Modulation of the Immune Response
20180125971 ยท 2018-05-10
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
A61K31/427
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
A61K31/357
HUMAN NECESSITIES
A61K31/407
HUMAN NECESSITIES
A61P43/00
HUMAN NECESSITIES
A61K31/137
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
A61K2035/122
HUMAN NECESSITIES
A61K39/46433
HUMAN NECESSITIES
A61K31/135
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
A61K31/4045
HUMAN NECESSITIES
A61K2239/38
HUMAN NECESSITIES
A61K31/405
HUMAN NECESSITIES
International classification
A61K39/395
HUMAN NECESSITIES
A61K31/135
HUMAN NECESSITIES
A61K31/4045
HUMAN NECESSITIES
A61K31/405
HUMAN NECESSITIES
A61K31/357
HUMAN NECESSITIES
G01N33/50
PHYSICS
A61K31/407
HUMAN NECESSITIES
A61K31/137
HUMAN NECESSITIES
Abstract
Methods for identifying compounds that modulate the generation of regulatory T cells (Treg) in vivo and in vitro, i.e., compounds that act on the transcription factors that increase or decrease expression of Foxp3.
Claims
1. A composition comprising a ligand that binds specifically to an aryl hydrocarbon receptor (AHR) transcription factor, linked to a biocompatible nanoparticle.
2. The composition of claim 1, wherein the ligand is a small molecule that competes for binding to the AHR competitively with 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD) and activates AHR-dependent signaling.
3. The composition of claim 1, wherein the ligand is 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD).
4. The composition of claim 1, wherein the ligand is tryptamine (TA).
5. The composition of claim 1, further comprising a monoamine oxidase inhibitor such as tranylcypromine.
6. The composition of claim 1, wherein the ligand is 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE).
7. The composition of claim 1, wherein the ligand is 6-formylindolo[3,2-b]carbazole (FICZ).
8. The composition of claim 1, further comprising an antibody that selectively binds to an antigen present on a T cell, a B cell, a dendritic cell, or a macrophage.
9. The composition of claim 8, wherein the antibody is linked to the biocompatible nanoparticle.
10. A method for increasing the number of CD4/CD25/Foxp3-expressing T regulatory (Treg) cells in a population of T cells, the method comprising: contacting the population of cells with a sufficient amount of a composition comprising one or more AHR ligands selected from the group consisting of 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), tryptamine (TA), and 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE), wherein the ligand is linked to a biocompatible nanoparticle, and optionally evaluating the presence and/or number of CD4/CD25/Foxp3-expressing cells in the population; wherein the method results in an increase in the number and/or activity of regulatory T cells (Treg).
11. The method of claim 10, wherein the population of T cells comprises na?ve T cells or CD4.sup.+CD62 ligand.sup.+ T cells.
12. The method of claim 10, further comprising administering the Treg cells to a subject suffering from an autoimmune disorder, in an amount sufficient to improve or ameliorate a symptom of the disorder.
13. The method of claim 10, wherein the population of T cells is in a living mammalian subject.
14. The method of claim 13, wherein the subject has an autoimmune disorder.
15. The method of claim 14, wherein the autoimmune disorder is multiple sclerosis.
16. The method of claim 13, comprising administering the one or more ligands orally.
17. The method of claim 13, comprising administering the one or more ligands intravenously.
18. A method of identifying a candidate compound that increases generation or activity of regulatory T cells (Treg), the method comprising: providing a cell expressing a reporter construct comprising a binding sequence for the Aryl Hyrocarbon Receptor (AHR) in a mammalian Foxp3 promoter sequence, wherein said binding sequence is operably linked to a reporter gene, for example a reporter gene selected from the group consisting of luciferase, green fluorescent protein, and variants thereof, contacting the cell with a test compound; and evaluating an effect of the test compound on expression of the reporter gene, wherein a test compound that increases or decreases expression of the reporter gene is a candidate compound that modulates generation of Treg.
19. The method of claim 18, further comprising measuring expression of the reporter construct in the presence of a known AHR ligand selected from the group consisting of 2,3,7,8 tetrachlorodibenzo-p-dioxin (TCDD), tryptamine (TA), and 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE), or a compound that binds to the AHR competitively therewith; determining whether the candidate compound competes for binding to the AHR with the known compound; and selecting the candidate compound if it binds the AHR competitively with the known compound.
Description
DESCRIPTION OF DRAWINGS
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
DETAILED DESCRIPTION
[0105] Because of the importance of the central role Tregs play in immunomodulation, characterization of the pathways and identification of compounds capable of modulating these pathways, e.g., to promote the generation (e.g., differentiation of cells to or towards) Treg cells or that promote increased activity of Tregs is important for the treatment of, e.g., autoimmunity, infections and cancer.
[0106] The present invention provides, inter alia, compositions and methods useful for therapeutic immunomodulation.
[0107] Accordingly, the present invention is based, at least in part, on the discovery that modulation of the AhR by compounds described herein can be used to modulate (e.g., increase or decrease the number and/or activity of) immunomodulatory cells in vitro and in vivo.
[0108] In some embodiments, the present invention is based on the identification of the ligand-activated transcription factor aryl hydrocarbon receptor (AHR) as a Foxp3 dependent regulator of Treg differentiation (e.g., generation) and/or activity in vitro and in vivo. Also described herein are ligands of a transcription factor (e.g., AHR) that cause increased Treg expression and/or activity. More specifically, the data presented herein demonstrates the use of AHR-specific ligands, e.g., the high affinity AHR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE), to promote an increase in the number and/or activity of Treg immunomodulatory cells, which will be useful to suppress the immune response in the treatment of diseases or disorders caused by an abnormal (e.g., an excessive, elevated, or inappropriate) immune response, e.g., an autoimmune disease or disorder. Surprisingly, effective doses of TCDD can be administered intravenously or orally.
[0109] Other potentially useful AHR transcription factor ligands are described in Denison and Nagy, Ann. Rev. Pharmacol. Toxicol., 43:309-34, 2003, and references cited herein, all of which are incorporated herein in their entirety. Other such molecules include planar, hydrophobic HAHs (such as the polyhalogenated dibenzo-pdioxins, dibenzofurans, and biphenyls) and PAHs (such as 3-methylcholanthrene, benzo(a)pyrene, benzanthracenes, and benzoflavones), and related compounds. (Denison and Nagy, 2003, supra). Nagy et al., Toxicol. Sci. 65:200-10 (2002), described a high-throughput screen useful for identifying and confirming other ligands. See also Nagy et al., Biochem. 41:861-68 (2002). In some embodiments, those ligands useful in the present invention are those that bind competitively with TCDD, TA, and/or ITE.
[0110] In some embodiments, the present invention provides methods useful for identifying transcription factors (e.g., ligand-activated transcription factors) and/or ligands (e.g., ligands capable of promoting an increased association between a ligand-activated transcription factor and Foxp3) capable of modulating (e.g., increasing or decreasing) Foxp3 expression or activity.
Therapeutic Sequences
[0111] As stated above, the present invention includes the identification of specific transcription factor binding sites in the Foxp3 gene. These binding sites include, i.e., NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, and Delta EF1. As described herein, manipulating activity and/or levels of those TFs can alter expression of Foxp3, and thus modulate (e.g., promote) generation and/or increased activity of Treg in vivo and in vitro. Compounds that modulate the activity and/or levels of those TFs to increase generation and/or activity of Treg are useful, e.g., in the treatment of disorders in which it is desirable to decrease an aberrant immune response, e.g., autoimmune diseases.
[0112] Sequences useful in the methods described herein include, but are not limited to, e.g., NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and Delta EF1 sequences, and TF binding sequences therefore, all of which are known in the art. In some embodiments, the methods include the use of nucleic acids or polypeptides that are at least 80% identical to a human NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, or Delta EF1 sequence, e.g., at least 80%, 85%, 90%, or 95% identical to a human sequence as described herein.
[0113] To determine the percent identity of two sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 60%, e.g., at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
[0114] The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In the present methods, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch ((1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available on the world wide web at www.gcg.com), using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0115] Active fragments of TFs useful in the methods described herein are those fragments that bind to the same DNA sequence (e.g., promoter sequence) that the full-length TF binds to, and has at least 30% of the transcription initiating activity of the full-length TF, e.g., at least 40%, 50%, 60%, 70%, 80%, 90% or more of the activity of the full-length protein, on the same promoters and the same genes as the full-length protein.
[0116] Foxp3
[0117] At least in some species, Treg differentiation and function is driven by the transcription factor Foxp3 (Fontenot et al., Nat. Immunol., 4:330-336, 2003; Hori et al., Science, 299:1057-61, 2003). Foxp3 may also be important for human Treg; mutations in Foxp3 have been linked to various immunological conditions (e.g., autoimmune conditions), for example, autoimmune syndrome immune dysregulation, polyendocrinopathy, and enteropathy X-linked (IPEX) (Chatila et al., J. Clin. Invest., 106:R75-81 (2000); Gavin et al., Proc. Natl. Acad. Sci. U.S.A., 103: 6659-64 (2006)). In humans, Foxp3-negative Tregs have also been described, see, e.g., Roncarolo and Gregori, Eur J Immunol. 38, 925 (2008).
[0118] Exemplary human Foxp3 mRNA sequences are known in the art and include Genbank Acc. No. NM_014009.2; the amino acid sequence of the protein is Genbank Acc. No. NP_054728.2. The sequence of the human Foxp3 gene can be found at NC_000023.9; the mouse gene is at NT_039700.6. The Foxp3 promoter has been identified and sequenced, see, e.g., Mantel et al., J. Immunol. 176 (6): 3593 (2006). All of the binding sites for AHR in the mouse Foxp3 gene are highlighted, e.g., in
Transcription Factors that Increase Transcription of Foxp3
[0119] As described herein, NKX22, AHR, and Delta EF1 increase transcription of Foxp3. Therefore, compounds that increase levels and/or activity of these TFs would increase the generation and/or activity of Treg. Conversely, compounds that decrease levels and/or activity of these TFs would be expected to decrease generation of Tregs, thereby increasing the immune response.
[0120] AHR
[0121] Exemplary human AhR mRNA sequences are known in the art and include Genbank Acc. No. NM_001621.3; the amino acid sequence of the protein is Genbank Acc. No. NP_001612.1. Active fragments of AhR are DNA binding fragments with transcription activity, and contain at least one PAS region, e.g., amino acids 122-224 or 282-381 of NP_001612.1. Consensus recognition sequences that bind AhR include the sequence TNGCGTG.
[0122] DeltaEF1
[0123] Exemplary human DeltaEF1 mRNA sequences are known in the art and include Genbank Acc. No. NM_030751.3; the amino acid sequence of the protein is Genbank Acc. No. NP_110378.2. Consensus recognition sequences that bind DeltaEF1 include the sequences CACCT and CACCTG (Sekido et al., Genes Cells 2:771-783 (1997)).
[0124] NKX2.2
[0125] Exemplary human NKX2.2 mRNA sequences are known in the art and include Genbank Acc. No. NM_002509.2; the amino acid sequence of the protein is Genbank Acc. No. NP_002500.1. Consensus recognition sequences that bind NKX2.2 include the sequences ACTTGAT and T(T/C)AAGT(A/G)(C/G)TT (SEQ ID NO: 140)(Watada et al., Proc. Natl. Acad. Sci. U.S.A. 97(17):9443-9448 (2000))
Transcription Factors that Decrease Transcription of Foxp3
[0126] As described herein, EGR1, EGR2, EGR3, and NGFIC (EGR4) decrease transcription of Foxp3. Therefore, compounds that increase levels and/or activity of these TFs would decrease generation of Tregs, thereby increasing the immune response. Conversely, compounds that decrease levels and/or activity of these TFs would be expected to increase generation of Tregs, reducing the immune response.
[0127] EGR1
[0128] The sequence of human egr1 protein is available in the GenBank database at Accession No. NP 001955.1; the mRNA is at Accession No. NM 001964.2. Additional information regarding egr1 can be found on the internet at ncbi.nlm.nih.gov, in the UniGene database at UniGene Hs.326035, and in the Entrez Gene database at GeneID: 1958. Consensus recognition sequences that bind EGR1 include the sequence 5GCG(G/T)GGGCG3 (SEQ ID NO:141) (Nakagama et al., Mol. Cell. Biol., 15 (3):1489-1498 (1995)).
