COMPOSITIONS AND METHODS FOR IDENTIFYING METABOLICALLY ACTIVE AGENTS
20180128812 ยท 2018-05-10
Inventors
- Joseph T. Bass (Winnetka, IL, US)
- Clara Bien Peek (Chicago, IL, US)
- Akihiko Taguchi (Chicago, IL, US)
- Mark Perelis (Evanston, IL, US)
- Biliana Marcheva (Evanston, IL, US)
Cpc classification
C12Q1/6897
CHEMISTRY; METALLURGY
G01N33/5008
PHYSICS
C12N5/0658
CHEMISTRY; METALLURGY
G01N2800/042
PHYSICS
International classification
G01N33/50
PHYSICS
Abstract
The present invention relates to cells with altered cell cycle control. In particular, the present invention provides cells with altered cell cycle control and uses of such cells to identify metabolically active agents.
Claims
1-21. (canceled)
22. A plurality of immortalized or primary beta cells, wherein said beta cells lack a functional Bmal1 gene.
23. The beta cells of claim 22, wherein said Bmal1 gene comprises a deletion of at least a portion of said gene.
24. The beta cells of claim 22, wherein said cells further comprise a reporter gene that reports the level of insulin secretion.
25. The beta cells of claim 24, wherein said reporter gene expresses a fluorescent marker in response to cleavage of proinsulin.
26. The beta cells of claim 25, wherein said fluorescent marker is luciferase.
27. The beta cells of claim 24, wherein said reporter gene is present on a plasmid.
28. The beta cells of claim 22, wherein said cells lack glucose-stimulated insulin secretion or exhibit impaired glucose-stimulated insulin secretion.
29. The beta cells of claim 22, wherein said beta cells are in vitro, ex vivo, or in vivo in a non-human mammal.
30. A kit or system, comprising: (a) the beta cells of claim 22; and (b) glucose.
31. A method of screening for compounds that alter insulin secretion, comprising: a) contacting the beta cells of claim 22, with a test compound and glucose; and b) measuring the level of insulin secretion in said beta cells in the presence and absence of said test compound.
32. The method of claim 31, wherein test compounds that restore said insulin secretion are identified.
33. A plurality of immortalized or primary myoblasts, wherein said myoblasts lack a functional Bmal1 gene.
34. The myoblasts of claim 33, wherein said Bmal1 gene comprises a deletion of at least a portion of said gene.
35. The myoblasts of claim 33, wherein said myoblasts are in vitro, ex vivo, or in vivo in a non-human mammal.
36. The myoblasts of claim 33, wherein said myoblasts exhibit impairs oxygen consumption and/or extracellular lactate production.
37. The myoblasts of claim 33, wherein said myoblasts exhibit reduced hypoxia induced HIF1 accumulation.
38. A method of screening for compounds that alter oxygen consumption, comprising: a) contacting the myoblasts of claim 33 with a test compound; and b) measuring the level of oxygen consumption said myoblasts in the presence and absence of said test compound.
39. The method of claim 38, wherein test compounds that restore oxygen consumption are identified.
40. The method of claim 38, further comprising contacting said myoblasts with glucose.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
DEFINITIONS
[0043] As used herein, the terms pancreatic lineage cells or cells of the pancreatic lineage refer to any endocrine (e.g., alpha cells, beta cells, delta cells, PP cells, epsilon cells, etc.) or exocrine cells that comprise the pancreas, or the precursor cells (e.g., progenitor cells, intermediate development cells, etc.) that are committed to a pancreatic cell lineage.
[0044] As used herein, the terms pancreatic beta cells, islet beta cells, or beta cells refer to monohormonal, pancreatic lineage, endocrine cells located in the islets of Langerhans of the pancreas. Beta cells are capable of secreting insulin in response to elevated glucose concentrations (e.g., glucose-responsive) and express markers, including, but not limited to, insulin and pdx1.
DETAILED DESCRIPTION
[0045] The present invention relates to cells with altered cell cycle control. In particular, the present invention provides cells with altered cell cycle control and uses of such cells to identify metabolically active agents.
[0046] Intrinsic molecular circadian clock genes in the beta cell are new targets for diabetes therapeutics since they act as regulators of insulin secretion (Nature 2010; Science 2015), representing a novel pathway to intervene in conditions of diabetes caused by altered sleep-wake cycles, shiftwork, and jetlag, in addition to other common forms of the disease. A central theme in the approach to developing diabetes drugs stems from the discovery described herein that the molecular clock plays an essential role in beta cell function and insulin secretion. Using conditional gene targeting in mice and genomic profiling in mouse and human beta cells, a genetic map through which the molecular clock controls insulin secretion and survival in the beta cell was developed. Further experiments demonstrated that acutely disrupting circadian genes causes impaired insulin secretion and triggers the rapid onset of diabetes. Moreover, genetic mapping shows that heritable variants in the molecular clock are associated with human glucose metabolism, further indicating that manipulation of the clock pathway may have general implications for diabetes therapeutics in man (Dupuis et al, Nature Genetics). Further provided herein are immortalized beta cell lines that enable the discovery of new small molecule drugs to restore insulin secretion in the context of circadian clock gene disruption (e.g., using CRISPR-CAS9 gene editing) and a bioluminescent insulin Nanoluc reporter of endogenous insulin secretion. The Insulin Nanoluc reporter enables high throughput screening using insulin as an endpoint at significant time and cost savings compared with traditional immunoassay approaches. Given the strong association between circadian rhythm dysregulation and human diabetes, it is contemplated that this chemical genetics approach reveals new bioactive molecules that promote functional beta cell compensation in obesity-associated nutrient stress and insulin resistance. While the primary screening endpoint is insulin secretion, it was also found that the clock gene network promotes beta cell growth and survival in mice and as such it is contemplated that molecules enhancing insulin secretion also protect from injury and enhance regeneration. Experiments described herein identified small molecules that enhance insulin secretion in the setting of impaired molecular clock function.
[0047] Accordingly, provided herein are a plurality of immortalized or primary beta cells or myoblasts, wherein the beta cells or myoblasts lack a functional Bmal1 gene. In some embodiments, the beta cells are in vitro (e.g., immortalized cell lines), ex vivo, or in vivo in a non-human mammal. In some embodiments, the cells lack glucose-stimulated insulin secretion. In some embodiments, the cells exhibit impaired glucose-stimulated insulin secretion.
[0048] The Bmal1 deficient cells described herein find use in research, screening, and therapeutic applications. Exemplary applications are described herein.
[0049] In some embodiments, the cells further comprise a reporter gene that reports the level of insulin secretion. In some embodiments, the reporter gene expresses a fluorescent or bioluminescent marker (e.g., luciferase) in response to cleavage of proinsulin. In some embodiments, the reporter gene is present on a plasmid. In some embodiments, the plasmids described herein (e.g., Proinsulin-NanoLuc constructs) are utilized.
[0050] In some embodiments, cells are provided in the form of a composition, kit or system, comprising the cells described herein. In some embodiments, compositions, kits, and systems further comprise one or more of controls (e.g., insulin secretion control), glucose, buffers, analysis components (e.g., computer software, computer processor, or display screen), test compounds, and the like.
[0051] In some embodiments, the present invention provides methods of screening for compounds (e.g., compounds that find use in the treatment and prevention of diabetes and associated metabolic disorders). In some embodiments, screening methods are comprise contacting the cells described herein (e.g., beta cells or myoblasts that lack functional Bmal1 genes) with a test compound and optionally glucose. Test compounds that alter insulin secretion and/or oxygen consumption are identified (e.g., using insulin report cassettes or the methods described in example 3 below). In some embodiments, the screening is high-throughput screening.
[0052] Embodiments of the present invention provide compounds identified by the methods described herein. In some embodiments, such compounds find use in the treatment of diabetes and related disorders.
[0053] Embodiments of the present invention further provide pharmaceutical compositions (e.g., comprising one or more of the therapeutic agents described above). The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Compositions and formulations for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
[0054] Compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
[0055] Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids.
[0056] The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
[0057] The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the active agents of the formulation.
[0058] In some embodiments, methods of treating and preventing diabetes and/or related disorders are provided (e.g., utilizing compositions identified using the screening methods described herein). Dosing is dependent on severity and responsiveness of the disease state or condition to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. In some embodiments, treatment is administered in one or more courses, where each course comprises one or more doses per day for several days (e.g., 1, 2, 3, 4, 5, 6) or weeks (e.g., 1, 2, or 3 weeks, etc.). In some embodiments, courses of treatment are administered sequentially (e.g., without a break between courses), while in other embodiments, a break of 1 or more days, weeks, or months is provided between courses. In some embodiments, treatment is provided on an ongoing or maintenance basis (e.g., multiple courses provided with or without breaks for an indefinite time period). Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient. The administering physician can readily determine optimum dosages, dosing methodologies and repetition rates.
[0059] In some embodiments, dosage is from 0.01 g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly. The treating physician can estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
EXPERIMENTAL
Example 1
Pancreatic Cell Enhancers Regulate Rhythmic Transcription of Genes Controlling Insulin Secretion
Materials and Methods
Animals
[0060] Male wild-type C57BL/6J mice were purchased from the Jackson Laboratory. Per2Luc (12) and PdxCre; Bmal1flx/flx (6) mice were produced and maintained on a C57BL/6J background at the Northwestern University Center for Comparative Medicine. Bmal1flx/flx mice (47) were crossed with PdxCreER transgenic mice (kindly provided by D. Melton, Harvard University) (48) to generate PdxCreER; Bmal1flx/flx mice, as well as Bmal1flx/flx and PdxCreER littermate controls. Unless otherwise stated, mice were maintained on a 12:12 light:dark (LD) cycle with free access to regular chow and water. All animal care and use procedures were conducted in accordance with regulations of the Institutional Animal Care and Use Committee at Northwestern University.
Islet Isolation, Insulin Secretion Assays, and In Vitro Islet Synchronization
[0061] Mouse pancreatic islets were isolated via bile duct collagenase digestion (Collagenase P, Sigma) and Ficoll gradient separation and left to recover overnight (16 hours) at 37 C. in RPMI 1640 with 10% fetal bovine serum (FBS), 1% 1-glutamine, and 1% penicillin/streptomycin. For standard insulin release assays, five islets were statically incubated in Krebs-Ringer buffer (KRB) and stimulated for 1 hour at 37 C. with various glucose concentrations, 30 mM KCl, 2.5 M forskolin, 1 mM 8-Br-cAMP, 10 mM 1-leucine+2 mM 1-glutamine, 1 mM carbachol, 10 M PMA, or 10 M ionomycin. Supernatant was collected and assayed for insulin content by enzyme-linked immunosorbent assay (ELISA; Crystal Chem Inc.). Islets were then sonicated in acid-ethanol solution and solubilized overnight at 4 C. before assaying total insulin content by ELISA. For rhythmic insulin release assays, islets were first synchronized with 10 M forskolin (Sigma) for 1 hour and allowed to recover for 16 hours. Insulin secretion assays were then performed as above in individual groups of five islets every 4 hours for 72 hours (
LumiCycle Analysis
[0062] Approximately 2 hours before the start of the dark period (i.e., lights off), 100 to 150 pancreatic islets were isolated from Per2Luc mice as described above. Islets were cultured on tissue culture membranes (Millipore) in Dulbecco's modified Eagle's medium (DMEM; Gibco, 1.2 ml) containing sodium bicarbonate (352.5 g/ml), 10 mM HEPES (Gibco), 2 mM 1-glutamine, 2% B-27 serum-free supplement (Invitrogen), penicillin (25 U/ml), streptomycin (Gibco, 20 g/ml), and 0.1 mM luciferin sodium salt (Biosynth AG). Sealed cultures were placed at 37 C. in a LumiCycle luminometer (Actimetrics) and bioluminescence from tissues was recorded continuously. After several days in culture, islets were synchronized by 10 M forskolin (Sigma) treatment for 1 hour followed by incubation in fresh media. Period was calculated via a modified best-fit sine wave analysis using LumiCycle analysis software (Actimetrics).
Measurement of Islet Oxygen Consumption
[0063] After bile duct collagenase digestion, 40 purified pancreatic islets were plated in wells of a 96-well respirometry plate (Seahorse Bioscience) and cultured overnight in complete medium. The next day, culture medium was replaced with assay buffer containing 3 mM glucose, 0.8 mM Mg2+, 1.8 mM Ca2+, 143 mM NaCl, 5.4 mM KCl, 0.91 mM NaH2PO4, and phenol red (Seahorse Bioscience; 15 mg/ml) and allowed to equilibrate at 37 C. in a CO2-free incubator for 1 to 2 hours. The plate was then loaded into a Seahorse XF96 instrument, and the oxygen consumption rate (OCR) was measured for four sequential 3-min intervals at basal conditions and after injection of glucose (20 mM final concentration), oligomycin (FiFO ATP synthase inhibitor) (5 M final concentration), and antimycin A (complex III inhibitor) (5 M final concentration). OCR values given represent the average of four sequential measurements. Mitochondrial oxygen consumption was calculated by subtracting OCR values after antimycin A treatment (representing nonmitochondrial oxygen consumption).
RNA Isolation and qPCR mRNA Quantification
[0064] Islets were added to microfuge tubes containing Tri Reagent (Molecular Research Center Inc.) and frozen at 80 C. RNA was isolated according to the manufacturer's protocol and purified using RNeasy columns (Qiagen). cDNAs were then synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time quantitative polymerase chain reaction (qPCR) analysis was performed with SYBR Green Master Mix (Applied Biosystems) and analyzed using an Applied Biosystems 7900 Fast Real-Time PCR System. Relative expression levels were determined using the comparative CT method to normalize target gene mRNA to Gapdh. Exon-specific primer sequences for qPCR were as follows: Bmal1 exons 5 to 7, forward, 5-ATCGCAAGAGGAAAGGCAGT-3 (SEQ ID NO: 2); reverse, 5-ATCCTTCCTTGGTGTTCTGCAT-3(SEQ ID NO: 3). Bmal1 exons 7 to 9, forward, 5-AGGCCCACAGTCAGATTGAA-3(SEQ ID NO: 4); reverse, 5-TGGTACCAAAGAAGCCAATTCAT-3(SEQ ID NO: 5). Bmal1 exon 8, forward, 5-GGCGTCGGGACAAAATGAAC-3(SEQ ID NO: 6); reverse, 5-TCTAACTTCCTGGACATTGCAT-3(SEQ ID NO: 7). Bmal1 exons 8 and 9, forward, 5-TGCAATGTCCAGGAAGTTAGAT-3(SEQ ID NO: 8); reverse, 5-TGGTGGCACCTCTCAAAGTT-3(SEQ ID NO: 9). Bmal1 exons 10 to 12, forward, 5-TAGGATGTGACCGAGGGAAG-3(SEQ ID NO: 10); reverse, 5-AGCTCTGGCCAATAAGGTCA-3(SEQ ID NO: 11).
