gene on the chromosome; a method of making the attachment of a ribosome impossible by forming a secondary structure by artificially adding a Shine-Dalgarno (SD) sequence and its complementary sequence on the front end of the SD sequence of the gene encoding the enzyme; a method of reverse transcription engineering (RTE), which adds a promoter to be reversely transcribed on the 3 terminus of the open reading frame (ORF) of the corresponding sequence, etc., and may also include a combination thereof, but are not particularly limited thereto.

    [0021] Specifically, the method of deleting part or the entirety of a gene encoding the enzyme may be performed by substituting a polynucleotide encoding an endogenous target protein within the chromosome with a polynucleotide or a marker gene having a partial deletion in the nucleic acid sequence, using a vector for chromosomal insertion in bacteria. In an exemplary embodiment of the method for deleting part or the entirety of a gene, a method of deleting the gene by homologous recombination may be used.

    [0022] As used herein, the term part, although it may vary depending on the types of polynucleotides, may specifically refer to 1 nucleotide to 300 nucleotides, more specifically 1 nucleotide to 100 nucleotides, and even more specifically 1 nucleotide to 50 nucleotides, but is not particularly limited thereto.

    [0023] As used herein, the term homologous recombination refers to genetic recombination that occurs via crossover at genetic chain loci having mutual homology.

    [0024] Specifically, the method of modifying the expression control sequence may be carried out by inducing a modification of the expression control sequence via deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the nucleic acid sequence of the expression control sequence; or by substituting with a weaker promoter, etc. The expression control sequence may include a promoter, an operator sequence, a sequence encoding a ribosome-binding region, and sequences controlling the termination of transcription and translation.

    [0025] Furthermore, the method of modifying the gene sequence on the chromosome may be carried out by inducing a modification in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof in the gene sequence for further weakening the enzyme activity; or by substituting with a gene sequence which was improved to have weaker activity or a gene sequence which was improved to have no activity.

    [0026] According to an exemplary embodiment of the present disclosure, in order to inactivate the endogenous activity of phosphatase having the amino acid sequence of SEQ ID NO: 1, it was found that the L-tryptophan productivity in various Escherichia coli producing L-tryptophan, in which the gene, yidA, encoding the phosphatase is deleted, was increased compared with the parent strains in which yidA is not deleted. Therefore, it was confirmed that a microorganism of the genus Escherichia producing L-tryptophan, in which the endogenous activity of phosphatase is modified to be inactivated, was able to efficiently produce L-tryptophan.

    [0027] In the present invention, the microorganism producing L-tryptophan refers to a microorganism capable of producing L-tryptophan from a carbon source in the media above. Additionally, the microorganism producing L-tryptophan may be a recombinant microorganism. Specifically, the types of the microorganism are not particularly limited as long as a microorganism can produce L-tryptophan. However, the microorganism may be a microorganism belonging to the genera Enterobacter, Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, and Brevibacterium, and specifically a microorganism belonging to the genus Escherichia.

    [0028] More specifically, the microorganism of the genus Escherichia may specifically be Escherichia coli. However, any microorganisms belonging to the genus Escherichia which can increase the L-tryptophan productivity by inactivating the phosphatase activity can be included without limitation.

    [0029] Specifically, the parent strain of the microorganism of the genus Escherichia producing L-tryptophan by inactivation of the phosphatase activity may not be particularly limited as long as the microorganism has tryptophan productivity. For example, the microorganism producing tryptophan may be a microorganism in which, for enhancing the tryptophan biosynthetic pathway, the activities of the gene in the competitive pathway, the regulator in the directional pathway of tryptophan operon, and the gene for introducing and decomposing tryptophan were weakened or inactivated, and/or the activity of the tryptophan operon was overexpressed. The method of weakening or inactivating the activity are the same as explained above, and the methods known in the art may be included without limitation. Additionally, the methods for overexpressing the activity of tryptophan operon known in the art are included without limitation. For example, the methods may include a method of further inserting a polynucleotide, which includes part or the entirety of the nucleotide sequence of the operon gene or an expression control region introduced from outside, into the chromosome; a method of increasing the copy number by introducing into a vector system; a method of enhancing operon activity by substituting the expression control sequence that controls gene expression with another expression control sequence, a modification having an induced mutation in part or the entirety of the nucleotide sequence of the expression control region, and an introduction of a modification of the gene itself, etc., but are not limited thereto. Specifically, the microorganism may be Escherichia coli, in which part or the entirety of the pheA gene, trpR gene, mtr gene, and/or tnaAB gene are deleted and/or the tryptophan is overexpressed.