[0129] Active fragments of egr1 include those portions of the protein that bind DNA, e.g., one or more of the two C2H2 type DNA-binding zinc fingers (see, e.g., Sukhatme et al., 1988, supra), e.g., amino acids 338-362 and/or 368-390 of GenBank Acc. No. NP_001955.1. Exemplary active fragments are described in Huang et al., Cancer Res. 1995; 55(21):5054-5062, and in Jain et al., J. Biol. Chem. 1996; 271(23):13530-6.
[0130] Inhibitors of egr-1 are described in WO2007/118157.
[0131] EGR2
[0132] The sequence of human egr2 protein is available in the GenBank database at Accession No. NP_000390.2; the mRNA is at Accession No. NM_000399.2.
[0133] Consensus recognition sequences that bind EGR2 include the sequences GCGGGGGCG (SEQ ID NO: 142) and T-G-C-G-T/g-G/A-G-G-C/a/t-G-G/T (SEQ ID NO: 143)(lowercase letters indicate bases selected less frequently) (Swirnoff and Milbrandt, Mol. Cell. Biol. 15:2275-2287 (1995)).
[0134] EGR3
[0135] The sequence of human egr3 protein is available in the GenBank database at Accession No. NP_004421.2; the mRNA is at Accession No. NM_004430.2. The gen
[0136] Consensus recognition sequences that bind EGR3 include the sequences GCGGGGGCG (SEQ ID NO: 142) and T-G-C-G-T/g-G/A-G-G-C/a/t-G-G/T (SEQ ID NO: 143) (lowercase letters indicate bases selected less frequently) (Swimoff and Milbrandt, Mol. Cell. Biol. 15:2275-2287 (1995)).
[0137] NGFIC (EGR4)
[0138] Exemplary human NGFIC mRNA sequences are known in the art and include Genbank Acc. No. NM_001965.2; the amino acid sequence of the protein is Genbank Acc. No. NP_001956.2. See Crosby et al., Mol Cell Biol. 11(8):3835-41 (1991).
[0139] Consensus recognition sequences that bind NGFIC include the sequences GCGGGGGCG (SEQ ID NO: 142) and T-G-C-G-T/g-G/A-G-G-C/a/t-G-G/T (SEQ ID NO: 143) (lowercase letters indicate bases selected less frequently) (Swirnoff and Milbrandt, Mol. Cell. Biol. 15:2275-2287 (1995)).
Methods of Identifying Compounds that Modulate Expression, Levels or Activity of One or More of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and Delta EF1
[0140] A number of methods are known in the art for evaluating whether a compound alters expression, levels or activity of one or more of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, and/or Delta EF1.
[0141] Methods of assessing expression are well known in the art and include, but are not limited to, Northern analysis, ribonuclease protection assay, reverse transcription-polymerase chain reaction (RT-PCR), real time PCR, and RNA in situ hybridization (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd Ed., Cold Spring Harbor Laboratory Press (2001)). Levels of peptides can be monitored by, e.g., Western analysis, immunoassay, or in situ hybridization. Activity, e.g., altered promoter binding and/or transcription activity, can be determined by, e.g., electrophoretic mobility shift assay, DNA footprinting, reporter gene assay, or a serine, threonine, or tyrosine phosphorylation assay. In some embodiments, the effect of a test compound on expression, level or activity is observed as a change in glucose tolerance or insulin secretion of the cell, cell extract, co-culture, explant, or subject. In some embodiments, the effect of a test compound on expression, level, or activity of one or more of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, and/or Delta EF1, is evaluated in a transgenic cell or non-human animal, or explant, tissue, or cell derived therefrom, having altered glucose tolerance or insulin secretion, and can be compared to a control, e.g., wild-type animal, or explant or cell derived therefrom.
[0142] The effect of a test compound on expression, level, or activity can be evaluated in a cell, e.g., a cultured mammalian cell, a pancreatic beta cell, cell lysate, or subject, e.g., a non-human experimental mammal such as a rodent, e.g., a rat, mouse, or rabbit, or a cell, tissue, or organ explant, e.g., pancreas or pancreatic cells.
[0143] In some embodiments, the ability of a test compound to modulate level, expression or activity of one or more of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and/or Delta EF1 is evaluated in a knockout animal, or other animal having decreased expression, level, or activity of one or more of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and/or Delta EF1 conditional knockout transgenic animal.
[0144] In some embodiments, the ability of a test compound to modulate, e.g., increase or decrease, e.g., permanently or temporarily, expression from one or more of NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, and/or Delta EF1 promoter can be evaluated by, e.g., a routine reporter (e.g., LacZ or GFP) transcription assay. For example, a cell or transgenic animal whose genome includes a reporter gene operably linked to an NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and/or Delta EF1 promoter can be contacted with a test compound; the ability of the test compound to increase or decrease the activity of the reporter gene or gene product is indicative of the ability of the compound to modulate expression of the TF. In another example, a cell or transgenic animal whose genome includes a reporter gene operably linked to a promoter comprising a recognition sequence for one of those TFs, e.g., all or a portion of the Foxp3 promoter comprising recognition sequences for one of those TFs, can be contacted with a test compound; the ability of the test compound to increase or decrease the activity of the reporter gene or gene product is indicative of the ability of the compound to modulate activity of the TF.
[0145] The test compound can be administered to a cell, cell extract, explant, or subject (e.g., an experimental animal) expressing a transgene comprising an NKX22, AHR, EGR1, EGR2, EGR3, NGFIC, and/or Delta EF1 promoter or recognition sequence fused to a reporter such as GFP or LacZ (see, e.g., Nehls et al., Science, 272:886-889 (1996), and Lee et al., Dev. Biol., 208:362-374 (1999), describing placing the beta-galactosidase reporter gene under control of the whn promoter). Enhancement or inhibition of transcription of a transgene, e.g., a reporter such as LacZ or GFP, as a result of an effect of the test compound on the promoter or factors regulating transcription from the promoter, can be used to assay an effect of the test compound on transcription of one or more of the TFs identified herein. Reporter transcript levels, and thus promoter activity, can also be monitored by other known methods, e.g., Northern analysis, ribonuclease protection assay, reverse transcription-polymerase chain reaction (RT-PCR) or RNA in situ hybridization (see, e.g., Cuncliffe et al., Mamm. Genome, 13:245-252 (2002); Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd Ed., Cold Spring Harbor Laboratory Press (2001)). Test compounds can also be evaluated using a cell-free system, e.g., an environment including a promoter-reporter transgene (e.g., an ARNT promoter-LacZ transgene), transcription factors binding the promoter, a crude cell lysate or nuclear extract, and one or more test compounds (e.g., a test compound as described herein), wherein an effect of the compound on promoter activity is detected as a color change.
[0146] In one embodiment, the screening methods described herein include the use of a chromatin immunoprecipitation (ChIP) assay, in which cells, e.g., pancreatic beta cells, expressing one or more of the TFs identified herein, are exposed to a test compound. The cells are optionally subjected to crosslinking, e.g., using UV or formaldehyde, to form DNA-protein complexes, and the DNA is fragmented. The DNA-protein complexes are immunoprecipitated, e.g., using an antibody directed to one or more of the TFs identified herein. The protein is removed (e.g., by enzymatic digestion) and analyzed, e.g., using a microarray. In this way, changes in binding of the transcription factor to its target genes can be evaluated, thus providing a measure of activity of the TFs identified herein.
Test Compounds
[0147] Test compounds for use in the methods described herein are not limited and can include crude or partially or substantially purified extracts of organic sources, e.g., botanical (e.g., herbal) and algal extracts, inorganic elements or compounds, as well as partially or substantially purified or synthetic compounds, e.g., small molecules, polypeptides, antibodies, and polynucleotides, and libraries thereof.
[0148] A test compound that has been screened by a method described herein and determined to increase expression, levels, or activity of one or more of the TFs described herein can be considered a candidate compound for the treatment of a disorder treatable with immune therapy (i.e., by increasing or decreasing control of the immune response by increasing or decreasing levels of Treg), e.g., cancer, or an autoimmune disorder. A candidate compound that has been screened, e.g., in an in vivo model of a disorder treatable with immune therapy, e.g., cancer, or an autoimmune disorder, and determined to have a desirable effect on the disorder, e.g., on one or more symptoms of the disorder, can be considered a candidate therapeutic agent. Candidate therapeutic agents, once screened and verified in a clinical setting, are therapeutic agents. Candidate therapeutic agents and therapeutic agents can be optionally optimized and/or derivatized, and formulated with physiologically acceptable excipients to form pharmaceutical compositions.
Methods of Treatment
[0149] As described above, the present invention is based, at least in part, on the identification of useful targets for therapeutic immunomodulation. Accordingly, the present invention provides compositions and methods for treating a patient (e.g., a human) with an immunological condition. Immunological conditions that will benefit from treatment using the present invention include those diseases or disorders caused by an autoimmune response or an absent or insufficient immune response.
[0150] Autoimmunity
[0151] Autoimmunity is presently the most common cause of disease in the world and is the third most prevent disease in the U.S. Autoimmune conditions that may benefit from treatment using the compositions and methods described herein include, but are not limited to, for example, Addison's Disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis, Bechet's disease, bullous pemphigoid, celiac disease, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, cold agglutinin disease, CREST Syndrome, Crohn's disease, diabetes (e.g., type I), dysautonomia, endometriosis, eosinophilia-myalgia syndrome, essential mixed cryoglobulinemia, fibromyalgia, syndrome/fibromyositis, Graves' disease, Guillain Barr? syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP), inflammatory bowel disease (IBD), lichen planus, lupus, Meniere's disease, mixed connective tissue disease (MCTD), multiple sclerosis, myasthenia gravis, pemphigus, pernicious anemia, polyarteritis nodosa, polychondritis, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sj?gren's syndrome, spondyloarthropathy, stiff-man syndrome, Takayasu arteritis, temporal arteritis/giant cell arteritis, thyroid disease, ulcerative colitis, uveitis, vasculitis, vitiligo, and Wegener's granulomatosis.
[0152] As described herein, a patient with one or more autoimmune conditions can be treated by increasing the number of Treg cells and/or the activity of Treg cells in the patient using, e.g., a therapeutically effective amount of one or more transcription factors (e.g., a ligand-activated transcription factor such as AHR) and/or one or more transcription factor ligands (e.g., TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE)) that are capable of promoting an increase in the expression and/or activity of Foxp3, and thereby promoting an increase in the number or activity of Treg cells in vitro and/or in vivo.
[0153] In some embodiments, the methods include administering (e.g., to a population of T cells or to a subject) a composition comprising a nucleic acid encoding a transcription factor as described herein, e.g., e.g., NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and/or Delta EF1. The nucleic acid can be in an expression vector, e.g., a modified viral vector such as is known in the art, e.g., a lentivirus, retrovirus, or adenovirus. Methods for using these vectors in cell or gene therapy protocols are known in the art. For cell therapy methods, it is desirable to start with a population of T cells taken from the subject to be treated.
[0154] In some embodiments, the methods include administering a composition comprising a ligand that activates a transcription factor described herein, e.g., the AHR receptor. In some embodiments, the ligand is co-administered with one or more inhibitors of its degradation, e.g., tryptamine together with a monoamine oxidase inhibitor, e.g., tranylcypromine. The inhibitor can be administered in the same or in a separate composition. Thus the invention also includes compositions comprising tryptamine and an inhibitor of its degradation, e.g., a MAOI, e.g., tranylcypromine.
[0155] In some embodiments, a patient in need of treatment can be administered a pharmaceutically effective dose of one or more ligands capable of promoting an increase in the expression and/or activity of Foxp3 and thereby promoting an increase in the number or activity of Treg cells in vitro and/or in vivo (e.g., TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE)).
