METHODS AND COMPOSITIONS FOR TREATING CANCER

20230035892 · 2023-02-02

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides methods for treating cancer using GRK2 inhibitors such as small molecule inhibitors of GRK2 among others. The invention also features compositions containing GRK2 inhibitors, methods of diagnosing patients with GRK2-associated cancer and methods of predicting the response of cancer in a subject to treatment with GRK2 inhibitors.

    Claims

    1. A method of treating a subject with cancer, the method comprising administering to the subject an effective amount of a G-protein-coupled receptor kinase 2 (GRK2) small molecule antagonist.

    2. A method of treating a subject with cancer, the method comprising contacting a tumor, tumor microenvironment, site of metastasis, cancer cell, metastatic cancer cell, or stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    3. A method of treating a subject identified as having cancer, the method comprising administering to the subject an effective amount of a GRK2 small molecule antagonist.

    4. A method of treating a subject identified as having cancer, the method comprising contacting a tumor, tumor microenvironment, site of metastasis, cancer cell, metastatic cancer cell, or stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    5. A method of reducing or inhibiting cancer cell proliferation in a subject in need thereof, the method comprising administering to the subject an effective amount of a GRK2 small molecule antagonist.

    6. A method of reducing or inhibiting cancer cell proliferation in a subject in need thereof, the method comprising contacting a cancer cell with an effective amount of a GRK2 small molecule antagonist.

    7. A method of reducing or inhibiting cancer cell or tumor growth in a subject in need thereof, the method comprising administering to the subject an effective amount of a GRK2 small molecule antagonist.

    8. A method of reducing or inhibiting cancer cell or tumor growth in a subject in need thereof, the method comprising contacting a tumor, tumor microenvironment, site of metastasis, cancer cell, metastatic cancer cell, or stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    9. The method of any one of claims 1-8, wherein the cancer is GRK2-associated cancer.

    10. The method of any one of claims 1-9, wherein the method comprises identifying the cancer as GRK2-associated cancer prior to administration of the GRK2 small molecule antagonist.

    11. A method of treating a subject with cancer, the method comprising: (a) identifying a subject with GRK2-associated cancer; and (b) administering to the subject an effective amount of a GRK2 small molecule antagonist.

    12. A method of treating a subject with cancer, the method comprising: (a) identifying a subject with GRK2-associated cancer; and (b) contacting a tumor, tumor microenvironment, site of metastasis, cancer cell, metastatic cancer cell, or stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    13. A method of treating a subject with GRK2-associated cancer, the method comprising administering to the subject an effective amount of a GRK2 small molecule antagonist.

    14. A method of treating a subject with GRK2-associated cancer, the method comprising contacting a tumor, tumor microenvironment, site of metastasis, cancer cell, metastatic cancer cell, or stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    15. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a tumor with an effective amount of a GRK2 small molecule antagonist.

    16. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    17. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a site of metastasis with an effective amount of a GRK2 small molecule antagonist.

    18. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a cancer cell with an effective amount of a GRK2 small molecule antagonist.

    19. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a metastatic cancer cell with an effective amount of a GRK2 small molecule antagonist.

    20. The method of claim 2, 4, 8, 12, or 14, wherein the wherein the method comprises contacting a stromal cell in a tumor microenvironment with an effective amount of a GRK2 small molecule antagonist.

    21. A method of predicting the response of a cancer in a subject to treatment with a GRK2 inhibitor, the method comprising contacting a cancer cell isolated from the subject with a GRK2 small molecule antagonist and evaluating the response of the cancer cell.

    22. The method of claim 21, wherein the evaluating comprises assessing cancer cell growth, cancer cell proliferation, cancer cell metastasis, cancer cell invasion, cancer cell migration, cancer cell death, cancer cell autophagy, cancer cell GRK2 expression, or cancer cell innervation.

    23. The method of claim 22, wherein the evaluating comprises assessing cancer cell proliferation.

    24. A method of predicting the response of a cancer in a subject to treatment with a GRK2 inhibitor, the method comprising: (a) isolating a cancer cell from the subject; (b) measuring the expression of GRK2 in the cancer cell; and (c) comparing GRK2 expression in the cancer cell to a reference, wherein increased expression of GRK2 in the cancer cell as compared to the reference indicates that the subject will respond to treatment with a small molecule antagonist.

    25. The method of claim 24, wherein the method further comprises providing a GRK2 small molecule antagonist suitable for administration to the subject.

    26. The method of claim 24, wherein the method further comprises administering to the subject an effective amount of a GRK2 small molecule antagonist.

    27. The method of any one of claims 1-26, wherein the GRK2 small molecule antagonist is a compound of Formula I, Formula II, or Formula III, Formula IV, or any one of compounds 1-70.

    28. The method of claim 27, wherein the GRK2 small molecule antagonist is a compound of Formula I.

    29. The method of claim 28, wherein the GRK2 small molecule antagonist of Formula I is a compound of any one of Formula I-1 to I-39.

    30. The method of claim 27, wherein the GRK2 small molecule antagonist is a compound of Formula II.

    31. The method of claim 30, wherein the GRK2 small molecule antagonist of Formula II is a compound of any one of Formula II-1 to II-35.

    32. The method of claim 27, wherein the GRK2 small molecule antagonist is a compound of Formula III.

    33. The method of claim 32, wherein the GRK2 small molecule antagonist of Formula III is a compound of any one of Formula III-1 to III-56.

    34. The method of claim 27, wherein the GRK2 small molecule antagonist is a compound of Formula IV.

    35. The method of claim 34, wherein the GRK2 small molecule antagonist of Formula IV is a compound of any one of Formula IV-1 to IV-80.

    36. The method of claim 27, wherein the GRK2 small molecule antagonist is any one of compounds 1-70.

    37. The method of any one of claims 1-36, wherein the GRK2 small molecule antagonist reduces GRK2 kinase activity.

    38. The method of any one of claims 1-37, wherein the cancer is pancreatic cancer, melanoma, small cell lung cancer, non-small cell lung cancer, gastric cancer, colorectal cancer, head and neck cancer, ovarian cancer, testicular cancer, thymoma, uterine cancer, kidney cancer, acute myeloid leukemia, diffuse large B-cell lymphoma, prostate cancer, breast cancer, or hepatocellular carcinoma.

    39. The method of claim 38, wherein the cancer is pancreatic cancer.

    40. The method of any one of claims 1-39, wherein the GRK2 small molecule antagonist is administered locally.

    41. The method of claim 40, wherein the GRK2 small molecule antagonist is administered intratumorally.

    42. The method of any one of claims 1-41, wherein the method further comprises administering a second therapeutic agent.

    43. The method of claim 42, wherein the second therapeutic agent is an anti-cancer agent, a GRK2 signaling inhibitor, a GRK2 function blocker, a neurotransmission blocker, or a neuronal growth factor blocker.

    44. The method of claim 43, wherein the second therapeutic agent is an anti-cancer agent.

    45. The method of claim 44, wherein the anti-cancer agent is a chemotherapeutic agent, a checkpoint inhibitor, a biologic cancer agent, a cancer-specific agent, a cytokine therapy, an anti-angiogenic drug, a drug that targets cancer metabolism, an antibody that marks a cancer cell surface for destruction, an antibody-drug conjugate, a cell therapy, a commonly used anti-neoplastic agent, a CAR-T therapy, an oncolytic virus, or a non-drug therapy.

    46. The method of claim 45, wherein the checkpoint inhibitor is an inhibitory antibody, a fusion protein, an agent that interacts with a checkpoint protein, an agent that interacts with the ligand of a checkpoint protein, an inhibitor of CTLA-4, an inhibitor of PD-1, an inhibitor of PDL1, an inhibitor of PDL2, or an inhibitor of B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, or B-7 family ligands.

    47. The method of any one of claims 1-46, wherein the GRK2 small molecule antagonist does not cross the blood brain barrier (BBB).

    48. The method of claim 47, wherein the GRK2 small molecule antagonist has been modified to prevent BBB crossing by conjugation to a targeting moiety, formulation in a particulate delivery system, addition of a molecular adduct, or through modulation of its size, polarity, flexibility, or lipophilicity.

    49. The method of any one of claims 1-48, wherein the GRK2 small molecule antagonist does not have a direct effect on the central nervous system or gut.

    50. The method of any one of claims 1-49, wherein the GRK2 small molecule antagonist decreases tumor volume, decreases tumor growth, decreases tumor innervation, decreases nerve activity in a tumor, decreases cancer cell proliferation, decreases cancer cell invasion, decreases cancer cell migration, decreases cancer cell metastasis, increases cancer cell autophagy, increases cancer cell death, decreases tumor GRK2 expression, causes remission, treats the cancer or tumor, increases time to recurrence, or improves survival.

    51. The method of any one of claims 1-50, wherein the method further comprises measuring one or more of tumor volume, tumor growth, tumor innervation, nerve activity in a tumor, cancer cell proliferation, cancer cell invasion, cancer cell migration, cancer cell metastasis, cancer cell autophagy, cancer cell death, or GRK2 expression before administration of the GRK2 small molecule antagonist.

    52. The method of any one of claims 1-51, wherein the method further comprises measuring one or more of tumor volume, tumor growth, tumor innervation, nerve activity in a tumor, cancer cell proliferation, cancer cell invasion, cancer cell migration, cancer cell metastasis, cancer cell autophagy, cancer cell death, or GRK2 expression after administration of the GRK2 small molecule antagonist.

    53. The method of any one of claims 1-52, wherein the GRK2 small molecule antagonist is administered in an amount sufficient to decrease tumor volume, decrease tumor growth, decrease tumor innervation, decrease nerve activity in a tumor, decrease cancer cell proliferation, decrease cancer cell invasion, decrease cancer cell migration, decrease cancer cell metastasis, increase cancer cell autophagy, increase cancer cell death, decrease tumor GRK2 expression, cause remission, treat the cancer or tumor, increase time to recurrence, or improve survival.

    54. The method of any one of claims 1-53, wherein the subject is not diagnosed as having high blood pressure or a cardiac condition.

    55. The method of any one of claims 1-54, wherein the subject is human.

    56. An anti-cancer therapy comprising a GRK2 small molecule antagonist a second agent selected from the group consisting of chemotherapeutic agents, checkpoint inhibitors, biologic cancer agents, cancer-specific agents, cytokine therapies, anti-angiogenic drugs, drugs that target cancer metabolism, antibodies that mark a cancer cell surface for destruction, antibody-drug conjugates, cell therapies, commonly used anti-neoplastic agents, CAR-T therapies, oncolytic viruses, non-drug therapies, neurotransmission blockers, and neuronal growth factor blockers.

    57. The anti-cancer therapy of claim 56, wherein the GRK2 small molecule antagonist is a compound of Formula I, Formula II, Formula III, or Formula IV, or any one of compounds 1-70.

    58. The anti-cancer therapy of claim 57, wherein the GRK2 small molecule antagonist is a compound of Formula I.

    59. The anti-cancer therapy of claim 58, wherein the GRK2 small molecule antagonist of Formula I is a compound of any one of Formula I-1 to I-39.

    60. The anti-cancer therapy of claim 57, wherein the GRK2 small molecule antagonist is a compound of Formula II.

    61. The anti-cancer therapy of claim 60, wherein the GRK2 small molecule antagonist of Formula II is a compound of any one of Formula II-1 to II-35.

    62. The anti-cancer therapy of claim 57, wherein the GRK2 small molecule antagonist is a compound of Formula III.

    63. The anti-cancer therapy of claim 62, wherein the GRK2 small molecule antagonist of Formula III is a compound of any one of Formula III-1 to III-56.

    64. The anti-cancer therapy of claim 57, wherein the GRK2 small molecule antagonist is a compound of Formula IV.

    65. The anti-cancer therapy of claim 64, wherein the GRK2 small molecule antagonist of Formula IV is a compound of any one of Formula IV-1 to IV-80.

    66. The anti-cancer therapy of claim 57, wherein the GRK2 small molecule antagonist is any one of compounds 1-70.

    67. The anti-cancer therapy of any one of claims 56-66, wherein the second agent is a chemotherapeutic agent.

    68. The anti-cancer therapy of any one of claims 56-66, wherein the second agent is a checkpoint inhibitor.

    69. The anti-cancer therapy of claim 68, wherein the checkpoint inhibitor is an inhibitory antibody, a fusion protein, an agent that interacts with a checkpoint protein, an agent that interacts with the ligand of a checkpoint protein, an inhibitor of CTLA-4, an inhibitor of PD-1, an inhibitor of PDL1, an inhibitor of PDL2, or an inhibitor of B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, or B-7 family ligands.

    70. A pharmaceutical composition comprising a GRK2 small molecule antagonist and an anti-cancer therapeutic.

    71. The pharmaceutical composition of claim 70, wherein the GRK2 small molecule antagonist is a compound of Formula I, Formula II, Formula III, or Formula IV, or any one of compounds 1-70.

    72. The pharmaceutical composition of claim 71, wherein the GRK2 small molecule antagonist is a compound of Formula I.

    73. The pharmaceutical composition of claim 72, wherein the GRK2 small molecule antagonist of Formula I is a compound of any one of Formula I-1 to I-39.

    74. The pharmaceutical composition of claim 71, wherein the GRK2 small molecule antagonist is a compound of Formula II.

    75. The pharmaceutical composition of claim 74, wherein the GRK2 small molecule antagonist of Formula II is a compound of any one of Formula II-1 toll-35.

    76. The pharmaceutical composition of claim 71, wherein the GRK2 small molecule antagonist is a compound of Formula III.

    77. The pharmaceutical composition of claim 76, wherein the GRK2 small molecule antagonist of Formula III is a compound of any one of Formula III-1 to III-56.

    78. The pharmaceutical composition of claim 71, wherein the GRK2 small molecule antagonist is a compound of Formula IV.

    79. The pharmaceutical composition of claim 78, wherein the GRK2 small molecule antagonist of Formula IV is a compound of any one of Formula IV-1 to IV-80.

    80. The pharmaceutical composition of claim 71, wherein the GRK2 small molecule antagonist is any one of compounds 1-70.

    81. The pharmaceutical composition of any one of claims 70-80, wherein the anti-cancer therapeutic is a chemotherapeutic agent, a checkpoint inhibitor, a biologic cancer agent, a cancer-specific agent, a cytokine therapy, an anti-angiogenic drug, a drug that targets cancer metabolism, an antibody that marks a cancer cell surface for destruction, an antibody-drug conjugate, a cell therapy, a commonly used anti-neoplastic agent, a CAR-T therapy, an oncolytic virus, or a non-drug therapy.

    82. The pharmaceutical composition of claim 81, wherein the anti-cancer therapeutic is a chemotherapeutic agent.

    83. The pharmaceutical composition of claim 81, wherein the anti-cancer agent is a checkpoint inhibitor.

    84. The pharmaceutical composition of claim 83, wherein the checkpoint inhibitor is an inhibitory antibody, a fusion protein, an agent that interacts with a checkpoint protein, an agent that interacts with the ligand of a checkpoint protein, an inhibitor of CTLA-4, an inhibitor of PD-1, an inhibitor of PDL1, an inhibitor of PDL2, or an inhibitor of B7-H3, B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, or B-7 family ligands.

    85. The pharmaceutical composition of any one of claims 70-84, wherein the composition further comprises a pharmaceutically acceptable excipient.

    Description

    DETAILED DESCRIPTION

    [0401] Described herein are compositions and methods for the treatment of cancer in a subject (e.g., a mammalian subject, such as a human) by administering GRK2 inhibitors. GRK2 inhibitors include inhibitors specific to GRK2 (e.g., GRK2-specific inhibitory RNAs), inhibitors that reduce GRK2 function (e.g., GRK2 small molecule antagonists), and inhibitors that target GKR2 binding partners or downstream signaling pathways. These methods and compositions provide new mechanistic approaches for treating cancer.

    GRK2

    [0402] G-protein-coupled receptor kinase 2 (GRK2, Entrez Gene ID 156, also known as adrenergic beta kinase 1, ADRBK1, and BARK1) is a member of the G protein-coupled receptor kinase family of proteins. GRK2 is a positive effector of certain G protein-coupled receptors (GPCRs) and receptor-tyrosine kinases (RTK) transduction cascades. GRK2 phosphorylates the beta-adrenergic receptor as well as a wide range of other substrates including non-GPCR cell surface receptors, and cytoskeletal, mitochondrial, and transcription factor proteins. GRK2 specifically phosphorylates the agonist-occupied form of the beta-adrenergic and closely related receptors, likely inducing their desensitization. GRK2 is a key regulator of LPAR1 signaling that competes with RALA for binding to LPAR1, thus affecting the signaling properties of the receptor. GRK2 desensitizes LPAR1 and LPAR2 in a phosphorylation-independent manner. GRK2 positively regulates the ciliary smoothened (SMO)-dependent Hedgehog (Hh) signaling pathway by facilitating the trafficking of SMO into the cilium and the stimulation of SMO activity. The reaction catalyzed by GRK2 is as follows:


    ATP+[beta-adrenergic receptor]=ADP+[beta-adrenergic receptor] phosphate.

    [0403] The present invention relates to the discovery that loss of GRK2 in pancreatic cancer cell lines prevented tumor growth in vitro and when the GRK2 knockout cancer cells were implanted in mice. Cancer cell proliferation could not be restored by the introduction of kinase-dead GRK2 into knockout cancer cells, suggesting that loss of GRK2 kinase activity mediates the anti-proliferative effect. Treatment of pancreatic cancer cell lines with a small molecule GRK2 antagonist also reduced cancer cell proliferation. These findings indicate that inhibition of GRK2, particularly using small molecule GRK2 antagonists, can be used as a therapeutic strategy for treating pancreatic cancer and other cancers. These data also suggest that patients with overexpression of GRK2 are at increased risk of developing cancer and would benefit from specific treatments, such as treatment with the compositions and methods described herein.

    GRK2 inhibitors

    [0404] GRK2 inhibitors described herein can reduce or inhibit GRK2 function, expression, or signaling in order to treat cancer. GRK2 inhibitors can be grouped into categories based on their mechanism of action and their effect on GRK2: (i) GRK2-specific inhibitors (e.g., inhibitors that directly bind to, target, or knock down GRK2, such as GRK2-specific inhibitory RNAs and nucleases); (ii) GRK2 function blockers (e.g., inhibitors that prevent GRK2 from binding to a binding partner, or carrying out other processes necessary for normal GRK2 activity, e.g., small molecule antagonists of GRK2 and inhibitory RNAs and nucleases directed to GRK2 binding partners); and (iii) GRK2 signaling inhibitors (e.g., inhibitors that disrupt downstream signaling pathways or intracellular or extracellular events that occur after activation of GRK2).