RNA Sequencing and Analysis
[0065] After RNA isolation (described above), RNA quality was assessed using a Bioanalyzer (Agilent), and sequencing libraries were constructed using an Illumina TruSeq Stranded mRNA sample prep kit LT (Illumina, RS-122-2101) according to the manufacturer's instructions. Libraries were quantified using both a Bioanalyzer (Agilent) and qPCR-based quantification (Kapa Biosystems) and sequenced on either an Illumina HiSEq 2000 or NextSEq 500 instrument to a depth of at least 30 million reads using 100-base pair (bp) or 75-bp paired-end reads, respectively.
[0066] For differential expression comparison between PdxCre; Bmal1flx/flx and Bmal1flx/flx islets, RNA raw sequence reads were aligned to the reference genome (mm10) using STAR version 2.3.1s_r366 (49). Differentially expressed RNAs were identified using DESEq 2 version 1.6.3 (50) (FDR-adjusted P<0.05).
[0067] For cycling RNAs, raw sequence reads were similarly aligned using STAR (mm10 index for mouse and hg19 for human), and uniquely mapped reads (tags) were normalized using the algorithm used in DESEq 2 (50). The geometric mean of the raw read counts was calculated for each gene. A normalization factor was calculated for each sample using the median of the raw read counts of each gene divided by the geometric mean of the gene. The normalized read counts were computed by dividing the raw read counts by the normalization factor. The normalized tags for the mouse and human time series were separately concatenated and z-scored within each gene (14). Rhythm detection of the z-scored and normalized counts was performed with empirical JTK_CYCLE with asymmetry search, which increases sensitivity of detecting cycling transcripts by extending comparisons to reference waveforms beyond cosines, including arbitrary asymmetric waveforms that better represent expression patterns seen in biological data. Rhythmic time series were examined with reference waveforms with a period of 24 hours; a phase of 0, 4, 8, 12, 16, or 20; and an asymmetry of 4, 12, or 20. Because of the small number of waveforms compared, the Bonferroni correction was used instead of the empirical P values. Genes with a Bonferroni-adjusted P value below 0.05 were considered to be rhythmic.
[0068] For KEGG ontology term enrichment (51, 52), Ensembl gene IDs were supplied and analyzed using Homer (version 4.7.2) command findGO (53). Genes exhibiting rhythmic mRNA accumulation in vivo in liver were derived from reported exon cycling transcripts (9). cell culture
[0069] Beta-TC6 cells were purchased from ATCC (CRL-11506) and cultured in DMEM supplemented with 15% FBS, 1% 1-glutamine, and 1% penicillin/streptomycin. All cells used in experiments were at fewer than 15 passages.
Mouse BMAL1 and CLOCK Polyclonal Antibody Generation
[0070] Guinea pig anti-mouse BMAL1 and CLOCK polyclonal antibodies were generated using a 37- and 39-amino acid peptide fragment of the mouse BMAL1 and CLOCK proteins, respectively (RS synthesis). Guinea pigs were immunized with KLH-conjugated peptides (Pocono Farms), and BMAL1- and CLOCK-specific antibodies were affinity-purified from whole serum using resin cross-linked with antigen peptides (Pierce).
Chromatin Immunoprecipitation (ChIP)
[0071] Beta-TC6 cells (40 to 160 million) were fixed for 30 min in 2 mM disuccinimidyl glutarate and for 10 min in 1% formaldehyde and then either frozen at 80 C. or processed immediately. Nuclei were isolated in buffer containing 1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.0), and protease inhibitors and sonicated using a Diagenode Bioruptor to shear chromatin into 200- to 1000-bp fragments. Protein-DNA complexes were incubated with antibodies against BMAL1 and CLOCK (affinity-purified guinea pig IgGs as described above), H3K4Me2 (Abcam), H3K27Ac (Active Motif), H2AZ (Active Motif), or PDX1 (Novus Biologicals) and immunoprecipitated with IgG paramagnetic beads (Invitrogen). Eluted chromatin was isolated using MinElute PCR purification columns (Qiagen).
ChIP Sequencing and Analysis
[0072] Sequencing libraries were generated using KAPA DNA Library Preparation kits (Kapa Biosystems, KK8504) according to manufacturer's instructions. Library concentrations were assessed by both a Bioanalyzer (Agilent) and qPCR-based quantification (Kapa Biosystems). Libraries were sequenced using 75-bp single-end reads on an Illumina Next-SEq 500 instrument to a depth of >10 million mapped reads.
[0073] Raw sequence reads were aligned to the mm10 reference genome and displayed using UCSC annotated genes using bowtie version 1.1.1 (54) with parameters -best and -m 1 to ensure reporting of uniquely mapped reads (tags). ChIP-seq peaks were designated as regions with a factor of 4 enrichment over both the input sample and the local background and were normalized to 10 million reads using default parameters for the Homer findPeaks command (53) and specifying -style factor for BMAL1, CLOCK, and PDX1 and -style histone for H2A.Z, H3K4Me2, and H3K27Ac. For BMAL1 and CLOCK peaks, promoter binding was defined as peaks occurring within 2 kb of the nearest gene TSS, and distal binding was defined as those occurring greater than 2 kb from a nearest TSS.
[0074] To identify consensus motifs for BMAL1 and CLOCK, 50-bp windows surrounding transcription factor peaks we scanned using findMotifsGenome.pl with standard background (random genomic sequences sampled according to GC content of peak sequences). The occurrence of tandem E-boxes with variable-length spacing was identified by generating synthetic canonical E-box motifs separated by the indicated number of random spacers (i.e., CACGTGNNNCACGTG=3 spacers (SEQ ID NO: 12)) using seq2profile.pl allowing for two mismatches and testing for their occurrence at BMAL1 and CLOCK peaks using annotatePeaks.pl.
[0075] Fastq files for all BMAL1 and H3K27Ac ChIP-seq were downloaded from the ENA server (study accession number SRP014752) and raw sequence reads for 12 sequential time points were concatenated into a single file. Alignments and peak calling were performed using bowtie and Homer as described above. Shared BMAL1 binding sites were identified by comparing binding locations between cells and liver using the Homer command mergePeaks and specifying -d 200, which identified peaks occurring within 200 bp as shared across tissues.
Tamoxifen Treatment
[0076] For in vivo delivery of tamoxifen (Sigma, dissolved in corn oil), mice received three intraperitoneal (i.p.) injections of 200 g tamoxifen/g body weight, administered every other day. Subsequent experiments were conducted 10 to 14 days after tamoxifen treatment. For in vitro administration of tamoxifen, isolated islets were incubated for 24 hours with 1 mM tamoxifen (dissolved in ethanol) prior to transfer to complete media for 24 hours to recover. Islets were then synchronized with forskolin prior to insulin secretion assays as described above.
Immunohistochemical Analysis
[0077] Mice were anesthetized with i.p. injection of phenobarbital (Nembutal, 50 mg/ml) and perfused with heparinized saline, followed by 4% paraformaldehyde (PFA) (Sigma) in PBS. Brain and pancreas were removed and post-fixed with 4% PFA overnight at 4 C. Brain tissues were then cryoprotected in 30% sucrose (Sigma), frozen in O.T.C. (Tissue Tek), and 30-m brain sections collected for antibody staining. Pancreata were embedded in paraffin, and blocks of 6-m sections were mounted on slides. The following primary antibodies were used for staining: guinea pig anti-insulin (1:500, DAKO), mouse anti-glucagon (1:500, Sigma), and rabbit anti-BMAL1 (1:500, Novus Biological). Triple staining was visualized with the following secondary antibodies: AMCA goat anti-guinea pig (1:400, Jackson ImmunoResearch), Alexa Fluor 488-conjugated goat anti-mouse (1:400, Invitrogen), and Alexa Fluor 546-conjugated goat anti-rabbit (1:400, Life Technologies). Nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI) as indicated. Images were acquired with PictureFrame 1.0 using a Zeiss Axioskop 50. cell mass was assessed by morphometric analysis of insulin immunostained pancreatic sections (DAKO; Histomouse Plus kit, Life Technologies). Four pancreatic sections, spaced 50 m apart, were stained for each animal, and endocrine versus total pancreas area was calculated using Image-Pro Premier software (Media Cybernetics) using the smart segmentation feature.
Glucose and Insulin Measurements and Glucose Tolerance Tests
[0078] Blood glucose and plasma insulin levels in ad libitum-fed mice were assessed at ZT2 and ZT14 from tail vein bleeds. Glucose tolerance tests were performed in mice after a 14-hour fast, and blood glucose and plasma insulin levels were measured at the indicated times after i.p. glucose injection of either 2 or 3 g/kg body weight, respectively. Plasma insulin levels were measured by ELISA.
Behavioral Analysis
[0079] Locomotor activity was analyzed in 2- to 4-month-old pancreas-specific Bmal1 knockout mice and their respective littermate controls after tamoxifen treatment. All animals were individually housed in standard mouse cages equipped with running wheels and allowed free access to food and water. Mice were placed in a 12:12 LD cycle for 14 days, followed by 14 days in constant darkness (DD). Total activity data was recorded and analyzed in 6-min bouts using ClockLab software (Actimetrics). The free-running period was determined as the duration of time between the major activity periods on consecutive days in DD. Period was calculated using a .sup.2 periodogram for days 7 to 14 in DD. Food consumption was analyzed in pancreas-specific Bmal1 knockout mice and their littermate controls before and after tamoxifen treatment. All animals were individually housed with free access to water and regular chow. Daytime and nighttime food consumption was determined by manual measurement of food at both ZT0 and ZT12 for three consecutive days.
Intracellular Calcium Determination
[0080] BetaTC-6 cells were plated at a density of 100,000 cells per well in black 96-well plates with clear bottoms and cultured overnight at 37 C. and 5% CO2. Islets were dispersed to single cells by incubating in 0.05% Trypsin-EDTA at 37 C. for 3 min and plated at a density of 100 islets per well in laminin-treated black 96-well plates with clear bottoms and cultured in complete media for 48 hours at 37 C. and 5% CO2. Cells were then washed with BSA-free KRB buffer with no glucose and loaded with 5 M Fura-2 (Invitrogen) and 0.04% Pluronic F-127 (Invitrogen) for 30 min at 37 C. Following a wash with BSA-free KRB, Fura-2 intensity was measured after injection of either glucose or ionomycin (Sigma) to final concentrations of 20 mM or 10 M, respectively. Cells were alternately excited with 340- and 380-nm light, and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (Bio Tek) at sequential 30-s intervals. Raw fluorescence data were exported to Microsoft Excel and expressed as the 340/380 ratio for each well.