[0156] Alternatively or in addition, a population of cells capable of differentiation into Treg cells (e.g., na?ve T cells and/or CD4.sup.+CD62 ligand.sup.+ T cells) can be contacted with a transcription factor ligand capable of promoting increase in Foxp3 expression and/or activity (e.g., TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE)) in vitro, thereby effectively promoting an increase in the number of Treg cells in the population. Alternatively or in addition, a population of cells containing Treg cells (e.g., isolated Treg cells (e.g., 100%) or a population of cells containing at least 20, 30, 40, 50, 60, 70, 80, 90, 95, or 99% Treg cells) can be contacted with a transcription factor ligand capable of promoting an increase in Foxp3 expression and/or activity (e.g., TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE)), thereby effectively promoting an increase in the activity of the Treg cells in the population. Alternatively or in addition, the cells can be contacted with an expression vector, e.g., a viral vector such as a lentivirus, retrovirus, or adenovirus, comprising a nucleic acid encoding a transcription factor described herein, e.g., NKX22, AHR, EGR1, EGR2, EGR3, NGFIC and Delta EF1. In some embodiments, the cells are also activated, e.g., by contacting them with an effective amount of a T cell activating agent, e.g., a composition of one or both of anti-CD3 antibodies and anti-CD28 antibodies. One or more cells from these populations can then be administered to the patient alone or in combination with one or more ligands capable of promoting an increase in the expression and/or activity of Foxp3 and thereby promoting an increase in the number or activity of Treg cells in vitro and/or in vivo (e.g., TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE).
[0157] Patient Selection
[0158] The compositions and methods described herein are of particular use for treating a patient (e.g., a human) that would benefit from therapeutic immunomodulation (e.g., a patient in need of a suppressed immune response). The methods include selecting a patient in need of treatment and administering to the patient one or more of the compositions described herein. A subject in need of treatment can be identified, e.g., by their medical practitioner.
[0159] In some embodiments, the methods include determining presence and/or levels of autoantibodies to an autoantigen specific for the disease, e.g., the presence and/or levels of autoantibodies to an autoantigen listed in Table 1 or 2. The results can be used to determine a subject's likelihood or risk of developing the disease; subjects can be selected for treatment using a method described herein based on the presence and/or levels of autoantibodies.
[0160] Validation of Treatment/Monitoring Treatment Efficacy
[0161] During and/or following treatment, a patient can be assessed at one or more time points, for example, using methods known in the art for assessing severity of the specific autoimmune disease or its symptoms, to determine the effectiveness of the treatment. In some embodiments, levels of autoantibodies to an autoantigen specific for the disease can also be monitored, e.g., levels of autoantibodies to an autoantigen listed in Table 1 or 2; a decrease (e.g., a significant decrease) in levels of autoantibodies would indicate a positive response, i.e., indicating that the treatment is successful; see, e.g., Quintana et al., Proc. Natl. Acad. Sci. U.S.A., 101(suppl. 2):14615-14621 (2004). Treatment can then be continued without modification, modified to improve the progress or outcome (e.g., increase dosage levels, frequency of administration, the amount of the pharmaceutical composition, and/or change the mode of administration), or stopped.
[0162] Administration
[0163] A therapeutically effective amount of one or more of the compositions described herein can be administered by standard methods, for example, by one or more routes of administration, e.g., by one or more of the routes of administration currently approved by the United States Food and Drug Administration (FDA; see, for example world wide web address fda.gov/cder/dsm/DRG/drg00301.htm), e.g., orally, topically, mucosally, intravenously or intramuscularly.
[0164] In some embodiments, one or more of the ligands described herein can be administered orally with surprising effectiveness.
[0165] Pharmaceutical Formulations
[0166] A therapeutically effective amount of one or more of the compositions (e.g., including, but not limited to, one or more of the small molecule ligands, for example TCDD, tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE)) described herein can be incorporated into pharmaceutical compositions suitable for administration to a subject, e.g., a human. Such compositions typically include the composition and a pharmaceutically acceptable carrier. As used herein the language pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances are known. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions, e.g., an inhibitor of degradation of the ligand.
[0167] In some embodiments, the composition can also include an autoantigen, e.g., an autoantigen listed in Table 1 or 2, or another autoantigen known in the art to be associated with an autoimmune disease.
[0168] A pharmaceutical composition can be formulated to be compatible with its intended route of administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
[0169] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL? (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
[0170] Sterile injectable solutions can be prepared by incorporating the composition (e.g., an agent described herein) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
[0171] Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, PRIMOGEL? (sodium carboxymethyl starch), or corn starch; a lubricant such as magnesium stearate or STEROTES?; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
[0172] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
[0173] In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
[0174] Nucleic acid molecules can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al., PNAS 91:3054-3057, 1994). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g. retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
[0175] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration. In one aspect, the pharmaceutical compositions can be included as a part of a kit.
[0176] Generally the dosage used to administer a pharmaceutical compositions facilitates an intended purpose for prophylaxis and/or treatment without undesirable side effects, such as toxicity, irritation or allergic response. Although individual needs may vary, the determination of optimal ranges for effective amounts of formulations is within the skill of the art. Human doses can readily be extrapolated from animal studies (Katocs et al., Chapter 27 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990). Generally, the dosage required to provide an effective amount of a formulation, which can be adjusted by one skilled in the art, will vary depending on several factors, including the age, health, physical condition, weight, type and extent of the disease or disorder of the recipient, frequency of treatment, the nature of concurrent therapy, if required, and the nature and scope of the desired effect(s) (Nies et al., Chapter 3, In: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al., eds., McGraw-Hill, New York, N.Y., 1996).
AHR Ligand-Nanoparticles
[0177] As demonstrated herein, compositions comprising nanoparticles linked to AHR ligands are surprisingly effective in delivering the ligand, both orally and by injection, and in inducing the Treg response in living animals. Thus, the invention further includes compositions comprising AHR ligands linked to biocompatible nanoparticles, optionally with antibodies that target the nanoparticles to selected cells or tissues.
[0178] AHR Transcription Factor Ligands
[0179] AHR-specific ligands, e.g., the high affinity AHR ligand 2,3,7,8-tetrachloro-dibenzo-p-dioxin (TCDD), tryptamine (TA), and/or 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE), promote an increase in the number and/or activity of Treg immunomodulatory cells, which will be useful to suppress the immune response in the treatment of diseases or disorders caused by an abnormal (e.g., an excessive, elevated, or inappropriate) immune response, e.g., an autoimmune disease or disorder.
[0180] Other potentially useful AHR transcription factor ligands are described in Denison and Nagy, Ann. Rev. Pharmacol. Toxicol., 43:309-34, 2003, and references cited herein, all of which are incorporated herein in their entirety. Other such molecules include planar, hydrophobic HAHs (such as the polyhalogenated dibenzo-pdioxins, dibenzofurans, and biphenyls) and PAHs (such as 3-methylcholanthrene, benzo(a)pyrene, benzanthracenes, and benzoflavones), and related compounds. (Denison and Nagy, 2003, supra). Nagy et al., Toxicol. Sci. 65:200-10 (2002), described a high-throughput screen useful for identifying and confirming other ligands. See also Nagy et al., Biochem. 41:861-68 (2002). In some embodiments, those ligands useful in the nanoparticle compositions are those that bind competitively with TCDD, TA, and/or ITE.
[0181] Biocompatible Nanoparticles
[0182] The nanoparticles useful in the methods and compositions described herein are made of materials that are (i) biocompatible, i.e., do not cause a significant adverse reaction in a living animal when used in pharmaceutically relevant amounts; (ii) feature functional groups to which the binding moiety can be covalently attached, (iii) exhibit low non-specific binding of interactive moieties to the nanoparticle, and (iv) are stable in solution, i.e., the nanoparticles do not precipitate. The nanoparticles can be monodisperse (a single crystal of a material, e.g., a metal, per nanoparticle) or polydisperse (a plurality of crystals, e.g., 2, 3, or 4, per nanoparticle).
[0183] A number of biocompatible nanoparticles are known in the art, e.g., organic or inorganic nanoparticles. Liposomes, dendrimers, carbon nanomaterials and polymeric micelles are examples of organic nanoparticles. Quantum dots can also be used. Inorganic nanoparticles include metallic nanoparticle, e.g., Au, Ni, Pt and TiO2 nanoparticles. Magnetic nanoparticles can also be used, e.g., spherical nanocrystals of 10-20 nm with a Fe2+ and/or Fe3+ core surrounded by dextran or PEG molecules. In some embodiments, colloidal gold nanoparticles are used, e.g., as described in Qian et al., Nat. Biotechnol. 26(1):83-90 (2008); U.S. Pat. Nos. 7,060,121; 7,232,474; and U.S. P.G. Pub. No. 2008/0166706. Suitable nanoparticles, and methods for constructing and using multifunctional nanoparticles, are discussed in e.g., Sanvicens and Marco, Trends Biotech., 26(8): 425-433 (2008).
[0184] In all embodiments, the nanoparticles are attached (linked) to the AHR ligands described herein via a functional groups. In some embodiments, the nanoparticles are associated with a polymer that includes the functional groups, and also serves to keep the metal oxides dispersed from each other. The polymer can be a synthetic polymer, such as, but not limited to, polyethylene glycol or silane, natural polymers, or derivatives of either synthetic or natural polymers or a combination of these. Useful polymers are hydrophilic. In some embodiments, the polymer coating is not a continuous film around the magnetic metal oxide, but is a mesh or cloud of extended polymer chains attached to and surrounding the metal oxide. The polymer can comprise polysaccharides and derivatives, including dextran, pullanan, carboxydextran, carboxmethyl dextran, and/or reduced carboxymethyl dextran. The metal oxide can be a collection of one or more crystals that contact each other, or that are individually entrapped or surrounded by the polymer.
[0185] In other embodiments, the nanoparticles are associated with non-polymeric functional group compositions. Methods are known to synthesize stabilized, functionalized nanoparticles without associated polymers, which are also within the scope of this invention. Such methods are described, for example, in Halbreich et al., Biochimie, 80 (5-6):379-90, 1998.
[0186] In some embodiments, the nanoparticles have an overall size of less than about 1-100 nm, e.g., about 25-75 nm, e.g., about 40-60 nm, or about 50-60 nm in diameter. The polymer component in some embodiments can be in the form of a coating, e.g., about 5 to 20 nm thick or more. The overall size of the nanoparticles is about 15 to 200 nm, e.g., about 20 to 100 nm, about 40 to 60 nm; or about 60 nm.
[0187] Synthesis of Nanoparticles
[0188] There are varieties of ways that the nanoparticles can be prepared, but in all methods, the result must be a nanoparticle with functional groups that can be used to link the nanoparticle to the binding moiety.
[0189] For example, AHR ligands can be linked to the metal oxide through covalent attachment to a functionalized polymer or to non-polymeric surface-functionalized metal oxides. In the latter method, the nanoparticles can be synthesized according to a version of the method of Albrecht et al., Biochimie, 80 (5-6): 379-90, 1998. Dimercapto-succinic acid is coupled to the nanoparticle and provides a carboxyl functional group. By functionalized is meant the presence of amino or carboxyl or other reactive groups that can be used to attach desired moieties to the nanoparticles, e.g., the AHR ligands described herein or antibodies.
[0190] In another embodiment, the AHR ligands are attached to the nanoparticles via a functionalized polymer associated with the nanoparticle. In some embodiments, the polymer is hydrophilic. In a specific embodiment, the conjugates are made using oligonucleotides that have terminal amino, sulfhydryl, or phosphate groups, and superparamagnetic iron oxide nanoparticles bearing amino or carboxy groups on a hydrophilic polymer. There are several methods for synthesizing carboxy and amino derivatized-nanoparticles. Methods for synthesizing functionalized, coated nanoparticles are discussed in further detail below.
[0191] Carboxy functionalized nanoparticles can be made, for example, according to the method of Gorman (see WO 00/61191). Carboxy-functionalized nanoparticles can also be made from polysaccharide coated nanoparticles by reaction with bromo or chloroacetic acid in strong base to attach carboxyl groups. In addition, carboxy-functionalized particles can be made from amino-functionalized nanoparticles by converting amino to carboxy groups by the use of reagents such as succinic anhydride or maleic anhydride.
[0192] Nanoparticle size can be controlled by adjusting reaction conditions, for example, by varying temperature as described in U.S. Pat. No. 5,262,176. Uniform particle size materials can also be made by fractionating the particles using centrifugation, ultrafiltration, or gel filtration, as described, for example in U.S. Pat. No. 5,492,814.
[0193] Nanoparticles can also be treated with periodate to form aldehyde groups. The aldehyde-containing nanoparticles can then be reacted with a diamine (e.g., ethylene diamine or hexanediamine), which will form a Schiff base, followed by reduction with sodium borohydride or sodium cyanoborohydride.
[0194] Dextran-coated nanoparticles can also be made and cross-linked, e.g., with epichlorohydrin. The addition of ammonia will react with epoxy groups to generate amine groups, see Hogemann et al., Bioconjug. Chem. 2000. 11(6):941-6, and Josephson et al., Bioconjug. Chem., 1999, 10(2):186-91.