    [0405] GRK2-Specific Inhibitors

    [0406] In some embodiments, the GRK2 inhibitor is a GRK2-specific inhibitor. GRK2-specific inhibitors selectively bind to, target, or knock down GRK2, without directly binding to or targeting other proteins. GRK2-specific inhibitors include inhibitory RNAs (e.g., shRNA, siRNA, or miRNA) and nucleases (e.g., TALENs, ZFNs, gRNAs, or Cas, e.g., Cas9) directed to GRK2. GRK2-specific inhibitors can reduce GRK2 function, expression, or signaling by 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or more).

    [0407] In some embodiments, the GRK2-specific inhibitor is an inhibitory RNA (e.g., shRNA, siRNA, or miRNA) directed to GRK2.

    [0408] In some embodiments, the GRK2-specific inhibitor is a nuclease (e.g., a TALEN, ZFN, gRNA, or Cas, e.g., Cas9) directed to GRK2. In some embodiments, the nuclease is directed to GRK2 by a guide RNA (gRNA) molecule. The gRNA may be introduced into a cell (e.g., a cancer cell) using a DNA construct (e.g., via an integrating virus). Exemplary gRNA molecules that can be used to target a nuclease to GRK2, for use in the methods and compositions described herein, include the gRNA molecules encoded by the DNA molecules used to knockout GRK2 in pancreatic cancer cells (e.g., SEQ ID NOs: 1-6). In some embodiments, the gRNA molecule directed to GRK2 is encoded by a DNA molecule having a nucleic acid sequence with at least 85% (e.g., at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%) sequence identity to the nucleic acid sequence of any one of SEQ ID NOs: 1-6. In some embodiments, the gRNA molecule directed to GRK2 is encoded by a DNA molecule having the nucleic acid sequence of any one of SEQ ID NOs: 1-6.

    [0409] GRK2 Function Blockers

    [0410] In some embodiments, the GRK2 inhibitor is a GRK2 function blocker. GRK2 function blockers can reduce or inhibit GRK2 function by reducing GRK2 expression, preventing or reducing the interaction of GRK2 with its binding partners (e.g., ADRB1 or other binding partners listed in Table 2), or preventing or reducing GRK2 activity (e.g., kinase activity). GRK2 function blockers include GRK2-specific inhibitors that directly target or bind to GRK2 (e.g., inhibitory RNAs and nucleases directed to GRK2), GRK2 small molecule antagonists, and GRK2 inhibitors directed to GRK2 binding partners (e.g., small molecule inhibitors, inhibitory RNAs, and nucleases directed to binding partners of GRK2, e.g., ADRB1 or other binding partners listed in Table 2).

    [0411] GRK2 binding partners include ADRB1 (Entrez Gene ID: 153), ADRB2 (Entrez Gene ID: 154), RALA (Entrez Gene ID: 5898), LPAR1 (Entrez Gene ID: 1902), LPAR2 (Entrez Gene ID: 9170), CCRS (Entrez Gene ID: 1234), ADRA2A (Entrez Gene ID: 150), ARRB1 (Entrez Gene ID: 408), and GIT1 (Entrez Gene ID: 28964). In some embodiments, the GRK2 binding partner is a molecule listed in Table 2.

    [0412] In some embodiments, the GRK2 function blocker is a small molecule antagonist that reduces or inhibits GRK2 activity. GRK2 small molecule antagonists for use in the methods and compositions described herein include compounds having the structure of any one of Formula I (e.g., having the structure of any one of Formula I-1 to I-39), Formula II (e.g., having the structure of any one of Formula II-1 to II-35), Formula III (e.g., having the structure of any one of Formula III-1 to III-56), or Formula IV (e.g., having the structure of any one of Formula IV-1 to IV-80), and Compounds 1-70. In some embodiments, the GRK2 small molecule antagonist reduces or inhibits GRK2 function. For example, the GRK2 small molecule inhibitor can reduce or inhibit GRK2 kinase activity. In some embodiments, the GRK2 small molecule inhibitor is a small molecule listed in U.S. Patent Application Publication No. US20170240538, International Application Publication No. WO/2005/090328, International Application Publication No. WO2007/034846, International Application Publication No. WO/2016/210403, or U.S. Pat. No. 7,910,602, the disclosures of which are incorporated herein by reference. In some embodiments, the GRK2 small molecule antagonist has the structure of Formula I-10 (described in Waldschmidt et al., J. Med. Chem. 59:3793-3807, 2016, the disclosure of which is incorporated herein by reference), Formula II-26 (described in Waldschmidt et al., J. Med. Chem. 60:3052-3069, 2017, the disclosure of which is incorporated herein by reference), Formula III-26 (described in Okawa et al., J. Med. Chem. 60:6942-6690, 2017, the disclosure of which is incorporated herein by reference), Formula III-27 (CAS-865609-72-9), Formula IV-8, or Compound 70.

    [0413] In some embodiments, the GRK2 function blocker is an inhibitory RNA (e.g., shRNA, siRNA, or miRNA) directed to a GRK2 binding partner listed in Table 2. In some embodiments, the GRK2 function blocker is a nuclease (e.g., a TALEN, ZFN, gRNA, or Cas, e.g., Cas9) directed to a GRK2 binding partner listed in Table 2.

    [0414] GRK2 Signaling Inhibitors

    [0415] In some embodiments, the GRK2 inhibitor is a GRK2 signaling inhibitor. GRK2 signaling inhibitors include agents that reduce or inhibit signaling that occurs downstream of GRK2 activation or binding to a binding partner, such as small molecule inhibitors of intracellular signaling cascades (e.g., small molecule inhibitors that target the smoothened (SMO)-dependent Hedgehog (Hh) signaling pathway) and inhibitory RNAs directed to components of downstream signaling cascades (e.g., inhibitory RNAs directed to molecules in the SMO-dependent Hh signaling pathway). Small molecule signaling inhibitors for use in the methods and compositions described herein are listed in Table 3.

    TABLE-US-00002 TABLE 2 GRK2 BINDING PARTNERS Symbol HGNC Accession No. Entrez Gene ID ADRB2 286 154 ADRB1 285 153 ADRA2A 281 150 ARRB1 711 408 GIT1 4272 28964 CCR5 1606 1234 LPAR1 3166 1902 LPAR2 3168 9170 RALA 9839 5898

    TABLE-US-00003 TABLE 3 GRK2 SIGNALING INHIBITORS Pathway Inhibitors Structure Smoothened (SMO)- dependent Hedgehog (Hh) signaling LDE225/Sonidegib [00287]embedded image GDC-0449/Vismodegib [00288]embedded image

    [0416] Agent Modalities

    [0417] A GRK2 inhibitor can be selected from a number of different modalities. A GRK2 inhibitor can be a nucleic acid molecule (e.g., DNA molecule or RNA molecule, e.g., mRNA or inhibitory RNA molecule (e.g., siRNA, shRNA, or miRNA), or a hybrid DNA-RNA molecule), a small molecule (e.g., a GRK2 small molecule inhibitor, an inhibitor of a signaling cascade, or an epigenetic modifier), or a nuclease (e.g., Cas9, TALEN, or ZFN). Any of these modalities can be a GRK2 inhibitor directed to target (e.g., to reduce or inhibit) GRK2 function, GRK2 expression, GRK2 binding, or GRK2 signaling.

    [0418] The nucleic acid molecule, small molecule, or nuclease can be modified. For example, the modification can be a chemical modification, e.g., conjugation to a marker, e.g., fluorescent marker or a radioactive marker. In other examples, the modification can include conjugation to a molecule that enhances the stability or half-life of the GRK2 inhibitor (e.g., the Fc domain of an antibody or serum albumin, e.g., human serum albumin). The modification can also include conjugation to an antibody to target the agent to a particular cell or tissue. Additionally, the modification can be a chemical modification, packaging modification (e.g., packaging within a nanoparticle or microparticle), or targeting modification to prevent the agent from crossing the blood brain barrier.

    [0419] Small Molecules

    [0420] Numerous small molecule GRK2 inhibitors (e.g., antagonists) useful in the methods of the invention are described herein and additional small molecule GRK2 inhibitors useful as therapies for cancer can also be identified through screening based on their ability to reduce or inhibit GRK2 function or signaling (e.g., GRK2 kinase activity). Small molecules include, but are not limited to, small peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, synthetic polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic and inorganic compounds (including heterorganic and organometallic compounds) generally having a molecular weight less than about 5,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 2,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 1,000 grams per mole, e.g., organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.

    [0421] In some embodiments, the GRK2 inhibitor is a GRK2 small molecule antagonist described herein (e.g., a compound having the structure of Formula I (e.g., having the structure of any one of Formula I-1 to I-39), Formula II (e.g., having the structure of any one of Formula II-1 toll-35), Formula III (e.g., having the structure of any one of Formula III-1 to III-56), or Formula IV (e.g., having the structure of any one of Formula IV-1 to IV-80), or any one of Compounds 1-70). In some embodiments, the GRK2 small molecule antagonist is a small molecule listed in U.S. Patent Application Publication No. US20170240538, International Application Publication No. WO/2005/090328, International Application Publication No. WO2007/034846, International Application Publication No. WO/2016/210403, or U.S. Pat. No. 7,910,602, the disclosures of which are incorporated herein by reference. In some embodiments, the GRK2 small molecule antagonist has the structure of Formula I-10 (described in Waldschmidt et al., J. Med. Chem. 59:3793-3807, 2016), Formula II-26 (described in Waldschmidt et al., J. Med. Chem. 60:3052-3069, 2017), Formula III-26 (described in Okawa et al., J. Med. Chem. 60:6942-6690, 2017), Formula III-27 (CAS-865609-72-9), Formula IV-8, or Compound 70. GRK2 inhibitors can be used to treat a disorder or condition described herein. A pharmaceutical composition containing the GRK2 small molecule antagonist can be formulated for treatment of a cancer described herein. In some embodiments, a pharmaceutical composition that includes the GRK2 small molecule antagonist is formulated for local administration, e.g., to the affected site in a subject.

    [0422] Nucleic Acids

    [0423] Inhibitory RNA

    [0424] In some embodiments, the GRK2 inhibitor is an inhibitory RNA molecule, e.g., that acts by way of the RNA interference (RNAi) pathway. An inhibitory RNA molecule can decrease the expression level (e.g., protein level or mRNA level) of GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway). For example, an inhibitory RNA molecule includes a small interfering RNA (siRNA), short hairpin RNA (shRNA), and/or a microRNA (miRNA) that targets full-length GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway). A siRNA is a double-stranded RNA molecule that typically has a length of about 19-25 base pairs. A shRNA is a RNA molecule containing a hairpin turn that decreases expression of target genes via RNAi. shRNAs can be delivered to cells in the form of plasmids (e.g., viral or bacterial vectors), by transfection, electroporation, or transduction. A microRNA is a non-coding RNA molecule that typically has a length of about 22 nucleotides. MiRNAs bind to target sites on mRNA molecules and silence the mRNA, e.g., by causing cleavage of the mRNA, destabilization of the mRNA, or inhibition of translation of the mRNA. In some embodiments, the inhibitory RNA molecule decreases the level and/or activity of a positive regulator of function. In other embodiments, the inhibitory RNA molecule decreases the level and/or activity of an inhibitor of a positive regulator of function.

    [0425] An inhibitory RNA molecule can be modified, e.g., to contain modified nucleotides, e.g., 2′-fluoro, 2′-o-methyl, 2′-deoxy, unlocked nucleic acid, 2′-hydroxy, phosphorothioate, 2′-thiouridine, 4′-thiouridine, 2′-deoxyuridine. Without being bound by theory, it is believed that certain modification can increase nuclease resistance and/or serum stability, or decrease immunogenicity.

    [0426] In some embodiments, the inhibitory RNA molecule decreases the level and/or activity or function of GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway). In some embodiments, the inhibitory RNA molecule inhibits expression of GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway) (e.g., inhibits translation to protein). In other embodiments, the inhibitory RNA molecule increases degradation of GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway), and/or decreases the stability (i.e., half-life) of GRK2, a GRK2 binding partner (e.g., a binding partner listed in Table 2), or a molecule required for GRK2 signaling or function (e.g., a component of the SMO-dependent Hh signaling pathway). The inhibitory RNA molecule can be chemically synthesized or transcribed in vitro.

    [0427] The making and use of inhibitory therapeutic agents based on non-coding RNA such as ribozymes, RNAse P, siRNAs, and miRNAs are also known in the art, for example, as described in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press 2010.

    [0428] Gene Editing

    [0429] In some embodiments, the GRK2 inhibitor is a component of a gene editing system. For example, the GRK2 inhibitor introduces an alteration (e.g., insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation) in GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). Exemplary gene editing systems include the zinc finger nucleases (ZFNs), Transcription Activator-Like Effector-based Nucleases (TALEN), and the clustered regulatory interspaced short palindromic repeat (CRISPR) system. ZFNs, TALENs, and CRISPR-based methods are described, e.g., in Gaj et al. Trends Biotechnol. 31.7(2013):397-405.

    [0430] CRISPR refers to a set of (or system containing a set of) clustered regularly interspaced short palindromic repeats. A CRISPR system refers to a system derived from CRISPR and Cas (a CRISPR-associated protein) or other nuclease that can be used to silence or mutate a gene described herein. The CRISPR system is a naturally occurring system found in bacterial and archaeal genomes. The CRISPR locus is made up of alternating repeat and spacer sequences. In naturally-occurring CRISPR systems, the spacers are typically sequences that are foreign to the bacterium (e.g., plasmid or phage sequences). The CRISPR system has been modified for use in gene editing (e.g., changing, silencing, and/or enhancing certain genes) in eukaryotes. See, e.g., Wiedenheft et al., Nature 482: 331, 2012. For example, such modification of the system includes introducing into a eukaryotic cell a plasmid containing a specifically-designed CRISPR and one or more appropriate Cas proteins. The CRISPR locus is transcribed into RNA and processed by Cas proteins (e.g., Cas9) into small RNAs that contain a repeat sequence flanked by a spacer. The RNAs serve as guides to direct Cas proteins to silence specific DNA/RNA sequences, depending on the spacer sequence. See, e.g., Horvath et al., Science 327: 167, 2010; Makarova et al., Biology Direct 1:7, 2006; Pennisi, Science 341: 833, 2013. In some examples, the CRISPR system includes the Cas9 protein, a nuclease that cuts on both strands of the DNA. See, e.g., Id.

    [0431] In some embodiments, in a CRISPR system for use described herein, e.g., in accordance with one or more methods described herein, the spacers of the CRISPR are derived from a target gene sequence, e.g., from a GRK2 sequence or sequence of a GRK2 binding partner (e.g., a binding partner listed in Table 2).

    [0432] In some embodiments, the GRK2 inhibitor includes a guide RNA (gRNA) for use in a CRISPR system for gene editing. In embodiments, the GRK2 inhibitor contains a ZFN, or an mRNA encoding a ZFN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). In some embodiments, the GRK2 inhibitor contains a TALEN, or an mRNA encoding a TALEN, that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). In some embodiments, the GRK2 inhibitor contains a Cas (e.g., Cas9), or an mRNA encoding a Cas (e.g., Cas9), that targets (e.g., cleaves) a nucleic acid sequence (e.g., DNA sequence) of GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2).

    [0433] In some examples, the gRNA or Cas (e.g., Cas9) can be used in a CRISPR system to engineer an alteration in a gene (e.g., GRK2). In other examples, the ZFN and/or TALEN can be used to engineer an alteration in a gene (e.g., GRK2). Exemplary alterations include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations. The alteration can be introduced in the gene in a cell, e.g., in vitro, ex vivo, or in vivo. In some embodiments, the alteration decreases the level and/or activity of (e.g., knocks down or knocks out) GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2), e.g., the alteration is a negative regulator of function. In yet another example, the alteration corrects a defect (e.g., a mutation causing a defect), in GRK2.

    [0434] In certain embodiments, the CRISPR system is used to edit (e.g., to add or delete a base pair) a target gene, e.g., GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). In other embodiments, the CRISPR system is used to introduce a premature stop codon, e.g., thereby decreasing the expression of a target gene. In yet other embodiments, the CRISPR system is used to turn off a target gene in a reversible manner, e.g., similarly to RNA interference. In some embodiments, the CRISPR system is used to direct Cas (e.g., Cas9) to a promoter of a target gene, e.g., GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2), thereby blocking an RNA polymerase sterically.

    [0435] In some embodiments, a CRISPR system can be generated to edit GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2) using technology described in, e.g., U.S. Publication No. 20140068797; Cong, Science 339: 819, 2013; Tsai, Nature Biotechnol., 32:569, 2014; and U.S. Pat. Nos. 8,871,445; 8,865,406; 8,795,965; 8,771,945; and 8,697,359.

    [0436] In some embodiments, the CRISPR interference (CRISPRi) technique can be used for transcriptional repression of specific genes, e.g., the gene encoding GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). In CRISPRi, an engineered Cas9 protein (e.g., nuclease-null dCas9, or dCas9 fusion protein, e.g., dCas9—KRAB or dCas9—SID4X fusion) can pair with a sequence specific guide RNA (sgRNA). The Cas9-gRNA complex can block RNA polymerase, thereby interfering with transcription elongation. The complex can also block transcription initiation by interfering with transcription factor binding. The CRISPRi method is specific with minimal off-target effects and is multiplexable, e.g., can simultaneously repress more than one gene (e.g., using multiple gRNAs). Also, the CRISPRi method permits reversible gene repression.