Results
The Cell Clock Produces Rhythmic Insulin Secretion and Secretory Gene Transcription
[0081] First, to determine whether transcriptional oscillations in pancreatic islets give rise to rhythmic islet physiology, the phase dependence of pancreatic islet function was determined by analyzing nutrient-induced insulin secretion in parallel with live-cell clock oscillation in islets from Per2Luc reporter mice (12). After synchronization with forskolin (6, 13), insulin secretion was assessed every 4 hours in individual groups of five islets at each time point over the ensuing 72-hour window (
[0082] The genome-wide effect of rhythmic transcription on insulin secretory dynamics was examined by performing RNA sequencing (RNA-seq) over two circadian cycles in RNA isolated from wild-type islets synchronized ex vivo (
[0083] To determine the identity of functional circadian gene networks in the islet, overrepresentation of defined KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways among rhythmic RNAs were identified. Enrichment of factors mediating vesicle exocytosis was observed, which indicates that daily variation in insulin secretory capacity arises from genomic regulation of the transport and release of peptidergic hormone (
[0084] To further understand the physiologic function of tissue-specific rhythmic gene transcription, genome-wide rhythms of RNA expression in wild-type islets were compared to those in pancreas-specific clock mutant mice (PdxCre; Bmal1flx/flx), which exhibit severe hypoinsulinemic diabetes due to defects downstream of glucose metabolism and mitochondrial respiration (
[0085] Many of the RNAs that were altered in islet clock knockout mice were identified as cycling RNAs in wild-type islets; overall, a total of 720 oscillating genes exhibited altered expression in animals with disrupted pancreatic clock function (
[0086] To determine whether the rhythmic islet transcriptome is conserved from mouse to humans, RNA-seq was performed in RNA isolated from synchronized human islets (
BMAL1 and CLOCK Bind Near Cell Type-Specific Enhancers in Pancreatic Cells
[0087] Because genome-wide RNA sequencing studies indicate that genomic regulation by the clock gives rise to rhythmic insulin secretion, it was next analyzed how core circadian transcription factors regulate this process by analyzing the extent of binding by BMAL1 and CLOCK to rhythmically expressed genes. In this context, cistrome studies have recently characterized cell transcriptional hubs encoding genes that program both development and function (31), revealing colocalization within regions of accessible chromatin (H2A.Z) and active enhancers [monomethylated histone 3 Lys4 (H3K4Mel) colocalized with acetylated histone 3 Lys27 (H3K27Ac)] containing binding sites for lineage-determining transcription factors (PDX1, MAFB, FOXA2, NKX6-2, and NKX2-2) (31-33). To determine the intersection between circadian transcription factor regulation and genomic binding at regulatory loci, chromatin immunoprecipitation sequencing was performed (ChIP-seq) in the mouse cell line Beta-TC6 (
[0088] To determine whether BMAL1 and CLOCK directly regulate the oscillating transcripts identified in the synchronized wild-type islets (
BMAL1 Binds to Distinct Enhancers in Liver and Pancreatic Cells
[0089] Given evidence for tissue-specific regulation at enhancers as a predominant mode of circadian regulation in liver (10), the binding position of BMAL1 and CLOCK in relation to the TSS of rhythmic genes in cells was examined. Because genome-wide promoter activity studies and epigenetic characterization of mammalian regulatory regions have indicated that the majority of core promoter activity is localized within 2 kb of the TSS (35-37), binding events occurring within 2 kb of the nearest annotated gene TSS were classified as promoter-proximal. IT was found that BMAL1 and CLOCK bind predominantly at distal sites (defined as greater than 2 kb from the TSS) rather than at proximal promoter sites (defined as less than 2 kb from the TSS) of rhythmically regulated genes (
[0090] Although clock factors have been shown to exert distinct physiologic functions across tissues, a major gap remains in understanding the underlying genomic mechanisms accounting for these tissue-specific functions. To determine whether BMAL1 regulates rhythmic genes through unique sites in the cell compared to liver, the tissue in which the circadian cistrome has been best characterized (9-11, 34, 38), sites of BMAL1 occupancy in the cells were compared to a published set of liver BMAL1 peaks (9). Unexpectedly, although there was a considerable overlap of genes identified as direct BMAL1 binding targets in cells and liver (40%, 1063 genes out of 2660 total cell target genes) (
[0091] Because BMAL1 predominantly bound at distal regulatory regions in islets that were divergent from liver, the chromatin regulatory context at all cycling genes in cells was examined by defining all regulatory regions at cycling loci using dimethylated histone 3 Lys4 (H3K4Me2) peaks within 2 kb of the TSS (promoter) and more than 2 kb from the TSS (enhancer) (
Cell Clock Disruption During Adulthood Impairs Insulin Secretion and Causes Diabetes
[0092] To test the hypothesis that clock genes modulate genome-wide transcription on a daily basis throughout adult life, the impact of acute clock inhibition on glucose metabolism in PdxCreER; Bmal1flx/flx mice at 2 to 3 months of age after administration of tamoxifen was examined, which abrogates BMAL1 expression exclusively within the cell (
[0093] It was further found that islets isolated from tamoxifen-treated PdxCreER; Bmal1flx/flx mice secreted significantly less insulin relative to littermate controls when exposed to (i) 20 mM glucose; (ii) 10 mM leucine combined with 2 mM glutamine, which bypasses glycolysis to trigger mitochondrial adenosine triphosphate (ATP) production; or (iii) 30 mM KCl, which chemically closes the KATP channel, thus inducing membrane depolarization distal to glucose metabolism and an increase in cytosolic calcium (
[0094] The response to Gq-type GPCR signaling was tested by stimulating islets with the muscarinic agonist carbachol, the diacylglycerol (DAG) mimetic phorbol 12-myristate 13-acetate (PMA), and the Ca2+ ionophore ionomycin. Carbachol and PMA restored insulin secretion in PdxCreER; Bmal1flx/flx islets (
[0095] This example describes the genome-wide basis of coordinated cross-tissue circadian oscillation through integrated studies of cell physiology and cistrome regulation. Pancreatic cells were studied as a paradigm of peripheral clock regulation of metabolism because clock disruption in the islet leads to severe hypoinsulinemic diabetes and has direct application to understanding human tissue rhythms and disease. Although the circadian system functions as a hierarchy in the intact animal, the results reveal organ-autonomous cycles of nutrient-coupled insulin secretion in isolated islets ex vivo that result in a high amplitude in maximal glucose responsiveness, showing that the clock primes insulin secretion within limited windows each day. It was further found that circadian-driven transcriptional oscillation within pancreas drives daily waves of expression of genes involved in the biogenesis, transport, and signal-induced activation of peptide exocytosis, indicating that genomic rhythmicity gives rise to tissue-specific function of the clock. The observations suggest that autonomous transcription cycles enable islet cells to anticipate diurnal changes in the demand for insulin.
[0096] Cistromic profiling within the cell provides further insight into the regulation of tissue-specific genome oscillation. CLOCK and BMAL1 bind predominantly within distal tissue-specific enhancers rather than the promoters of cycling genes in proximity to H3K4Me2-, H2A.Z-, and H3K27Ac-modified nucleosomes that are co-occupied by PDX1. Consistent with tissue specificity in enhancer selection across cell types, BMAL1 binding in islet cells was highly divergent from liver, even within shared cycling target genes across the two tissues. These findings indicate that the establishment of accessible chromatin domains during development is a critical determinant of the available regulatory sites for clock-mediated transcription across distinct cell types.
[0097] Finally, studies using chemically inducible genetic clock inactivation demonstrate that inhibition of circadian signaling in differentiated cells acutely blocks peptide exocytosis and leads to hypoinsulinemic diabetes, providing evidence that clock function throughout adult life is necessary for glucose constancy. It is contemplated that cell-autonomous genomic rhythms may regulate peptidergic secretion across diverse secretory and neuronal cell types, coordinating the availability of signaling molecules with the sleep/wake cycle each day. Furthermore, given the association between circadian and sleep disruption with human metabolic disease in both clinical (44, 45) and genetic (46) studies, the finding that circadian transcription is conserved in human islets suggests that clock dysregulation in cells may contribute to the pathogenesis of human diabetes. The demonstration of coordinated circadian genomic and physiologic rhythms in pancreatic p cell insulin exocytosis and its control by enhancers provides a new window to understanding how geophysical and physiologic time are transcriptionally coupled, and how errors in this process may contribute to diabetes and other metabolic disorders.
TABLE-US-00001 TABLE 1 Target Genes Genes -log.sub.10 P in in Fraction of KEGG Term value Term Term Targets Gene Symbol Cycling in wild type islets Circadian rhythm 14.2992954 30 17 0.013832384 Nr1d1, Prkaa2, Clock, Rorc, Rbx1, Npas2, Creb1, Rorb, Fbxw11, Per2, Rora, Per3, Prkag2, Arntl, Btrc, Prkaa1, Cry1 Insulin secretion 10.86222887 86 22 0.017900732 Cacna1c, Atf2, Chrm3, Atf4, Prkacb, Slc2a2, Camk2g, Prkcb, Prkx, Plcb1, Prkca, Cacna1d, Kcnn4, Gnaq, Creb1, Creb3, Plcb4, Pclo, Kcnn3, Atp1b2, Rims2, Stx1a SNARE interactions 10.86222887 33 16 0.013018714 Sec22b, Gosr1, in vesicular Vti1b, Vamp8, transport Vamp5, Stx8, Ykt6, Vamp1, Bnip1, Vti1a, Vamp4, Stx17, Use 1, Stx16, Stx4a, Stx1a COPII complex 7.449579942 11 7 0.005695688 Sar1b, Sar1a, Sec31b, Sec24b, Sec31a, Sec24a, Sec13 Phosphatidylinositol 6.130040566 81 24 0.019528072 Calm1, Synj2, signaling system Plcd1, Dgke, Pikfyve, Inpp5k, Itpr2, Inpp5e, Prkcb, Plcb1, Prkca, Plcg1, Calm2, Pi4ka, Dgkh, Impa2, Ocrl, Pip5k1b, Itpr1, Plcb4, Inpp4a, Plcd3, Pik3r3, Synj1 MAPK Signaling 5.435454827 253 58 0.04719284 Rps6ka4, Il1r1, pathway Atf4, Map2k5, Prkacb, Pdgfa, Prkx, Taok1, Cacna1a, Rapgef2, Cacna1d, Ikbkb, Nr4a1, Mapk8ip3, Map3k5, Nfkb2, Nlk, Dusp10, Rap1a, Gadd45b, Mapk10, Map2k3, Stmn1, Rap1b, Dusp4, Sos1, Traf6, Mapkapk2, Taok3, Rps6ka5, Hspa8, Map2k1, Cacna1c, Atf2, Elk4, Braf, Ppm1b, Pla2g4b, Prkcb, Mapk11, Mapkapk5, Prkca, Hspb1, Elk1, Ngf, Map3k3, Cacna2d1, Tnfrsf1a, Raf1, Cacna1b, Crkl, Sos2, Mknk1, Rps6ka3, Dusp3, Mapk9, Nf1, Nfatc3 Protein export 4.23117336 25 9 0.007323027 Sec11c, Spcs2, Hspa5, Srp9, Immp2l, Sec61b, Spcs1, Srp14, Sec11a Type II diabetes 3.580764239 50 14 0.011391375 Cacna1c, Mapk10, mellitus Cacna1b, Slc2a2, Mtor, Insr, Cacna1a, Ikbkb, Cacna1d, Irs1, Mapk9, Pik3r3, Socs4, Prkce Differentially expressed in PdxCre; Bmal1.sup.fix/fix islets MAPK Signaling 4.105230153 253 26 0.052631579 Dusp6, Cacna1c, pathway Elk4, Cd14, Braf, Atf4, Myc, Prkcb, Taok1, Cacna1a, Gadd45g, Chuk, Hspb1, Rasa2, Cacna2d3, Tgfbr1, Map3k2, Cacna2d1, Cacna1h, Cacna2d2, Cacna1b, Akt3, Rras2, Pdgfra, Nf1, Jund Type II diabetes 3.580764239 50 7 0.01417004 Cacna1a, mellitus Cacna1c, Hkdc1, Socs2, Cacna1b, Pklr, Socs4 Phosphatidylinositol 3.205302246 81 10 0.020242915 Dgkh, Dgkb, signaling system Pikfyve, Prkcb, Plcb4, Itpr1, Plcb3, Itpk1, Pik3c2a, Synj1 Insulin secretion 2.164694745 86 9 0.018218623 Cacna1c, Atf4, Prkcb, Plcb4, Plcb3, Pclo, Kcnn4, Atp1b3, Rims2 Circadian rhythm 2.009822141 30 4 0.008097166 Prkab2, Clock, Per2, Per3 COPII complex 1.817835746 11 2 0.004048583 Sec23a, Sec24a Protein export 0.691657973 25 2 0.004048583 Sec11c, Srp9 SNARE interactions 4.31E12 33 0 0 0 in vesicular transport BMAL1 Targets nonCycling Rap1 signaling 12.44593154 214 34 0.065637066 Pdgfc, Sipa1l1, pathway Adcy2, Plce1, Magi2, Pard6b, Bcar1, Rapgef1, Igf1r, Efna5, P2ry1, Akt3, Adcy8, Kit, Gnai1, Fgfr2, Kit1, Src, Pard6a, Vegfc, Pard6g, Itgb1, Hgf, Sipa1l2, Fgf14, Kdr, Ins1, Prkd1, Tek, Magi3, Gnao1, Rac1, Mapk1, Nras MAPK Signaling 8.881669516 253 34 0.065637066 Cd14, Gadd45g, pathway Ecsit, Map3k7, Mapk8, Rps6ka2, Cacng4, Dusp1, Cacna2d3, Rps6ka1, Map3k14, Jun, Akt3, Ppm1a, Rasgrf2, Tgfb2, Flnb, Fgfr2, Nfatc1, Ppp3ca, Dusp6, Casp3, Myc, Mef2c, Fgf14, Nfkb1, Rac1, Tgfbr1, Mapk1, Pla2g4a, Nras, Dusp5, Grb2, Cacnb3 Insulin secretion 7.184122363 86 15 0.028957529 Gcg, Atp1b1, Rab3a, Cckar, Camk2d, Kcnma1, Kcnn2, Creb3l2, Ins1, Abcc8, Adcy2, Adcy8, Pdx1, Atp1a1, Atp1a3 Phosphatidylinositol 2.936660459 81 10 0.019305019 Cds1, Dgkb, signaling system Dgkg, Inpp4b, Pi4kb, Pi4k2a, Plce1, Itpk1, Pten, Inpp5j Circadian rhythm 2.927736192 30 5 0.00965251 Cry2, Cul1, Bhlhe40, Bhlhe41, Per1 Type II diabetes 2.031842078 50 6 0.011583012 Mapk1, Mapk8, mellitus Hk3, Ins1, Abcc8, Pdx1 Protein export 1.386777127 25 3 0.005791506 Sec63, Spcs3, Sec62 SNARE interactions 0.387042009 33 2 0.003861004 Vamp3, Stx18 in vesicular transport COPII complex 1.38097E11 11 0 0 0 CLOCK targets nonCycling Rap1 signaling 12.87814504 214 23 0.085185185 Pard6a, Vegfc, pathway Pard6g, Itgb1, Cdc42, Hgf, Sipa1l2, Dock4, Prkd1, Adcy2, Magi2, Mapk1, Bcar1, Pard6b, Rapgef1, Efna5, Akt2, Gnai3, Ngfr, F2rl3, Vegfb, Kit, Gnai1 MAPK Signaling 7.105451517 253 20 0.074074074 Dusp7, Dusp6, pathway Cdc42, Tab2, Max, Map3k4, Map3k7, Mapk8, Dusp1, Mecom, Gng12, Mapk1, Rps6ka1, Jun, Map4k2, Dusp5, Akt2, Mknk2, Tgfb2, Ppp3ca Circadian rhythm 5.503601854 30 5 0.018518519 Cry2, Fbxl3, Bhlhe40, Bhlhe41, Per1 Insulin secretion 2.396637964 86 6 0.022222222 Abcc8, Adcy2, Kcnj11, Camk2d, Kcnma1, Atp1b3 Type II diabetes 2.241662226 50 4 0.014814815 Mapk1, Mapk8, mellitus Abcc8, Kcnj11 Phosphatidylinositol 0.567315545 81 3 0.011111111 Dgkg, Inpp4b, signaling system Pten SNARE interactions 0.34973543 33 1 0.003703704 Gosr2 in vesicular transport COPII complex 1.40878E11 11 0 0 0 Protein export 1.1483E11 25 0 0 0 BMAL1 targets Cycling Circadian rhythm 10.2035023 30 6 0.037037037 Nrld1, Prkag2, Prkaa2, Rbx1, Amtl, Clock Insulin secretion 4.527557 86 6 0.037037037 Pclo, Chrm3, Slc2a2, Camk2g, Rims2, Gnaq Rap1 signaling 3.138964233 214 9 0.055555556 Rapgef6, Ngr pathway Magi1, Skap1, Insr, Pard3, Cnr1, Adora2b, Gnaq Type II diabetes 2.361287911 50 3 0.018518519 Irs1, Slc2a2, mellitus Insr MAPK Signaling 2.306955066 253 9 0.055555556 Ngr, Il1r1, pathway Dusp4, Ppm1b, Mknk1, Taok1, Rps6ka3, Rps6ka5, Nfkb2 Protein export 2.285014334 25 2 0.012345679 Sec61b, Immp2l SNARE interactions in 1.829545138 33 2 0.012345679 Stx17, Stx16 vesicular transport COPII complex 1.537746457 11 1 0.00617284 Sec31a Phosphatidylinositol 1.355737038 81 3 0.018518519 Pikfyve, signaling system Pip5k1b, Itpr2 CLOCK targets Cycling Circadian rhythm 11.92035309 30 6 0.037037037 Nr1d1, Rorc, Amtl, Per2, Cry1, Per3 MAPK Signaling 4.899304791 253 10 0.055555556 Cacna1c, pathway Cacna2d1, Stmn1, Rps6ka4, Dusp4, Mknk1, Cacna1a, Prkca, Hspb1, Nfatc3 COPII complex 4.353710244 11 2 0.00617284 Sec31a, Sec24a Insulin secretion 1.828132526 86 3 0.037037037 Cacna1c, Prkca, Chrm3 Type II diabetes 1.649314642 50 2 0.018518519 Cacna1a, mellitus Cacna1c Rap1 signaling 1.339863213 214 5 0.055555556 Prkca, Cnr1, pathway Vegfa, Calm2, Pfn2 Phosphatidylinositol 0.977936239 81 2 0.018518519 Prkca, Calm2 signaling system SNARE interactions 0.878529011 33 1 0.012345679 Stx16 in vesicular transport Protein export 1.66591E11 25 0 0.012345679 0
TABLE-US-00002 TABLE 2 Differentially Expressed in BMAL1 Cycling Bmal1 KO at ZT2 Target Signature -Cell Genes Glut2 Yes No Yes Gck No No No Kcnj11 No No No Abcc8 No No Yes Pcsk1 No No No Glp1r No No No Ins1 No No Yes Ins2 No No No Key Transcription Factors Pdx1 NO No Yes Nkx2.2 No No No Pax6 No No No NeuroD1 No No No MafA No No No Ngn3 No No No Pax4 No No No Disallowed Genes Ldha Yes No No Slc61a1 No No No Pdgfra No 2.3 fold increase No Cxcl12 No No Yes Maf No 0.3 fold increase Yes Lmo4 No 1.8 fold increase No Hk1 No No No
Example 2
BmaL1 Deficient Beta Cell Line
Materials and Methods
Cell Culture
[0098] Beta TC-6 cells were obtained from ATCC (CRL-11506) on Jan. 24, 2014. Cells were cultured in Dulbecco's modified Eagle's Medium supplemented (Corning Cat#10-013-CV) with 15% fetal bovine serum (Cat 35-011-CV), 1% penicillin-streptomycin (Corning, Cat 30-002-CI), and 1% L-glutamine (Life Technologies, Cat#25030081) at 37 degree with 5% CO2. Culture medium was exchanged every 2 or 3 days.