    [0030] In the present disclosure, in addition to pheA gene, trpR gene, mtr gene, tnaAB gene, and tryptophan operon, and protein sequences encoded by them, the DNA and protein sequences used in the present disclosure may be obtained from a known database, e.g., GenBank of NCBI, but are not limited thereto. Additionally, the specific details with respect to pheA gene, trpR gene, mtr gene, tnaAB gene, etc. may be found in the disclosures of Korean Patent No. 10-0792095 and Korean Patent Publication No. 10-2013-0082121, and the entirety of the specifications of the same may be included as references of the present disclosure.

    [0031] From the exemplary embodiments of the present disclosure, it was confirmed that, as a result of inactivating the activity of phosphatase in various parent strains, any microorganism of the genus Escherichia producing L-tryptophan, regardless of its parent strain, had significantly improved L-tryptophan productivity when the phosphatase activity was inactivated.

    [0032] In another aspect, the present disclosure provides a method for producing L-tryptophan, comprising culturing the microorganism of the genus Escherichia of the present disclosure producing L-tryptophan, in which the activity of phosphatase comprising an amino acid sequence of SEQ ID NO: 1 is modified to be inactivated, in a medium; and recovering L-tryptophan from the cultured medium or the cultured microorganism.

    [0033] The medium and other culture conditions used for culturing the microorganism of the present disclosure are not particularly limited but any medium used for the conventional cultivation of the microorganism of the genus Escherichia may be used. Specifically, the microorganism of the present disclosure may be cultured in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorous sources, inorganic compounds, amino acids and/or vitamins, etc., in an aerobic condition while adjusting temperature, pH, etc.

    [0034] Examples of the carbon sources to be used in the present disclosure may include carbohydrates such as glucose, fructose, sucrose, maltose, mannitol, sorbitol, etc.; alcohols such as sugar alcohols, glycerol, pyruvate, lactate, citrate, etc.; and amino acids such as organic acid, glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava starch, sugar cane molasses, corn steep liquor, etc., and specifically, carbohydrates such as glucose and sterile pretreated molasses (i.e., molasses converted to a reducing sugar), etc. Furthermore, various other carbon sources in a suitable amount may be used without limitation. These carbon sources may be used alone or in a combination of two or more, but are not limited thereto.

    [0035] Examples of the nitrogen sources to be used in the present disclosure may include inorganic compounds such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or decomposition products thereof, defatted soybean cake or decomposition products thereof, etc. These nitrogen sources may be used alone or in a combination of two or more, but are not limited thereto.

    [0036] Examples of the phosphorus sources to be used in the present application may include potassium phosphate monobasic, dipotassium phosphate dibasic, corresponding sodium-containing salts, etc., but are not limited thereto. Examples of inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, manganese sulfate, calcium carbonate, etc., and additionally, amino acids, vitamins, and/or suitable precursors for a culture medium may be included. These media or precursors may be added to a culture by a batch culture or continuous culture.

    [0037] In the present disclosure, the pH of a culture may be adjusted during the culture by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid to the culture in an appropriate manner. Additionally, during the cultivation, an anti-foaming agent such as a fatty acid polyglycol ester may be used to inhibit the formation of foam. Additionally, oxygen or an oxygen-containing gas may be injected into the culture in order to maintain an aerobic state of the culture; or nitrogen, hydrogen, or carbon dioxide gas may be injected without the injection of a gas in order to maintain an anaerobic or microaerobic state of the culture.

    [0038] The culture temperature may generally be in a range from 27 C. to 40 C., and specifically, from 30 C. to 37 C., but is not limited thereto. The cultivation may be continued until the desired amount of useful materials are obtained, and specifically for from 10 hours to 100 hours, but the cultivation time is not limited thereto.

    [0039] L-Tryptophan may be recovered by a suitable method known in the art, e.g., batch culture, continuous culture, or fed batch culture, etc., according to the cultivation method of the present disclosure.

    [0040] The recovery may also include a step of purification. The step of purification can purify L-tryptophan recovered using a suitable method known in the art.

    MODE FOR INVENTION

    [0041] Hereinbelow, the present disclosure will be described in detail with accompanying exemplary embodiments. However, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

    Example 1: Preparation of yidA-Deficient Wild-Type Strain

    [0042] In the Example, preparation of a strain in which the activity of phosphatase is inactivated from a strain producing L-tryptophan was attempted.

    [0043] In order to enhance the tryptophan productivity in the W3110 strain, an Escherichia coli wild-type strain, i.e., a representative microorganism of the genus Escherichia, the yidA gene encoding phosphatase was deleted by homologous recombination from the W3110 trp2 strain (Korean Patent Publication No. 10-2013-0082121), in which the tryptophan productivity was enhanced and in which the tnaAB gene in the form of an operon of the pheA gene (NCBI gene ID: 12934467) encoding chorismate mutase/prephenate dehydratase (CM-PDT), the tnaA gene (NCBI gene ID: 12933600) encoding tryptophanase, and the tnaB gene (NCBI gene ID: 12933602) encoding a tryptophan importer were deleted.