    [0437] In some embodiments, CRISPR-mediated gene activation (CRISPRa) can be used for transcriptional activation, e.g., of one or more genes described herein, e.g., a gene that inhibits GRK2 or a GRK2 binding partner (e.g., a binding partner listed in Table 2). In the CRISPRa technique, dCas9 fusion proteins recruit transcriptional activators. For example, dCas9 can be used to recruit polypeptides (e.g., activation domains) such as VP64 or the p65 activation domain (p65D) and used with sgRNA (e.g., a single sgRNA or multiple sgRNAs), to activate a gene or genes, e.g., endogenous gene(s). Multiple activators can be recruited by using multiple sgRNAs—this can increase activation efficiency. A variety of activation domains and single or multiple activation domains can be used. In addition to engineering dCas9 to recruit activators, sgRNAs can also be engineered to recruit activators. For example, RNA aptamers can be incorporated into a sgRNA to recruit proteins (e.g., activation domains) such as VP64. In some examples, the synergistic activation mediator (SAM) system can be used for transcriptional activation. In SAM, MS2 aptamers are added to the sgRNA. MS2 recruits the MS2 coat protein (MCP) fused to p65AD and heat shock factor 1 (HSF1). The CRISPRi and CRISPRa techniques are described in greater detail, e.g., in Dominguez et al., Nat. Rev. Mol. Cell Biol. 17:5, 2016, incorporated herein by reference.

    [0438] Viral Vectors

    [0439] The GRK2 inhibitor can be delivered by a viral vector (e.g., a viral vector expressing a GRK2 inhibitor). Viral vectors can be used to express a transgene encoding an inhibitory nucleotide. A viral vector may be administered to a cell or to a subject (e.g., a human subject or animal model) to increase expression of an inhibitory nucleotide. Viral vectors can also be used to express a neurotoxin from Table 10 for combination therapy with a GRK2 inhibitor. A viral vector expressing a neurotoxin from Table 10 can be administered to a cell or to a subject (e.g., a human subject or animal model) to decrease or block neurotransmission. Viral vectors can be directly administered (e.g., injected) to a tumor to treat cancer.

    [0440] Viral genomes provide a rich source of vectors that can be used for the efficient delivery of exogenous genes into a mammalian cell. Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of a mammalian cell by generalized or specialized transduction. These processes occur as part of the natural viral replication cycle, and do not require added proteins or reagents in order to induce gene integration. Examples of viral vectors include a retrovirus (e.g., Retroviridae family viral vector), adenovirus (e.g., AdS, Ad26, Ad34, Ad35, and Ad48), parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as orthomyxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses, such as picornavirus and alphavirus, and double stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus, replication deficient herpes virus), and poxvirus (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, human papilloma virus, human foamy virus, and hepatitis virus, for example. Examples of retroviruses include: avian leukosis-sarcoma, avian C-type viruses, mammalian C-type, B-type viruses, D-type viruses, oncoretroviruses, HTLV-BLV group, lentivirus, alpharetrovirus, gammaretrovirus, spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, Virology (Third Edition) Lippincott-Raven, Philadelphia, 1996). Other examples include murine leukemia viruses, murine sarcoma viruses, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, Gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus and lentiviruses. Other examples of vectors are described, for example, in U.S. Pat. No. 5,801,030, the teachings of which are incorporated herein by reference.

    Blood Brain Barrier Permeability

    [0441] In some embodiments, the GRK2 inhibitors for use in the present invention are agents that are not capable of crossing, or that do not cross, the blood brain barrier (BBB) of a mammal, e.g., an experimental rodent (e.g., mouse or rat), dog, pig, non-human primate, or a human. The BBB is a highly selective semipermeable membrane barrier that separates the circulating blood from the brain extracellular fluid (e.g., cerebrospinal fluid) in the central nervous system (CNS). The BBB is made up of high-density endothelial cells, which are connected by tight junctions. These cells prevent most molecular compounds in the bloodstream (e.g., large molecules and hydrophilic molecules) from entering the brain. Water, some gases (e.g., oxygen and carbon dioxide), and lipid-soluble molecules (e.g., hydrophobic molecules, such as steroid hormones) can cross the BBB by passive diffusion. Molecules that are needed for neural function, such as glucose and amino acids, are actively transported across the BBB.

    [0442] A number of approaches can be used to render an agent BBB impermeable. These methods include modifications to increase an agent's size, polarity, or flexibility or reduce its lipophilicity, targeting approaches to direct an agent to another part of the body and away from the brain, and packaging approaches to deliver an agent in a form that does not freely diffuse across the BBB. These approaches can be used to render a BBB permeable GRK2 inhibitor BBB impermeable, and they can also be used to improve the properties (e.g., cell-specific targeting) of a GRK2 inhibitor that does not cross the BBB. The methods that can be used to render an agent BBB impermeable are discussed in greater detail herein below.

    [0443] Formulation of BBB-Impermeable Agents for Enhanced Cell Targeting

    [0444] One approach that can be used to render a GRK2 inhibitor BBB impermeable is to conjugate the agent to a targeting moiety that directs it somewhere other than the brain. The targeting moiety can be an antibody for a receptor expressed by the target cell (e.g., N-Acetylgalactosamine for liver transport; DGCR2, GBF1, GPR44 or SerpinB10 for pancreas transport; Secretoglobin, family 1A, member 1 for lung transport). The targeting moiety can also be a ligand of any receptor or other molecular identifier expressed on the target cell in the periphery. These targeting moieties can direct the GRK2 inhibitor of interest to its corresponding target cell, and can also prevent BBB crossing by directing the agent away from the BBB and increasing the size of the GRK2 inhibitor via conjugation of the targeting moiety.

    [0445] GRK2 inhibitors can also be rendered BBB impermeable through formulation in a particulate delivery system (e.g., a nanoparticle, liposome, or microparticle), such that the agent is not freely diffusible in blood and cannot cross the BBB. The particulate formulation used can be chosen based on the desired localization of the GRK2 inhibitor (e.g., a tumor, tumor microenvironment, or site of metastasis), as particles of different sizes accumulate in different locations. For example, nanoparticles with a diameter of 45 nm or less enter the lymph node, while 100 nm nanoparticles exhibit poor lymph node trafficking. Some examples of the link between particle size and localization in vivo are described in Reddy et al., J Controlled Release 112:26 2006, and Reddy et al., Nature Biotechnology 25:1159 2007.

    [0446] GRK2 inhibitors can be tested after the addition of a targeting moiety or after formulation in a particulate delivery system to determine whether or not they cross the BBB. Models for assessing BBB permeability include in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; and Wang et al., Int J Pharm 288:349 2005. A GRK2 inhibitor that exhibits BBB impermeability can be used in the methods described herein.

    [0447] Modification of Existing Compounds to Render them BBB Impermeable

    [0448] There are multiple parameters that have been empirically derived in the field of medicinal chemistry to predict whether a compound will cross the BBB. The most common numeric value for describing permeability across the BBB is the log BB, defined as the logarithmic ratio of the concentration of a compound in the brain and in the blood. Empirical rules of thumb have been developed to predict BBB permeability, including rules regarding molecular size, polar surface area, sum of oxygen and nitrogen atoms, lipophilicity (e.g., partition coefficient between apolar solvent and water), “lipoaffinity”, molecular flexibility, and number of rotatable bonds (summarized in Muehlbacher et al., J Comput Aided Mol Des. 25: 1095 2011; and Geldenhuys et al., Ther Deliv. 6: 961 2015). Some preferred limits on various parameters for BBB permeability are listed in Table 1 of Ghose et al., ACS Chem Neurosci. 3: 50 2012, which is incorporated herein by reference. Based on the parameters shown in the table, one of skill in the art could modify an existing GRK2 inhibitor to render it BBB impermeable.

    [0449] One method of modifying a GRK2 inhibitor to prevent BBB crossing is to add a molecular adduct that does not affect the target binding specificity, kinetics, or thermodynamics of the agent. Molecular adducts that can be used to render an agent BBB impermeable include polyethylene glycol (PEG), a carbohydrate monomer or polymer, a dendrimer, a polypeptide, a charged ion, a hydrophilic group, deuterium, and fluorine. GRK2 inhibitors can be tested after the addition of one or more molecular adducts or after any other properties are altered to determine whether or not they cross the BBB. Models for assessing BBB permeability include in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; and Wang et al., Int J Pharm 288:349 2005. A GRK2 inhibitor that exhibits BBB impermeability can be used in the methods described herein.

    [0450] Screening for or Development of BBB Impermeable Agents

    [0451] Another option for developing BBB impermeable agents is to find or develop new agents that do not cross the BBB. One method for finding new BBB impermeable agents is to screen for compounds that are BBB impermeable. Compound screening can be performed using in vitro models (e.g., monolayer models, co-culture models, dynamic models, multi-fluidic models, isolated brain microvessels), in vivo models, and computational models, as described in He et al., Stroke 45:2514 2014; Bickel, NeuroRx 2:15 2005; Wang et al., Int J Pharm 288:349 2005, and Czupalla et al., Methods Mol Biol 1135:415 2014. For example, the ability of a molecule to cross the blood brain barrier can be determined in vitro using a transwell BBB assay in which microvascular endothelial cells and pericytes are co-cultured separated by a thin macroporous membrane, see e.g., Naik et al., J Pharm Sci 101:1337 2012 and Hanada et al., Int J Mol Sci 15:1812 2014; or in vivo by tracking the brain uptake of the target molecule by histology or radio-detection. Compounds would be deemed appropriate for use as GRK2 inhibitors in the methods described herein if they do not display BBB permeability in the aforementioned models.

    Cancer

    [0452] The methods described herein can be used to treat cancer in a subject by administering to the subject an effective amount of a GRK2 inhibitor, e.g., a GRK2 inhibitor described herein. The method may include administering locally (e.g., intratumorally) to the subject a GRK2 inhibitor described herein in a dose (e.g., effective amount) and for a time sufficient to treat the cancer. For example, the stroma associated with the tumor, e.g., fibroblasts, is disrupted such that an essential function, e.g., the production of matrix metalloproteases, is altered to inhibit tumor survival or promote tumor control.

    [0453] In some embodiments, the GRK2 inhibitor inhibits proliferation or disrupts the function of non-neural cells associated with the cancer, e.g., the method includes administering to the subject an effective amount of a GRK2 inhibitor for a time sufficient to inhibit proliferation or disrupt the function of non-neural cells associated with the cancer. Non-neural cells associated with the cancer include malignant cancer cells, malignant cancer cells in necrotic and hypoxic areas, adipocytes, pericytes, endothelial cells, cancer associated fibroblasts, fibroblasts, mesenchymal stem cells, red blood cells, or extracellular matrix. The proliferation of non-neural cells associated with the cancer may be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The proliferation of non-neural cells associated with the cancer can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0454] The GRK2 inhibitor can treat cancer by increasing cancer cell death or cancer cell autophagy in a subject (e.g., a human subject or animal model) or in a cancer cell culture (e.g., a culture generated from a patient tumor sample, a cancer cell line, or a repository of patient samples). A GRK2 inhibitor can increase cancer cell death or cancer cell autophagy by at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to before administration to a subject or cancer cell culture. A GRK2 inhibitor can increase cancer cell death or cancer cell autophagy in a subject or cancer cell culture between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0455] The GRK2 inhibitor can also act to inhibit cancer cell growth, proliferation, metastasis, migration, or invasion, e.g., the method includes administering to the subject (e.g., a human subject or animal model) or a cancer cell culture (e.g., a culture generated from a patient tumor sample, a cancer cell line, or a repository of patient samples) a GRK2 inhibitor in an amount (e.g., an effective amount) and for a time sufficient to inhibit cancer cell growth, proliferation, metastasis, migration, or invasion. Cancer cell growth, proliferation, metastasis, migration, or invasion can be decreased in the subject or cancer cell culture at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. Cancer cell growth, proliferation, metastasis, migration, or invasion can be decreased in the subject or cancer cell culture between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0456] The GRK2 inhibitor can inhibit cancer cell invasion or metastasis along a nerve, e.g., the method includes administering to the subject (e.g., a human subject or animal model) a GRK2 inhibitor in an amount (e.g., an effective amount) and for a time sufficient to inhibit cancer cell invasion or metastasis along a nerve. The GRK2 inhibitor can decrease cancer cell invasion or metastasis along a nerve in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The GRK2 inhibitor can decrease cancer cell invasion or metastasis along a nerve in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0457] The GRK2 inhibitor can also reduce the number of nerve fibers in the affected tissue, reduce the activity of peripheral nerve fibers in the affected tissue (e.g., reduce neurotransmission), or reduce axonal growth or sprouting of nerve fibers in the affected tissue. For example, the method includes administering to the subject (e.g., a human subject or animal model) a GRK2 inhibitor in an amount (e.g., an effective amount) and for a time sufficient to reduce the number of nerve fibers in the affected tissue, reduce the activity of peripheral nerve fibers in the affected tissue (e.g., reduce neurotransmission), or reduce axonal growth or sprouting of nerve fibers in the affected tissue. The affected tissue can be a tumor, a tumor micro-environment, or site of metastasis. The number of nerve fibers in the affected tissue, the activity of peripheral nerve fibers in the affected tissue, or the axonal growth or sprouting of nerve fibers in the affected tissue can be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, compared to before the administration. The number of nerve fibers in the affected tissue, the activity of peripheral nerve fibers in the affected tissue, or the axonal growth or sprouting of nerve fibers in the affected tissue can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%.

    [0458] The nerve fibers that are modulated can be part of the peripheral nervous system, e.g., a somatic nerve, an autonomic nerve, a sensory nerve, a cranial nerve, an optic nerve, an olfactory nerve, a sympathetic nerve, a parasympathetic nerve, a chemoreceptor, a photoreceptor, a mechanoreceptor, a thermoreceptor, a nociceptor, an efferent nerve fiber, or an afferent nerve fiber.

    [0459] Cancer Types

    [0460] In the methods described herein, the cancer or neoplasm may be any solid or liquid cancer and includes benign or malignant tumors, and hyperplasias, including gastrointestinal cancer (such as non-metastatic or metastatic colorectal cancer, pancreatic cancer, gastric cancer, esophageal cancer, hepatocellular cancer, cholangiocellular cancer, oral cancer, lip cancer); urogenital cancer (such as hormone sensitive or hormone refractory prostate cancer, renal cell cancer, bladder cancer, penile cancer); gynecological cancer (such as ovarian cancer, cervical cancer, endometrial cancer); lung cancer (such as small-cell lung cancer and non-small-cell lung cancer); head and neck cancer (e.g., head and neck squamous cell cancer); CNS cancer including malignant glioma, astrocytomas, retinoblastomas and brain metastases; malignant mesothelioma; non-metastatic or metastatic breast cancer (e.g., hormone refractory metastatic breast cancer); skin cancer (such as malignant melanoma, basal and squamous cell skin cancers, Merkel Cell Carcinoma, lymphoma of the skin, Kaposi Sarcoma); thyroid cancer; bone and soft tissue sarcoma; and hematologic neoplasias (such as multiple myeloma, acute myelogenous leukemia, chronic myelogenous leukemia, myelodysplastic syndrome, acute lymphoblastic leukemia, Hodgkin's lymphoma).

    [0461] Additional cancers that can be treated according to the methods described herein include breast cancer, lung cancer, stomach cancer, colon cancer, liver cancer, renal cancer, colorectal cancer, prostate cancer, pancreatic cancer, cervical cancer, anal cancer, vulvar cancer, penile cancer, vaginal cancer, testicular cancer, pelvic cancer, thyroid cancer, uterine cancer, rectal cancer, brain cancer, head and neck cancer, esophageal cancer, bronchus cancer, gallbladder cancer, ovarian cancer, bladder cancer, oral cancer, oropharyngeal cancer, larynx cancer, biliary tract cancer, skin cancer, a cancer of the central nervous system, a cancer of the respiratory system, and a cancer of the urinary system. Examples of breast cancers include, but are not limited to, triple-negative breast cancer, triple-positive breast cancer, HER2-negative breast cancer, HER2-positive breast cancer, estrogen receptor-positive breast cancer, estrogen receptor-negative breast cancer, progesterone receptor-positive breast cancer, progesterone receptor-negative breast cancer, ductal carcinoma in situ (DCIS), invasive ductal carcinoma, invasive lobular carcinoma, inflammatory breast cancer, Paget disease of the nipple, and phyllodes tumor.

    [0462] Other cancers that can be treated according to the methods described herein include leukemia (e.g., B-cell leukemia, T-cell leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphocytic (lymphoblastic) leukemia (ALL), chronic lymphocytic leukemia (CLL), and erythroleukemia), sarcoma (e.g., angiosarcoma, chondrosarcoma, Ewing's sarcoma, fibrosarcoma, gastrointestinal stromal tumor, leiomyosarcoma, liposarcoma, malignant peripheral nerve sheath tumor, malignant fibrous cytoma, osteosarcoma, pleomorphic sarcoma, rhabdomyosarcoma, synovial sarcoma, vascular sarcoma, Kaposi's sarcoma, dermatofibrosarcoma, epithelioid sarcoma, leyomyosarcoma, and neurofibrosarcoma), carcinoma (e.g., basal cell carcinoma, large cell carcinoma, small cell carcinoma, non-small cell lung carcinoma, renal carcinoma, hepatocarcinoma, gastric carcinoma, choriocarcinoma, adenocarcinoma, hepatocellular carcinoma, giant (or oat) cell carcinoma, squamous cell carcinoma, adenosquamous carcinoma, anaplastmic carcinoma, adrenocortical carcinoma, cholangiocarcinoma, Merkel cell carcinoma, DCIS, and invasive ductal carcinoma), blastoma (e.g., hepatoblastoma, medulloblastoma, nephroblastoma, neuroblastoma, pancreatoblastoma, pleuropulmonary blastoma, retinoblastoma, and glioblastoma multiforme), lymphoma (e.g., Hodgkin's lymphoma, non-Hodgkin's lymphoma, and Burkitt lymphoma), myeloma (e.g., multiple myeloma, plasmacytoma, localized myeloma, and extramedullary myeloma), melanoma (e.g., superficial spreading melanoma, nodular melanoma, lentigno maligna melanoma, acral lentiginous melanoma, and amelanotic melanoma), neuroma (e.g., ganglioneuroma, Pacinian neuroma, and acoustic neuroma), glioma (e.g., astrocytoma, oligoastrocytoma, ependymoma, brainstem glioma, optic nerve glioma, and oligoastrocytoma), pheochromocytoma, meningioma, malignant mesothelioma, and virally induced cancer.