Generation of CRISPR-CAS9 Plasmids Targeting Mouse Bmal1
[0099] CRISPR-CAS9 gene editing enables precision gene editing by targeting the CAS9 endonuclease to specific genomic locations using homologous RNA guides. We targeted exon 8 in the mouse Bmal1 gene encoding the DNA binding bHLH domain to mimic the effect of Cre-LoxP models of Bmal1 deletion in vivo which delete this essential domain in mice (PMID 18779586) and we have demonstrated that excision of this exon in beta cells causes hypoinsulinemia and diabetes (PMID 20562852, PMID 26542580). Exon 8 of the mouse Bmal1 gene was targeted by designing RNA guides (sgRNAs) using the Zhang lab CRISPR design tool and the likelihood of targeting off-target templates was minimized by aligning these sequences to the mouse genome. The CAS9 nuclease requires recognition of a PAM consensus sequence (NGG) to cleave DNA so CACC nucleotide sequence was added to the 5 end of the sgRNA and AAAC was added to the 5 end of the reverse complement of the sgRNA oligos for cloning into the pSpCas9(BB)-2A-Puro vector (Addgene plasmid #48139, deposited by Feng Zhang) using the BbsI restriction enzyme.
sgRNA Oligo Sequences Targeting Bmal1 Exon 8 are as Follows:
TABLE-US-00003 5 forwardtargetingsequence: (SEQIDNO:13) CACCGCTGGACATTGCATTGCATGT 5 reversecomplement: (SEQIDNO:14) AAACACATGCAATGCAATGTCCAGC 3 forwardtargetingsequence: (SEQIDNO:15) CACCGTAGATAAACTCACCGTGCTA 3 reversecomplement:Rev (SEQIDNO:16) AAACTAGCACGGTGAGTTTATCTAC
The two sgRNA oligos were annealed to form double stranded DNA and cloned into the pSpCas9(BB)-2A-Puro plasmid encoding the CRISPR-CAS9 nuclease using the BbsI restriction enzyme.
[0100] To enable stable selection of Beta TC-6 clones with constitutively disrupted expression of Bmal1 a homology directed repair template (Bmal1-HDR plasmid) encoding a fluorescent marker (mCherry) and selectable marker (neomycin resistance) that was inserted into the region in exon 8 cleaved by the CAS9 endonuclease was utilized (
Transfection of CRISPR-CAS9 plasmids and stable selection of Bmal1.sup./ cells
[0101] Beta TC-6 cells (passages 25-30) were plated into 6 well plates (Corning, 353046) and cultured overnight. The pSpCas9 vector containing sgRNAs (400 ug) and the Bmal1-HDR vector (600 ug) were transfected into Beta TC-6 cells using Lipofectamine 2000 (Thermo Fisher Scientific, Cat#11668027) according to the manufacturer's instructions (
Generation of Bmal1.SUP./ Beta TC-6 Cells Stably Expressing Insulin Nanoluc
[0102] The Insulin Nanoluc plasmid (Addgene plasmid #62057, deposited by David Altshuler) was used to provide a low cost, scalable, and rapid method to detect insulin secretion (
[0103] The pLX304 lentivirus packaging plasmid containing the Proinsulin-NanoLuc construct was transfected into HEK293T (ATCC CRL-11268) cells with pCMV-VSVG (envelope vector) and 8.91 (packaging vector) which were obtained from Jeff Milbrandt at Washington University in St. Louis. Supernatant containing lentivirus particles was harvested 48 hours after transfection. Beta TC-6 cells were infected with Insulin-NanoLuc lentivirus and stably expressing cells were selected by treating with puromycin (2 g/ml, 2 days).
Validation of Insulin Nanoluc Method
[0104] To ensure that the Insulin Nanoluc secretion is correlated to the secretion of endogenous insulin, luciferase intensity and insulin concentration measured by ELISA in supernatants of Insulin Nanoluc-expressing Beta TC-6 cells was compared following stimulation with 20 mM glucose. It was confirmed that luciferase intensity is highly correlated with endogenous insulin secretion (
High Throughput Screen for Drugs to Rescue Insulin Secretion in Bmal1.SUP./ .Beta Cells
[0105] A high throughput screen was used to identify small molecule drugs capable of restoring glucose-stimulated insulin secretion in clock-deficient beta cells. Bmal1.sup./ beta cells and primary islets display reduced glucose-stimulated insulin secretion (GSIS) and that agonists of G.sub.q-coupled muscarinic receptor and diacyl glycerol (DAG) signaling rescue secretion to that of wild type cells. Compounds to augment GSIS in Bmal1.sup./ cells were identified by adding compounds in combination with 20 mM glucose and using the DAG mimetic Phorbol 12-myristate 13-acetate (PMA), which rescues GSIS in these cells, as a positive control. The spectrum collection small molecule compound library (MicroSource Discovery Sytems, Inc) consisting of 2700 known drugs and drug-like molecules was screened for compounds that augment insulin secretion in Bmal1.sup./ Beta TC-6 cells. Insulin Nanoluc expressing Bmal1.sup./ Beta TC-6 cells (30,000 cells/well) were plated in 384 well plates and cultured for 4 days at 37 C. with 5% CO.sub.2. Prior to the assay, cells were washed once with KRB buffer containing 0 mM glucose and starved in glucose-free KRB buffer for 1 hour. After aspirating, KRB buffer containing 20 mM glucose in addition to small molecules (10 uM) were added, and the cells were incubated for 1 hour. As a negative control, 16 wells received only 20 mM glucose, which fails to elicit insulin secretion in Bmal1.sup./ cells, and an additional 16 wells received KRB buffer containing 20 mM glucose and 10 M PMA, which is known to induce insulin secretion in Bmal1.sup./ mouse islets and Beta TC-6 cells. After 1 hour, the supernatant was collected and centrifuged at 500G for 30 min. The supernatant was transferred into a fresh 384-well assay plate containing Nano-Glo Luciferase Assay Substrate (Promega) and luciferase intensity was measured by EnSpire Plate Reader (PerkinElmer) Intensity was measured within 30 minutes.
[0106]
[0107]
[0108]
[0109]
Determination of Hit Compounds
[0110] Z scores for luciferase intensities produced by screened compounds were calculated from the following formula:
z=(X)/
where z is the z-score, X is intensity of compounds, is the intensity of negative control (20 mM glucose), and is the standard deviation of negative control. Hit compounds were defined as those that elicited a response of more than 3 standard deviations from the mean (Z score >3).
Hit Compounds
[0111] Screening the spectrum library of 2700 compounds in Bmal1.sup./ Insulin Luc expressing cells yielded 34 hit compounds that displayed a Z score >3 (as described above). A literature search revealed that the known and predicted targets for 23 of the hits are cell surface receptor and ion channel proteins. Among these were 4 compounds targeting ion channels including the glutamate-gated cation channel NMDAR, ligand and temperature gated TRPV1 cation channel, and a glutamate gated chloride channel. The targets of the remaining 19 compounds are membrane bound receptors belong to the 7 transmembrane g-coupled protein receptor superfamily including muscarinic and nicotinic acetylcholine receptors, dopamine receptors, serotonin receptors, a g coupled bile acid receptor and the beta 2 adrenergic receptor. Eleven of these GPCRs are known to couple to the G.sub.q protein, which is consistent with these compounds operating through DAG signaling which we have previously found to rescue GSIS in Bmal1.sup./ beta cells. Two compounds target G.sub.s coupled receptors that signal via adenyl cyclase and cAMP and the remaining 6 compounds targeted receptors coupled to the G.sub.i/o protein that inhibits adenyl cyclase and activates phospholipase C/DAG signaling.
Example 3
Circadian Clock Interaction with HIF1 Mediates Cellular Oxygenic Energy Production and Glycolysis
Materials and Methods
Animals
[0112] All animal care and use procedures were in accordance with guidelines of the Institutional Animal Care and Use Committee. Bmal.sup.fx/fx mice (25512522) were crossed with ACTA-rtTA-TRE-Cre transgenic mice (kindly provided by Dr. Grant Barish) 19263419) to generate ACTA-rtTA-TRE-Cre; Bmal1.sup.fx/fx mice, as well as Bmal1.sup.fx/fx and ACTA-rtTA-TRE-Cre littermate controls. Vhl.sup.fx/fx mice (Jackson Laboratories) (11171994) were crossed with CAG-Cre-ER transgenic mice (Jackson Laboratories) (11944939) to generate CAG-Cre-ER; Vhl.sup.fx/fx mice, as well as Vhl.sup.fx/fx and CAG-Cre-ER controls. All experiments were performed using male C57BL/6J mice between 3-5 months of age, and mice were maintained on a 12:12 light dark (LD) cycle in the Northwestern University Center for Comparative Medicine.
CRISPR-Mediated Gene Deletion in C2C12 Myoblasts
[0113] CRISPR-Cas9 technology was utilized to direct homologous recombination-mediated excision of exon 8 of the Bmal1 gene in C2C12 myoblasts (Ser. No. 18/779,586). The mouse Bmal1 gene was targeted by designing RNA guides (sgRNAs) using the Zhang lab CRISPR design tool and the likelihood of targeting off-target templates was minimized by aligning these sequences to the mouse genome. (pSpCas9(BB)-2A-Puro). An additional plasmid was generated from pTOPO2.1 (Invitrogen) containing the Neomycin resistance cassette from pCDNA3.1-neo (Invitrogen) flanked by 1 kb intronic regions of genomic DNA directly to the 5 and 3 of BMAL1 exon 8 (named pBmal1-HR). C2C12 myoblasts were co-transfected with guide RNA and pBmal1-HR plasmids, and stably-integrated clones were selected for neomycin resistance (G418, Mediatech). Clones were assayed for loss of Bmal1 mRNA and protein expression. Data shown are averaged data from two independent Bmal1.sup./ clones.
Oxygen Consumption Rate (OCR) and Extracellular Medium Acidification Rate (ECAR) Measurements
[0114] OCR and ECAR were measured in differentiated C2C12 myyotubes as previously described (24051248, 21189469). Cells were plated and differentiated on Seahorse Biosciences 96-well culture plates and transferred to fresh glucose-containing medium (for OCR) and no glucose-containing medium (for ECAR) without sodium bicarbonate 1 hour prior to measurements. Plates were placed in a XF96 Bioanalyzer, and OCR and ECAR were measured before and after sequential addition of 10 M Oligomycin and 10 M carbonylcyanide-p-trifluoromethoxyphenylhydrazone (FCCP) (for OCR wells) or 10 mM glucose and 10 M Oligomycin (for ECAR wells).