    [0044] Specifically, for the deletion of the gene, yidA, having the nucleotide sequence of SEQ ID NO: 2, the one-step inactivation method using lambda Red recombinase developed by Datsenko K A et al. was employed (Proc Natl Acad Sci USA, (2000) 97:6640-6645). As a marker for confirming the gene insertion, an rmf promoter was ligated to pUC19 (New England Biolabs (USA)), and the chloramphenicol gene of pUCprmfmloxP obtained by ligating the mutant, loxP-Cm.sup.R-loxP cassette, which was obtained from pACYC184 (New England Biolab), was used (Korean Patent Publication No. 10-2009-0075549).

    [0045] First, primary polymerase chain reaction (hereinafter referred to as PCR) was performed using pUCprmfmloxP as a template and primer combinations of SEQ ID NOs: 3 and 4 having a part of the yidA gene and a partial nucleotide sequence of the chloramphenicol-resistant gene of the pUCprmfmloxP gene under the conditions of 30 cycles of denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 1 minute, thereby obtaining yidA1st (about 1.2 kb), a PCR product. Thereafter, yidA1st (1.2 kb), the PCT product, obtained by PCR was electrophoresed on a 0.8% agarose gel eluted, and then used as a template for secondary PCR. The secondary PCR was performed using the eluted primary PCR product as a template and the primer combinations of SEQ ID NOs: 5 and 6 containing nucleotide sequences of 20 bp of the 5 and 3 regions of the PCR product obtained in the primary PCR under the conditions of 30 cycles of denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 1 minute, thereby obtaining yidA (about 1.3 kb), a PCR product. The thus-obtained PCR product was electrophoresed on a 0.8% agarose gel, eluted, and then used in recombination.

    [0046] E. coli W3110 trp2, which was transformed with a pKD46 vector according to the one-step inactivation method developed by Datsenko K A et al. (Proc Natl Acad Sci USA., (2000) 97:6640-6645), was prepared as a competent strain, and transformation was performed by introducing the gene fragment, yidA (1.3 kb) obtained by primary and secondary PCR. The strains were cultured on the LB medium containing chloramphenicol, and then primary transformants having chloramphenicol resistance were selected.

    [0047] After removal of pKD46 from the thus-obtained primary recombinant strains having chloramphenicol resistance, a pJW168 vector (Gene, (2000) 247, 255-264) was introduced therein so as to remove the chloramphenicol marker gene from the strains (Gene, (2000) 247, 255-264). PCR was performed using primers of SEQ ID NOs: 7 and 8 to obtain a PCR product (about 0.5 kb), indicating that the strains finally obtained had deletion of the yidA gene. The strains having the deletion of such gene were designated as W3110 trp2 yidA.

    [0048] The sequences of the primers used in the Example are listed in Table 1 below.

    TABLE-US-00001 TABLE1 SEQ ID Primer Sequence NO: yidA- aatctacctggggaactcATGgctattaaactcattgcta 3 Cm-F2 tcgatatggaAggTgACACTATAgAACgCg yidA- cgcccacagaTTAattcagcacatacttctcaatagcaaa 4 Cm-R2 cgccacgccaTAgTggATCTgATgggTACC yidA- ggtgttgtactgatttttgagcggaatcgcgttagcatgg 5 F1 gtcaggaaccaatctacctggggaactcAT yidA- gcagtaaaccaataatcagtaagcgggcaaacgcgtttat 6 F1 gctgtttgcccgcccacagaTTAattcagc yidA ATTGATGCGCTCTCACCGCA 7 conF1 yidA GCCTCTGGGTGAATAGTATT 8 conR1

    Example 2: Preparation of Tryptophan-Producing Strain in which Phosphatase is Inactivated

    [0049] In the Example, KCCM11166P (Korean Patent No. 10-1261147), which is an another representative Escherichia coli producing tryptophan, was used as the parent strain, and the yidA gene encoding phosphatase was deleted by homologous recombination in the same manner as described in Example 1.

    [0050] It was confirmed that the strains finally obtained had deletion of the yidA gene due to the PCR product (about 0.5 kb) which was obtained by PCR using the primers of SEQ ID NOs: 7 and 8, and then the strains were designated as CA04-2805.