    [0463] In some embodiments, the cancer is a paraneoplastic cancer (e.g., a cancer that causes a paraneoplastic syndrome). Paraneoplastic syndromes are rare disorders that are triggered by an altered immune system response to a neoplasm, and are mediated by humoral factors such as hormones, cytokines, or auto-antibodies produced by the tumor. Symptoms of paraneoplastic syndrome may be endocrine, neuromuscular, or musculoskeletal, cardiovascular, cutaneous, hematologic, gastrointestinal, renal, or neurological. Paraneoplastic syndromes commonly present with lung, breast, and ovarian cancer and cancer of the lymphatic system (e.g., lymphoma). Paraneoplastic neurological disorders are disorders that affect the central or peripheral nervous system, and can include symptoms such as ataxia (difficulty with walking and balance), dizziness, nystagmus (rapid uncontrolled eye movements), difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision problems, sleep disturbances, dementia, seizures, or sensory loss in the limbs. Breast, ovarian, and lung cancers are most commonly associated with paraneoplastic neurological disorders. Other common types of paraneoplastic syndromes include paraneoplastic cerebellar degeneration, paraneoplastic pemphigus, paraneoplastic autonomic neuropathy, paraneoplastic encephalomyelitis, and cancer-associated autoimmune retinopathy.

    [0464] Endocrine paraneoplastic syndromes include Cushing syndrome (caused by ectopic ACTH), which is most commonly caused by small cell lung cancer, pancreatic carcinoma, neural tumors, or thymoma; SIADH (caused by antidiuretic hormone), which is most commonly caused by small cell lung cancer and CNS malignancies; hypercalcemia (caused by PTHrp, TGFα, TNF, or IL-1), which is most commonly caused by lung cancer, breast carcinoma, renal and bladder carcinoma, multiple myeloma, adult T cell leukemia/lymphoma, ovarian carcinoma, and squamous cell carcinoma (e.g., lung, head, neck, or esophagus carcinoma); hyperglycemia (caused by insulin insulin-like substance, or “big” IGF-II), which is most commonly caused by fibrosarcoma, mesenchymal sarcomas, insulinoma, and hepatocellular carcinoma; carcinoid syndrome (caused by serotonin or bradykinin), which is most commonly caused by bronchial adenoma, pancreatic carcinoma, and gastric carcinoma; and hyperaldosteronism (caused by aldosterone), which is most commonly caused by adrenal adenoma/Conn's syndrome, non-Hodgkin's lymphoma, ovarian carcinoma, and pulmonary cancer.

    [0465] Neurological paraneoplastic syndromes include Lambert-Eaton myasthenic syndrome (LEMS), which is most commonly caused by small cell lung cancer; paraneoplastic cerebellar degeneration, which is most commonly caused by lung cancer, ovarian cancer, breast carcinoma, and Hodgkin's lymphoma; encephalomyelitis; limbic encephalitis, which is most commonly caused by small cell lung carcinoma; myasthenia gravis, which is most commonly caused by thymoma; brainstem encephalitis; opsoclonus myoclonus ataxia (caused by autoimmune reaction against Nova-1), which is most commonly caused by breast carcinoma, ovarian carcinoma, small cell lung carcinoma, and neuroblastoma; anti-NMDA receptor encephalitis (caused by autoimmune reaction against NMDAR subunits), which is most commonly caused by teratoma; and polymyositis, which is most commonly caused by lung cancer, bladder cancer, and non-Hodgkin's lymphoma. Mucotaneous paraneoplastic syndromes include acanthosis nigricans, which is most commonly caused by gastric carcinoma, lung carcinoma, and uterine carcinoma; dermatomyositis, which is most commonly caused by bronchogenic carcinoma, breast carcinoma, ovarian cancer, pancreatic cancer, stomach cancer, colorectal cancer, and Non-Hodgkin's lymphoma; Leser-Trelat sign; necrolytic migratory erythema, which is most commonly caused by glucoganoma; Sweet's syndrome; florid cutaneous papillomatosis; pyoderma gangrenosum; and acquired generalized hypertrichosis.

    [0466] Hematological syndromes include granulocytosis (caused by G-CSF); polycythemia (caused by erythropoietin), which is commonly caused by renal carcinoma, cerebellar hemangioma, and heptatocellular carcinoma; Trousseau sign (caused by mucins), which is commonly caused by pancreatic carcinoma and bronchogenic carcinoma; nonbacterial thrombotic endocarditis, which is caused by advanced cancers; and anemia, which is most commonly caused by thymic neoplasms. Other paraneoplastic syndromes include membranous glomerular nephritis; neoplastic fever; Staffer syndrome, which is caused by renal cell carcinoma; and tumor-induced osteomalacia (caused by FGF23), which is caused by hemangiopericytoma and phosphaturic mesenchymal tumor.

    [0467] In some embodiments, a subject is identified as having cancer after presenting with symptoms of a paraneoplastic syndrome. A common symptom of paraneoplastic syndrome is fever. Auto-antibodies directed against nervous system proteins are also frequently observed in patients with paraneoplastic syndromes, including anti-Hu, anti-Yo, anti-Ri, anti-amphiphysin, anti-CV2, anti-Ma2, anti-recoverin, anti-transducin, anti-carbonic anhydrase II, anti-arrestin, anti-GCAP1, anti-GCAP2, anti-HSP27, anti-Rab6A, and anti-PNR. Other symptoms that can be used to identify a patient with paraneoplastic cancer include ataxia, dizziness, nystagmus, difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision loss, sleep disturbances, dementia, seizures, dysgeusia, cachexia, anemia, itching, or sensory loss in the limbs. In some embodiments, a patient presents with symptoms of paraneoplastic syndrome and is then identified as having cancer based on imaging tests (e.g., CT, MRI, or PET scans).

    [0468] The cancer may be highly innervated, metastatic, non-metastatic cancer, or benign (e.g., a benign tumor). The cancer may be a primary tumor or a metastasized tumor.

    [0469] In some embodiments, the cancer is a GRK2-associated cancer (e.g., a cancer in which GRK2 is overexpressed).

    [0470] Subjects who can be treated with the methods disclosed herein include subjects who have had one or more tumors resected, received chemotherapy or other pharmacological treatment for the cancer, received radiation therapy, and/or received other therapy for the cancer. Subjects who have not previously been treated for cancer can also be treated with the methods disclosed herein.

    [0471] Combination Therapies

    [0472] A GRK2 inhibitor described herein can be administered in combination with a second therapeutic agent for treatment of cancer. In some embodiments, the second therapeutic agent is selected based on tumor type, tumor tissue of origin, tumor stage, or mutations in genes expressed by the tumor.

    [0473] Checkpoint Inhibitors

    [0474] One type of agent that can be administered in combination with a GRK2 inhibitor described herein is a checkpoint inhibitor. Checkpoint inhibitors can be broken down into at least 4 major categories: i) agents such as antibodies that block an inhibitory pathway directly on T cells or natural killer (NK) cells (e.g., PD-1 targeting antibodies such as nivolumab and pembrolizumab, antibodies targeting TIM-3, and antibodies targeting LAG-3, 2B4, CD160, A2aR, BTLA, CGEN-15049, or KIR), ii) agents such as antibodies that activate stimulatory pathways directly on T cells or NK cells (e.g., antibodies targeting OX40, GITR, or 4-1BB), iii) agents such as antibodies that block a suppressive pathway on immune cells or rely on antibody-dependent cellular cytotoxicity to deplete suppressive populations of immune cells (e.g., CTLA-4 targeting antibodies such as ipilimumab, antibodies targeting VISTA, and antibodies targeting PD-L2, Gr1, or Ly6G), and iv) agents such as antibodies that block a suppressive pathway directly on cancer cells or that rely on antibody-dependent cellular cytotoxicity to enhance cytotoxicity to cancer cells (e.g., rituximab, antibodies targeting PD-L1, and antibodies targeting B7-H3, B7-H4, Gal-9, or MUC1). Such agents described herein can be designed and produced, e.g., by conventional methods known in the art (e.g., Templeton, Gene and Cell Therapy, 2015; Green and Sambrook, Molecular Cloning, 2012).

    [0475] Chemotherapy

    [0476] A second type of therapeutic agent that can be administered in combination with a GRK2 inhibitor described herein is a chemotherapeutic agent (e.g., a cytotoxic agent or other chemical compound useful in the treatment of cancer). These include alkylating agents, antimetabolites, folic acid analogs, pyrimidine analogs, purine analogs and related inhibitors, vinca alkaloids, epipodopyyllotoxins, antibiotics, L-asparaginase, topoisomerase inhibitors, interferons, platinum coordination complexes, anthracenedione substituted urea, methyl hydrazine derivatives, adrenocortical suppressant, adrenocorticosteroides, progestins, estrogens, antiestrogen, androgens, antiandrogen, and gonadotropin-releasing hormone analog. Also included is 5-fluorouracil (5-FU), leucovorin (LV), irenotecan, oxaliplatin, capecitabine, paclitaxel and doxetaxel. Non-limiting examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammaII and calicheamicin omegaII; dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores), aclacinomysins, actinomycin, authramycin, azaserine, bleomycins, cactinomycin, carabicin, caminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalamycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; anti-metabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues such as denopterin, methotrexate, pteropterin, trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, testolactone; anti-adrenals such as aminoglutethimide, mitotane, trilostane; folic acid replenisher such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfomithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triaziquone; 2,2′,2″-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (“Ara-C”); cyclophosphamide; thiotepa; taxoids, e.g., paclitaxel; chloranbucil; gemcitabine; 6-thioguanine; mercaptopurine; methotrexate; platinum coordination complexes such as cisplatin, oxaliplatin and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; and pharmaceutically acceptable salts, acids or derivatives of any of the above. Two or more chemotherapeutic agents can be used in a cocktail to be administered in combination with the first therapeutic agent described herein. Suitable dosing regimens of combination chemotherapies are known in the art.

    [0477] Biologic Cancer Agents

    [0478] Another type of therapeutic agent that can be administered in combination with a GRK2 inhibitor described herein is a therapeutic agent that is a biologic such a cytokine (e.g., interferon or an interleukin (e.g., IL-2 or IL-12)) used in cancer treatment. In other embodiments the biologic is an anti-angiogenic agent, such as an anti-VEGF agent, e.g., bevacizumab. In some embodiments the biologic is an immunoglobulin-based biologic, e.g., a monoclonal antibody (e.g., a humanized antibody, a fully human antibody, an Fc fusion protein or a functional fragment thereof) that agonizes a target to stimulate an anti-cancer response, or antagonizes an antigen important for cancer. Such agents include Rituximab; Daclizumab; Basiliximab; Palivizumab; Infliximab; Trastuzumab; Gemtuzumab ozogamicin; Alemtuzumab; Ibritumomab tiuxetan; Adalimumab; Omalizumab; Tositumomab-I-131; Efalizumab; Cetuximab; Bevacizumab; Natalizumab; Tocilizumab; Panitumumab; Ranibizumab; Eculizumab; Certolizumab pegol; Golimumab; Canakinumab; Ustekinumab; Ofatumumab; Denosumab; Motavizumab; Raxibacumab; Belimumab; Ipilimumab; Brentuximab Vedotin; Pertuzumab; Ado-trastuzumab emtansine; and Obinutuzumab. Also included are antibody-drug conjugates. Examples of biologic cancer agents that can be used in combination with GRK2 inhibitors described herein are shown in Table 4 below.

    TABLE-US-00004 TABLE 4 APPROVED CANCER ANTIBODIES Antibody Company Antigen Indication ado-trastuzumab Genentech HER2 Metastatic breast cancer emtansine alemtuzumab Genzyme CD52 B-cell chronic lymphocytic leukemia atezolizumab Genentech PD-L1 Urothelial carcinoma Metastatic non-small cell lung cancer avelumab EMD Serono PD-L1 Metastatic Merkel cell carcinoma bevacizumab Genentech VEGF Metastatic colorectal cancer blinatumomab Amgen CD19 Precursor B-cell acute lymphoblastic leukemia brentuximab Seattle Genetics CD30 Hodgkin lymphoma vedotin Anaplastic large-cell lymphoma cetuximab ImClone Systems EGFR Metastatic colorectal carcinoma daratumumab Janssen Biotech CD38 Multiple myeloma dinutuximab United Therapeutics GD2 Pediatric high-risk neuroblastoma durvalumab AstraZeneca PD-L1 Urothelial carcinoma elotuzumab Bristol-Myers SLAMF7 Multiple myeloma Squibb ibritumomab Spectrum CD20 Relapsed or refractory low-grade, tiuxetan Pharmaceuticals follicular, or transformed B-cell non- Hodgkin's lymphoma ipilimumab Bristol-Myers CTLA-4 Metastatic melanoma Squibb necitumumab Eli Lilly EGFR Metastatic squamous non-small cell lung carcinoma nivolumab Bristol-Myers PD-1 Metastatic melanoma Squibb Metastatic squamous non-small cell lung carcinoma obinutuzumab Genentech CD20 Chronic lymphocytic leukemia ofatumumab Glaxo Grp CD20 Chronic lymphocytic leukemia olaratumab Eli Lilly PDGFRA Soft tissue sarcoma panitumumab Amgen EGFR Metastatic colorectal cancer pembrolizumab Merck PD-1 Metastatic melanoma pertuzumab Genentech HER2 Metastatic breast cancer ramucirumab Eli Lilly VEGFR2 Gastric cancer rituximab Genentech CD20 B-cell non-Hodgkin's lymphoma trastuzumab Genentech HER2 Metastatic breast cancer

    [0479] Cancer-Specific Agents

    [0480] In some embodiments, the therapeutic agents administered with the GRK2 inhibitors described herein are cancer-specific. Cancer-specific agents are agents that have been shown to be particularly effective against certain types of cancer. Cancer-specific agents that can be administered with the GRK2 inhibitors described herein are listed in Table 5 below.

    TABLE-US-00005 TABLE 5 CANCER-SPECIFIC AGENTS Cancer type Agents Pancreatic Chemotherapeutics (Paclitaxel Albumin-stabilized Nanoparticle Formulation, cancer Erlotinib Hydrochloride, Everolimus, Fluorouracil Injection, Gemcitabine Hydrochloride, Irinotecan Hydrochloride Liposome, Mitomycin C, Sunitinib Malate, FOLFIRINOX, GEMCITABINE-CISPLATIN, GEMCITABINE- OXALIPLATIN, OFF, Lanreotide Acetate, Abraxane, Gemcitabine, Irinotecan, 5-FU, Oxaliplatin) lutetium Lu 177-dotatate Melanoma Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), BRaf inhibitors (vemurafenib, debrafenib), MEK inhibitors, CDK4 inhibitors (ribociclib) Renal cell Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), mTOR inhibitors carcinoma (everolimus), bevacizumab Lung cancer Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), EGFR inhibitors (erlotinib, gefitinib, cetuximab) Esophageal cancer Chemotherapeutic agents (5FU, docetaxel), trastuzumab Ovarian cancer Chemotherapeutics (taxanes, cisplatin) Uterine cancer Chemotherapeutics (taxanes, cisplatin) Head and Neck Checkpoint inhibitors (pembro, ipi, nivolumab, durvalumab), EGFR inhibitors cancer (erlotinib, gefitinib, cetuximab) Mesothelioma Chemotherapeutics (pemetrexed, cisplatin)

    [0481] Non-Drug Therapies

    [0482] Another type of agent that can be administered in combination with a GRK2 inhibitor is a therapeutic agent that is a non-drug treatment. For example, the second therapeutic agent is radiation therapy, cryotherapy, hyperthermia and/or surgical excision of tumor tissue.

    [0483] CAR-T Therapy

    [0484] Another therapy that can be employed in combination with the methods and compositions described herein is chimeric antigen receptor (CAR)-T therapy, or therapy with lymphocytes, such as autologous or allogeneic T cells, that have been modified to express a CAR that recognizes specific cancer antigens. Commonly, CARs contain a single chain fragment variable (scFv) region of an antibody or a binding domain specific for a tumor associated antigen (TAA) coupled via hinge and transmembrane regions to cytoplasmic domains of T cell signaling molecules. The most common lymphocyte activation moieties include a T cell costimulatory domain (e.g., CD28 and/or CD137) in tandem with a T cell effector function triggering (e.g. CD3) moiety. CARs have the ability to redirect T cell reactivity and specificity toward a selected target in a non-MHC restricted manner, exploiting the antigen-binding properties of monoclonal antibodies. The non-MHC restricted antigen recognition gives CAR-T cells the ability to bypass a major mechanism of tumor escape.

    [0485] Oncolytic Viruses

    [0486] Another type of therapeutic agent that can be administered in combination with a GRK2 inhibitor described herein is an oncolytic virus. Oncolytic viruses are naturally occurring and genetically engineered viruses that can selectively infect, replicate in, and kill cancer cells without harming normal cells. These viruses may be considered a type of immunotherapy, a treatment that harnesses the immune system to fight cancer, as a growing body of research suggests that oncolytic viruses may work by triggering an immune response against cancer. In some embodiments, the oncolytic virus administered in combination with a GRK2 inhibitor described herein is tamilogene laherparepvec (T-VEC), maraba virus, PVS-RIPO, canerpaturev, enadenotucirev, pelareorep, pexastimogene devacirepvec (JX-594), or tasadenoturev.

    [0487] Neurotransmission Blockers

    [0488] In some embodiments, the GRK2 inhibitor is administered in combination with a neurotransmission blocker (e.g., an agent that decreases neurotransmission). A neurotransmission blocker can be used to reduce or inhibit neural activity in a cancer or tumor that is innervated by nerves or to decrease the number of nerves in the tumor. For example, in some embodiments, the neurotransmission blocker is an antagonist of a neurotransmitter receptor listed in Table 6. Exemplary antagonists are listed in Tables 8A-8K. Neurotransmission blockers also include agents that decrease neurotransmitter synthesis or release (e.g., agents that decrease the activity of a biosynthetic protein encoded by a gene in Table 6 via inhibition or downregulation, or agents that decrease the activity of a synaptic or vesicular protein via blocking, disrupting, downregulating, or antagonizing the protein), increase neurotransmitter reuptake or degradation (e.g., agents that agonize, open, or stabilize transporters that remove neurotransmitter from the synaptic cleft), decrease neurotransmitter receptor activity (e.g., agents that decrease the activity of a signaling protein encoded by a gene in Table 6 via blocking or antagonizing the protein, or agents that block, antagonize, or downregulate a neurotransmitter receptor listed in Table 6), decrease neurotransmitter receptor synthesis or membrane insertion, increase neurotransmitter degradation, regulate neurotransmitter receptor conformation (e.g., agents that bind to a receptor and keep it in a “closed” or “inactive” conformation), and disrupt the pre- or postsynaptic machinery (e.g., agents that block or disrupt a structural protein, or agents that block, disrupt, downregulate, or antagonize a synaptic or vesicular protein). In some embodiments, the neurotransmitter receptor is a channel (e.g., a ligand or voltage gated ion channel), the activity of which can be decreased by blockade, antagonism, or inverse agonism of the channel. Neurotransmission blockers further include agents that sequester, block, antagonize, or degrade a neurotransmitter listed in Tables 6 or 7. Neurotransmission blockers include antibodies that bind to or block the function of neurotransmitters, neurotransmitter receptor antagonists, and toxins that disrupt synaptic release. Neurotransmission modulators can decrease neurotransmission by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or more. Neurotransmission blockers can be administered in any of the modalities described herein (e.g., antibody, small molecule, nucleic acid, polypeptide, or viral vector).