[0195] Carboxy-functionalized nanoparticles can be converted to amino-functionalized magnetic particles by the use of water-soluble carbodiimides and diamines such as ethylene diamine or hexane diamine.
[0196] Avidin or streptavidin can be attached to nanoparticles for use with a biotinylated binding moiety, such as an oligonucleotide or polypeptide. See e.g., Shen et al., Bioconjug. Chem., 1996, 7(3):311-6. Similarly, biotin can be attached to a nanoparticle for use with an avidin-labeled binding moiety.
[0197] In all of these methods, low molecular weight compounds can be separated from the nanoparticles by ultra-filtration, dialysis, magnetic separation, or other means. The unreacted AHR ligands can be separated from the ligand-nanoparticle conjugates, e.g., by size exclusion chromatography.
[0198] In some embodiments, colloidal gold nanoparticles are made using methods known in the art, e.g., as described in Qian et al., Nat. Biotechnol. 26(1):83-90 (2008); U.S. Pat. Nos. 7,060,121; 7,232,474; and U.S. P.G. Pub. No. 2008/0166706.
[0199] In some embodiments, the nanoparticles are pegylated, e.g., as described in U.S. Pat. Nos. 7,291,598; 5,145,684; 6,270,806; 7,348,030, and others.
[0200] Antibodies
[0201] In some embodiments, the nanoparticles also include antibodies to selectively target a cell. The term antibody, as used herein, refers to full-length, two-chain immunoglobulin molecules and antigen-binding portions and fragments thereof, including synthetic variants. A typical full-length antibody includes two heavy (H) chain variable regions (abbreviated herein as VH), and two light (L) chain variable regions (abbreviated herein as VL). The term antigen-binding fragment of an antibody, as used herein, refers to one or more fragments of a full-length antibody that retain the ability to specifically bind to a target. Examples of antigen-binding fragments include, but are not limited to: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F(ab)2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., Nature 341:544-546 (1989)), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR). Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al. Science 242:423-426 (1988); and Huston et al. Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)). Such single chain antibodies are also encompassed within the term antigen-binding fragment.
[0202] Production of antibodies and antibody fragments is well documented in the field. See, e.g., Harlow and Lane, 1988. Antibodies, A Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory. For example, Jones et al., Nature 321: 522-525 (1986), which discloses replacing the CDRs of a human antibody with those from a mouse antibody. Marx, Science 229:455-456 (1985), discusses chimeric antibodies having mouse variable regions and human constant regions. Rodwell, Nature 342:99-100 (1989), discusses lower molecular weight recognition elements derived from antibody CDR information. Clackson, Br. J. Rheumatol. 3052: 36-39 (1991), discusses genetically engineered monoclonal antibodies, including Fv fragment derivatives, single chain antibodies, fusion proteins chimeric antibodies and humanized rodent antibodies. Reichman et al., Nature 332: 323-327 (1988) discloses a human antibody on which rat hypervariable regions have been grafted. Verhoeyen, et al., Science 239: 1534-1536 (1988), teaches grafting of a mouse antigen binding site onto a human antibody.
[0203] In the methods described herein, it would be desirable to target the compounds to T cells, B cells, dendritic cells, and/or macrophages, therefore antibodies selective for one or more of those cell types can be used. For example, for T cells, anti-CXCR4, anti-CD28, anti-CD8, anti-TTLA4, or anti-CD3 antibodies can be used; for B cells, antibodies to CD20, CD19, or to B-cell receptors can be used; for dendritic cell targeting, exemplary antibodies to CD11c, DEC205, MHC class I or class II, CD80, or CD86 can be used; for macrophages, exemplary antiboduies to CD11b, MHC class I or class II, CD80, or CD86 can be used. Other suitable antibodies are known in the art.
Kits
[0204] The present invention also includes kits. In some embodiments the kit comprise one or more doses of a composition described herein. The composition, shape, and type of dosage form for the induction regimen and maintenance regimen may vary depending on a patients requirements. For example, dosage form may be a parenteral dosage form, an oral dosage form, a delayed or controlled release dosage form, a topical, and a mucosal dosage form, including any combination thereof.
[0205] In a particular embodiment, a kit can contain one or more of the following in a package or container: (1) one or more doses of a composition described herein; (2) one or more pharmaceutically acceptable adjuvants or excipients (e.g., a pharmaceutically acceptable salt, solvate, hydrate, stereoisomer, and clathrate); (3) one or more vehicles for administration of the dose; (5) instructions for administration. Embodiments in which two or more, including all, of the components (1)-(5), are found in the same container can also be used.
[0206] When a kit is supplied, the different components of the compositions included can be packaged in separate containers and admixed immediately before use. Such packaging of the components separately can permit long term storage without loosing the active components' functions. When more than one bioactive agent is included in a particular kit, the bioactive agents may be (1) packaged separately and admixed separately with appropriate (similar of different, but compatible) adjuvants or excipients immediately before use, (2) packaged together and admixed together immediately before use, or (3) packaged separately and admixed together immediately before use. If the chosen compounds will remain stable after admixing, the compounds may be admixed at a time before use other than immediately before use, including, for example, minutes, hours, days, months, years, and at the time of manufacture.
[0207] The compositions included in particular kits of the present invention can be supplied in containers of any sort such that the life of the different components are optimally preserved and are not adsorbed or altered by the materials of the container. Suitable materials for these containers may include, for example, glass, organic polymers (e.g., polycarbonate and polystyrene), ceramic, metal (e.g., aluminum), an alloy, or any other material typically employed to hold similar reagents. Exemplary containers may include, without limitation, test tubes, vials, flasks, bottles, syringes, and the like.
[0208] As stated above, the kits can also be supplied with instructional materials. These instructions may be printed and/or may be supplied, without limitation, as an electronic-readable medium, such as a floppy disc, a CD-ROM, a DVD, a Zip disc, a video cassette, an audiotape, and a flash memory device. Alternatively, instructions may be published on a internet web site or may be distributed to the user as an electronic mail.
EXAMPLES
[0209] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Example 1: Cloning and Characterization of Zebrafish Foxp3
[0210] The zebrafish is an experimental model of vertebrate development; as described herein, it can also be used as an immunogenic model. This example describes the cloning and characterize of the zebrafish (Danio rerio) functional homologue of mammalian Foxp3 (herein termed zFoxp3).
[0211] Identification of zFoxp3
[0212] To investigate whether Foxp3-dependent immunoregulatory mechanisms operate in the zebrafish, we searched the zebrafish genome for a Foxp3 homologue, which we termed zFoxp3 (
[0213] The accession numbers for the amino acid sequences used in the gene tree analysis are as follows: Danio rerio Foxp1a Q08BX8 BC124513; Foxp1b Q2LE08 NM_001039637; Foxp2 Q4JNX5 NM_001030082; Foxp3 annotated (EST CK028390); Foxp4 annotated. Homo sapiens: Foxp1 Q9H334 NM_001012505, Foxp2 O15409 NM_148899, Foxp3 Q9BZS 1 NM_014009, Foxp4 Q8IVH2 NM_138457; Mus musculus: Foxp1 P58462 NM_053202, Foxp2 P58463 NM_053242, Foxp3 Q99JB6 NM_054039, Foxp4 Q9DBY0 NM_028767; Ciona intestinalis Foxp Q4H3H6. The amino acid sequence of the apparent stickleback orthologues of Foxp1, Foxp2, Foxp3 and Foxp4 were obtained from Ensembl.
[0214] Cloning zFoxp3
[0215] zFoxp3 was cloned from cDNA prepared from zebrafish kidney by using a TOPO? PCR cloning kit (Invitrogen, CA, USA) according to the manufacturer's instructions.
[0216] Characterization of Foxp3
[0217] The amino acids (aa) predicted to mediate the interaction of the forkhead domain with DNA (Stroud et al., Structure. 14, 159-66 (2006)) or the transcription factor NFAT (Wu et al., Cell 126, 375-87 (2006)) in mammalian Foxp3 are conserved in zFoxp3, as well as aa found to be mutated in humans with impaired Foxp3 activity (Ziegler, Annu Rev Immunol. 24, 209-26 (2006)) (
[0218] As shown in
[0219] Foxp3 can physically interact with NF-kB and NFAT to down-regulate their transcriptional activities (Wu et al., (2006), supra; Bettelli et al., (2005), supra). As shown in
[0220] MSCV GFP-RV retroviral DNA plasmids were transfected into the Phoenix packaging cell line and 72 hours later the retrovirus-containing supernatants were collected. MACS-purified CD4+ T cells were activated 24 hours later with plate-bound antibodies to CD3 and CD28, and infected by centrifugation (45 minutes at 2000 rpm) with retrovirus-containing supernatant supplemented with 8 ?g/ml Polybrene (Sigma-Aldrich) and recombinant human IL-2 (25 units/ml).
[0221] Cells were cultured in serum-free X-VIVO 20? media (BioWhittaker, Walkersville, Md., USA) for 72 hours. During the last 16 hours, cells were pulsed with 1 ?Ci of [.sup.3H]thymidine (PerkinElmer, Waltham, Mass., USA) followed by harvesting on glass fiber filters and analysis of incorporated [.sup.3H]thymidine in a beta-counter (1450 Microbeta, Trilux, PerkinElmer). Alternatively, culture supernatants were collected 48 after activation and the cytokine concentration was determined by ELISA using antibodies for IFN-?, IL-17, IL-4, IL-10 from BD Biosciences and antibodies to TGF-? from R&D Systems. For suppression assays, MACS purified CD4.sup.+CD25.sup.? T cells from na?ve C57BL/6 mice (1-5?10.sup.4 cells/well) were stimulated with antibodies to CD3 and C57BL/6 irradiated spleen cells (0.3-1.5?10.sup.4 cells/well) for 3 days in the presence of different ratios of CD4.sup.+GFP.sup.+ retrovirus-transduced T cells.
[0222] Retroviral transduction of zFoxp3 into mouse T cells led to the up-regulation of surface molecules associated with Treg function such as CD25, CTLA-4 and GITR (see
[0223] Western blot studies of zebrafish tissues identified a Foxp3 cross-reactive protein in thymus, kidney and spleen compatible with the predicted size of zFoxp3.
[0224] The expression of zFoxp3 was then analyzed by real-time PCR on FACS-sorted lymphocytes, myelomonocytes and erythrocytes (Traver et al., Nat Immunol 4, 1238-46 (2003)). RNA was extracted from cells using RNAeasy columns (Qiagen, Valencia, Calif., USA), complementary DNA was prepared as recommended (Bio-Rad Laboratories, Hercules, Calif., USA) and used as template for real time PCR. The expression of Foxp3 was quantified with specific primers and probes (Applied Biosystems, Foster City, Calif., USA) on the GeneAmp 5500 Sequence Detection System (Applied Biosystems). Expression was normalized to the expression of the housekeeping gene, GAPDH.
[0225] As shown in
Example 2: Identification of Transcription Factor Binding Sites in Foxp3
[0226] The elements regulating gene expression in genomic DNA are under selective pressure, and therefore are more conserved than the surrounding nonfunctional sequences. Phylogenetic footprinting is a method based on the analysis of sequence conservation between orthologous genes from different species to identify regions of DNA involved in the regulation of gene expression. Once identified, these conserved regions can be analyzed with TFBS detection algorithms to generate a list of putative TFBS.
[0227] We performed a phylogenetic footprinting analysis aimed at identifying regulatory regions within the zebrafish, mouse and human Foxp3 gene (Ovcharenko et al., Genome Res 15, 184-94 (2005)). The inclusion of distant species like the zebrafish is highly informative because it facilitates the identification of conserved regulatory sequences amidst DNA regions that were not subjected to any selective pressure (Ovcharenko et al., Genome Res 15, 184-94 (2005)).
[0228] The Mulan server (mulan.dcode.org) was used to perform a phylogenetic footprinting analysis of Foxp3. Mulan brings together different algorithms in a web-based user-friendly interface: programs for the rapid identification of local sequence conservation connected to the multiTF/TRANSFAC database for the detection of evolutionarily conserved TFBS in multiple alignments.