Protein Gel Electrophoresis and Immunoblotting
[0115] MEF and C2C12 whole cell lysates were prepared in CelLytic MT Mammalian Tissue Lysis Reagent (Sigma) supplemented with protease inhibitors. Snap-frozen mouse skeletal muscle tissue was diluted in CelLytic MT Mammalian Tissue Lysis Reagent (Sigma) supplemented with protease inhibitors and homogenized using a TissueLyser II apparatus (Qiagen). Protein levels were quantified using DC Protein Assay (Biorad), and protein extracts were subject to SDS-PAGE gel electrophoresis and transferred to nitrocellulose membranes (GE Healthcare). Primary antibodies used were anti-HIF1 (Novus Biologicals) and anti--actin (Cell Signaling).
Quantitative Real-Time PCR
[0116] Total RNA was extracted from C2C12 and MEF cell pellets and snap-frozen mouse skeletal muscle tissue using Tri-Reagent (Molecular Research Center, Inc). For muscle tissue samples, tissue was homogenized using a TissueLyser II apparatus (Qiagen). cDNA was synthesized using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). Real-time PCR was performed and analyzed using a CFX384 (Biorad). PCR conditions were: 10 min at 95 C., then 35 cycles of 10 s at 95 C., 15 s at 60 C. Relative expression levels (normalized to 18S rRNA (C2C12 and MEF) or -actin (skeletal muscle)) were determined using the comparative CT method.
Luciferase Assays
[0117] Undifferentiated C2C12 myoblasts were transfected with plasmids expressing either the PER2:LUCIFERASE (15620658, 18454201) or hypoxia response element (HRE)-luciferase reporters (kindly provided by Dr. Navdeep Chandel) (18268343), as well as plasmids expressing genes encoding bHLH-PAS proteins including CLOCK, BMAL1, HIF1, and ARNT (HIF1). 48 hours after transfection, cells were assayed for luciferase activity using the Dual Luciferase Assay Kit (Promega).
C2C12 Myotube Synchronization
[0118] For RNA expression studies, confluent dishes of C2C12 myoblasts were first differentiated with 2% horse serum two days prior to cell synchronization. Cells were then synchronized by serum shock every 4 hours for 44 hours with 50% horse serum as previously described (22210883). Twenty-four hours after the final shock, cells were collected and analyzed for mRNA expression. For PERIOD2:LUCIFERASE (PER2:LUC) reporter assays, C2C12 myoblast cells were first infected with PER2:LUC-expressing lentivirus (gift of A. Liu, University of Memphis) (18454201) and maintained in DMEM that included 10% FBS and 2.5 g/ml blastocidin to select for stable Per2-luc integration. Myoblasts were then differentiated for 5 days with 2% horse serum, and then synchronized in 50% horse serum for 2 hours. Myotubes were then treated with either 62.5 uM Dimethyloxalylglycine (DMOG) (Sigma) or DMSO (vehicle) in DMEM plus 0.1 mM luciferin and 0.5% horse serum, and luciferase activity was continuously monitored using a LumiCycle apparatus (Actimetrics).
Chromatin Immunoprecipitation (ChIP)
[0119] ChIP experiments were performed as previously described. Briefly, C2C12 myotubes were dual-crosslinked with Disuccinimidyl glutarate DSG for 30 min followed by 1% formaldehyde for 10 min. Myotubes were collected, and nuclei were isolated via needle lysis in IP buffer (ref). Chromatin was sheared by sonication and incubated overnight with 2 g of either anti-HIF1 antibody (Novus Biologicals) or anti-BMAL1 antibody (generated as described (26542580)) followed by 2 hours with pre-blocked protein A Agarose beads (Millipore). Beads were washed 6 times followed by de-crosslinking using Chelex beads (Sigma) and proteinase K (Invitrogen) digestion. Eluted immunoprecipitated DNA and input DNA were purified by Qiaprep mini-elute reagents and subjected to qPCR analysis using primers specific to known CLOCK/BMAL1 E-box target sites.
Mouse Embryonic Fibroblast (MEF) Isolation
[0120] MEFs were isolated as previously described (24051248). Pregnant mice were sacrificed at pcd 14-15, and embryos were dissected away from the uterus and placed in 1PBS. Heads and internal organs were removed, and heads were subsequently used for genotyping. Blood was washed away from the remaining carcasses with 1PBS, and tissue was minced in Trypsin-EDTA, followed by incubation with stirring for 30 minutes. Trypsin was neutralized with heat-inactivated FBS, and cells were pelleted by centrifugation at 270g for 5 minutes. Following centrifugation, cells were resuspended in DMEM containing 15% FBS and plated at 110.sup.6 cells per 100 mm dish. Media was changed 24 hours after plating. Cells were maintained in DMEM containing 15% FBS.
Mouse Treadmill Exercise
[0121] 3-4 month old male C57B6L/J mice were familiarized with the treadmill (Columbus Instruments) by running for 15 min at 6 m/min on two consecutive days prior to our experiments. On the third day, mice were placed on the treadmill for 3 min at 6 m/min. After 3 min, the treadmill speed was increased by 1 m/min every minute until exhaustion, which was defined as more than 10 falls onto the stimulus grid per minute. Mice were euthanized by CO.sub.2 inhalation followed by cervical dislocation, and skeletal muscle tissue was snap-frozen in liquid nitrogen.
Results
Tissue-Specific Circadian Control of HIF-Mediated Anaerobic Glycolysis
[0122] To determine whether the cell autonomous circadian clock in skeletal muscle contributes to regulation of fuel utilization and glycolytic flux, oxygen consumption (OCR) and extracellular medium acidification (ECAR) rates, which quantify mitochondrial respiration and glycolysis, respectively, were assessed in Bmal1.sup./ C2C12 mouse myoblasts generated using CRISPR-CAS9-mediated homologous recombination under relative normoxic conditions. Similar to previous findings in Bmal1.sup./ liver, impaired OCR was observed in Bmal1.sup./ myotubes compared to WT myotubes both in basal conditions and in response to the ATP synthase inhibitor oligomycin and the drug FCCP, which measure uncoupled respiration and maximal flux through the electron transport chain (ETC), respectively (24051248). A major difference was observed, however, in comparing anaerobic glycolysis in liver and skeletal muscle metabolism in Bmal1.sup./ myotubes. Specifically, in contrast to Bmal1.sup./ liver, which exhibits increased anaerobic glycolysis and lactate production (24051248), Bmal1.sup./ myotubes exhibited reduced extracellular lactate production, as indicated by decreased ECAR both in basal conditions and in response to glucose and when the ETC is blocked by oligomycin, indicating tissue-specific differences in the circadian regulation of fuel selection between liver and muscle.
[0123] Since HIF1 is known to be important for glycolytic metabolism in oxidative tissues such as skeletal muscle during both rest and in response to hypoxia (15328538, 26391197, 24619881), as well as for promoting aerobic glycolysis in von Hippel Lindau angioblastomas, renal cell carcinoma, and other endocrine neoplasms (Ser. No. 12/209,156), it was contemplated that reduced HIF1 within Bmal1.sup./ skeletal muscle may underlie their impaired ECAR, and that the muscle clock may mediate anaerobic glycolytic metabolism through interactions with the HIF pathway. Furthermore, in contrast to tissues such as liver where basal levels of HIF1 are low, skeletal muscle expresses relatively high levels of HIF1 protein even under normoxic conditions (Ser. No. 11/689,469), indicating potential tissue-specific roles of HIF1 in normoxic and hypoxic conditions. Moreover, loss of HIF1 specifically in skeletal muscle leads to decreased basal and exercise-induced expression of glycolytic genes and correspondingly low lactate production and impaired tolerance to strenuous acute exercise in mice (15328538, 16043777, 18269201, 16043777). Thus, the impact of genetic disruption of both the circadian clock activator versus repressor TFs on the HIF-mediated response to hypoxia was next assessed. In mouse embryonic fibroblasts (MEFs) isolated from mice lacking the clock activator BMAL1, HIF1 accumulation was observed in response to increasing doses of cobalt chloride (CoCl.sub.2), an iron antagonist and hypoxia-mimetic which stabilizes HIF1 by inactivating prolyl hydrolyases, rendering them incapable of marking HIF1 for degradation (7539918). Conversely, MEFs lacking the circadian repressors CRY1 and CRY2 displayed increased HIF1 accumulation compared to control cells following CoCl.sub.2 exposure, indicating that the core circadian clock feedback loop controls HIF protein levels and the hypoxic response. In addition, we observed a similar reduction in HIF accumulation in Bmal1.sup./ myotubes exposed to environmental hypoxia (1% O.sub.2 for up to 6 hrs), in parallel with reduced expression of known HIF1 target genes in the absence of Bmal1, including its own negative regulator Prolyl hydroxylase 3 (Phd3) and the pro-angiogenesis factor Vascular endothelial growth factor-alpha (Vegfa), as well as several genes important for anaerobic glycolysis, including Lactate dehydrogenase A (Ldha), Pyruvate kinase muscle isoform (Pk-m), and the Monocarboxylate transporter 4 (Mct4) (15823097, 8089148, 15288294, 16452478, 9113979). Finally, a similar decrease in Ldha and Mct4 expression was observed in gastrocnemius muscle of skeletal muscle-specific Bmal1 knockouts (ACTA-rtTA-TRE-Cre; Bmal.sup.fx/fx) compared to controls (Ser. No. 19/263,419), indicating cell-autonomous in vivo regulation of the glycolytic fuel utilization pathways in skeletal muscle. Together, these data indicate a role for the circadian clock in mediating HIF-dependent control of muscle lactate production and its secretion at both the cell autonomous level in myoblasts and in the intact animal in vivo.
[0124] The impaired hypoxia-induced HIF1 accumulation and transcriptional activity in the Bmal1 mutant cells may be due to reduced HIF1/BMAL1 heterodimerization due to the absence of BMAL1, potentially leading to reduced stability of the nuclear monomeric form of HIF1, as is the case in cells lacking HIF1 (10085255). In support of a physiologic interaction between HIF1 and BMAL1, in vitro structural and biochemical studies reveal direct dimerization between bHLH-PAS protein components of the HIF and clock pathways, as a high degree of sequence- and structure-level similarity exists between HIF1 (aka ARNT) and the core clock activator BMAL1 (also termed ARNT-like), particularly within the protein-protein PAS domain interaction surfaces (22653727, 24263188). While the N-terminus contains the bHLH domain for DNA binding, the conserved central PASA and PASB domains are responsible for nutrient sensing, recruitment of transcriptional co-regulatory proteins, and determining specificity for heterodimerization with other bHLH-PAS factors (22653727, 17024177, 23240775, 21512126, 24263188, 9632792). To test functional interactions between HIF1/BMAL1 heterodimers, the transactivation by these TFs of the hypoxia-response element (HRE), a canonical regulatory motif present within the promoter of HIF1-target genes, was examined in mammalian skeletal muscle cells. Specifically, the ability of HIF1, in combination with either HIF1 (ARNT) or BMAL1 (ARNT-like), to activate a HRE-luciferase reporter was assessed (Ser. No. 18/268,343). It was found that HIF1/BMAL1 trans-activated HRE-luciferase to an even greater extent than HIF1/HIF1 (ARNT), whereas CLOCK/BMAL1 and CLOCK/ARNT did not activate HRE-luciferase, demonstrating the formation of a transcriptionally competent HIF1/BMAL1 complex in mouse skeletal muscle cells and providing further evidence that the circadian clock regulates the hypoxic response pathway through HIF1.
Hypoxia and HIF1 Exert Reciprocal Control of Circadian Transcription Cycles
[0125] Given the functional interaction observed between HIF1 and BMAL1, and that they both target similar E-box-like motifs, it was contemplated that a bi-directional relationship may exist between the circadian and hypoxic pathways. Several approaches were taken to determine whether the HIF pathway exerts reciprocal effects upon the core clock itself. First, to determine the impact of hypoxia on the period length of the autonomous circadian clock within muscle cells, synchronized C2C12 myotubes that stably expressed the circadian reporter PERIOD2:LUCIFERASE (PER2:LUC) were treated with the HIF1/2-stabilizing drug dimethyloxalyl glycine (DMOG), which inhibits PDH/VHL-mediated HIF degradation similarly to CoCl.sub.2 but without causing toxicity due to long-term culture (11595184, 15620658, 18454201, 1321909, 11292861). Continuous monitoring of luciferase activity revealed significant period lengthening of PER2:LUC oscillations in the presence of DMOG (22 hrs in DMSO-treated controls compared to 23 hrs in DMOG-treated cells, p<0.05), demonstrating that HIF directly impacts a core property of the circadian clock within muscle.
[0126] Second, to determine whether HIF1 localizes to regulatory regions within core clock genes in skeletal muscle, directed chromatin immunoprecipitation (ChIP) of HIF1 was performed at endogenous CLOCK/BMAL1 targets containing canonical E-box binding sites (5-CACGTG-3) (22936566). Significantly enhanced binding of HIF1 to the E-box within the promoter regions of Per2 and Cry1 was found, as well as to canonical HRE targets sites within the Ldha and Vegfa promoters (24360282, 21343542), but not within a non-specific promoter for Slc2a2, the solute carrier family 2 gene encoding the glucose transporter GLUT2, which does not contain a canonical CLOCK/BMAL1 E-box binding site. Direct binding of HIF1 to circadian target genes suggests a role for the hypoxic response in regulating circadian gene transcription and is consistent with the impact of HIF1 on period length. Third, the ability of HIF1 to trans-activate the Period2 gene through co-expression of HIF1 and BMAL1 was assessed and it was found that HIF1/BMAL1 stimulated the transcription of the PER2:LUC reporter expressed within C2C12 myoblasts to a similar extent as CLOCK/BMAL1. Furthermore, increased expression of core clock genes was found in both myotubes and MEFs in response to hypoxia induced by either exposure to 1% O.sub.2 or with the chemical mimetic CoCl.sub.2. These findings are consistent with the previous observations that increased period length correlates with increased expression of circadian repressors (10408444, 11395012, 10217146). Importantly, nearly all of the induced genes are direct targets of CLOCK/BMAL1 and contain E-box regulatory sites within their promoters.