    TABLE-US-00006 TABLE 6 NEUROTRANSMITTER GENES & PATHWAYS Accession Entrez Gene Pathway Type Number Gene ID ABAT Neurotransmitter Biosynthesis P80404 18 ACHE Neurotransmitter Biosynthesis P22303 43 ADORA2A Neurotransmitter Receptor P29274 135 ADORA2B Neurotransmitter Receptor P29275 136 Adra1a Adrenergic/ Receptor P35348 148 Neurotransmitter Adra1b Adrenergic/ Receptor P35368 147 Neurotransmitter Adra1d Adrenergic/ Receptor P25100 146 Neurotransmitter Adra2a Adrenergic/ Receptor P08913 150 Neurotransmitter Adra2b Adrenergic/ Receptor P18089 151 Neurotransmitter Adra2c Adrenergic/ Receptor P18825 152 Neurotransmitter Adrb1 Adrenergic/ Receptor P08588 153 Neurotransmitter Adrb2 Adrenergic/ Receptor P07550 154 Neurotransmitter Adrb3 Adrenergic/ Receptor P13945 155 Neurotransmitter Adrbk1 Adrenergic Kinase P25098 156 Adrbk2 Adrenergic Kinase P35626 157 BACE1 Neurotransmitter Biosynthesis P56817 23621 BCHE Neurotransmitter Biosynthesis P06276 590 BRS3 Neuromodulator Receptor P32247 P32247 C6orf89 Neuromodulator Receptor Q6UWU4 221477 CHAT Neurotransmitter Biosynthesis P28329 1103 CHRFAM7A Neurotransmitter Receptor Q494W8 89832 Chrm1 Cholinergic/ Receptor P11229 1128 Neurotransmitter Chrm2 Cholinergic/ Receptor P08172 1129 Neurotransmitter Chrm3 Cholinergic/ Receptor P20309 1131 Neurotransmitter Chrm4 Cholinergic/ Receptor P08173 1132 Neurotransmitter Chrm5 Cholinergic/ Receptor P08912 1133 Neurotransmitter Chrna1 Cholinergic/ Receptor P02708 1134 Neurotransmitter Chrna10 Cholinergic/ Receptor Q9GZZ6 57053 Neurotransmitter Chrna2 Cholinergic/ Receptor Q15822 1135 Neurotransmitter Chrna3 Cholinergic/ Receptor P32297 1136 Neurotransmitter Chrna4 Cholinergic/ Receptor P43681 1137 Neurotransmitter Chrna5 Cholinergic/ Receptor P30532 1138 Neurotransmitter Chrna6 Cholinergic/ Receptor Q15825 8973 Neurotransmitter Chrna7 Cholinergic/ Receptor P36544 1139 Neurotransmitter Chrna9 Cholinergic/ Receptor Q9UGM1 55584 Neurotransmitter Chrnb1 Cholinergic/ Receptor P11230 1140 Neurotransmitter Chrnb2 Cholinergic/ Receptor P17787 1141 Neurotransmitter Chrnb3 Cholinergic/ Receptor Q05901 1142 Neurotransmitter Chrnb4 Cholinergic/ Receptor P30926 1143 Neurotransmitter Chrnd Cholinergic/ Receptor Q07001 1144 Neurotransmitter Chrne Cholinergic/ Receptor Q04844 1145 Neurotransmitter Chrng Cholinergic/ Receptor P07510 1146 Neurotransmitter CNR1 Cannabinoid/ Receptor P21554 1268 Neurotransmitter CNR2 Cannabinoid/ Receptor P34972 1269 Neurotransmitter CNRIP1 Neurotransmitter Receptor Q96F85 25927 COMT Neurotransmitter Biosynthesis P21964 1312 CPA4 Neurotransmitter Biosynthesis Q9UI42 51200 CPE Neuropeptide/ Biosynthesis P16870 1363 Neurotransmitter CREM Neurotransmitter Signaling Q03060 1390 DAGLA Neurotransmitter Biosynthesis Q9Y4D2 747 (Cannabinoid) DAGLB Neurotransmitter Biosynthesis Q8NCG7 221955 (Cannabinoid) DBH Neurotransmitter Biosynthesis P09172 1621 DDC Neurotransmitter Biosynthesis P20711 1644 DGKI Neurotransmitter Biosynthesis O75912 9162 DOPO Dopaminergic Receptor P09172 1621 DPP4 Neurotransmitter Biosynthesis P27487 1803 Drd1 Dopaminergic/ Receptor P21728 1812 Neurotransmitter Drd2 Dopaminergic/ Receptor P14416 1813 Neurotransmitter Drd3 Dopaminergic/ Receptor P35462 1814 Neurotransmitter Drd4 Dopaminergic/ Receptor P21917 1815 Neurotransmitter Drd5 Dopaminergic/ Receptor P21918 1816 Neurotransmitter ECEL1 Neurotransmitter Biosynthesis O95672 9427 FAAH Neurotransmitter Biosynthesis O00519 2166 FNTA Neurotransmitter Signaling P49354 2339 GABARAP Neurotransmitter Receptor O95166 11337 GABARAPL1 Amine Receptor Q9H0R8 23710 Neuromodulator GABARAPL2 Amine Receptor P60520 11345 Neuromodulator GABBR1 Neurotransmitter Receptor Q9UBS5 2550 GABBR2 Amine Receptor O75899 9568 Neuromodulator GABRA1 Neurotransmitter Receptor P14867 2554 GABRA2 Neurotransmitter Receptor P47869 2555 GABRA3 Neurotransmitter Receptor P34903 2556 GABRA4 Neurotransmitter Receptor P48169 2557 GABRA5 Neurotransmitter Receptor P31644 2558 GABRA6 Neurotransmitter Receptor Q16445 2559 GABRB1 Neurotransmitter Receptor P18505 2560 GABRB2 Neurotransmitter Receptor P47870 2561 GABRB3 Neurotransmitter Receptor P28472 2562 GABRD Neurotransmitter Receptor O14764 2563 GABRE Neurotransmitter Receptor P78334 2564 GABRG1 Neurotransmitter Receptor Q8N1C3 2565 GABRG2 Neurotransmitter Receptor P18507 2566 GABRG3 Neurotransmitter Receptor Q99928 2567 GABRP Neurotransmitter Receptor O00591 2568 GABRQ Neurotransmitter Receptor Q9UN88 55879 GABRR1 Neurotransmitter Receptor P24046 2569 GABRR2 Neurotransmitter Receptor P28476 2570 GABRR3 Neurotransmitter Receptor A8MPY1 200959 GAD1 Neurotransmitter Biosynthesis Q99259 2571 GAD2 Neurotransmitter Biosynthesis Q05329 2572 GCHFR Neurotransmitter Biosynthesis P30047 2644 GLRA1 Neurotransmitter Receptor P23415 2741 GLRA2 Neurotransmitter Receptor P23416 2742 GLRA3 Neurotransmitter Receptor O75311 8001 GLRA4 Neurotransmitter Receptor Q5JXX5 441509 GLRB Neurotransmitter Receptor P48167 2743 GLS Neurotransmitter Biosynthesis O94925 2744 GLS2 Neurotransmitter Biosynthesis Q9UI32 27165 GluA1 (GluR1) Amine Receptor P42261 2890 Neuromodulator GluK1 (GluR5) Amine Receptor P39086 2897 Neuromodulator GLUL Neurotransmitter Biosynthesis P15104 2752 GluN1(NR1) Amine Receptor Q05586 2902 Neuromodulator GNMT Neurotransmitter Biosynthesis Q14749 27232 GPER1 Neurotransmitter Receptor Q99527 2852 GPR1 Neurotransmitter Receptor P46091 2825 GPR139 Neurotransmitter Receptor Q6DWJ6 124274 GPR143 Neurotransmitter Receptor P51810 4935 GPR149 Neurotransmitter Receptor Q86SP6 344758 GPR18 Neurotransmitter Receptor Q14330 2841 GPR21 Neurotransmitter Receptor Q99679 2844 GPR26 Neurotransmitter Receptor Q8NDV2 2849 GPR3 Neurotransmitter Receptor P46089 2827 GPR35 Neurotransmitter Receptor Q9HC97 2859 GPR52 Neurotransmitter Receptor Q9Y2T5 9293 GPR55 Neurotransmitter Receptor Q9Y2T6 9290 GPR78 Neurotransmitter Receptor Q96P69 27201 GPR83 Neurotransmitter Receptor Q9NYM4 10888 GPR84 Neurotransmitter Receptor Q9NQS5 53831 GPRASP1 Neurotransmitter Receptor Q5JY77 9737 GPR50 Amine Receptor Q13585 9248 Neuromodulator GRIA1 Neurotransmitter Receptor P42261 2890 GRIA2 Neurotransmitter Receptor P42262 2891 GRIA3 Neurotransmitter Receptor P42263 2892 GRIA4 Neurotransmitter Receptor P48058 2893 GRID1 Neurotransmitter Receptor Q9ULK0 2894 GRID2 Neurotransmitter Receptor O43424 2895 GRIK1 Neurotransmitter Receptor P39086 2897 GRIK2 Neurotransmitter Receptor Q13002 2898 GRIK3 Neurotransmitter Receptor Q13003 2899 GRIK4 Neurotransmitter Receptor Q16099 2900 GRIK5 Neurotransmitter Receptor Q16478 2901 GRIN1 Neurotransmitter Receptor Q05586 2902 GRIN2A Neurotransmitter Receptor Q12879 2903 GRIN2B Neurotransmitter Receptor Q13224 2904 GRIN2C Neurotransmitter Receptor Q14957 2905 GRIN2D Neurotransmitter Receptor O15399 2906 GRIN3A Neurotransmitter Receptor Q8TCU5 116443 GRIN3B Neurotransmitter Receptor O60391 116444 GRK2 Neurotransmitter Receptor P25098 156 GRK3 Neurotransmitter Receptor P35626 157 GRM1 Neurotransmitter Receptor Q13255 2911 GRM2 Neurotransmitter Receptor Q14416 2912 GRM3 Neurotransmitter Receptor Q14832 2913 GRM4 Neurotransmitter Receptor Q14833 2914 GRM5 Neurotransmitter Receptor P41594 2915 GRM6 Neurotransmitter Receptor O15303 2916 GRM7 Neurotransmitter Receptor Q14831 2917 GRM8 Neurotransmitter Receptor O00222 2918 HNMT Neurotransmitter Biosynthesis P50135 3176 HOMER1 Neurotransmitter Receptor Q86YM7 9456 HRH1 Neurotransmitter Receptor P35367 3269 HRH2 Neurotransmitter Receptor P25021 3274 HRH3 Neurotransmitter Receptor Q9Y5N1 11255 HRH4 Neurotransmitter Receptor Q9H3N8 59340 Htr1a Neurotransmitter Receptor P08908 3350 Htr1b Neurotransmitter Receptor P28222 3351 Htr1c Neurotransmitter Receptor P28335 Htr1d Neurotransmitter Receptor P28221 3352 Htr1e Neurotransmitter Receptor P28566 3354 Htr1f Neurotransmitter Receptor P30939 3355 Htr2a Neurotransmitter Receptor P28223 3356 Htr2b Neurotransmitter Receptor P41595 3357 Htr2c Neurotransmitter Receptor P28335 3358 Htr3a Neurotransmitter Receptor P46098 3359 Htr3b Neurotransmitter Receptor O95264 9177 Htr3c Neurotransmitter Receptor Q8WXA8 170572 Htr3d Neurotransmitter Receptor Q70Z44 200909 HTR3E Neurotransmitter Receptor A5X5Y0 285242 Htr4 Neurotransmitter Receptor Q13639 3360 Htr5a Neurotransmitter Receptor P47898 3361 Htr5b Neurotransmitter Receptor P35365 79247 HTR5BP Neurotransmitter Receptor 645694 Htr6 Neurotransmitter Receptor P50406 3362 Htr7 Neurotransmitter Receptor P32305 3363 ITPR1 Neurotransmitter Signaling Q14643 3708 ITPR2 Neurotransmitter Signaling Q14571 3709 ITPR3 Neurotransmitter Signaling Q14573 3710 LYNX1 Neurotransmitter Receptor Q9BZG9 66004 MAOA Neurotransmitter Biosynthesis P21397 4128 MAOB Neurotransmitter Biosynthesis P27338 4129 NAMPT Neurotransmitter Biosynthesis P43490 10135 NISCH Neurotransmitter Receptor Q9Y2I1 11188 NOS1 Neurotransmitter Biosynthesis P29475 4842 NPTN Neurotransmitter Receptor Q9Y639 27020 P2RX1 Neurotransmitter Receptor P51575 5023 P2RX2 Neurotransmitter Receptor Q9UBL9 22953 P2RX3 Neurotransmitter Receptor P56373 5024 P2RX4 Neurotransmitter Receptor Q99571 5025 P2RX5 Neurotransmitter Receptor Q93086 5026 P2RX6 Neurotransmitter Receptor O15547 9127 P2RX7 Neurotransmitter Receptor Q99572 5027 P2RY11 Neurotransmitter Receptor Q96G91 5032 PAH Neurotransmitter Biosynthesis P00439 5053 PC Neurotransmitter Biosynthesis P11498 5091 PDE1B Neurotransmitter Signaling Q01064 5153 PDE4A Neurotransmitter Signaling P27815 5141 PDE4D Neurotransmitter Signaling Q08499 5144 PHOX2A Neurotransmitter Biosynthesis O14813 401 PHOX2B Neurotransmitter Biosynthesis Q99453 8929 PIK3CA Neurotransmitter Signaling P42336 5290 PIK3CB Neurotransmitter Signaling P42338 5291 PIK3CG Neurotransmitter Signaling P48736 5294 PLCB1 Neurotransmitter Signaling Q9NQ66 23236 PLCB2 Neurotransmitter Signaling Q00722 5330 PLCB3 Neurotransmitter Signaling Q01970 5331 PLCB4 Neurotransmitter Signaling Q15147 5332 PLCD1 Neurotransmitter Signaling P51178 5333 PLCE1 Neurotransmitter Signaling Q9P212 51196 PLCG1 Neurotransmitter Signaling P19174 5335 PLCL1 Neurotransmitter Signaling Q15111 5334 PLCL2 Neurotransmitter Signaling Q9UPR0 23228 PPP1CB Neurotransmitter Signaling P62140 5500 PPP1CC Neurotransmitter Signaling P36873 5501 PRIMA1 Neurotransmitter Biosynthesis Q86XR5 145270 PRKACG Neurotransmitter Signaling P22612 5568 PRKAR2B Neurotransmitter Signaling P31323 5577 PRKCG Neurotransmitter Signaling P05129 5582 PRKX Neurotransmitter Signaling P51817 5613 RIC3 Neurotransmitter Receptor Q7Z5B4 79608 SHANK3 Neurotransmitter Signaling Q9BYB0 85358 SLC6A1 Amine Transferase P30531 6529 Neuromodulator SLC6A13 Amine Transferase Q9NSD5 6540 Neuromodulator Slc6a4 Serotonin Transporter P31645 6532 SNX13 Neurotransmitter Signaling Q9Y5W8 23161 TAAR1 Amine Receptor Q96RJ0 134864 Neuromodulator TAAR2 Amine Receptor Q9P1P5 9287 Neuromodulator TAAR5 Neurotransmitter Receptor O14804 9038 TH Neurotransmitter Biosynthesis P07101 7054 TPH1 Neurotransmitter Biosynthesis P17752 7166 TPH2 Neurotransmitter Biosynthesis Q8IWU9 121278 TRHDE Neurotransmitter Biosynthesis Q9UKU6 29953

    TABLE-US-00007 TABLE 7 NEUROTRANSMITTERS Ligand Pathway Type 2-Arachidonoylglycerol Endocannabinoid Ligand 2-Arachidonyl glyceryl ether Endocannabinoid Ligand 3-methoxytyramine Amines Ligand Acetylcholine Amino Acids Ligand Adenosine Purine Ligand Adenosine triphosphate Purine Ligand Agmatine Amino Acids Ligand Anandamide Endocannabinoid Ligand Aspartate Amino Acids Ligand Carbon monoxide Gas Ligand D-serine Amino Acids Ligand Dopamine Monoamines Ligand Dynorphin Opioids Ligand Endorphin Opioids Ligand Enkephalin Opioids Ligand Epinephrine Monoamines Ligand Gamma-aminobutyric acid Amino Acids Ligand Glutamate Amino Acids Ligand Glycine Amino Acids Ligand Histamine Monoamines Ligand N-Acetylaspartylglutamate Neuropeptides Ligand N-Arachidonoyl dopamine Endocannabinoid Ligand N-methylphenethylamine Amines Ligand N-methyltryptamine Amines Ligand Nitric oxide Gas Ligand Norepinephrine Monoamines Ligand Octopamine Amines Ligand Phenethylamine Amines Ligand Serotonin Monoamines Ligand Synephrine Amines Ligand Tryptamine Amines Ligand Tyramine Amines Ligand Virodhamine Endocannabinoid Ligand