Example 3: Adaptive Cellular Immunity and Foxp3-Dependent Immunoregulation in Zebrafish
[0229] The adaptive cellular immune response of 6 month old zebrafish immunized intraperitoneally (ip) with heat killed M. tuberculosis (MT) or PBS in incomplete Freund's adjuvant (IFA) was studied.
[0230] As shown in
[0231] Another group of six month old zebrafish were anesthetized with 0.02% tricaine (Sigma-Aldrich) and immunized i.p. with 10 ?l/fish of zebrafish brain homogenate (zCNS) emulsified in complete Freund's adjuvant (CFA). As shown in
[0232] These results demonstrated that zebrafish can mount adaptive antigen-specific cell-mediated immune and autoimmune responses.
[0233] C. elegans and D. melanogaster have been extremely useful for the identification of the genes governing innate immunity (Lemaitre et al., Nat Rev Immunol 4, 521-7 (2004)). These experimental models, however, lack an adaptive immune system and therefore cannot be used to study vertebrate-specific immune processes. The zebrafish harbors both innate and adaptive immune systems with functional macrophages (Davis et al., Immunity 17, 693-702 (2002)), B cells (Danilova et al., Proc Natl Acad Sci USA 99, 13711-6 (2002)) and T cells (Danilova et al., Dev Comp Immunol 28, 755-67 (2004); Langenau et al., Proc Natl Acad Sci USA 101, 7369-74 (2004)). Taking together the presence of basic components of the adaptive immune system (Langenau et al., Nat Rev Immunol. 5, 307-17 (2005)) with the experimental advantages offered by the zebrafish for the realization of large scale genetic and chemical screens (Lieschke et al., Nat Rev Genet. 8, 353-67 (2007)), the zebrafish can serve as an experimental model for the study of pathways controlling adaptive immune processes such as Treg development.
Example 4: AHR Controls Foxp3 Expression and Treg Generation
[0234] Using the methods described above, a conserved binding site for the aryl hydrocarbon receptor (AHR) was identified in the genomic sequence of Foxp3 (see
[0235] First, Foxp3 expression was measured in mouse Treg isolated from Foxp3.sup.gpf knock in mice. Foxp3.sup.gpf knock in mice have a GFP reporter inserted in the Foxp3 gene, producing GFP in Foxp3.sup.+ Treg, which facilitates the identification and FACS sorting of GFP:Foxp3.sup.+ Treg (Bettelli et al., Nature 441, 235-8 (2006)).
[0236] CD4+ T cells were purified from Foxp3gfp knock in mice using anti-CD4 beads (Miltenyi, Auburn, Calif., USA) and sorted (FACSAria? cell sorter, BD Biosciences) into naive CD4.sup.+Foxp3:GFP.sup.? or CD4.sup.+Foxp3:GFP T cells. CD4.sup.+Foxp3:GFP.sup.? T cells were stimulated with plate bound 1 ?g/ml of anti-CD3 (145-2C11, eBioscience) and 2 ?g/ml of anti-CD28 (37.51, eBioscience) for 5 days, supplemented with recombinant IL-2 (50 U/ml) at day 2 and 4, and analyzed by FACS at day 5 for their differentiation into CD4.sup.?Foxp3:GFP.sup.+ Treg. TGF?1 (2.5 ng/ml) was used as a positive control.
[0237] Higher levels of AHR expression were detected on FACS-sorted CD4.sup.+GFP:Foxp3+ Treg than in CD4.sup.+GFP:Foxp3.sup.? T cells (see
[0238] Briefly, CD4+ T cells were purified from Foxp3gfp knock in mice as described above. RNA was then extracted using RNAeasy columns (Qiagen, Valencia, Calif., USA). Complementary DNA was prepared as recommended (Bio-Rad Laboratories, Hercules, Calif., USA) and used as template for real time PCR. The expression of Foxp3 was quantified with specific primers and probes (Applied Biosystems, Foster City, Calif., USA) on the GeneAmp 5500 Sequence Detection System (Applied Biosystems). Expression was normalized to the expression of the housekeeping genes, GAPDH or actin.
[0239] Data generated using RT-PCR corroborated the observed association between AHR and Foxp3. In addition, CYP1A1 expression, a AHR responsive gene, was also observed in CD4.sup.+GFP:Foxp3.sup.+ Treg cells. Furthermore, as shown in
[0240] To investigate whether AHR directly controls Foxp3 expression, we used a bacterial artificial chromosome that contained the entire foxp3 locus tagged with a Renilla luciferase reporter after the ATG start codon. More specifically, we used the RP23-267C15 BAC clone, which contains 200 kb of mouse genomic DNA, including the entire locus of the Foxp3 gene. A Renilla cDNA cassette was the cloned immediately after the ATG start codon of Foxp3 gene by homologous recombination using the Red recombineering system contained in the DY 380 bacteria strain. The final construct was designated BACFoxp3:Ren.
[0241] As shown in
[0242] Chromatin immunoprecipitation (ChIP) was then applied to analyze the interaction of AHR with the CABS and NCABS shown in
[0243] Briefly, cells were treated for 90 with TCDD, fixed with 1% formaldehyde for 15 minutes and quenched with 0.125 M glycine. Chromatin was isolated and sheared to an average length of 300-500 bp by sonication. Genomic DNA (input) was prepared by treating aliquots of chromatin with RNase, proteinase K and heat for de-crosslinking, followed by ethanol precipitation. AHR-bound DNA sequences were immuno-precipitated with an AHR-specific antibody (Biomol SA-210). Crosslinks were reversed by incubation overnight at 65? C., and ChIP DNA was purified by phenol-chloroform extraction and ethanol precipitation. Quantitative PCR reactions were then performed using the following primer pairs:
[0244] Cyp1a1-845 F: aggctcttctcacgcaactc (SEQ ID NO: 144) and Cyp1a1-845 R: ctggggctacaaagggtgat (SEQ ID NO: 145);
[0245] Foxp3 (NCAB-1)?2269 F: agctgcccattacctgttag (SEQ ID NO: 146) and Foxp3 (NCAB-1)?2269 R: ggaggtctgcatggatcttag (SEQ ID NO:147);
[0246] Foxp3 (NCAB-2)?1596 F: gccttgtcaggaaaaactctg (SEQ ID NO: 148) and Foxp3 (NCAB-2)?1596 R: gtcctcgatttggcacagac (SEQ ID NO: 149);
[0247] Foxp3 (NCAB-3)?800 F: cttgcccttcttggtgatg (SEQ ID NO: 150) and Foxp3 (NCAB-3)?800 R: ttgtgctgagtgccctgac (SEQ ID NO:151);
[0248] Foxp3 (CAB)+13343 F: gctttgtgcgagtggagag (SEQ ID NO:152) and Foxp3 (CAB)+13343 R: agggattggagcacttgttg (SEQ ID NO: 153).
[0249] The Untr6 region in chromosome 6 located at chr6:120, 258, 582-120, 258, 797 was amplified as a control using Untr6 F: tcaggcatgaaccaccatac (SEQ ID NO: 154) and Untr6 R: aacatccacacgtccagtga (SEQ ID NO: 155).
[0250] Experimental Ct values were converted to copy numbers detected by comparison with a DNA standard curve run on the same PCR plates. Copy number values were then normalized for primer efficiency by dividing by the values obtained using Input DNA and the same primer pairs. Error bars represent standard deviations calculated from the triplicate determinations.
[0251] ChIP analysis of the interaction of AHR with CABS and NCABS in Foxp3 and CYP1A1 was then performed in control and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD; a high affinity AHR ligand) treated CD4.sup.+ T cells and T cells isolated from mice.
[0252] As shown in
[0253] TCDD was also used to characterize the functional relationship between AHR and Foxp3. Treatment of 3-day post-fertilization zebrafish embryos with TCDD led to a dose-dependent increase in zFoxp3 expression, suggesting that the conserved AHR binding site in the zFoxp3 sequence is functional (see
[0254] We then studied the effect of AHR activation on mouse Treg numbers. Na?ve C57BL/6 mice were treated with TCDD (1 mg/mouse, ip) and immunized 24 hours later with MOG.sub.35-55 in CFA. Draining lymph nodes were prepared 10 days later and CD4.sup.+Foxp3.sup.+ Treg were quantified by FACS. Administration of TCDD led to a small increase in the number of CD4.sup.+Foxp3.sup.+ Treg (see
[0255] To rule out any direct cytotoxic or pro-apoptotic effect of TCDD on effector T cells, purified mouse CD4.sup.+CD25.sup.? T cells were activated in vitro with antibodies to CD3 in the presence of TCDD. Incubation with TCDD did not increase T cell apoptosis as measured by annexin-FITC staining and did not decrease the proliferative response (see
[0256] To establish if TCDD triggered the conversion of CD4.sup.+Foxp3.sup.? T cells into new Foxp3.sup.+ Treg cells, FACS sorted CD4.sup.+Foxp3:GFP? T cells were activated in vitro with antibodies to CD3 and CD28 in the presence of TCDD, and the generation of CD4.sup.+Foxp3:GFP.sup.+ Treg was followed by FACS. TGFb1 was used as a positive control. As shown in
[0257] Thus, AHR activation by the high affinity AHR ligand TCDD can trigger the conversion of CD4.sup.+Foxp3.sup.? T cells into functional CD4.sup.+GFP.sup.+ Treg.
[0258] As shown in
[0259] To investigate if new Treg could also be generated in vivo following TCDD administration, we transferred CD4.sup.+Foxp3:GFP.sup.? 2D2 T cells from CD90.2 donors into wild type CD90.1 recipients. CD4.sup.+Foxp3:GFP.sup.? 2D2 T cells express a MOG.sub.35-55-specific T cell receptor. The recipients were administered 1 ?g/mouse TCDD and were immunized 2 days later with MOG.sub.35-55. CD4.sup.+Foxp3:GFP.sup.+CD90.2 T cells (donor cells that underwent conversion into Treg upon treatment with TCDD) were then quantified by FACS. As shown in
[0260] Thus, the increase in the frequency of Treg that follows activation of AHR with TCDD is due, at least in part, to the conversion of CD4.sup.+Foxp3:GFP.sup.? T cells into CD4.sup.+Foxp3: GFP.sup.+ Treg.
Example 5: AHR Activation by TCDD Suppresses EAE
[0261] To analyze the functionality of the Treg cells induced by AHR activation, we studied the effect of TCDD on EAE development.
[0262] C57BL/6 mice were given a single intraperitoneal (ip) dose of TCCD, and one day later EAE was induced by immunization with MOG.sub.35-55 in CFA. TCDD was also administered orally (1 ?g/mouse) to determined whether an effective dose of this ligand can be delivered via oral administration and whether this dose is capable of reducing EAE development. EAE was induced by injecting the mice subcutaneously with 100 ml of the MOG.sub.35-55 peptide (MEVGWYRSPFSRVVHLYRNGK (SEQ ID NO: 156)) in complete Freund adjuvant oil. In addition, the mice received 150 ng of pertussis toxin (Sigma-Aldrich) ip on days 0 and 2. Clinical signs of EAE were assessed according to the following score: 0, no signs of disease; 1, loss of tone in the tail; 2, hind limb paresis; 3, hind limb paralysis; 4, tetraplegia; 5, moribund.
[0263] As shown in
TABLE-US-00001 TABLE 3 TCDD Treatment Suppresses EAE Mean day of onset Mean maximum Treatment Incidence (Mean ? standard score (?g per mouse) (positive/total) deviation (SD)) (mean ? SD) Control 42/49 (87%) 13.6 ? 2.8 2.4 ? 1.4 TCDD 1 ?g 4/40 (10%) 21.8 ? 1.5* 0.2 ? 0.6* TCDD 0.1 ?g 5/5 (100%) 17.0 ? 1.2 3.1 ? 0.5 TCDD 0.01 ?g 7/7 14.1 ? 2.9 2.7 ? 0.6 Mice treated with corn oil (control) or TCDD (ip) were immunized with MOG.sub.35-55 peptide in CFA and monitored for EAE development. Statistical analysis was performed by comparing groups using one-way analysis of variance. *P < 0.0001.
[0264] As shown in
[0265] In addition, orally administered of 1 ?g/mouse of TCDD, one day before EAE induction, also prevented EAE development (P<0.001, two-way ANOVA, n=10). This observation suggests that an effective does of TCDD can be administered orally.