[0127] Finally, to test the epistatic relationship between HIF and CLOCK/BMAL1 activity in response to hypoxia, clock gene expression was examined in MEF cells generated from mice carrying a tamoxifen-inducible CRE-mediated deletion of the Von Hippel-Lindau (Vhl) gene (Cag-CRE-ER; Vhl.sup.fx/fx (11171994), a tumor suppressor and E3 ligase that is deficient in clear-cell carcinomas and haemangioblastomas and responsible for the rapid turnover of HIF1 in normoxic tissues (Ser. No. 12/209,156). Consistent with the effect of hypoxia and HIF stabilization on clock gene expression in wild-type embryonic fibroblasts and C2C12 myotubes, Vhl.sup./ MEFs displayed increased expression of core clock genes, indicating that hypoxia induces circadian gene expression through induction of the HIF pathway. Together, these data uncover a bi-directional relationship between the circadian and hypoxic pathways, whereby hypoxia and HIF stabilization reciprocally feedback to regulate the core clock itself.
Circadian Clock Generates Time-of-Day-Dependent Hypoxic Response to Exercise
[0128] The findings above highlight a reciprocal interaction between circadian and HIF TFs in skeletal muscle. To determine whether the circadian clock and HIF TFs act cooperatively to control gene expression in muscle tissue in vivo in response to a hypoxi challenge, a model of acute strenuous exercise in mice to induce hypoxic stress was employed. Mice lacking HIF1 in skeletal muscle fail to induce the expression of HIF1-regulated genes important in the production of ATP via glycolysis and lactate and display reduced tolerance to strenuous exercise, indicating a defect in type II fast-twitch muscle fibers and suggesting a role of HIF1 in acute exercise tolerance (Ser. No. 15/328,538). Thus, using strenuous exercise a paradigm, assays were performed to test 1) whether HIF induction is gated by activity of the circadian clock (e.g., by time of day), and 2) whether clock gene expression is altered by hypoxic stress in skeletal muscle tissue in vivo. WT mice were exercised by treadmill running to exhaustion at either ZT0 or ZT12, the start of the light or dark period, respectively (total run time was approximately 20-35 minutes depending on the mouse). Gastrocnemius muscle (i.e. primarily type II fiber-containing) was then rapidly excised and assayed for both HIF1- and clock-target gene expression. Of note, induction of both HIF1 targets, including Pk-m, Ldha, and Vegfa, and clock targets, including Bmal1, Per1, Cry2, and Nampt, was observed when mice were exercised at ZT0, but not at ZT12, indicating that circadian timing controls the induction of the HIF- and clock-dependent transcriptional response to exercise in vivo. These data demonstrate a clear time-of-day dependent effects of hypoxia on both core clock and HIF target genes, reinforcing the reciprocal nature of the circadian and hypoxic response pathways in response to both time of day and alterations in the oxygenic environment.
[0129] Circadian clocks are unique in that they are capable of not only anticipating daily changes in the solar cycle, leading to daily oscillations in the expression of oxidative and reductive metabolic enzymes, but also retaining plasticity, enabling adaptation to flux in the nutrient and oxygen environment. The capacity of circadian clocks to exhibit flexibility can be understood at the molecular level since clock TFs contain PAS domains that are canonical environmental response modules important in sensing flux in xenobiotic, metabolite, and oxygen, and transducing such changes into adaptive transcriptional programs (24263188, 20148691, 10357859). Described herein is a previously uncharacterized relationship between molecular clocks and the activity of HIF1 in mouse skeletal muscle, revealing how peripheral clocks collaborate with the central oxygen-responsive TF HIF1 to promote rhythmic tissue-specific metabolic function. While in silico and in vitro biochemical analyses have led to the proposal that HIF TFs may form complexes with circadian clock proteins due to the high degree of structural similarity between the HIF and clock TFs, a hypothesis supported by studies in the vertebrate zebrafish model (23421720, 25730270, 9576906), it has remained unclear whether functional interactions between the bHLH-PAS proteins might occur in mammalian tissues important in the balance between oxidative and reductive metabolism. To address the potential integration of circadian and oxygen-sensing mechanisms under physiologic conditions in mammalian cells, skeletal muscle tissue was utilized for several reasons including: (i) muscle tissue displays abundant HIF1 protein levels and transcriptional activity relative to other tissue types, showing that circadian clock/HIF interactions may participate in basal (normoxic) metabolic function (Ser. No. 11/689,469), (ii) HIF1 is a determinant of exercise tolerance in type IIX glycolytic muscle fibers (Ser. No. 15/328,538, 18269201, 24794533), and (iii) genetic disruption of the ARNT-like circadian activator, BMAL1, leads to impaired muscle fiber distribution, glycolytic gene expression, and glucose tolerance (26000164, 26486627, 24567902). Thus, it was hypothesized that the skeletal muscle circadian clock may play a role in both anticipating oxidative-reductive fuel cycles each day, but also gating the capacity of oxidative skeletal muscle to augment glycolytic energy production through regulation of HIF signaling.
[0130] The data provide several lines of evidence that crosstalk between circadian and oxygen-sensing pathways is established through physical and functional interaction between HIF1 and the circadian protein BMAL1. First, dose-dependent transactivation of both the HRE- and PER2-luciferase reporters was observed when BMAL1 and HIF1 were co-expressed, indicating that these factors form heterologous and transcriptionally competent complex. Second, HIF1 enrichment was observed at canonical CLOCK/BMAL1 E-box sites, including those present in the Per2 and Cry1 promoters, demonstrating direct HIF1 occupancy localized to regulatory sites within the promoter regions of core clockgenes.
[0131] The ability of cells to respond to acute changes in oxygen levels is an important feature of aerobic organisms and requires a functional HIF1 network. As oxygen levels decrease, the generation of ATP shifts from mitochondrial oxidative phosphorylation to oxygen-independent glycolysis in the cytoplasm, a HIF1-dependent process. Interestingly, the findings show an important role for the clock in this process, as we reveal that HIF1-BMAL1 interactions may regulate glucose metabolism in a tissue-specific manner. Remarkably, whereas Bmal1.sup./ liver showed increased anaerobic glycolytic gene expression and lactate production under normoxic conditions (24051248), Bmal1.sup./ myotubes display an opposite phenotype of reduced extracellular lactate production and reduced expression of known HIF1 targets, consistent with the reduced levels and transcriptional activity of HIF1 in muscle. This observation has important implications for defining the tissue-specific physiologic role of the HIF1-clock TF interaction in mediating basal muscle metabolism even in the resting normoxic state, in contrast to liver, where HIF1-clock TF interactions likely only induce glycolysis during hypoxic stress.
[0132] The studies presented here reveal endogenous HIF-clock TF interactions in skeletal muscle under both normoxic and hypoxic conditions that may have broader implications for understanding the interplay between circadian and oxygen sensing pathways in pathological hypoxic states including anemia and cardiac and ischemic cerebral injury. Furthermore, while BMAL1-mediated HIF activation may be beneficial to promote adaptation to hypoxic stress such as exercise and ischemic stress, it is possible that circadian regulation of HIF may contribute to pathologies in which HIF drives aberrant aerobic glycolysis including tumor growth and progression. In this instance, it is tempting to speculate that pharmacological modulation of clock activity may aid in HIF down-regulation particularly in cancers involving mutations in Vhl and mitochondrial oxidative enzymes (e.g. succinate dehydrogenase (Sdh)) (16892081).
[0133] In summary, the clock system functions not only to anticipate changes in the external light cycle, but peripheral clocks also act as a rheostat to regulate oxygen sensing in oxidative tissues under both basal and hypoxic conditions.
Example 4
Chemogenetic Screen for Identification of Circadian Regulators of Insulin Secretion
[0134] Impaired circadian function is associated with reduced insulin secretion in pancreatic cells. Experiments were conducted during development of embodiments herein to identify small molecule and biologic agonists that restore the insulin secretory defects in the setting of circadian disruption. A high-throughput chemo-genetic screen was performed in Bmal1 null cell lines established by CRISPR gene editing that also express an insulin nano-luciferase reporter (
Cell Culture
[0135] Beta TC-6 cells were obtained from ATCC (CRL-11506). Cells were cultured in Dulbecco's Modified Eagle's Medium (Corning, Cat#10-013-CV) supplemented with 15% fetal bovine serum (Corning, Cat#35-011-CV), 1% penicillin-streptomycin (Corning, Cat#30-002-CI), and 1% L-glutamine (Life Technologies, Cat#25030081) at 37 C. with 5% CO.sub.2. Culture medium was exchanged every 2-3 days.
Generation of CRISPR-CAS9 Plasmids Targeting Mouse Bmal1 and Clock (Related to FIG. 23)
[0136] For Bmal1: Exon 8 of the mouse Bmal1 gene was targeted by designing RNA guides (sgRNAs) using the Zhang lab CRISPR design tool (crispr.mit.edu). Exon 8 in BMAL1 encodes the basic-helix-loop-helix (bHLH) DNA binding domain and is the exon targeted in pancreas-specific Cre-LoxP-mediated knockout models with hypoinsulinemia and diabetes. Uniqueness of these sequences were confirmed by alignment to the mouse genome, reducing the likelihood of targeting off-target templates. Additionally, since the CAS9 nuclease requires recognition of a Protospacer Adjacent Motif (PAM) consensus sequence (5-NGG-3) to cleave DNA, the CACC and AAAC nucleotide sequences were added to the 5 end of the forward targeting sgRNA oligos or the reverse complement of the sgRNA oligos, respectively, for cloning into the pSpCas9(BB)-2A-Puro vector (Addgene plasmid #48139, deposited by Feng Zhang) using the BbsI restriction enzyme. The sgRNA oligo sequences targeting Bmal1 exon 8 were as follows: 5 forward targeting sequence: CACCGCTGGACATTGCATTGCATGT (SEQ ID NO: 13); 5 reverse complement: AAACACATGCAATGCAATGTCCAGC (SEQ ID NO: 14); 3 forward targeting sequence: CACCGTAGATAAACTCACCGTGCTA (SEQ ID NO: 15); 3 reverse complement: AAACTAGCACGGTGAGTTTATCTAC (SEQ ID NO: 16).
[0137] To enable stable selection of Beta TC-6 clones with constitutively disrupted BMAL1 expression, a homology-directed repair (HDR) template (Bmal1-HDR plasmid) encoding a fluorescent marker (mCherry) and selectable marker (neomycin resistance) was designed that for insertion into the region in exon 8 cleaved by the CAS9 endonuclease. A double-stranded DNA oligo was synthesized encoding both an mCherry reporter and neomycin resistance cassette flanked by 1kb of the complimentary sequence homologous to Bmal1 exon 8 surrounding the PAM sequence recognized by the sgRNAs. To generate this plasmid, a neomycin resistance cassette (pcDNA3.1, Invitrogen) was first cloned into the Topo cloning site of PCR2.1-TOPO vector (pCR2.1-TOPO, Invitrogen). Then, the IRES-mCherry sequence (pMSCV-IRES-mCherry, Addgene plasmid #52114, deposited by Dario Vignali) was cloned into the BstB1 site located between neomycin resistance cDNA and its terminator. Finally, 1kb sequences homologous to the 5 and 3 sequences surrounding the CAS9 targeted-region in Bmal1 exon 8 were isolated from mouse genomic DNA and cloned into the PCR2.1-TOPO vector using Hind3/Spe1 sites for the 5 homologous sequence and Xho1/Xba1 sites for 3 homologous sequence, respectively. The two sgRNA oligos were annealed to form double stranded DNA and cloned into the pSpCas9(BB)-2A-Puro plasmid encoding the CRISPR-CAS9 nuclease using the BbsI restriction enzyme.
[0138] For Clock: Clock CRISPR/Cas9 KO plasmid (sc-419693) and Clock HDR plasmid (sc-419693-HDR) were obtained from Santa Cruz Biotechnology. The Clock CRISPR/Cas9 KO plasmid consists of a pool of 3 plasmids, each encoding the Cas9 nuclease and a target-specific 20 nt guide RNA (gRNA). The sgRNA oligo sequences targeting Clock were as follows: 5 forward targeting sequence: TCCATCTTTCTCGCGTTACC (SEQ ID NO: 17) for a target of exon 6; 5 forward targeting sequence: TCCTGGTAACGCGAGAAAGA (SEQ ID NO: 18) for a target of exon 6; and 5 forward targeting sequence: AGATGCTAGTGAGATTCGAC (SEQ ID NO: 19) for a target of exon 7. The Clock HDR plasmid consists of a pool of plasmids, each containing a homology-directed DNA repair template corresponding to the cut sites generated by the Clock CRISPR/Cas9 KO plasmid. Each HDR template contains two 800 bp homology arms designed to specifically bind to the genomic DNA surrounding the corresponding Cas9-induced double-strand DNA break site. The HDR plasmid also incorporates an antibiotic resistance gene (puromycin) for selection of cells containing a successful CRISPR/Cas9 double strand break.
Transfection of CRISPR-CAS9 Plasmids and Stable Selection of Bmal1.sup./ and Clock.sup./ Cells (Related to
[0139] Beta TC-6 cells (passages 25-30) were plated into 6-well plates (Corning, Cat#353046) and cultured overnight. For Bmal1: The pSpCas9 vector containing sgRNAs (400 ng) and the Bmal1-HDR vector (600 ng) were transfected into Beta TC-6 cells by Lipofectamine 2000 (Thermo Fisher Scientific, Cat#11668027). After 48 hrs of transfection, the cells were treated with 500 g/ml of G418 Sulfate (Corning, Cat#30-234-CR) to select for neomycin resistant clones for 14 days. After G418 selection, more than 10 single colonies were hand-picked and cultured individually in 96 well plates (Corning, Cat#3603). RNA and protein were extracted from these colonies and Bmal1 expression was assessed by qPCR and Western blot. For Clock: The Clock CRISPR/Cas9 KO Plasmid (1 g) and Clock HDR Plasmid (1 g) were transfected into Beta TC-6 cells by Lipofectamine 2000 (Thermo Fisher Scientific, Cat#11668027). After 48 hrs of transfection, the cells were treated with 2 g/ml of puromycin (Sigma-Aldrich, Cat#P8833) to select for puromycin resistant clones for 14 days. After puromycin selection, more than 10 single colonies were hand-picked and cultured individually in 96 well plates (Corning, Cat#3603). RNA and protein were extracted and Clock expression was assessed by qPCR and Western blot.