    TABLE-US-00008 TABLE 8A AGONISTS AND ANTAGONIST AGENTS Gene Agonist Antagonist Adrb2 NCX 950 Alprenolol Accession Bitolterol Carvedilol Number: Isoetarine Desipramine P07550 Norepinephrine Nadolol Phenylpropanolamine Levobunolol Dipivefrin Metipranolol Epinephrine Bevantolol Orciprenaline Oxprenolol Dobutamine Nebivolol Ritodrine Asenapine Terbutaline Bupranolol Salmeterol Penbutolol Formoterol Celiprolol Salbutamol Pindolol Isoprenaline Acebutolol Arbutamine Bopindolol Arformoterol Fenoterol Pirbuterol Ephedra Procaterol Clenbuterol Bambuterol Indacaterol Droxidopa Olodaterol Vilanterol Pseudoephedrine Cabergoline Mirtazepine Adra1d Midodrine Dapiprazole Accession Norepinephrine Amitriptyline Number: Clonidine Alfuzosin P25100 Oxymetazoline Promazine Pergolide Prazosin Bromocriptine Imipramine Droxidopa Nortriptyline Xylometazoline Doxazosin Ergotamine Nicardipine Cirazoline Dronedarone Cabergoline Tamsulosin Methoxamine Propiomazine Epinephrine Phenoxybenzamine Carvedilol Doxepin Terazosin Quetiapine Methotrimeprazine Silodosin Adrb1 Isoetarine Esmolol Accession Norepinephrine Betaxolol Number: Phenylpropanolamine Metoprolol P08588 Epinephrine Atenolol Dobutamine Timolol Salbutamol Sotalol Isoprenaline Propranolol Arbutamine Labetalol Fenoterol Bisoprolol Pirbuterol Alprenolol Ephedra Amiodarone Clenbuterol Carvedilol Droxidopa Nadolol Pseudoephedrine Levobunolol Carteolol Metipranolol Cabergoline Bevantolol Mirtazapine Practolol Loxapine Oxprenolol Vortioxetine Celiprolol Desipramine Nebivolol Asenapine Bupranolol Penbutolol Pindolol Acebutolol Bopindolol Cartelol Adrb3 SR 58611 Bopindolol Accession Norepinephrine Propranolol Number: Epinephrine Bupranolol P13945 Isoprenaline Arbutamine Fenoterol Ephedra Clenbuterol Droxidopa Mirabegron Adrbk1 ATP Alprenolol Accession Carbachol Heparin Number: Dopamine P25098 Isoproterenol Morphine DAMGO histamine Acetylcholine Etorphine NMDA Dopamine Adrbk2 Isoproterenol Propranolol Accession DAMGO Number: ATP P26819 Chrm3 cgmp MT3 Accession ATP Hexocyclium Number: Cevimeline Himbacine P20309 arecoline Biperiden oxotremorine-M lithocholylcholine NNC 11-1314 AFDX384 xanomeline 4-DAMP oxotremorine hexahydrodifenidol pentylthio-TZTP VU0255035 arecaidine propargyl ester N-methyl scopolamine NNC 11-1607 Darifenacin furmethide Thiethylperazine NNC 11-1585 methoctramine Acetylcholine silahexocyclium methylfurmethide Strychnine Bethanechol MT7 Carbachol Heparin Succinylcholine Olanzapine ALKS 27 Pirenzepine itopride Clidinium methacholine Ipratropium Meperidine Propantheline Cinnarizine Dicyclomine Trimipramine Darifenacin Tiotropium Atropine Scopolamine Amitriptyline Doxepin Lidocaine Nortriptyline Tropicamide Metixene Homatropine Methylbromide Solifenacin Glycopyrrolate Propiomazine Diphemanil Methylsulfate Promethazine Diphenidol Pancuronium Ziprasidone Quetiapine Imipramine Clozapine Cyproheptadine Aripiprazole Nicardipine Amoxapine Loxapine Promazine Oxyphencyclimine Anisotropine Methylbromide Tridihexethyl Chlorpromazine Ketamine Cyclosporin A Paroxetine Benzquinamide Tolterodine Oxybutynin Alcuronium WIN 62,577 Tramadol Chlorprothixene Aclidinium Methotrimeprazine Umeclidinium Cryptenamine Mepenzolate Maprotiline Brompheniramine Isopropamide Trihexyphenidyl Ipratropium bromide Hyoscyamine Procyclidine Pipecuronium Fesoterodine Disopyramide Desipramine Mivacurium Chrna3 Nicotine A-867744 Accession Varenicline NS1738 Number: Acetylcholine Hexamethonium P32297 Ethanol Mecamylamine Cytisine Dextromethorphan Levamisole Pentolinium Galantamine Levomethadyl Acetate Bupropion Chrna6 Nicotine Hexamethonium Accession Cytisine Mecamylamine Number: Varenicline Q15825 Galantamine Chrna9 Nicotine Hexamethonium Accession Galantamine Mecamylamine Number: Ethanol Tetraethylammonium Q9UGM1 Muscarine ATG003 Strychnine Lobeline RPI-78M Chrnb1 Galantamine Accession Number: P11230 Chrnb4 Nicotine Atropine Accession Varenicline Oxybutynin Number: PNU-120596 Pentolinium P30926 Ethanol Dextromethorphan Galantamine Chrng Galantamine Accession Number: P07510 Adcyap1 Nicotine Atropine Accession CGMP PPADS Number: Apomorphine Onapristone P18509 Suramin Muscarine Nifedipine Haloperidol ATP Astressin Dihydrotestosterone Melatonin Maxadilan Scopolamine Dexamethasone Tetrodotoxin Acetylcholine Apamin Histamine Hexamethonium Carbachol Indomethacin NMDA Propranolol Dopamine Bumetanide Isoproterenol Progesterone Salbutamol Charybdotoxin Morphine Prazosin Clonidine Nimodipine 2,6-Diamino-Hexanoic Acid Amide CYSLTR1 Salbutamol Montelukast Accession Dexamethasone Zafirlukast Number: Arachidonic acid Cinalukast Q9Y271 Histamine Pranlukast Nedocromil Theophylline Indomethacin Zileuton Iralukast Pobilukast Sulukast Verlukast LTB4R LTB U75302 Accession ATP CP105696 Number: Dexamethasone CP-195543 Q15722 cholesterol Etalocib 20-hydroxy-LTB< SC-41930 12R-HETE LY255283 arachidonic acid Zafirlukast ONO-4057 RO5101576 BILL 260 PENK Dopamine Naltrexone Accession kainate Naloxone Number: NMDA Progesterone P01210 DAMGO Morphine Htr2c Apomorphine Melatonin Accession Bifeprunox SB 224289 Number: Tramadol LY334362 P28335 AL-37350A FR260010 5-MeO-DMT Sulpiride BW723C86 Thiethylperazine CGS-12066 cyamemazine DOI Mesulergine 5-CT SB 221284 YM348 Zotepine LSD Metergoline xanomeline methiothepin WAY-163909 Spiperone Dopamine SB 215505 LY344864 Tiospirone VER-3323 SB 228357 TFMPP Pizotifen 8-OH-DPAT SB 206553 MK-212 SB 204741 NMDA SDZ SER-082 org 12962 Ritanserin 5-MeOT SB 242084 RU 24969 S33084 Acetylcholine Roxindole QUINPIROLE RS-127445 quipazine Terguride tryptamine EGIS-7625 Ro 60-0175 SB 243213 Oxymetazoline RS-102221 Ergotamine Olanzapine Cabergoline Aripiprazole Lorcaserin Agomelatine Pergolide Ziprasidone Methylergonovine Quetiapine Renzapride Sarpogrelate Pramipexole Perphenazine GR-127935 Thioridazine BRL-15572 Sertindole ipsapirone Loxapine SB 216641 Methysergide SL65.0155 Risperidone S 16924 Asenapine Bromocriptine Mianserin Lisuride Clozapine Tegaserod Trifluoperazine Epicept NP-1 Trazodone dapoxetine Doxepin Dexfenfluramine Nortriptyline 3,4- Chlorprothixene Methylenedioxymethamphetamine Ropinirole Minaprine Maprotiline Propiomazine Desipramine Mirtazapine Amoxapine Yohimbine Cyproheptadine Imipramine Amitriptyline Promazine Chlorpromazine Ketamine Propranolol Fluoxetine Ketanserin Mesulergine AC-90179 Ergoloid mesylate 2 Methotrimeprazine Paliperidone Clomipramine Trimipramine Captodiame Nefazodone GABA Receptor Bamaluzole bicuculline Accession GABA Metrazol Numbers Gabamide Flumazenil (Q9UBS5, O95166, GABOB Thiothixine O75899, P28472, Gaboxadol Bupropion P18507, P47870, Ibotenic acid Caffeine P47869, O14764) Isoguvacine Isonipecotic acid Muscimol Phenibut Picamilon Progabide Quisqualamine SL 75102 Thiomuscimol Alcohols (e.g., ethanol, isopropanol) Avermectins (e.g., ivermectin) Barbiturates (e.g., phenobarbital) Benzodiazepines Bromides (e.g., potassium bromide Carbamates (e.g., meprobamate, carisoprodol) Chloralose Chlormezanone Clomethiazole Dihydroergolines (e.g., ergoloid (dihydroergotoxine)) Etazepine Etifoxine Imidazoles (e.g., etomidate) Kavalactones (found in kava) Loreclezole Neuroactive steroids (e.g., allopregnanolone, ganaxolone) Nonbenzodiazepines (e.g., zaleplon, zolpidem, zopiclone, eszopiclone) Petrichloral Phenols (e.g., propofol) Piperidinediones (e.g., glutethimide, methyprylon) Propanidid Pyrazolopyridines (e.g., etazolate) Quinazolinones (e.g., methaqualone) Skullcap constituents Stiripentol Sulfonylalkanes (e.g., sulfonmethane, tetronal, trional) Valerian constituents (e.g., valeric acid, valerenic acid) Volatiles/gases (e.g., chloral hydrate, chloroform, diethyl ether, sevoflurane) Glutamate 3,5-dihydroxyphenylglycine APICA Receptor eglumegad EGLU Accession Biphenylindanone A LY-341,495 Number: DCG-IV (P42261, P39086, L-AP4 P39086, Q13585, P42261, P42262, P42263, P48058, P39086, Q13002, Q13003, Q13003, Q16478, Q12879, Q14957, Q13224, Q14957, O15399, Q8TCU5, O60391) CNR1/CNR2 N-Arachidonoylethanolamine SR 141716A Accession 2-Arachidonoyl-glycerol LY-320135 Number: 2-Arachidonoyl-glycerylether AM251 (P21554, P34972) N-Arachidonoyl-dopamine AM281 O-Arachidonoyl-ethanolamine SR 144528 N-Arachidonoylethanolamine AM630 2-Arachidonoyl-glycerol 2-Arachidonoyl-glycerylether N-Arachidonoyl-dopamine O-Arachidonoyl-ethanolamine Δ-9-THC CP-55,940 R(+)-WIN 55,212-2 HU-210 Levonantradol Nabilone Methanandamide ACEA O-1812 Δ9-THC CP-55,940 R(+)-WIN 55,212-2 HU-210 Levonantradol Nabilone Methanandamide JWH-015 JWH-133

    TABLE-US-00009 TABLE 8B ADRENERGIC AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non-selective adrenaline (epinephrine), carvedilol, arotinolol, and labetalol noradrenaline (norepinephrine), isoprenaline (isoproterenol), dopamine, caffeine, nicotine, tyramine, methylphenidate, ephedrine and pseudophedrine. α1 selective (ADRA1A, phenylephrine, methoxamine, acepromazine, alfuzosin, doxazosin, ADRA1B, ADRA1D) midodrine, cirazoline, labetalol, phenoxybenzamine, xylometazoline, metaraminol KW3902, phentolamine, prazosin, chloroehtylclonidine, tamsulosin, terazosin, tolazoline, oxymetazoline trazodone, amitriptyline, silodosin, clomipramine, doxepin, trimipramine, typical and atypical antipsychotics, and antihistamines, such as hyroxyzine α2 selective (ADRA2A, α-methyl dopa, clonidine, phentolamine, phenoxybenzamine, ADRA2B, ADRA2C) brimonidine, agmatine, yohimbine, idazoxan, atipamezole, dexmedetomidine, mirtazapine, tolazoline, trazodone, medetomidine, romifidine and typical and atypical chloroethylclonidine, antipsychotics detomidine, lofexidine, xylazine, tizanidine, guanfacine, and amitraz β1 selective (ADRB1) Dobutamine metroprolol, atenolol, acebutolol, bisoprolol, betaxolol, levobetaxolol, esmolol, celiprolol, carteolol, landiolol, oxprenolol, propanolol, practolol, penbutolol, timolol, labetalol, nebivolol, levobunolol, nadolol, pindolol, sotalol, metipranolol, tertatolol, vortioxene β2 selective (ADRB2) salbutamol, albuterol, bitolterol butaxamine, acebutolol, timolol, mesylate, levabuterol, ritodrine, propanolol, levobunolol, carteolol, metaproterenol, terbutaline, labetalol, pindolol, oxprenolol, salmeterol, formoterol, and nadolol, metipranolol, penbutolol, pirbuterol tertatolol, sotalol β3 selective (ADRB3) L-796568, amibegron, solabegron, SR 59230A, arotinolol mirabegron

    TABLE-US-00010 TABLE 8C DOPAMINE AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non-selective pramipexole, ropinirole, rotigotine, haloperidol, paliperidone, clozapine, apomorphine, risperidone, olanzapine, quetiapine, propylnorapomorphine, ziprasidone, metoclopramide, bromocriptine, cabergoline, ciladopa, droperidol, domperidone, amoxapine, dihydrexidine, dinapsoline, clomipramine, trimipramine, choline, doxamthrine, epicriptine, lisuride, melatonin, acepromazine, pergolide, piribedil, quinagolide, amisulpride, asenapine, azaperone, roxindole, dopamine benperidol, bromopride, butaclamol, chlorpromazine, clebopride, chlorprothixene, clopenthixol, clocapramine, eticlopride, flupenthixol, fluphenazine, fluspirilene, hydroxyzine, itopride, iodobenzamide, levomepromazine, levosulpiride, loxapine, mesoridazine, metopimazine, mosapramine, nafadotride, nemonapride, penfluridol, perazine, perphenazine, pimozide, prochlorperazine, promazine, pipotiazine, raclopride, remoxipride, spiperone, spiroxatrine, stepholidine, sulpiride, sultopride, tetrahydropalmatine, thiethylperazine, thioridazine, thiothixene, tiapride, trifluoperazine, trifluperidol, triflupromazine, thioproperazine, taractan, zotepine, zuclopenthixol, ziprasidone, ANP-010, NGD-94-4 D1 (DRD1) Fenoldopam, A-86929, SCH-23,390, SKF-83,959, Ecopipam, dihydrexidine, dinapsoline, Clebopride, Flupenthixol, dinoxyline, doxanthrine, SKF-81297, Zuclopenthixol, Taractan, PSYRX- SKF-82958, SKF-38393, G-BR-APB, 101, LuAF-35700, GLC-756, dopexamine ADX10061, Zicronapine D2 (DRD2) Cabergoline, pergolide, quinelorane, Chloroethylnorapomorphine, sumanirole, talipexole, piribedil, desmethoxyfallypride, domperidone, quinpirole, quinelorane, dinoxyline, eticlopride, fallypride, hydroxyzine, dopexamine itopride, L-741,626, SV 293, yohimbine, raclopride, sulpiride, paliperidone, penfluridol, quetiapine, lurasidone, risperidone, olanzapine, blonanserin, perphenazine, metoclopramide, trifluoperazine, clebopride, levosulpiride, flupenthixol, haloperidol, thioridazine, alizapride, amisulpride, asenapine, bromopride, bromperidol, clozapine, fluphenazine, perphanazine, loxapine, nemonapride, pericyazine, pipamperone, prochlorperazine, thioproperazine, thiethylperazine, tiapride, ziprasidone, zuclopenthixol, taractan, fluanisone, melperone, molindone, remoxipride, sultopride, ALKS 3831, APD-403, ONC201, pridopidine, DSP-1200, NG-101, TAK-906, ADN-1184, ADN-2013, AG-0098, DDD-016, IRL-626, KP303, ONC-206, PF-4363467, PGW-5, CG- 209, ABT-925, AC90222, ACP-005, ADN-2157, CB030006, CLR-136, Egis-11150, Iloperidone, JNJ- 37822681, DLP-115, AZ-001, S- 33138, SLV-314, Y-931, YKP1358, YK-P1447, APD405, CP-903397, ocaperidone, zicronapine, TPN-902 D3 (DRD3) Piribedil, quinpirole, captodiame, Domperidone, FAUC 365, compound R, R-16, FAUC 54, FAUC nafadotride, raclopride, PNU-99,194, 73, PD-128,907, PF-219,061, PF- SB-277011-A, sulpiride, risperidone, 592,379, CJ-1037, FAUC 460, FAUC YQA14, U99194, SR 21502, 346, cariprazine levosulpiride, amisulpride, nemonapride, ziprasidone, taractan, sultopride, APD-403, F17464, ONC201, NG-101, TAK-906, ONC- 206, PF-4363467, ABT-127, ABT- 614, GSK-598809, GSK-618334, S-14297, S-33138, YKP1358, YK- P1447 D4 (DRD4) WAY-100635, A-412,997, ABT-724, A-381393, FAUC 213, L-745,870, L- ABT-670, FAUC 316, PD-168, 077, 570,667, ML-398, fananserin, CP-226,269 clozapine, PNB-05, SPI-376, SPI- 392, Lu-35-138, NGD-94-1 D5 (DRD5) Dihydrexidine, rotigotine, SKF- SCH 23390 83,959, fenoldopam, Partial aplindore, brexpiprazole, aripiprazole, CY-208,243, pardoprunox, phencyclidine, and salvinorin A