[0266] To confirm that the effects on EAE were mediated by the activation of AHR, we used C57BL/6 mice carrying the d allele of the ahr gene (AHR-d mice). This allele codes for a mutant AHR with a 10 fold reduction in its affinity for TCDD and other ligands (Okey et al., Mol Pharmacol. 35, 823-30 (1989)) due to mutations in its ligand binding sites. The administration of TCDD (1 ?g/mouse) to AHR-d mice did not increase the levels of CD4.sup.+Foxp3.sup.+ Treg in AHR-mt mice, and did not inhibit the progression of EAE, as shown in
TABLE-US-00002 TABLE 4 TCDD Treatment of AHR-d Mice Incidence Mean day of onset Mean maximum Treatment (positive/total) (Mean ? SD) score (mean ? SD) WT control 12/14 (86%) 13.9 ? 1.9 2.4 ? 1.4 AHR-d + TCDD 9/11 (82%) 17.3 ? 3.0.sup. 2.2 ? 1.4 WT + TCDD 1/10 (10%).sup.# 21 0.2 ? 0.6* C57BL/6 (WT) and AHR-d mice treated with corn oil (control) or TCDD (1 ?g/mouse) were immunized with MOG.sub.35-55 peptide in CFA and monitored for EAE development. Statistical analysis was performed by comparing groups using one-way analysis of variance. *P < 0.001 vs WT control group and P < 0.01 vs AHR-d TCDD group; .sup.P = 0.0046 vs WT control group; .sup.#P = 0.0005 vs WT control group, P = 0.0019 vs AHR-d TCDD group.
[0267] Taken together, these results show that TCDD-dependent AHR activation can inhibit or suppress the development and/or progression of EAE. The data presented in Example 3 indicate that this effect is due to the TCDD-dependent AHR activation that promotes the induction of functional Treg.
[0268] Antigen microarrays were then used to study the antibody response to myelin in mice that did not develop EAE as consequence of AHR activation by TCDD. The antigens listed in Table 1 were spotted onto Epoxy slides (TeleChem, Sunnyvale, Calif., USA) as described (Quintana et al., Proc Natl Acad Sci USA 101 Suppl 2, 14615-21 (2004)). Antigens were spotted in replicates of 6, the microarrays were blocked for 1 h at 37? C. with 1% bovine serum albumin, and incubated for 2 hours at 37? C. with a 1:100 dilution of the test serum in blocking buffer. The arrays were then washed and incubated for 45 min at 37? C. with goat anti-mouse IgG Cy3-conjugated detection antibodies (Jackson ImmunoResearch Labs, West Grove, Pa., USA). The arrays were scanned with a ScanArray 4000X scanner (GSI Luminomics, Billerica, Mass., USA). Antigen reactivity was defined by the mean intensity of binding to the replicates of that antigen on the microarray. Raw data were normalized and analyzed using the GeneSpring software (Silicon Genetics, Redwood City, Calif., USA) with the non-parametric Wilcoxon-Mann-Whitney test, using the Benjamini and Hochberg method with a false discovery rate (FDR) of 0.05 to determine significance. The samples were clustered using a pairwise average linkage algorithm based on Spearman's rank correlation as a distance measure.
[0269] The microarrays consisted of a collection of 362 CNS-related autoantigens including tissue lysates, recombinant proteins, peptide libraries spanning the whole sequence of myelin proteins and lipids found in the central and peripheral nervous system, a complete list of the antigens used is provided in Table 1.
TABLE-US-00003 TABLE 1 362 CNS-Related Autoantigens Heat 27 kDa Heat Shock Protein Shock 32 kDa Heat Shock Protein Proteins 40 kDa Heat Shock Protein (HSP) 47 kDa Heat Shock Protein 60 kDa Heat Shock Protein 60 kDa Heat Shock Protein peptide: aa 106-125; aa 1-20; aa 121-140; aa 136-155; aa 151-170; aa 16-35; aa 166- 185; aa 181-199; aa 195-214; aa 210-229; aa 225-244; aa 240-259; aa 255-275; aa 271-290; aa 286-305; aa 301- 320; aa 31-50; aa 316-335; aa 331-350; aa 346-365; aa 361-380; aa 376-395; aa 391-410; aa 406-425; aa 421- 440; aa 436-455; aa 451-470; aa 466-485; aa 46-65; aa 481-500; aa 496-515; aa 511-530; aa 526-545; aa 541- 560; aa 556-573; aa 61-80; aa 76-95; or aa 91-110 65 kDa Heat Shock Protein M. tuberculosis 70 kDa Heat Shock Protein 70 kDa Heat Shock Protein peptide aa 106-125; aa 1-20; aa 121-140; aa 136-155; aa 151-170; aa 16-35; aa 166-185; aa 181-199; aa 195-214; aa 210-229; aa 225-244; aa 240- 259; aa 255-275; aa 271-290; aa 286-305; aa 301-320; aa 31-50; aa 316-335; aa 331-350; aa 346-365; aa 361-380; aa 376-395; aa 391-410; aa 406-425; aa 421-440; aa 436- 455; aa 451-470; aa 466-485; aa 46-65; aa 481-500; aa 496-515; aa 511-530; aa 526-545; aa 541-560; aa 556- 575; aa 571-590; aa 586-605; aa 601-620; aa 616-635; aa 61-80; aa 631-640; aa 76-95; or aa 91-110 71 kDa Heat Shock Protein M. tuberculosis 90 kDa Heat Shock Protein GroEL CNS 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 106- 125; aa 1-20; aa 121-140; aa 136-155; aa 151-170; aa 16-35; aa 166-185; aa 181-200; aa 196-215; aa 211-230; aa 226- 245; aa 241-260; aa 256-275; aa 271-290; aa 286-305; aa 301-320; aa 31-50; aa 316-335; aa 331-350; aa 346-365; aa 361-380; aa 376-395; aa 391-410; aa 406-421; aa 46-65; aa 61-80; aa 76-95; or aa 91-110 Acetyl Cholinesterase ADAM-10 alpha-Cristallin beta-Cristallin bovine Myelin Basic Protein Brain Extract I Brain Extract II Brain Extract III Glial Filament Acidic Protein Research Diagnostic guinea pig Myelin Basic Protein human Myelin Basic Protein Myelin-Associated Oligodendrocytic Basic Protein peptide aa 106-125; aa 1-20; aa 121-140; aa 136-155; aa 151-170; aa 16-35; aa 166-185; aa 181-200; aa 31-50; aa 46-65; aa 61-80; aa 76-95; aa 91-110; aa 106-125; aa 1-20; aa 121- 140; aa 136-155; or aa 151-170 Myelin/oligodendrocyte glycoprotein peptide aa 16-35; aa 166-185; aa 181-200; aa 196-215; aa 211-230; aa 226-247; aa 31-50; aa 35-55; aa 46-65; aa 61-80; aa 76-95; or aa 91- 110 murine Myelin Basic Protein Myelin Associated Glycoprotein Myelin Basic Protein peptide aa 104-123; aa 11-30; aa 113- 132; aa 1-20; aa 121-138; aa 124-142; aa 138-147; aa 141- 161; aa 143-168; aa 155-178; aa 26-35; aa 31-50; aa 41-60; aa 51-70; aa 61-80; aa 71-92; aa 84-94; aa 89-101; aa 173- 186; or aa 93-112 Myelin Protein 2 peptide aa 106-125; aa 1-20; aa 121-132; aa 16-35; aa 31-50; aa 46-65; aa 61-80; aa 76-95; or aa 91- 110 Neurofilament 160 kd Neurofilament 200 kd Neurofilament 68 kd Neuronal Enolase Nicastrin NMDA receptor NOGO Olygodendrocyte-Specific Protein peptide aa 106-125; aa 1-20; aa 121-140; aa 136-155; aa 151-170; aa 16-35; aa 166-185; aa 181-199; aa 195-217; aa 31-50; aa 46-65; aa 61-80; aa 76-95; or aa 91-110 Proteolipid Protein Proteolipid Protein peptide aa 100-119; aa 10-29; aa 110- 129; aa 1-19; aa 125-141; aa 137-150; aa 137-154; aa 150- 163; aa 151-173; aa 158-166; aa 161-180; aa 178-191; aa 180-199; aa 190-209; aa 20-39; aa 205-220; aa 215-232; aa 220-239; aa 220-249; aa 248-259; aa 250-269; aa 265-277; aa 35-50; aa 40-59; aa 50-69; aa 65-84; aa 80-99; or aa 91- 110 Retinol Binding Protein S100beta protein Assay Designs Super Oxide Dismutase Synuclein, beta Synuclein, gamma Tissue Amydgala Amydgala AD Brain lysate Brain Tissue Membrane Cerebellar pedunculus Cerebral meninges Corpus Callosum Corpus Callosum AD Diencephalon Fetal brain Frontal lobe Frontal lobe AD Hippocampus Hippocampus AD Insula Occipital lobe Occipital lobe AD Olfactory region Optic Nerve Parietal lobe Parietal lobe AD Pons Pons AD Postcentral gyrus Postcentral gyrus AD Precentral gyrus Precentral gyrus AD Spinal cord Temporal lobe Temporal lobe AD Thalamus Thalamus AD Amyloid beta AD related Amyloid beta 10-20 Amyloid beta peptide 1-12; 12-28; 1-23; 1-38; beta 17-40; 25-35; or 34-42 Amyloid bri protein precursor 227 Amyloid DAN Protein Fragment 1-34 Amyloid Precursor Protein Amyloid protein no AB component Secreted amyloid precursor protein (SAP) beta Tau isoform variant 0N3R Tau isoform variant 1N3R Tau isoform variant 0N4R Tau isoform variant 2N3R Tau phospho Ser412 Tau phospho Ser441 Tau phospho Thr181 Tau Protein human Lipids (?)9-HODE Cayman Chemical 1 Palmitoyl-2-(5oxo-Valeroyl)-sn-Glycero-3- Phosphocholine 15a-hydroxycholestene 15-ketocholestane 15-ketocholestene 1-Palmitoil-2-(9oxo-Nonanoyl)-sn-Glycero-3- Phosphocholine 1-Palmitoil-2-Azelaoyl-sn-Glycero-3-Phosphocholine 1-Palmitoil-2-Glutaroyl-sn-Glycero-3-Phosphocholine 5 ?-cholestane-3 ?, 15 ?-diol 9(S)-HODE Cayman Chemical Asialoganglioside-GM1 Asialoganglioside-GM2 Brain ceramides Brain D-erythrosphingosine Brain lysophosphatidylethanolamine Brain L-?-lysophosphatidylserine Brain L-?-phosphatidylcholine Brain L-?-phosphatidyl-ethanolamine Brain L-?-phosphatidylserine Brain polar lipid extract Brain sphingomyelin Brain sulfatide Brain total lipid extract Cardiolipin Ceramide Ceramide 1-phosphate Cholesterol Disialogaglioside-GD1B Disialogaglioside-GD2 Disialoganglio side GD1a Disialoganglioside GD3 Fucosyl-GM1 Galactocerebrosides Ganglioside Mixture Ganglioside-GM4 Gangliotetraosylceramide asialo-GM1 HDL Hexacosanoic acid (26) Hydroxy fatty acid ceramide Isoprostane F2 I Lactocerebrosides Lactosylceramide LDL Lipid A, diphosphoryl from Salmonella enterica Lipopolysaccharides from Escherichia coli Lipopolysaccharides from Pseudomona aeruginosa Lipopolysaccharides from Salmonella enterica Lyso-GM1 Monosialoganglioside GM1 Monosialoganglioside GM2 Monosialoganglioside GM3 N-Hexanoyl-D-sphingosin Non-hydroxy fatty acid ceramide Phosphatidylinositol-4 phosphate Squalene Sulfatides Tetracosanoic acid (24) Tetrasialoganglioside-GQ1B TNPAL Galactocerebroside Total brain gangliosides Total cerebroside Trisialoganglioside GT1a Trisialoganglioside-GT1B
[0270] The control of EAE by AHR activation correlated with a significant decrease in IgG serum antibodies to 97 myelin antigens, which are listed in Table 2.