Generation of Bmal1.sup./ Beta TC-6 Cells Stably Expressing Insulin Nanoluc (Related to
High-Throughput Screen for Drugs to Restore Insulin Secretion in Bmal1.SUP./ .Beta Cells and Insulin Secretion Assays (Related to FIG. 25):
[0140] The Spectrum Collection small molecule compound library (MicroSource Discovery Sytems, Inc), which consists of 2700 known drugs and drug-like molecules, was screened for compounds that augment insulin secretion in Bmal1.sup./ Beta TC-6 cells. Insulin Nanoluc-expressing Bmal1.sup./ Beta TC-6 cells (30,000 cells/well) were placed into 384 well plates and cultured for 4 days at 37 C. and 5% CO.sub.2. The cells were washed once and starved in KRB buffer containing 0 mM glucose for 1 hr. After removing the KRB, KRB buffer containing 20 mM glucose in addition to the small molecules (10 uM) were added, and the cells were incubated for 1 hr. As a negative control, 16 wells received KRB buffer with only 20 mM glucose, which fails to elicit insulin secretion in Bmal1.sup./ cells, and as a positive control, 16 wells received KRB buffer containing 20 mM glucose and 10 M PMA, which is known to induce insulin secretion in both Bmal1.sup./ mouse islets and Beta TC-6 cells. After 1 hr, the supernatant was collected and centrifuged at 500 g for 30 min. The supernatant was transferred into a fresh 384-well assay plate containing Nano-Glo Luciferase Assay Substrate (Promega), and luciferase intensity was measured by EnSpire Plate Reader (PerkinElmer) within 30 minutes.
Determination of Hit Compounds (Related to FIG. 26)
[0141] Z scores for luciferase intensities produced by screened compounds were calculated from the following formula: z=(X)/ (where z is the Z score, X is the intensity of the compounds, is the intensity of negative control (20 mM glucose), and is the standard deviation of negative control). A row-based correction factor was applied to all luciferase readings to adjust for logarithmic signal decay. Hit compounds were defined as those that elicited a response of greater than 3 standard deviations from the mean (Z score >3) and more than 1.2-fold increase compared to negative control.
Insulin Secretion Assays in Beta TC-6 Cells (Related to FIGS. 27-28)
[0142] Beta TC-6 cells (300,000 cells/well) were seeded into poly-L-lysine-coated 24 well plates and cultured for 48-72 hrs at 37 C. and 5% CO.sub.2. The cells were washed once and incubated in KRB buffer containing 0 mM glucose for 1 hr. Cells were then treated for 1 hr with KRB buffer containing 0 or 20 mM glucose in the presence of hit compounds (including ivermectin, alexidine, and tomatine at final concentrations of 10 and 100 M) or an equivalent volume of DMSO as a vehicle control. Supernatants were then collected and centrifuged at 500G for 30 min and assayed for insulin content by ELISA (Crystal Chem Inc). Cell lysates were harvested in acid-ethanol solution (0.18M HCl in 70% Ethanol), sonicated, and solubilized overnight at 4 C. before assaying total insulin content by ELISA. For insulin secretion assays following prolonged ivermectin treatment, cells were first treated with 10 m ivermectin for 24 hrs prior to the 1 hr incubation with 0 mM glucose KRB buffer.
Insulin Secretion Assays in Isolated Islets (Confirmation of Hit Compounds) (Related to FIG. 27)
[0143] Mouse pancreatic islets were isolated via bile duct collagenase digestion (Collagenase P, Sigma) and Ficoll gradient separation and left to recover overnight (16 hrs) at 37 C. in RPMI 1640 with 10% FBS, 1% L-glutamine, and 1% penicillin/streptomycin. For insulin release assays, 5 islets were statically incubated in Krebs-Ringer Buffer (KRB) and stimulated for 1 hr at 37 C. with 2 or 20 mM glucose in the presence or absence of 10 M ivermectin. Supernatant was collected and assayed for insulin content by ELISA (Crystal Chem Inc). Islets were then sonicated in acid-ethanol solution and solubilized overnight at 4 C. before assaying total insulin content by ELISA.
RNA Isolation and qPCR mRNA Quantification (Related to
[0144] RNA was extracted from Beta TC-6 cells using the Tri Reagent (Molecular Research Center, Inc) and frozen at 80 C. RNA was isolated according to the manufacturer's protocol and purified using Quick-RNA MiniPrep (ZYMO RESEARCH). cDNAs were then synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time PCR analysis was performed with SYBR Green Master Mix (Applied Biosystems) and analyzed using a Touch CFX384 Real-Time PCR Detection System (Bio-Rad). Relative expression levels were determined using the comparative C.sub.T method to normalize target gene mRNA to Gapdh. Primer sequences for qPCR as follows: Gapdh Forward: 5-ATCGCAAGAGGAAAGGCAGT-3(SEQ ID NO: 2), Reverse: 5-ATCCTTCCTTGGTGTTCTGCAT-3 (SEQ ID NO: 3); Chop Forward: 5-CCACCACACCTGAAAGCAGAA-3 (SEQ ID NO: 20), Reverse: 5-AGGTGAAAGGCAGGGACTCA-3 (SEQ ID NO: 21); Atf3 Forward: 5-GCTGGAGTCAGTTACCGTCAA-3 (SEQ ID NO: 22), Reverse: 5-ATGTGTTGCAGAACGCACCT-3 (SEQ ID NO: 23); Nr4a2 Forward: 5-CACGCGAGTGTTCTTTTCCG-3 (SEQ ID NO: 24), Reverse: 5-AAGTCCGTGGTGATGCTACG-3 (SEQ ID NO: 25).
RNA-Sequencing and Analysis (Related to FIG. 29)
[0145] Following RNA isolation (described above), RNA quality was assessed using a Bioanalyzer (Agilent), and sequencing libraries were constructed using a NEBNext Ultra Directional RNA Library Prep Kit for Illumina (New England BioLabs, E7420L) according to the manufacturer's instructions. Libraries were quantified using both a Bioanalyzer (Agilent) and NEBNext Library Quant Kit for Illumina (New England BioLabs, E7630L) and sequenced on either an Illumina NextSeq 500 instrument to a depth of at least 10 million reads using 75 bp paired-end reads. For differential expression analysis, RNA raw sequence reads were aligned to the reference genome (mm10) using STAR version 2.3.1s_r366 and transcripts were counted using the featureCounts function within the R package subRead version 1.5.1. Differentially expressed RNAs were identified using DESeq2 version 1.6.3. (FDR-adjusted p-value <0.05). For gene ontology enrichment analysis, deferential expressed gene list were assessed with Metascape 1.0 (http://metascape.org).
Intracellular Calcium Determination (Related to FIGS. 27-28)
[0146] BetaTC-6 cells were plated at a density of 100,000 cells per well in black 96-well plates with clear bottoms and cultured overnight at 37 C. and 5% CO.sub.2. Cells were then washed with BSA-free KRB buffer with no glucose and loaded with 5 M Fura-2 (Invitrogen) and 0.04% Pluronic F-127 (Invitrogen) for 30 min at 37 C. Following a wash with BSA-free KRB, Fura-2 intensity was measured following injection of either glucose alone or indicated compounds. Cells were alternately excited with 340 nm and 380 nm wavelength light, and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (Bio Tek) at sequential 30-second intervals. Raw fluorescence data were exported to Microsoft Excel and expressed as the 340/380 ratio for each well.
Protein Gel Electrophoresis and Immunoblotting (FIG. 23)
[0147] Beta TC-6 cells lysates were prepared in CelLytic MT Mammalian Tissue Lysis Reagent (Sigma) supplemented with protease inhibitors. Protein levels were quantified using DC Protein Assay (Bio-Rad), and protein extracts were subject to SDS-PAGE gel electrophoresis and transferred to nitrocellulose membranes (GE Healthcare). Primary antibodies used were anti-BMAL1 (Santa Cruz Biotechnology, sc-48790), anti-CLOCK (Santa Cruz Biotechnology, sc-25361) and anti--ACTIN (Cell Signaling).
REFERENCES
[0148] The following references, some of which are cited above, are incorporated by reference in their entireties. [0149] N. Preitner, F. Damiola, L. Lopez-Molina, J. Zakany, D. Duboule, U. Albrecht, U. Schibler, The orphan nuclear receptor REV-ERB controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110, 251-260 (2002). doi:10.1016/S0092-8674(02)00825-5 pmid:12150932 [0150] I. Zamir, H. P. Harding, G. B. Atkins, A. Horlein, C. K. Glass, M. G. Rosenfeld, M. A. Lazar, A nuclear hormone receptor corepressor mediates transcriptional silencing by receptors with distinct repression domains. Mol. Cell. Biol. 16, 5458-5465 (1996). doi:10.1128/MCB.16.10.5458 pmid:8816459 [0151] A. Balsalobre, F. Damiola, U. Schibler, A serum shock induces circadian gene expression in mammalian tissue culture cells. Cell 93, 929-937 (1998). doi:10.1016/S0092-8674(00)81199-X pmid:9635423 [0152] F. W. Turek, C. Joshu, A. Kohsaka, E. Lin, G. Ivanova, E. McDearmon, A. Laposky, S. Losee-Olson, A. Easton, D. R. Jensen, R. H. Eckel, J. S. Takahashi, J. Bass, Obesity and metabolic syndrome in circadian Clock mutant mice. Science 308, 1043-1045 (2005). doi:10.1126/science.1108750 pmid:15845877 [0153] K. A. Lamia, K. F. Storch, C. J. Weitz, Physiological significance of a peripheral tissue circadian clock. Proc. Natl. Acad. Sci. U.S.A. 105, 15172-15177 (2008). doi:10.1073/pnas.0806717105 pmid:18779586 [0154] B. Marcheva, K. M. Ramsey, E. D. Buhr, Y. Kobayashi, H. Su, C. H. Ko, G. Ivanova, C. Omura, S. Mo, M. H. Vitaterna, J. P. Lopez, L. H. Philipson, C. A. Bradfield, S. D. Crosby, L. JeBailey, X. Wang, J. S. Takahashi, J. Bass, Disruption of the clock components CLOCK and BMAL1 leads to hypoinsulinaemia and diabetes. Nature 466, 627-631 (2010). doi:10.1038/nature09253 pmid:20562852 [0155] L. A. Sadacca, K. A. Lamia, A. S. deLemos, B. Blum, C. J. Weitz, An intrinsic circadian clock of the pancreas is required for normal insulin release and glucose homeostasis in mice. Diabetologia 54, 120-124 (2011). doi:10.1007/s00125-010-1920-8 pmid:20890745 [0156] C. B. Peek, A. H. Affinati, K. M. Ramsey, H. Y. Kuo, W. Yu, L. A. Sena, O. Ilkayeva, B. Marcheva, Y. Kobayashi, C. Omura, D. C. Levine, D. J. Bacsik, D. Gius, C. B. Newgard, E. Goetzman, N. S. Chandel, J. M. Denu, M. Mrksich, J. Bass, Circadian clock NAD+ cycle drives mitochondrial oxidative metabolism in mice. Science 342, 1243417 (2013). doi:10.1126/science.1243417 pmid:24051248 [0157] N. Koike, S. H. Yoo, H. C. Huang, V. Kumar, C. Lee, T. K. Kim, J. S. Takahashi, Transcriptional architecture and chromatin landscape of the core circadian clock in mammals. Science 338, 349-354 (2012). doi:10.1126/science.1226339 pmid:22936566 [0158] B. Fang, L. J. Everett, J. Jager, E. Briggs, S. M. Armour, D. Feng, A. Roy, Z. Gerhart-Hines, Z. Sun, M. A. Lazar, Circadian enhancers coordinate multiple phases of rhythmic gene transcription in vivo. Cell 159, 1140-1152 (2014). doi:10.1016/j.cell.2014.10.022 pmid:25416951 [0159] J. S. Menet, J. Rodriguez, K. C. Abruzzi, M. Rosbash, Nascent-Seq reveals novel features of mouse circadian transcriptional regulation. eLife 1, e00011 (2012). pmid:23150795 [0160] S. H. Yoo, S. Yamazaki, P. L. Lowrey, K. Shimomura, C. H. Ko, E. D. Buhr, S. M. Siepka, H. K. Hong, W. J. Oh, O. J. Yoo, M. Menaker, J. S. Takahashi, PERIOD2:LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues. Proc. Natl. Acad. Sci. U.S.A. 101, 5339-5346 (2004). pmid:14963227 [0161] J. S. O'Neill, E. S. Maywood, J. E. Chesham, J. S. Takahashi, M. H. Hastings, cAMP-dependent signaling as a core component of the mammalian circadian pacemaker. Science 320, 949-953 (2008). doi:10.1126/science.1152506 pmid:18487196 [0162] A. L. Hutchison, M. Maienschein-Cline, A. H. Chiang, S. M. Tabei, H. Gudjonson, N. Bahroos, R. Allada, A. R. Dinner, Improved statistical methods enable greater sensitivity in rhythm detection for genome-wide data. PLOS Comput. Biol. 11, e1004094 (2015). doi:10.1371/journal.pcbi.1004094 pmid:25793520 [0163] H. R. Ueda, S. Hayashi, W. Chen, M. Sano, M. Machida, Y. Shigeyoshi, M. Iino, S. Hashimoto, System-level identification of transcriptional circuits underlying mammalian circadian clocks. Nat. Genet. 