    Example 3: Evaluation of Tryptophan Productivity in yidA-Deficient Wild-Type Strain

    [0051] In order to compare the tryptophan productivity of W3110 trp2 yidA, prepared in Example 1, and W3110 trp2, which is the parent strain, pCL-Dtrp_att-trpEDCBA and pBAC-Dtrp_att-trpDCBA were introduced into each strain by the transformation method. The introduced vectors were vectors in which the expression of tryptophan operon was enhanced such that tryptophan can be produced in excess because the control mechanism in the tryptophan operon control region was released (Korean Patent Publication No. 10-2013-0082121). The vector-introduced strains were cultured on a tryptophan test medium prepared according to the composition listed in Table 2 below, and their L-tryptophan productivity was compared.

    TABLE-US-00002 TABLE 2 Composition of the tryptophan test medium Concentration (per Composition liter) Glucose 2 g K.sub.2HPO.sub.4 1 g (NH.sub.4).sub.2SO.sub.4 12 g NaCl 1 g Na.sub.2HPO.sub.4H.sub.2O 5 g MgSO.sub.4H.sub.2O 1 g MnSO.sub.4H.sub.2O 15 mg CuSO.sub.4H.sub.2O 3 mg ZnSO.sub.4H.sub.2O 30 mg Sodium citrate 1 g Yeast extract 1 g Phenylalanine 0.15 g pH 6.8

    [0052] One platinum loop of each of the strains cultured overnight on the LB solid medium in an incubator at 37 C. was inoculated into the test medium (25 mL) of Table 2. Thereafter, the resultants were cultured in an incubator at 37 C. and 200 rpm for 48 hours to compare tryptophan concentration (Table 3).

    TABLE-US-00003 TABLE 3 Tryptophan Strain concentration (g/L) W3110 trp2/pCL-Dtrp_att-trpEDCBA, 0.5 pBAC-Dtrp_att-trpDCBA W3110 trp2 yidA/pCL-Dtrp_att- 0.7 trpEDCBA, pBAC-Dtrp_att-trpDCBA

    [0053] The results above showed that the tryptophan productivity in the strain, in which the activity of phosphatase encoded by the gene yidA was inactivated, was increased by 40% as compared with the strain in which the activity of phosphatase was not inactivated. Therefore, it was confirmed that the tryptophan productivity could be improved by inactivation of phosphatase encoded by yidA. From such results, it can be interpreted that the degradation of E4P, an important precursor for tryptophan biosynthesis, was inhibited, and thereby the E4P concentration in the cells was maintained. As a result, energy that is unnecessarily wasted is preserved and used in the tryptophan biosynthesis.

    Example 4: Evaluation of Tryptophan Productivity in yidA-Deficient Strain

    [0054] In order to measure the tryptophan titer of the yidA-deficient strain (CA04-2805) prepared in Example 2 and the parent strain (KCCM11166P), the strains were cultured in the tryptophan titer medium prepared according to the compositions listed in Table 4, and then improvement of L-tryptophan production efficiency was confirmed.

    TABLE-US-00004 TABLE 4 Composition in tryptophan titer medium Concentration (per Composition liter) Glucose 60 g K.sub.2HPO.sub.4 1 g (NH.sub.4)2SO.sub.4 10 g NaCl 1 g MgSO.sub.47H.sub.2O 1 g Sodium citrate 5 g Yeast extract 2 g Calcium carbonate 40 g Phenylalanine 0.15 g Tyrosine 0.1 g pH 6.8

    [0055] One platinum loop of each of E. coli KCCM11166P and E. coli CA04-2805 cultured overnight on the LB solid medium in an incubator at 37 C. was inoculated into the titer medium (25 mL) of Table 4. Thereafter, the resultants were cultured in an incubator at 37 C. and 200 rpm for 48 hours to compare glucose consumption rate and tryptophan concentration.

    [0056] As a result, as described in Table 5 below, it was confirmed that the tryptophan concentration of CA04-2805, the strain in which the activity of phosphatase encoded by the yidA gene was inactivated, was increased by about 10% compared to that of KCCM11166P, the parent strain which was a control.

    TABLE-US-00005 TABLE 5 Tryptophan Strain concentration (g/L) KCCM11166P 7.48 CA04-2805 8.23

    [0057] The present inventors have confirmed that the KCCM11166P-based strain, which is the yidA-deficient strain in which the activity of phosphatase was inactivated, has an improved tryptophan-producing ability, and named the strain as CA04-2805 or CA04-2805 (KCCM11166P_yidA) and deposited it to the KCCM on Dec. 5, 2014, where it was assigned the deposit number KCCM11636P.

    [0058] The results above suggest that in the microorganism of the present disclosure of the genus Escherichia producing tryptophan, the strain which inactivates the phosphatase activity can improve the L-tryptophan-producing ability compared to unmodified strain to be inactivated.

    [0059] While the present disclosure has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present invention may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure is defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the appended claims.