TABLE-US-00004 TABLE 2 Specificity of IgG Antibodies Showing a Significant (FDR < 0.05) Downregulation in TCDD-Treated Mice Antigen FDR 70 kDa. Heat Shock Protein peptide aa 331-350 1.78E?05 60 kDa. Heat Shock Protein peptide aa 255-275 0.00547 60 kDa. Heat Shock Protein peptide aa 13-35 0.00547 32 kDa. Heat Shock protein 0.00547 Myelin Basic Protein peptide aa 138-147 0.00547 Proteolipid Protein peptide aa 1-19 0.00547 Proteolipid Protein peptide aa 161-180 0.00547 Proteolipid Protein peptide aa 10-29 0.00547 60 kDa. Heat Shock Protein peptide aa 1-20 0.0055 70 kDa. Heat Shock Protein peptide aa 61-80 0.0055 Ceramide 0.0055 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 91-110 0.0055 Proteolipid Protein peptide aa 137-150 0.0055 NOGO 0.00557 Olygodendrocyte-Specific Protein peptide aa 76-95 0.00557 b-Cristallin 0.0058 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 121-140 0.00703 60 kDa. Heat Shock Protein peptide aa 225-244 0.00708 Myelin Basic Protein peptide aa 113-132 0.00925 Olygodendrocyte-Specific Protein peptide aa 46-65 0.00925 Myelin Protein 2 peptide aa 91-110 0.00925 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 151-170 0.0093 Myelin/oligodendrocyte glycoprotein peptide aa 31-50 0.0093 NT-3 0.0093 Proteolipid Protein peptide aa 40-59 0.0116 70 kDa. Heat Shock Protein peptide aa 421-440 0.0118 Myelin Basic Protein peptide aa 173-186 0.0125 70 kDa. Heat Shock Protein peptide aa 121-140 0.0132 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 391-410 0.0132 Olygodendrocyte-Specific Protein peptide aa 136-155 0.0132 Olygodendrocyte-Specific Protein peptide aa 106-125 0.0134 70 kDa. Heat Shock Protein peptide aa 136-155 0.0141 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 406-421 0.0141 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 166-185 0.0143 Myelin Protein 2 peptide aa 1-20 0.0143 Myelin Protein 2 peptide aa 76-95 0.0144 Proteolipid Protein peptide aa 125-141 0.0144 Proteolipid Protein peptide aa 178-191 0.0144 40 kDa. Heat Shock Protein 0.0145 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 106-125 0.0158 Olygodendrocyte-Specific Protein peptide aa 195-217 0.0174 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 240-259 0.0187 70 kDa. Heat Shock Protein peptide aa 76-95 0.0194 Proteolipid Protein peptide aa 265-277 0.0194 Myelin Basic Protein peptide aa 89-101 0.0199 Myelin Basic Protein peptide aa 71-92 0.0199 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 16-35 0.0199 Proteolipid Protein peptide aa 265-277 0.0199 60 kDa. Heat Shock Protein peptide aa 46-65 0.0241 70 kDa. Heat Shock Protein peptide aa 166-185 0.0241 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 151-170 0.0241 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 376-395 0.0241 Myelin Basic Protein peptide aa 11-30 0.0241 Myelin/oligodendrocyte glycoprotein peptide aa 211-230 0.0241 Proteolipid Protein peptide aa 265-277 0.0241 70 kDa. Heat Shock Protein peptide aa 181-199 0.0242 Olygodendrocyte-Specific Protein peptide aa 31-50 0.0242 Proteolipid Protein peptide aa 265-277 0.0242 Myelin/oligodendrocyte glycoprotein peptide aa 91-110 0.0249 Optic Nerve lysate 0.0249 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 361-380 0.0258 Lactosylceramide 0.0258 Myelin Protein 2 peptide aa 31-50 0.0258 Myelin Basic Protein peptide aa 1-20 0.028 NMDA receptor 0.0285 CNF 0.0289 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 136-155 0.0292 Myelin Basic Protein peptide aa 141-161 0.0298 70 kDa. Heat Shock Protein peptide aa 406-425 0.0307 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 210-229 0.0307 Galactocerebrosides 0.0307 Myelin/oligodendrocyte glycoprotein peptide aa 46-65 0.0307 Proteolipid Protein peptide aa 150-163 0.0307 Proteolipid Protein peptide aa 265-277 0.0307 Proteolipid Protein peptide aa 80-99 0.0307 60 kDa. Heat Shock Protein peptide aa 210-229 0.0323 Proteolipid Protein peptide aa 137-154 0.0324 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 1-20 0.0337 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 225-244 0.0337 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 61-80 0.0337 Proteolipid Protein peptide aa 158-166 0.0337 Ceramide 1 phosphate 0.0346 Myelin-Associated Oligodendrocytic Basic Protein peptide aa 136-155 0.0369 Myelin Basic Protein peptide aa 155-178 0.0379 Myelin/oligodendrocyte glycoprotein peptide aa 106-125 0.0392 Proteolipid Protein peptide aa 180-199 0.0408 Myelin Protein 2 peptide aa 121-132 0.0413 Myelin Basic Protein peptide aa 104-123 0.0419 70 kDa. Heat Shock Protein 0.0421 Non h fatty acid ceramide 0.0421 Myelin-Associated Glycoprotein 0.0452 Myelin Basic Protein peptide aa 143-168 0.0452 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 91-110 0.047 2,3-cyclic nucleotide 3-phosphodiesterase peptide aa 181-199 0.0476 70 kDa. Heat Shock Protein peptide aa 255-275 0.0486 Brain ceramides 0.0486 Myelin Protein 2 peptide aa 46-65 0.0496
[0271] To further characterize the suppression of EAE by AHR activation we studied the activity of myelin specific T cells induced by vaccination with MOG.sub.35-55/CFA in TCDD-treated mice. TCDD-treated mice showed a suppressed recall proliferative response to the MOG.sub.35-55 peptide, however no differences were seen upon activation with antibodies to CD3 (see
[0272] In addition, cells were stimulated in culture medium containing 100 ?g/ml MOG.sub.35-55 for 2 days or with PMA (50 ng/ml) (Sigma-Aldrich) and ionomycin (1 nM) (Calbiochem, San Diego, Calif., USA) for 4 hours, Golgistop (BD Biosciences) was added to the culture during the last 4 hours. After staining of surface markers, cells were fixed and permeabilized using Cytofix/Cytoperm and Perm/Wash buffer from BD Biosciences according to the manufacturer's instructions. All antibodies to cytokines (IFN-gamma, IL-17, IL-10) including the corresponding isotype controls were obtained from BD Biosciences. Cells were incubated (1:100) at 25? C. for 20 min and washed twice in Perm/Wash before analysis. Data were acquired on a FACSCalibur (BD Biosciences) and analyzed with FlowJo software (Tree Star, Ashland, Oreg., USA). When compared to the draining lymph node cells from control animals, cells from TCDD-treated mice secreted higher amounts of TGFb1 and lower amounts of IFNg and IL-17 upon activation with MOG.sub.35-5.sub.5 (see
[0273] These data suggest that AHR activation interferes with the generation of the encephalitogenic T cell response.
Example 6: Treg Induced by AHR Activation Suppress EAE by a TGFb1-Dependent Mechanism
[0274] The inhibition of the development of EAE by AHR activation with TCDD was associated with a significant increase in the frequency of CD4.sup.+Foxp3.sup.+ T cells (see
[0275] Further characterization revealed that effector CD4.sup.+Foxp3:GFP.sup.? T cells purified from TCDD-treated mice showed normal proliferation (
[0276] To confirm that the protective effect of TCDD on EAE was Treg mediated we depleted the natural Treg with antibodies to CD25 prior to TCDD treatment. The difference between undepleted and depleted cell populations are shown in
TABLE-US-00005 TABLE 5 EAE Suppression in Treg Depleted Cell Populations Incidence Mean day of onset Mean maximum Treatment (positive/total) (Mean ? SD) score (mean ? SD) CD4.sup.+ control 7/7 (100%) 12.3 ? 1.9 2.7 ? 1.0 CD4.sup.+ TCDD 3/6 (57%) 13.3 ? 0.6 0.7 ? 0.8* CD4.sup.+CD25.sup.? 3/4 (75%) 11.0 ? 0.0 2.6 ? 1.8 TCDD Na?ve C57BL/6 mice received CD4.sup.+ or CD4.sup.+CD25.sup.? T cells (5 ? 10.sup.6) purified from TCDD or control treated mice 10 days after immunization with MOG.sub.35-55/CFA. 24 hours later EAE was induced in the recipient mice with MOG.sub.35-55/CFA, and the mice were monitored for EAE development. Statistical analysis was performed by comparing groups using one-way analysis of variance. *P < 0.05 vs CD4.sup.+ control group.
[0277] TGFb1 has been linked to the suppressive activity of Treg in vitro and in vivo (Li et al., Annu Rev Immunol. 24, 99-146 (2006)). To asses the role played by TGFb1 in the inhibition of the recall response to MOG.sub.35-55 by Treg (see
[0278] To analyze the role played by TFGb1 in vivo in the control of EAE, we transferred CD4.sup.+ T cells from TCDD treated mice into na?ve mice expressing a dominant negative variant of the TGFb receptor II on their T cells; T cells from these mice are unresponsive to the immunosuppressive effects of TGFb1 (Gorelik et al., Immunity. 12, 171-81 (2000)). As shown in
Example 7: Endogenous AHR Ligands Control Treg Development In Vivo
[0279] The observations described herein regarding the control of Treg development by AHR activation suggest that endogenous AHR ligands participate in immune regulation. In support of this, we have demonstrated that na?ve AHR-d mice harbor lower levels of CD4.sup.+Foxp3.sup.+ T cells (P<0.03, t-test; see
[0280] Several endogenous AHR ligands are described in the art.sup.28. Based on our results, AHR ligands such as TCDD could be useful in the control of Treg development. Our data additionally demonstrate that AHR ligands such as TCDD can be used to suppress the development and/or progression of EAE. Clearly, such technology would also be useful in the modulation of other immunological disorders such as autoimmune disorders. Two additional endogenous high affinity ligands for AHR are tryptamine (TA) (Heath-Pagliuso et al., Biochemistry. 37, 11508-15 (1998)), a derivative of tryptophan (Trp) catabolism and 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) (Song et al., Proc Natl Acad Sci USA. 99, 14694-9 Epub 2002 Oct. 30 (2002)), a molecule isolated from the lung. Interestingly, no toxicity has been reported for these AHR ligands in vivo, probably as a result of their short half-life (Henry et al., Arch Biochem Biophys. 450, 67-77 Epub 2006 Mar. 3 (2006)). To confirm the physiologic relevance of AHR activation for the control of Treg activity, we tested the effect of TA and ITE on EAE. Based on the short half-life of these molecules we administered them on a daily basis. The administration of ITE, but not TA, led to a significant reduction on EAE severity (P<0.001, two-way ANOVA, n=9; see
[0281] Together, these results indicate that modulation of Foxp3 expression by modulating activity of a transcription factor that binds to Foxp3 can be used to affect Treg and control of the immune response in vivo.
Example 8: Expression Levels of Transcription Factors in Foxp3 Knock-in Mice
[0282] Mouse Treg and non-Treg were isolated from Foxp3gpf knock in mice, mRNA was prepared and Foxp3 (see
[0283] GFP.sup.? CD4.sup.+ T cells were isolated from Foxp3gpf knock in mice, and then were activated in vitro with antibodies to CD3 and CD28 in the presence of TGF?1 to induce Treg differentiation in vitro. mRNA was prepared at the beginning of the experiment and after 3 or 6 days in culture, and the expression of Foxp3 (see
[0284] These results indicate that expression of Foxp3 and the transcription factors EGR1, EGR2, EGR3 and NKX2.2 is correlated. Taken together, the reported effects that these TFs exert on the regulation of gene expression, the identification of TF binding sites on the Foxp3 gene, and the correlation between the expression of these TF and Fox3, suggest that EGR1, EGR2, EGR3 and NKX2.2 play a role in the regulation of Foxp3 expression and the generation of Treg.
Example 9: Combination Treatment Using Tryptamine (TA)
[0285] As shown above, TA is rapidly degraded in vivo by monoamine oxidase inhibitors. As shown in
[0286] This observation suggests that TA is a TCDD-like ligand that, when used in combination with a monoamine oxidase inhibitor, can be used as a transcription factor ligand for promoting an increase in the number and/or activity of Treg.
Example 10: Modified Screening Assays
[0287] A modified zebrafish based screening assay was established by microinjecting fertilized zebrafish eggs with a BAC construct encoding the complete mouse Foxp3 locus, with a renilla reporter inserted after the Foxp3 methionine start codon (ATG). Six days after microinjection, renilla activity was determined in total zebrafish lysates. As shown in
[0288] These data suggest that zebrafish lines encoding murine Foxp3 can be used to screen for small molecules that increase or decrease Foxp3 expression levels.