37, 187-192 (2005). doi:10.1038/ng1504 pmid:15665827 [0164] X. W. Chen, H. Wang, K. Bajaj, P. Zhang, Z. X. Meng, D. Ma, Y. Bai, H. H. Liu, E. Adams, A. Baines, G. Yu, M. A. Sartor, B. Zhang, Z. Yi, J. Lin, S. G. Young, R. Schekman, D. Ginsburg, SEC24A deficiency lowers plasma cholesterol through reduced PCSK9 secretion. eLife 2, e00444 (2013). doi:10.7554/eLife.00444 pmid:23580231 [0165] A. J. Noble, Q. Zhang, J. O'Donnell, H. Hariri, N. Bhattacharya, A. G. Marshall, S. M. Stagg, A pseudoatomic model of the COPII cage obtained from cryo-electron microscopy and mass spectrometry. Nat. Struct. Mol. Biol. 20, 167-173 (2013). doi:10.1038/nsmb.2467 pmid:23262493 [0166] Z. Wang, D. C. Thurmond, Mechanisms of biphasic insulin-granule exocytosisroles of the cytoskeleton, small GTPases and SNARE proteins. J. Cell Sci. 122, 893-903 (2009). doi:10.1242/jcs.034355 pmid:19295123 [0167] Y. Liu, Y. Sugiura, W. Lin, The role of synaptobrevinl/VAMP1 in Ca2+-triggered neurotransmitter release at the mouse neuromuscular junction. J. Physiol. 589, 1603-1618 (2011). doi:10.1113/jphysiol.2010.201939 pmid:21282288 [0168] M. Ohara-Imaizumi, C. Nishiwaki, Y. Nakamichi, T. Kikuta, S. Nagai, S. Nagamatsu, Correlation of syntaxin-1 and SNAP-25 clusters with docking and fusion of insulin granules analysed by total internal reflection fluorescence microscopy. Diabetologia 47, 2200-2207 (2004). doi:10.1007/s00125-004-1579-0 pmid:15647897 [0169] K. Fujimoto, T. Shibasaki, N. Yokoi, Y. Kashima, M. Matsumoto, T. Sasaki, N. Tajima, T. Iwanaga, S. Seino, Piccolo, a Ca2+ sensor in pancreatic beta-cells. Involvement of cAMP-GEFII.Rim2. Piccolo complex in cAMP-dependent exocytosis. J. Biol. Chem. 277, 50497-50502 (2002). doi:10.1074/jbc.M210146200 pmid:12401793 [0170] H. Takahashi, T. Shibasaki, J. H. Park, S. Hidaka, T. Takahashi, A. Ono, D. K. Song, S. Seino, Role of Epac2A/Rapl signaling in interplay between incretin and sulfonylurea in insulin secretion. Diabetes 64, 1262-1272 (2015). pmid:25315008 [0171] M. Fukuda, Molecular cloning, expression, and characterization of a novel class of synaptotagmin (Syt XIV) conserved from Drosophila to humans. J. Biochem. 133, 641-649 (2003). doi:10.1093/jb/mvg082 pmid:12801916 [0172] A. Milochau, V. Lagree, M. N. Benassy, S. Chaignepain, J. Papin, I. Garcia-Arcos, A. Lajoix, C. Monterrat, L. Coudert, J. M. Schmitter, B. Ochoa, J. Lang, Synaptotagmin 11 interacts with components of the RNA-induced silencing complex RISC in clonal pancreatic -cells. FEBS Lett. 588, 2217-2222 (2014). pmid:24882364 [0173] R. A. Easom, CaM kinase II: A protein kinase with extraordinary talents germane to insulin exocytosis. Diabetes 48, 675-684 (1999). doi: 10.2337/diabetes.48.4.675 pmid: 10102681 [0174] T. J. Biden, C. Schmitz-Peiffer, J. G. Burchfield, E. Gurisik, J. Cantley, C. J. Mitchell, L. Carpenter, The diverse roles of protein kinase C in pancreatic beta-cell function. Biochem. Soc. Trans. 36, 916-919 (2008). doi:10.1042/BST0360916 pmid:18793161 [0175] X. Zhang, K. Orlando, B. He, F. Xi, J. Zhang, A. Zajac, W. Guo, Membrane association and functional regulation of Sec3 by phospholipids and Cdc42. J. Cell Biol. 180, 145-158 (2008). doi:10.1083/jcb.200704128 pmid:18195105 [0176] G. Jedd, J. Mulholland, N. Segev, Two new Ypt GTPases are required for exit from the yeast trans-Golgi compartment. J. Cell Biol. 137, 563-580 (1997). doi:10.1083/jcb.137.3.563 pmid:9151665 [0177] P. Pulimeno, T. Mannic, D. Sage, L. Giovannoni, P. Salmon, S. Lemeille, M. Giry-Laterriere, M. Unser, D. Bosco, C. Bauer, J. Morf, P. Halban, J. Philippe, C. Dibner, Autonomous and self-sustained circadian oscillators displayed in human islet cells. Diabetologia 56, 497-507 (2013). doi:10.1007/s00125-012-2779-7 pmid:23242133 [0178] C. Benner, T. van der Meulen, E. Caceres, K. Tigyi, C. J. Donaldson, M. O. Huising, The transcriptional landscape of mouse beta cells compared to human beta cells reveals notable species differences in long non-coding RNA and protein-coding gene expression. BMC Genomics 15, 620 (2014). doi:10.1186/1471-2164-15-620 pmid:25051960 [0179] L. Pasquali, K. J. Gaulton, S. A. Rodriguez-Segui, L. Mularoni, I. Miguel-Escalada, I. Akerman, J. J. Tena, I. Moran, C. Gmez-Marin, M. van de Bunt, J. Ponsa-Cobas, N. Castro, T. Nammo, I. Cebola, J. Garcia-Hurtado, M. A. Maestro, F. Pattou, L. Piemonti, T. Berney, A. L. Gloyn, P. Ravassard, J. L. Gmez-Skarmeta, F. Miller, M. I. McCarthy, J. Ferrer, Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Nat. Genet. 46, 136-143 (2014). doi:10.1038/ng.2870 pmid:24413736 [0180] M. P. Creyghton, A. W. Cheng, G. G. Welstead, T. Kooistra, B. W. Carey, E. J. Steine, J. Hanna, M. A. Lodato, G. M. Frampton, P. A. Sharp, L. A. Boyer, R. A. Young, R. Jaenisch, Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. U.S.A. 107, 21931-21936 (2010). doi:10.1073/pnas.1016071107 pmid:21106759 [0181] H. H. He, C. A. Meyer, H. Shin, S. T. Bailey, G. Wei, Q. Wang, Y. Zhang, K. Xu, M. Ni, M. Lupien, P. Mieczkowski, J. D. Lieb, K. Zhao, M. Brown, X. S. Liu, Nucleosome dynamics define transcriptional enhancers. Nat. Genet. 42, 343-347 (2010). doi:10.1038/ng.545 pmid:20208536 [0182] G. Rey, F. Cesbron, J. Rougemont, H. Reinke, M. Brunner, F. Naef, Genome-wide and phase-specific DNA-binding rhythms of BMAL1 control circadian output functions in mouse liver. PLOS Biol. 9, e1000595 (2011). doi:10.1371/journal.pbio.1000595 pmid:21364973 [0183] N. D. Heintzman, R. K. Stuart, G. Hon, Y. Fu, C. W. Ching, R. D. Hawkins, L. O. Barrera, S. Van Calcar, C. Qu, K. A. Ching, W. Wang, Z. Weng, R. D. Green, G. E. Crawford, B. Ren, Distinct and predictive chromatin signatures of transcriptional promoters and enhancers in the human genome. Nat. Genet. 39, 311-318 (2007). doi:10.1038/ng1966 pmid:17277777 [0184] S. J. Cooper, N. D. Trinklein, E. D. Anton, L. Nguyen, R. M. Myers, Comprehensive analysis of transcriptional promoter structure and function in 1% of the human genome. Genome Res. 16, 1-10 (2006). doi:10.1101/gr.4222606 pmid:16344566 [0185] P. Carninci, A. Sandelin, B. Lenhard, S. Katayama, K. Shimokawa, J. Ponjavic, C. A. Semple, M. S. Taylor, P. G. Engstrom, M. C. Frith, A. R. Forrest, W. B. Alkema, S. L. Tan, C. Plessy, R. Kodzius, T. Ravasi, T. Kasukawa, S. Fukuda, M. Kanamori-Katayama, Y. Kitazume, H. Kawaji, C. Kai, M. Nakamura, H. Konno, K. Nakano, S. Mottagui-Tabar, P. Arner, A. Chesi, S. Gustincich, F. Persichetti, H. Suzuki, S. M. Grimmond, C. A. Wells, V. Orlando, C. Wahlestedt, E. T. Liu, M. Harbers, J. Kawai, V. B. Bajic, D. A. Hume, Y. Hayashizaki, Genome-wide analysis of mammalian promoter architecture and evolution. Nat. Genet. 38, 626-635 (2006). doi:10.1038/ng1789 pmid:16645617 [0186] C. Vollmers, R. J. Schmitz, J. Nathanson, G. Yeo, J. R. Ecker, S. Panda, Circadian oscillations of protein-coding and regulatory RNAs in a highly dynamic mammalian liver epigenome. Cell Metab. 16, 833-845 (2012). doi:10.1016/j.cmet.2012.11.004 pmid:23217262 [0187] D. A. Stoffers, N. T. Zinkin, V. Stanojevic, W. L. Clarke, J. F. Habener, Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF 1 gene coding sequence. Nat. Genet. 15, 106-110 (1997). doi:10.1038/ng0197-106 pmid:8988180 [0188] B. G. Hoffman, G. Robertson, B. Zavaglia, M. Beach, R. Cullum, S. Lee, G. Soukhatcheva, L. Li, E. D. Wederell, N. Thiessen, M. Bilenky, T. Cezard, A. Tam, B. Kamoh, I. Birol, D. Dai, Y. Zhao, M. Hirst, C. B. Verchere, C. D. Helgason, M. A. Marra, S. J. Jones, P. A. Hoodless, Locus co-occupancy, nucleosome positioning, and H3K4mel regulate the functionality of FOXA2-, HNF4A-, and PDX1-bound loci in islets and liver. Genome Res. 20, 1037-1051 (2010). doi:10.1101/gr.104356.109 pmid:20551221 [0189] C. Gu, G. H. Stein, N. Pan, S. Goebbels, H. Hornberg, K. A. Nave, P. Herrera, P. White, K. H. Kaestner, L. Sussel, J. E. Lee, Pancreatic beta cells require NeuroD to achieve and maintain functional maturity. Cell Metab. 11, 298-310 (2010). doi:10.1016/j.cmet.2010.03.006 pmid:20374962 [0190] L. Kang, Z. He, P. Xu, J. Fan, A. Betz, N. Brose, T. Xu, Munc13-1 is required for the sustained release of insulin from pancreatic beta cells. Cell Metab. 3, 463-468 (2006). doi:10.1016/j.cmet.2006.04.012 pmid:16697276 [0191] O. Gen, O. Kochubey, R. F. Toonen, M. Verhage, R. Schneggenburger, Munc18-1 is a dynamically regulated PKC target during short-term enhancement of transmitter release. eLife 3, e01715 (2014). doi:10.7554/eLife.01715 pmid:24520164 [0192] C. J. Morris, J. N. Yang, J. I. Garcia, S. Myers, I. Bozzi, W. Wang, O. M. Buxton, S. A. Shea, F. A. Scheer, Endogenous circadian system and circadian misalignment impact glucose tolerance via separate mechanisms in humans. Proc. Natl. Acad. Sci. U.S.A. 112, E2225-E2234 (2015). doi:10.1073/pnas.1418955112 pmid:25870289 [0193] O. M. Buxton, S. W. Cain, S. P. O'Connor, J. H. Porter, J. F. Duffy, W. Wang, C. A. Czeisler, S. A. Shea, Adverse metabolic consequences in humans of prolonged sleep restriction combined with circadian disruption. Sci. Transl. Med. 4, 129ra43 (2012). pmid:22496545 [0194] A. Bonnefond, N. Clement, K. Fawcett, L. Yengo, E. Vaillant, J. L. Guillaume, A. Dechaume, F. Payne, R. Roussel, S. Czernichow, S. Hercberg, S. Hadjadj, B. Balkau, M. Marre, O. Lantieri, C. Langenberg, N. Bouatia-Naji, G. Charpentier, M. Vaxillaire, G. Rocheleau, N. J. Wareham, R. Sladek, M. I. McCarthy, C. Dina, I. Barroso, R. Jockers, P. Froguel, Rare MTNR1B variants impairing melatonin receptor 1B function contribute to type 2 diabetes. Nat. Genet. 44, 297-301 (2012). doi:10.1038/ng.1053 pmid:22286214 [0195] B. P. Johnson et al., The hepatocyte circadian clock controls acetaminophen bioactivation through NADPH-cytochrome P450 oxidoreductase. Proc. Natl. Acad. Sci. U.S.A. 111, 18757-18762 (2014). doi:10.1073/pnas.1421708111 pmid:25512522 [0196] G. Gu, J. Dubauskaite, D. A. Melton, Direct evidence for the pancreatic lineage: NGN3+ cells are islet progenitors and are distinct from duct progenitors. Development 129, 2447-2457 (2002). pmid: 11973276 [0197] A. Dobin, C. A. Davis, F. Schlesinger, J. Drenkow, C. Zaleski, S. Jha, P. Batut, M. Chaisson, T. R. Gingeras, STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21 (2013). doi: 10.1093/bioinformatics/bts635 pmid:23104886 [0198] M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014). doi:10.1186/s13059-014-0550-8 pmid:25516281 [0199] M. Kanehisa, S. Goto, Y. Sato, M. Kawashima, M. Furumichi, M. Tanabe, Data, information, knowledge and principle: Back to metabolism in KEGG. Nucleic Acids Res. 42, D199-D205 (2014). doi:10.1093/nar/gkt1076 pmid:24214961 [0200] H. Ogata, S. Goto, K. Sato, W. Fujibuchi, H. Bono, M. Kanehisa, KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 27, 29-34 (1999). doi:10.1093/nar/27.1.29 pmid:9847135 [0201] S. Heinz, C. Benner, N. Spann, E. Bertolino, Y. C. Lin, P. Laslo, J. X. Cheng, C. Murre, H. [0202] Singh, C. K. Glass, Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576-589 (2010). doi:10.1016/j.molcel.2010.05.004 pmid:20513432 [0203] B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009). doi:10.1186/gb-2009-10-3-r25 pmid:19261174
[0204] All publications and patents mentioned in the above specification are herein incorporated by reference as if expressly set forth herein. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in relevant fields are intended to be within the scope of the following claims.