    TABLE-US-00011 TABLE 8D GABA AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist GABA.sub.A barbiturates (e.g., allobarbital, bicuculline, gabazine, hydrastine, amobarbital, aprobarbital, alphenal, pitrazepin, sinomenine, tutin, barbital, brallobarbital, phenobarbital, thiocolchicoside, metrazol, secobarbital, thiopental), bamaluzole, securinine, gabazine GABA, GABOB, gaboxadol, ibotenic acid, isoguvacine, isonipecotic acid, muscimol, phenibut, picamilon, progabide, quisqualamine, SL 75102, thiomuscimol, positive allosteric modulators (PAMs) (e.g., alcohols, such as ethanol and isopropanol; avermectins, such as ivermectin; benzodiazepines, such as diazepam, alprazolam, chlordiazepoxide, clonazepam, flunitrazepam, lorazepam, midazolam, oxazepam, prazepam, brotizolam, triazolam, estazolam, lormetazepam, nitrazepam, temazepam, flurazepam, clorazepate halazepam, prazepam, nimetazapem, adinazolam, and climazolam; bromides, such as potassium bromide; carbamates, such as meprobamate and carisoprodol; chloralose; chlormezanone; chlomethiazole; dihydroergolines, such as ergoloid; etazepine; etifoxine; imidazoles, such as etomidate; imidazopyridines, such as alpidem and necopdiem; kavalactones; loreclezole; neuroactive steroids, such as allogregnanolone, pregnanolone, dihydrodeoxycorticosterone, tetrahydrodeoxycortisosterone, androstenol, androsterone, etiocholanolone, 3α-androstanediol, 5α, 5β, or 3α-dihydroprogesterone, and ganaxolone; nonbenzodiazepines, such as zalepon, zolpidem, zopiclone, and eszopiclone; petrichloral; phenols, such as propofol; piperidinediones, such as glutethimide and methyprylon; propanidid; pyrazolopyridines, such as etazolate; pyrazolopyrimidines, such as divaplon and fasiplon; cyclopyrrolones, sush as pagoclone and suproclone; β-cabolines, such as abecarnil and geodecarnil; quinazolinones, such as methaqualone; Scutellaria constituents; stiripentol; sulfonylalkanes, such as sulfonomethane, teronal, and trional; Valerian constituents, such as valeric acid and valerenic acid; and gases, such as chloral hydrate, chloroform, homotaurine, diethyl ether, and sevoflurane. GABA.sub.B 1,4-butanediol, baclofen, GABA, CGP-35348, homotaurine, Gabamide, GABOB, gamma- phaclofen, saclofen, and butyrolactone, gamma- SCH-50911 hydroxybutyric acid, gamma- hyrdoxyvaleric acid, gamma- valerolactone, isovaline, lesogaberan, phenibut, picamilon, progabide, homotaurine, SL-75102, tolgabide GABA.sub.A-ρ CACA, CAMP, GABA, GABOB, N4- gabazine, gaboxadol, isonipecotic chloroacetylcytosine arabinoside, acid, SKF-97,541, and (1,2,5,6- picamilon, progabide, tolgabide, and Tetrahydropyridin-4- neuroactive steroids, such as yl)methylphosphinic acid allopregnanolone, THDOC, and alphaxolone

    TABLE-US-00012 TABLE 8E MUSCARINC AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Chrm1 AF102B, AF150(S), AF267B, atropine, dicycloverine, hyoscyamine, acetylcholine, carbachol, cevimeline, ipratropium, mamba toxin muscarinic muscarine, oxotremorine, toxin 7 (MT7), olanzapine, oxybutynin, pilocarpine, vedaclidine, 77-LH-28-1, pirenzepine, telenzepine, and CDD-0097, McN-A-343, L689,660, tolterodine and xanomeline Chrm2 acetylcholine, methacholine, iper-8- atropine, dicycloverine, naph, berbine, and (2S,2′R,3′S,5′R)- hyoscyamine, otenzepad, AQRA-741, 1-methyl-2-(2-methyl-1,3-oxathiolan- AFDX-384, thorazine, 5-yl)pyrrolidine 3-sulfoxide methyl diphenhydramine, dimenhydrinate, iodide ipratropium, oxybutynin, pirenzepine, methoctramine, tripitramine, gallamine, and tolterodine Chrm3 acetylcholine, bethanechol, atropine, dicycloverine, hyoscyamine, carbachol, L689, 660, oxotremorine, alcidium bromide, 4-DAMP, pilocarpine, aceclidine, arecoline, darifenacin, DAU-5884, HL-031,120, and cevimeline ipratropium, J-104,129, oxybutynin, tiotropium, zamifenacin, and tolterodine Chrm4 acetylcholine, carbachol, and AFDX-384, dicycloverine, himbacine, oxotremorine), and Chrm5 agonists mamba toxin 3, PD-102,807, PD- (e.g., acetylcholine, milameline, 0298029, and tropicamide sabcomeline Chrm5 acetylcholine, milameline, VU-0488130, xanomeline sabcomeline Non- scopolamine, hydroxyzine, selective doxylamine, dicyclomine, flavoxate, cyclopentolate, atropine methonitrate, trihexyphenidyl/benzhexol, solifenacin, benzatropine, mebeverine, and procyclidine

    TABLE-US-00013 TABLE 8F NICOTINIC AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Chrna choline, acetylcholine, carbachol, turbocurarine, bupropion, receptors methacholine, nicotine, varenicline mecamylamine, 18- tartrate, galantamine hydrobromide, methozycoronaridine, suxamethonium chloride hexamethonium, trimethaphan, (succinylcholine chloride), atraciurium, doxacurium, mivacurium, epibatidine, iobeline, pancuronium, vecuronium, decamethonium, isopronicline/TC- succinylcholine, dextromethorphan, 1734/AZD3480 (TC-1734), AZD1446 neramexane, dextrophan, and 3- (TC-6683), TC-5619, TC-5214, MEM methoxymorphinan 3454 (RG3487), ABT-894, ABT-560, EVP-6124, EVP-4473, PNU-282987, AR-R17779, SSR 189711, JN403, ABBF, PHA-543613, SEN12333, GTS-21/DMXB-A, AZD0328, A- 582941, ABT-418, 5-iodo-A-85380, SIB-1765F, ABT-089, and ABT-594

    TABLE-US-00014 TABLE 8G SEROTONIN AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist 5-HT.sub.1A azapirones, such as alnespirone, pindolol, tertatolol, alprenolol, AV- binosperone, buspirone, 965, BMY-7,378, cyanopindolol, enilospirone, etapirone, geprione, dotarizine, flopropione, GR-46,611, ipsaprione, revospirone, zalospirone, iodocyanopindolol, isamoltane, perospirone, tiosperone, lecozotan, mefway, methiothepin, umespirone, and tandospirone; 8- methysergide, MPPF, NAN-190, OH-DPAT, befiradol, F-15,599, oxprenolol, pindobind, propanolol, lesopitron, MKC-242, LY-283,284, risperidone, robalzotan, SB-649,915, osemozotan, repinotan, U-92,016-A, SDZ-216,525, spiperone, spiramide, RU-24969, 2C-B, 2C-E, 2C-T-2, spiroxatrine, UH-301, WAY-100,135, aripiprazole, asenapine, bacoside, WAY-100,635, and xylamidine befiradol, brexpiprazole, bufotenin, cannabidiol, and fibanserin 5-HT.sub.1B triptans, such as sumatriptan, methiothepin, yohimbine, rizatriptan, eletriptan, donitripatn, metergoline, aripiprazole, isamoltane, almotriptan, frovatriptan, avitriptan, AR-A000002, SB-216,641, SB- zolmitriptan, and naratriptan; 224,289, GR-127,935, SB-236,057 ergotamine, 5- carboxamidotryptamine, CGS- 12066A, CP-93,129, CP-94,253, CP- 122,288, CP-135,807, RU-24969, vortioxetine, ziprasidone, and asenapine 5-HT.sub.1D triptans, such as sumatriptan, ziprasidone, methiothepin, rizatriptan, and naratriptan; yohimbine, metergoline, ergotamine, ergotamine, 5-(nonyloxy)tryptaime, BRL-15572, vortioxetine, GR- 5-(t-butyl)-N-methyltryptamine, CP- 127,935, LY-310,762, LY-367,642, 286,601, PNU-109,291, PNU- LY-456,219, and LY-456,220 142,633, GR-46611, L-694,247, L- 772,405, CP-122,288, and CP- 135,807 5-HT.sub.1E BRL-54443, eletriptan 5-HT.sub.1F LY-334,370, 5-n-butyryloxy-DMT, BRL-54443, eletriptan, LY-344,864, naratriptan, and lasmiditan 5-HT.sub.2A 25I-NBOH, 25I-NBOMe, (R)-DOI, cyproheptadine, methysergide, TCB-2, mexamine, O-4310, PHA- quetiapine, nefazodone, olanzapine, 57378, OSU-6162, 25CN-NBOH, asenapine, pizotifen, LY-367,265, juncosamine, efavirenz, mefloquine, AMDA, hydroxyzine, 5-MeO-NBpBrT, lisuride, and 2C-B and niaprazine 5-HT.sub.2B fenfluramine, pergolide, cabergoline, agomelatine, aripiprazole, mefloquine, BW-723C86, Ro60- sarpogrelate, lisuride, tegaserod, 0175, VER-3323, 6-APB, metadoxine, RS-127,445, SDZ SER- guanfacine, norfenfluramine, 5-MeO- 082, EGIS-7625, PRX-08066, SB- DMT, DMT, mCPP, aminorex, 200,646, SB-204,741, SB-206,553, chlorphentermine, MEM, MDA, LSD, SB-215,505, SB-228,357, LY- psilocin, MDMA 266,097, and LY-272,015 5-HT.sub.2C lorcaserin, lisuride, A-372,159, AL- agomelatine, CPC, eltoprazine, 38022A, CP-809,101, fenfluramine, etoperidone, fluoxetine, FR-260,010, mesulergine, MK-212, LU AA24530, methysergide, naphthyllisopropylamine, nefazodone, norfluoxetine, O- norfenfluramine, ORG-12,962, ORG- desmethyltramadol, RS-102,221, SB- 37,684, oxaflozane, PNU-22395, 200,646, SB-221,284, SB-242,084, PNU-181731, lysergamides, SDZ SER-082, tramadol, and phenethylamines, piperazines, trazodone tryptamines, Ro60-0175, vabicaserin, WAY-629, WAY- 161,503, WAY-163,909, and YM-348 5-HT.sub.2A/2C ketanserin, risperidone, trazodone, mirtazapine, clozapine 5-HT.sub.3 2-methyl-5-HT, alpha- dolasetron, granisetron, ondansetron, methyltryptamine, bufotenin, palonosetron, tropisetron, alosetron, chlorophenylbiguanide, ethanol, cilanosetron, mirtazapine, AS-8112, ibogaine, phenylbiguanide, bantopride, metroclopramide, quipazine, RS-56812, SR-57227, renzapride, zacopride, mianserin, varenicline, and YM-31636 vortioxetine, clozapine, olanzapine, quetiapine, menthol, thujone, lamotigrine, and 3-tropanyl indole-3- carboxylate 5-HT.sub.4 cisapride, tegaserod, prucalopride, piboserod, GR-113,808, GR- BIMU-8, CJ-033,466, ML-10302, 125,487, RS-39604, SB-203,186, mosapride, renzapride, RS-67506, SB-204,070, and chamomile RS-67333, SL65.1055, zacopride, metoclopramide, and sulpride 5-HT.sub.5A valeronic acid ASP-5736, AS-2030680, AS- 2674723, latrepiridine, risperidone, and SB-699,551 5-HT.sub.6 EMDT, WAY-181,187, WAY- ALX-1161, AVN-211, BVT-5182, 208,466, N-(inden-5- BVT-74316, cerlapiridine, EGIS- yl)imidazothiazole-5-sulfonamide, E- 12233, idalopiridine, interpridine, 6837, E-6801, and EMD-386,088 latrepiridine, MS-245, PRX-07034, SB-258,585, SB-271,046, SB- 357,134, SB-339,885, Ro 04-6790, Ro-4368554, sertindole, olanzapine, asenapine, clozapine, rosa rugosa extract, and WAY-255315 5-HT.sub.7 AS-19, 5-CT, 5-MeOT, 8-OH-DAPT, amisulpride, amitriptyline, aripiprazole, E-55888, E-57431, LP- amoxapine, clomipramine, clozapine, 12, LP-44, MSD-5a, RA-7, and N,N- DR-4485, fluphenazine, fluperlapine, Dimethyltryptamine ICI 169,369, imipramine, ketanserine, JNJ-18038683, loxapine, lurasidone, LY-215,840, maprotiline, methysergide, mesulergine, mianserin, olanzepine, pimozide, ritanserin, SB-258,719, SB-258,741, SB-269,970, SB-656,104-A, SB- 691,673, sertindole, spiperone, tenilapine, TFMPP, vortioxetine, trifluoperazine, ziprasidone, and zotepine Non- chlorpromazine, cyproheptadine, selective pizotifen, oxetorone, spiperone, 5-HT ritanserin, parachlorophenylalanine, antagonists metergoline, propranolol, mianserin, carbinoxamine, methdilazine, promethazine, pizotifen, oxatomide, feverfew, fenclonin, and reserpine

    TABLE-US-00015 TABLE 8H GLUATAMATE RECEPTOR AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist lonotropic AMPA, glutamic AP5, AP7, CPPene, selfotel, (GRIA-14, acid, ibotenic HU-211, Huperzine A, gabapentin, GRIK1-5, acid, kainic acid, remacemide, amantadine, and GRIN1- NMDA, atomoxetine, AZD6765, agmatine, 3B) quisqualic acid chloroform, dextrallorphan, dextromethorphan, dextrorphan, diphenidine, dizocilpine (MK-801), ethanol, eticyclidine, gacyclidine, ibogaine, ifenprodil, ketamine, kynurenic acid, memantine, magnesium, methoxetamine, nitromemantine, nitrous oxide, PD- 137889, perampanel, phencyclidine, rolicyclidine, tenocyclidine, methoxydine, tiletamine, neramexane, eliprodil, etoxadrol, dexoxadrol, WMS-2539, NEFA, delucemine, 8A-PDHQ, aptiganel, rhynchophylline Metabotropic L-AP4, ACPD, AIDA, fenobam, MPEP, (GRM1-8) L-QA, CHPG, LY-367,385, EGLU, CPPG, LY-379,268, MAP4, MSOP, LY-341,495 LY-354,740, ACPT, VU 0155041 Glycine rapastinel, NRX-1074, 7- antagonists chlorokynurenic acid, 4- chlorokynurenine, 5,7- dichlorokynurenic acid, kynurenic acid, TK-40, 1- aminocyclopropanecarboxylic acid (ACPC), L-phenylalanine, and xenon

    TABLE-US-00016 TABLE 8I HISTAMINE AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Non- histamine dihydrochloride, HTMT selective dimaleate, 2-pyridylethlyamine dihydrochloride H.sub.1 acrivastine, azelastine, astemizole, bilastine, bromodiphenhydramine, brompheniramine, buclizine, carbinoxamine, cetirizine, cetirizine dihydrochloride, clemastine fumarate, clemizole hydrochloride, chlorodiphenhydramine, chlorphenamine, chlorpromazine, clemastine, cyclizine, cyproheptadine, dexbrompheniramine, dexchlorpheniramine, dimenhydrinate, dimethindene maleate, dimetindene, diphenhydramine, diphenhydramine hydrochloride, doxepin hydrochloride, doxylamine, ebastine, embramine, fexofenadine, fexofenadine hydrochloride, hydroxyzine, ketotifen fumarate, loratadine, meclizine, meclizine dihydrochloride, mepyramine maleate, mirtazapine, olopatadine, olopatadine hydrochloride, orphenadrine, phenindamine, pheniramine, phenyltoloxamine, promethazine, quetiapine, rupatadine, terfenadine, tripelennamine, zotepine, trans- triprolidine hydrochloride, and triprolidine H.sub.1 inverse cetirizine, levocetirizine, agonists desloratadine, and pyrilamine H.sub.2 betazole, impromidine, dimaprit aminopotentidine, cimetidine, dihydrochloride, and amthamine famotidine, ICI 162,846, lafutidine, dihyrdobromide nizatidine, ranitidine, ranitidine hyrdochloride, roxatidine, zolantadine dimaleate, and toitidine H.sub.3 imetit dihydropbromide, immepip clobenpropit, clobenpropit dihyrdrobromide, immethridine dihydrobromide, A 3314440 dihydrobromide, α-Methylhistamine dihyrdochloride, BF 2649 dihydrobromide, N-methylhistamine hydrochloride, carcinine dihydrochloride, proxyfan oxalate, ditrifluoroacetate, ABT-239, and betahistine ciprofaxin, conessine, GT 2016, A- 349,821, impentamine dihydrobromide, iodophenpropit dihydrobromide, JNJ 10181457 dihydrochloride, JNJ 5207852 dihydrochloride, ROS 234 dioxalate, SEN 12333, VUF 5681 dihydrobromide, and thioperamide H.sub.4 imetit dihydropbromide, immepip thioperamide, JNJ 7777120, A dihyrdrobromide, 4-methylhistamine 943931 dihydrochloride, A 987306, dihydrochloride, clobenpropit JNJ 10191584 maleate, and VUF- dihydrobromide, VUF 10460, and 6002 VUF 8430 dihydrobromide

    TABLE-US-00017 TABLE 8J CANNABINOID AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist Cannabinoid receptor Anandamide, N-Arachidonoyl (non-selective) dopamine, 2-Arachidonoylglycerol (2-AG), 2-Arachidonyl glyceryl ether, Δ-9-Tetrahydrocannabinol, EGCG, Yangonin, AM-1221, AM-1235, AM- 2232, UR-144, JWH-007, JWH-015, JWH-018, ACEA, ACPA, arvanil, CP 47497, DEA, leelamine, methanandamide, NADA, noladin ether, oleamide, CB 65, GP-1a, GP- 2a, GW 405833, HU 308, JWH-133, L-759,633, L-759,656, LEI 101, MDA 19, and SER 601 CB.sub.1 receptor ACEA, ACPA, RVD-Hpα, (R)-(+)- rimonabant, cannabidiol, Δ.sup.9- methanandamide tetrahydrocannabivarin (THCV), taranabant, otenabant, surinabant, rosonabant, SLV-319, AVE1625, V24343, AM 251, AM 281, AM 6545, hemopressin, LY 320135, MJ 15, CP 945598, NIDA 41020, PF 514273, SLV 319, SR 1141716A, and TC-C 14G CB.sub.2 receptor CB 65, GP 1a, GP 2a, GW 405833, cannabidiol, Δ.sup.9- HU 308, JWH 133, L-759,656, L- tetrahydrocannabivarin (THCV), AM 759,633, SER 601, LEI 101 630, COR 170, JTE 907, and SR 144528