Example 11: AHR Activation with its Non-Toxic Ligand ITE Induces Functional Treg
[0289] The ligand-activated transcription factor aryl hydrocarbon receptor (AHR) is a regulator of zebrafish, mouse and human Foxp3 expression and T.sub.reg differentiation (Quintana et al., Nature 23, 23 (2008)). AHR activation by its ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) induced T.sub.reg that suppressed experimental autoimmune encephalomyelitis (EAE) by a TGFb1-dependent mechanism. These findings identify AHR as a therapeutic target of interest for the management of autoimmune disorders, but its therapeutic exploitation is limited by the well-characterized toxic features of TCDD (Baccarelli et al., Environ Health Perspect. 110, 1169 (2002)).
[0290] Several endogenous AHR ligands have been isolated, among them tryptophan derivatives like tryptamine (TA) (Heath-Pagliuso et al., Biochemistry. 37, 11508 (1998)) and the mucosal associated 2-(1H-indole-3-carbonyl)-thiazole-4-carboxylic acid methyl ester (ITE) depicted in
[0291] To analyze the feasibility of using ITE to activate AHR in vivo in a therapeutic setup, we studied the effect of ITE on EAE development. EAE was induced on na?ve C57BL/6 mice and ITE (200 mg/mice) was administered orally or intraperitoneally on daily basis. ITE administration, either orally or intraperitoneally, resulted in a significant delay on EAE development and a significant reduction of EAE clinical score (
[0292] To study the mechanism by which the ITE-induced T.sub.reg control EAE we studied the ability of AHR activation by ITE to induce T.sub.reg. We treated na?ve C57BL/6 mice with ITE (200 mg/mouse administered ip, daily) and immunized them with 100 mg/mouse of MOG.sub.35-55 in CFA. Spleens were prepared 10 days later and CD4.sup.+FoxP3.sup.+ T.sub.reg were quantified by FACS. Administration of ITE led to a significant increase in the number of CD4.sup.+FoxP3.sup.+ T.sub.reg (
[0293] To confirm the lack of toxicity of ITE, we administered it intraperitoneally for 14 days, 200 mg/mouse and studied the blood levels of biochemical indicators of liver function induction. Hepatocites are known to express high levels of AHR, thus toxic effects of AHR activation are manifested in the liver. Table 6 shows that at day 14 we did not detect any significant difference in the biochemical indicators of liver function, confirming the lack of toxicity in ITE.
TABLE-US-00006 TABLE 6 ITE Administration Does Not Result in Liver Toxicity TEST Units Control ITE Reference Range ALT/GPT U/L 16 ? 2 19 ? 4 0-54 AST/GOT U/L 79 ? 29 94 ? 17 9-74 Alkaline Phosphatase U/L 75 ? 8 55 ? 11 36-300 Total Bilirubin mg/dL 0 ? 0 0 ? 0 0.1-1.2 Direct Bilirubin mg/dL 0 ? 0 0 ? 0 0.0-0.8 Total Protein g/dL 6 ? 0 5 ? 0 4.4-8.0 Albumin g/dL 2 ? 0 3 ? 0 2.9-5.4 Globulin g/dL 3 ? 0 3 ? 0 2.0-4.0
[0294] To study the feasibility of administering ITE orally to activate AHR and induce functional Treg we treated na?ve C57BL/6 mice with ITE (200 mg/mouse administered orally, daily) and immunized them with 100 mg/mouse of MOG.sub.35-55 in CFA. Spleens were prepared 10 days later and CD4.sup.+FoxP3.sup.+ T.sub.reg were quantified by FACS. Administration of ITE led to a significant increase in the number of CD4.sup.+FoxP3.sup.+ T.sub.reg (
[0295] To confirm the ability of AHR activation by ITE to expand the T.sub.reg compartment we used Foxp3.sup.gpf knock in mice. Foxp3.sup.gpf knock in mice have a GFP reporter inserted in the Foxp3 gene, producing a GFP:Foxp3 fusion protein that facilitates the identification and FACS sorting of GFP:FoxP3.sup.+ T.sub.reg (Bettelli et al., Nature 441, 235 (2006)). Foxp3.sup.gpf knock in mice were treated with ITE (200 mg/mouse administered ip, daily) and immunized with 100 mg/mouse of MOG.sub.35-55 in CFA. Ten days later and CD4.sup.+FoxP3:GFP.sup.+ T.sub.reg were quantified by FACS. Administration of ITE led to a significant increase in the number of CD4.sup.+FoxP3:GFP.sup.+ T.sub.reg in blood and spleen (
[0296] We then studied the effect of ITE administration on the encephalitogenic response against myelin. EAE was induced on na?ve C57BL/6 mice and ITE (200 mg/mice) was administered orally or intraperitoneally on daily basis. Ten days after vaccination with MOG.sub.35-55/CFA, ITE-treated mice showed a suppressed recall proliferative response to the MOG.sub.35-55 peptide (
[0297] To confirm the suppressive effects of AHR activation on the generation of T cells secreting IFNg and IL17, IFNg.sup.+ and IL17.sup.+CD4.sup.+ T cells were quantified by FACS in the draining lymph nodes ten days after footpad immunization and intraperitoneal administration of ITE (200 mg/mice). AHR activation with ITE led to a decrease in the frequency of CD4+IL17.sup.+ and CD4.sup.+IFNg.sup.+ T cells (
[0298] To investigate the effect of AHR activation by ITE on the frequency of MOG.sub.35-55 specific Treg and effector T cells (Teff), Foxp3.sup.gpf knock in mice were immunized with MOG.sub.35-55/CFA, treated daily with intreaperitoneal ITE (200 mg/mice) and MOG.sub.35-55-specific T.sub.reg (CD4.sup.+FoxP3:GFP.sup.+) and Teff (CD4.sup.+FoxP3:GFP.sup.?) were analyzed by FACS using recombinant MHC class II tetramers containing MBP.sub.35-55 or the control peptide TMEV.sub.70-86. AHR activation with ITE led to a decrease in the frequency of MOG.sub.35-55-specific Teff and to a concomitant increase in the frequency of MOG.sub.35-55-specific T.sub.reg, reducing the MOG.sub.35-55-specific Teff/T.sub.reg ratio by half (
[0299] To investigate the active suppression of MOG.sub.35-55-specific Teff by Treg, Foxp3.sup.gpf knock in mice were immunized with MOG.sub.35-55/CFA, treated daily with intreaperitoneal ITE (200 mg/mice) and the recall response to MOG.sub.35-55 and a mitogenic antibody to CD3 antibody was studied on FACS-sorted CD4.sup.+ T cells and CD4.sup.+ FoxP3:GFP? Teff. Purified CD4+ T cells from ITE-treated mice showed a suppressed response to MOG.sub.35-55 but not to anti-CD3 (
[0300] To demonstrate that the effect of ITE on EAE was mediated by T.sub.reg, we purified CD4.sup.+ T cells from mice protected from EAE by oral or intraperitoneal administration of ITE 14 days after EAE induction. Protection from EAE could be transferred to wild type na?ve animals by the transfer of 5 10.sup.6 CD4.sup.+ T cells ITE-treated mice, but not with cells isolated from vehicle-treated mice (
[0301] AHR is known to be expressed by antigen presenting cells (APC) such as dendritic cells (CD11c.sup.+) and macrophages (CD11b.sup.+) (Vorderstrasse and Kerkvliet, Toxicol Appl Pharmacol. 171, 117 (2001); Laupeze et al., J Immunol. 168, 2652 (2002); Hayashi et al., Carcinogenesis. 16, 1403 (1995); Komura et al., Mol Cell Biochem. 226, 107 (2001)). To analyze the effects that AHR activation by ITE might have on different APC populations, which can potentially influence the generation of Teff and T.sub.reg cells, we studied the effect of ITE and TCDD treatment on MHC class II expression by as dendritic cells (CD11c.sup.+) and macrophages (CD11b). C57BL/6 mice were treated with ITE (200 mg/mouse administered ip, daily) or TCDD (1 mg/mouse administered ip on day 0) and immunized them with 100 mg/mouse of MOG.sub.35-55 in CFA. Spleens were prepared 10 days later and MCH class I expression was investigated on CD11b.sup.+ and CD11c.sup.+ cells by FACS. Administration of ITE or TCDD resulted in a significant decrease in CD11c.sup.+ MHC class II expression, which was concomitant with a significant increase in CD11b.sup.+ MHC class II expression (
Example 12: Administration of ITE-Loaded Nanoparticles Induces Functional Treg
[0302] As noted above, administration of a single dose of 1 mg/mouse of the AHR ligand TCDD could prevent the development of EAE. To achieve similar effects on disease progression, 200 mg/mouse of ITE have to be administered daily throughout the experiment. ITE is a tryptophan derivative which is thought to have a short half-life in vivo as a result of the activity of specific enzymes. Indeed, administration of ITE at weekly intervals, instead of daily, results in a complete loss of tis protective effects on EAE (
[0303] Gold colloid has been in use for over 50 years in the treatment of rheumatoid arthritis, these gold colloid nanoparticles have been shown to have little to no long-term toxicity or adverse effects (Paciotti et al., Drug Deliv. 11, 169 (2004)). Due to their small size (10-100 nm diameter), gold colloid nanoparticles have large surface areas on which multiple small proteins or other molecules can be conjugated (Paciotti et al., Drug Deliv. 11, 169 (2004)). The PEGylation of gold colloid nanoparticles greatly enhances the overall stability of the molecule to which it is covalently bonded (Qian et al., Nat Biotechnol. 26, 83 (2008)). Moreover, recently it has been shown that PEGylated) gold colloid nanoparticles can be linked to specific antibodies to target them to specific cell types (Qian et al., Nat Biotechnol. 26, 83 (2008)). Thus, to increase the half-life of ITE and to facilitate its targeting to specific cell types, we constructed polyethylene glycol coated (PEGylated) gold colloid nanoparticles loaded with AHR ligands (
[0304] PEGylated gold colloid nanoparticles carrying the AHR ligands FICZ, ITE or TCDD showed a typical spectrum of optical absorption (
[0305] To investigate the in vivo functionality of AHR-ligand loaded nanoparticles we induced EAE on na?ve C57BL/6 mice and treated them, starting at day 0, weekly with 45 femtomoles of nanoparticles. Similarly to what we have described in our previous experiments, treatment with TCDD resulted in a complete suppression of EAE, while the AHR ligand FICZ worsened the disease (
[0306] To study the mechanism by which the ITE-loaded nanoparticles control EAE we studied the activity of myelin specific T cells. We induced EAE on na?ve C57BL/6 mice and treated them, starting at day 0, weekly with 45 femtomoles of nanoparticles. Spleens were prepared 21 days after EAE was induced and analyzed for their recall response to MOG.sub.35-55 and anti-CD3. Mice treated with ITE-loaded nanoparticles showed a suppressed recall proliferative response to the MOG.sub.35-55 peptide (FIG. 35); no differences were seen upon activation with antibodies to CD3 (
Example 13: Induction of Functional Human Regulatory T Cells by AHR Activation
[0307] To investigate the potential of AHR targeting for the induction of human T.sub.reg we activated purified na?ve CD4.sup.+CD62L.sup.+CD45RO.sup.? T cells for healthy donors for 5 days with antibodies to CD3 and CD28 in the presence of TCDD 100 nM or TGFb1 2.5 ng/ml or both. T cell activation in the presence of TCDD resulted in the induction of CD4.sup.+ FoxP3.sup.+ T cells in some (
[0308] To study the functionality of the putative human T.sub.reg induced in the presence of TCDD we studied their suppressive activity of CD4.sup.+CD25.sup.High and CD4.sup.+CD25.sup.Low T cells following 5 days of activation in the of TCDD or TGFb1 2.5 ng/ml or both. Activation in the presence of TGFb1 did not result in the induction of suppressive T cells (
[0309] To investigate the mechanism mediating the suppressive activity of the TCDD-induced T.sub.reg, we analyzed them by real time PCR for the expression of several genes that have been previously linked to the suppressive function of T.sub.reg. FoxP3 expression was significantly up-regulated upon activation in the presence of TCDD and TGFb1 (
Other Embodiments
[0310] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.