    TABLE-US-00018 TABLE 8K PURINERGIC RECEPTOR AGONISTS AND ANTAGONISTS Receptor Agonist Antagonist ADORA1 (P1 Adenosine, N6- Caffeine, theophylline, 8- adenosine receptor) Cyclopentyladenosine, N6-3- Cyclopenty1-1,3-dimethylxanthine methoxyl-4-hydroxybenzyl adenine (CPX), 8-Cyclopenty1-1,3- riboside (B2), CCPA, tecadenoson, dipropylxanthine (DPCPX), 8- selodenoson, Certain Phenyl-1,3-dipropylxanthine, Benzodiazepines and Barbiturates, bamifylline, BG-9719, BG09928, FK- 2′-MeCCPA, GR 79236, and SDZ 453, FK838, rolofylline, N-0861, and WAG 994 PSB 36 ADORA2A (P1 Adenosine, N6-3-methoxyl-4- Caffeine, theophylline, istradefylline, adenosine receptor) hydroxybenzyl adenine riboside (B2), SCH-58261, SCH-442,416, ATL- YT-146, DPMA, UK-423,097, 444, MSX-3, preladenant, SCH- limonene, NECA, CV-3146, 412,348, VER-6623, VER-6947, binodenoson, ATL-146e, CGS- VER-7835, vipadenant, and ZM- 21680, and Regadenoson 241,385 ADORA2B (P1 Adenosine, 5′-N- Caffeine, theophylline, CVT-6883, adenosine receptor) ethylcarboxamidoadenosine, BAY ATL-801, compound 38, MRS-1706, 60-6583, LUF-5835, NECA, (S)- MRS-1754, OSIP-339,391, PSB- PHPNECA, and LUF-5845 603, PSB-0788, and PSB-1115 ADORA3 (P1 Adenosine, 2-(1-Hexynyl)-N- Caffeine, theophylline, MRS-1191, adenosine receptor) methyladenosine, CF-101 (IB- MRS-1220, MRS-1334, MRS-1523, MECA), CF-102, 2-C1-IB-MECA, MRS-3777, MRE3008F20, CP-532,903, inosine, LUF-6000, MRE3005F20, OT-7999, and MRS-3558 SSR161421, KF-26777, PSB-10, PSB-11, and VUF-5574 P2Y receptor ATP, ADP, UTP, UDP, UDP-glucose, clopidogrel, elinogrel, prasugrel, 2-methylthioladenosine 5′ ticlopidine, ticagrelor, AR-C diphosphate (2-MeSADP), 118925XX, AR-C 66096, AR-C lysophosphatidic acid, PSB 1114, 69931, AZD 1283, MRS 2179, MRS PSB 0474, NF 546, MRS 2365, MRS 2211, MRS 2279, MRS 2500, MRS 2690, MRS 2693, MRS 2768, MRS 2578, NF 157, NF 340, PPADS, 2905, MRS 2957, MRS 4062, and PPTN hydrochloride, PSD 0739, denufosol (P2Y.sub.2agonist) SAR 216471, and suramin P2X receptor ATP A 438079, A 740003, A 804598, A 839977, AZ 10606120, AZ 11645373, 5-BDBD, BX 430, Evans Blue, JNJ 47965567, KN-62, NF 023, NF 110, NF 157, NF 279, NF 449, PPADS, iso-PPADS, PPNDS, Ro 0437626, Ro 51, RO-3, TC-P 262, suramin, TNP-ATP, and P2X.sub.7 antagonists NF279, calmidazolium, and KN-62

    TABLE-US-00019 TABLE 9 NEUROTRANSMISSION MODULATORS Type Modulators Norepinephrine reuptake inhibitors amedalin, atomoxetine, CP-39,332, daledalin, (increase adrenergic neurotransmission) edivoxetine, esreboxetine, lortalamine, nisoxetine, reboxetine, talopram, talsupram, tandamine, viloxazine, bupropion, ciclazindol, manifaxine, maprotiline, radafaxine, tapentadol, teniloxazine, protriptyline, nortriptyline, and desipramine Norepineprhine-dopamine reuptake inhibitors amineptine, bupropion, desoxypipradrol, (increase adrenergic and dopamine dexmethylphenidate, difemetorex, diphenylprolinol, neurotransmission) ethylphenidate, fencamfamine, fencamine, lefetamine, methylenedioxypyrovalerone, methylphenidate, nomifensine, O-2172, oxolinic acid, pipradrol, prolintane, pyrovalerone, tametraline, and WY-46824 Serotonin-norepinephrine-dopamine reuptake mazindol, nefazodone, sibutramine, venlafaxine, inhibitors (SNDRIs) and serotonin-norepinephrine esketamine, duloxetine, ketamine, phencyclidine, reuptake inhibitors (SNRIs) tripelennamine, mepiprazole, amitifadine, AN788, (increase adrengergic, dopamine, and serotonin ansofaxine, centanafadine, atomoxetine, neurotransmission) desvenlafaxine, milnacipran, levomilnacipran, dasotraline, Lu AA34893, Lu AA37096, NS-2360, tedatioxetine, tesofensine, bicifadine, BMS- 866,949, brasofensine, diclofensine, DOV-216,303, EXP-561, liafensine, NS-2359, RG-7166, SEP- 227,162, SEP-228,425, SEP-228,432, naphyrone, 3,3-Diphenylcyclobutanamine, 3,4- Dichlorotametraline, D-161, desmethylsertraline, DMNPC, DOV-102,677, fezolamine, GSK1360707F, indatraline, JNJ-7925476, JZ-IV- 10, JZAD-IV-22, LR-5182, methylnaphthidate, MI-4, PRC200-SS, PRC050, PRC025, SKF-83,959, TP1, phenyltropanes (e.g., WF-23, dichloropane, and RTI-55), Ginkgo biloba extract, St John's Wort, hyperforin, adhyperforin, and uliginosin B Dopamine reuptake inhibitors Dopamine reuptake inhbiitors (e.g., altropane, (increase dopamine neurotransmission) amfonelic acid, amineptine, BTCP, 3C-PEP, DBL- 583, difluoropine, GBR-12783, GBR-12935, GBR- 13069, GBR-13098, GYKI-52895, lometopane, methylphenidate, ethylphenidate, modafinil, armodafinil, RTI-229, vanoxerine, adrafinil, benztropine, bupropion, fluorenol, medifoxamine, metaphit, rimcazole, venlafaxine, Chaenomeles speciosa, and oroxylin A), dopamine releasing agents (e.g., p-Tyramine), dextroamphetamine, lisdexamfetamine, dexmethylphenidate, and cathinone Dopamine prodrugs Levopoda, docarpamine (increase dopamine neurotransmission) GABA reuptake inhibitors CL-996, deramciclane, gabaculine, guvacine, (increase GABA neurotransmission) nipecotic acid, NNC-711, NNC 05-2090, SKF- 89976A, SNAP-5114, tiagabine, and hyperforin GABA analogs gabapentin, butyric acid, valproic acid, valpromide, (increase GABA neurotransmission) valnoctamide, 3-hydroxybutanal, GHB, sodium, oxybate, aceburic acid, GBL, GHBAL, GHV, GVL, GHC, GCL, HOCPCA, UMB68, pregabalin, tolibut, phaclofen, sacolfen, arecaidine, gaboxadol, isonipecotic acid, 3-Methyl-GABA, AABA, BABA, DAVA, GAVA, Glutamic acid, hopantenic acid, piracetam, and vigabatrin GABA prodrugs L-Glutamine, N-lsonicotinoyl-GABA, picamilon, (increase GABA neurotransmission) progabide, tolgabide Acetylcholinesterase inhibitors carbamates, physostigmine, neostigmine, (increase nicotinic and muscarinic pyridostigmine, ambenonium, demecarium, neurotransmission) rivastigmine, phenanthrene derivatives, galantamine, caffeine, rosmarinic acid, alpha- pinene, piperidines, donepezil, tacrine, edrophonium, Huperzine A, ladostigil, ungeremine, lactucopicrin, dyflos, echothiophate, parathion, and quasi-irreversible acetylcholinesterase inhibitors Serotonin reuptake inhibitors alaproclate, cericlamine, citalopram, dapoxetine, (increase serotonin neurotransmission) escitalopram, femoxetine, fluoxetine, fluvoxamine, ifoxetine, indalpine, omiloxetine, panuramine, paroxetine, pirandamine, RTI-353, sertraline, zimelidine, desmethylcitalopram, didesmethylcitalopram, seproxetine ((S)- norfluoxetine), desvenlafaxine, cianopramine, litoxetine, lubazodone, SB-649,915, trazodone, vilazodone, vortioxetine, dextromethorphan, dextropropoxyphene, dimenhydrinate, diphenhydramine, mepyramine (pyrilamine), mifepristone, delucemine, mesembrenone, mesembrine, roxindole, duloxetine, levomilnacipran, milnacipran, dapoxetine, sibutramine, chlorpheniramine, dextropmethorphan, and methadone Serotonin releasing agents chlorphentermine, cloforex, dexfenfluramine, (increase serotonin neurotransmission) etolorex, fenfluramine, flucetorex, indeloxazine, levofenfluramine, tramadol, carbamazepine, amiflamine (FLA-336), viqualine (PK-5078), 2- Methyl-3,4-methylenedioxyamphetamine (2-Methyl- MDA), 3-Methoxy-4-methylamphetamine (MMA), 3- Methyl-4,5-methylenedioxyamphetamine (5-Methyl- MDA), 3,4-Ethylenedioxy-N-methylamphetamine (EDMA), 4-Methoxyamphetamine (PMA), 4- Methoxy-N-ethylamphetamine (PMEA), 4-Methoxy- N-methylamphetamine (PMMA), 4- Methylthioamphetamine (4-MTA), 5-(2- Aminopropyl)-2,3-dihydrobenzofuran (5-APDB), 5- Indanyl-2-aminopropane (IAP), 5-Methoxy-6- methylaminoindane (MMAI), 5-Trifluoromethyl-2- aminoindane (TAI), 5,6-Methylenedioxy-2- aminoindane (MDAI), 5,6-Methylenedioxy-N- methyl-2-aminoindane (MDMAI), 6-Chloro-2- aminotetralin (6-CAT), 6-Tetralinyl-2-aminopropane (TAP), 6,7-Methylenedioxy-2-aminotetralin (MDAT), 6,7-Methylenedioxy-N-methyl-2-aminotetralin (MDMAT), N-Ethyl-5-trifluoromethyl-2-aminoindane (ETAI), N-Methyl-5-indanyl-2-aminopropane, aminorex, MDMA, MDEA, MDA, MBDB, and tryptamines, such as DMT, αMT, 5MeO-NMT, NMT, NETP, Dimethyl-Serotonin, 5MeO-NET, αET and αMT Excitatory amino acid reuptake inhibitors didydrokanic acid, WAY-213,613, L-trans-2,4-PDC, (increase Glutamate receptor neurotransmission) amphetamine, and L-Theanine Glycine reuptake inhibitors bitopertin, Org 24598, Org 25935, ALX-5407, (increase Glutamate receptor neurotransmission) sacrosine, Org 25543, and N-arachidonylglycerine Histidine decarboxylase inhibitors Tritoqualine, catechin (decrease histamine neurotransmission) Endocannabinoid enhancers AM404, fatty acid amide hydrolase inhibitors (e.g., (increase cannabinoid neurotransmission) AM374, ARN2508, BIA 10-2472, BMS-469908, CAY-10402, JNJ-245, JNJ-1661010, JNJ- 28833155, JNJ-40413269, JNJ-42119779, JNJ- 42165279, MK-3168, MK-4409, MM-433593, OL- 92, OL-135, PF-622, PF-750, PF-3845, PF- 04457845, PF-04862853, RN-450, SA-47, SA-73, SSR-411298, ST-4068, TK-25, URB524, URB597, URB694, URB937, VER-156084, and V-158866 Monoacylglycerol lipase inhibitors N-arachidonoyl maleimide, JZL184 (increase cannabinoid neurotransmission) Endocannabinoid transporter inhibitors SB-FI-26 (increase cannabinoid neurotransmission) Endocannabinoid reuptake inhibitors AM404, AM1172, LY-2183240, O-2093, OMDM-2, (increase cannabinoid neurotransmission) UCM-707, VDM-11, guineensine, ETI-T-24_B_I, WOBE437, and RX-055 Adenosine uptake inhibitors cilostazol, dilazep, and dipyramidole (increase purinergic neurotransmission) Nucleoside transporter inhibitors 8MDP, Decynium 22, 5-iodotubercidin, NBMPR, (increase purinergic neurotransmission) and TC-T 6000

    [0489] In some embodiments, the neurotransmission blocker is a neurotoxin listed in Table 10, or a functional fragment or variant thereof. Neurotoxins include, without limitation, convulsants, nerve agents, parasympathomimetics, and uranyl compounds. Neurotoxins may be bacterial in origin, or fungal in origin, or plant in origin, or derived from a venom or other natural product. Neurotoxins may be synthetic or engineered molecules, derived de novo or from a natural product. Suitable neurotoxins include but are not limited to botulinum toxin and conotoxin. Exemplary neurotoxins are listed in Table 10.

    TABLE-US-00020 TABLE 10 NEUROTOXINS NEUROTOXINS 2,4,5-Trihydroxyamphetamine 2,4,5-Trihydroxymethamphetamine 3,4-Dichloroamphetamine 5,7-Dihydroxytryptamine 5-Iodowillardiine Ablomin Aconitine Aconitum Aconitum anthora AETX Agelenin Agitoxin Aldrin Alpha-Methyldopamine Alpha-neurotoxin Altitoxin Anatoxin-a Androctonus australis hector insect toxin Anisatin Anthopleurin Antillatoxin Anuroctoxin Apamin Arum italicum Arum maculatum Babycurus toxin 1 Batrachotoxin BDS-1 Bestoxin Beta-Methylamino-L-alanine BgK Birtoxin BmKAEP BmTx3 BotlT2 BotlT6 Botulinum toxin Brevetoxin Bukatoxin Butantoxin Calcicludine Calciseptine Calitoxin Caramboxin Carbon disulfide CgNa toxin Charybdotoxin Cicutoxin Ciguatoxin Cll1 Clostridium botulinum Conantokins Conhydrine Coniine Conotoxin Contryphan CssII CSTX Curare Cyanide poisoning Cylindrospermopsin Cypermethrin Delta atracotoxin Dendrotoxin Dieldrin Diisopropyl fluorophosphates Dimethylmercury Discrepin Domoic acid Dortoxin DSP-4 Ergtoxin Falcarinol Fenpropathrin Gabaculine Ginkgotoxin Grammotoxin Grayanotoxin Hainantoxin Halcurin Hefutoxin Helothermine Heteroscodratoxin-1 Histrionicotoxin Homoquinolinic acid Hongotoxin Huwentoxin Ibotenic acid Ikitoxin inhibitor cystine knot Jingzhaotoxin Kainic acid Kaliseptine Kappa-bungarotoxin Kodaikanal mercury poisoning Kurtoxin Latrotoxin Lq2 Maitotoxin Margatoxin Maurotoxin Mercury (element) Methanol Methiocarb MPP+ MPTP Nemertelline Neosaxitoxin Nicotine N-Methylconiine Oenanthotoxin Oxalyldiaminopropionic acid Oxidopamine Oxotoxin Pahutoxin Palytoxin Pandinotoxin Para-Bromoamphetamine Para-Chloroamphetamine Para-Chloromethamphetamine Para-Iodoamphetamine Penitrem A Phaiodotoxin Phenol Phoneutria nigriventer toxin-3 Phrixotoxin Polyacrylamide Poneratoxin Psalmotoxin Pumiliotoxin Quinolinic acid Raventoxin Resiniferatoxin Samandarin Saxitoxin Scyllatoxin Sea anemone neurotoxin Slotoxin SNX-482 Stichodactyla toxin Taicatoxin Taipoxin Tamapin Tertiapin Tetanospasmin Tetraethylammonium Tetramethylenedisulfotetramine Tetrodotoxin Tityustoxin Tricresyl phosphate TsIV Vanillotoxin Veratridine

    [0490] Antibodies

    [0491] Neurotransmission modulators also include antibodies that bind to neurotransmitters or neurotransmitter receptors listed in Tables 6 and 7 and decrease neurotransmission. These antibodies include blocking and neutralizing antibodies. Antibodies to neurotransmitters or neurotransmitter receptors listed in Tables 6 and 7 can be generated by those of skill in the art using well established and routine methods.

    [0492] Neuronal Growth Factor Blockers

    [0493] In some embodiments, the GRK2 inhibitor is administered with a neuronal growth factor blocker (e.g., an agent that decreases neurogenic/axonogenic signals, e.g., an antagonist of a neurotrophic factor, neuronal growth factor, or neuronal growth factor receptor). For example, the neuronal growth factor blocker is an antagonist of a neuronal growth factor or neuronal growth factor receptor listed in Table 11. A neuronal growth factor blocker may decrease neurogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, or synaptic stabilization. Neuronal growth factor blockers decrease tissue innervation (e.g., innervation of a tumor) and the formation of synaptic connections between two or more neurons and between neurons and non-neural cells. A neuronal growth factor blocker may block one or more of these processes (e.g., through the use of antibodies that block neuronal growth factors or their receptors or inhibitory RNAs directed to neuronal growth factors or their receptors). Neuronal growth factor blockers can decrease one of the above-mentioned processes by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 200%, 500% or more.

    [0494] In some embodiments, the neuronal growth factor blocker decreases neurogenic/axonogenic signals, e.g., the method includes administering to the subject or contacting a cell with a neuronal growth factor blocker in an amount and for a time sufficient to decrease neurogenesis, axonogenesis, or innervation. For example, the neuronal growth factor blocker that leads to a decrease in neurogenesis or axonogenesis is a blocking or neutralizing antibody against a neurotrophic factor. Relevant neurotrophic factors include NGF, BDNF, ProNGF, Sortilin, TGFβ and TGFβ family ligands and receptors (e.g., TGFβR.sub.1, TGFβR.sub.2, TGFβ1, TGFβ2 TGFβ4), GFRα family ligands and receptors (e.g., GFRα1, GFRα2, GFRα3, GFRα4, GDNF), CNTF, LIF, neurturin, artemin, persephin, neurotrophin, chemokines, cytokines, and others listed in Table 11. Receptors for these factors can also be targeted, as well as downstream signaling pathways including Jak-Stat inducers, and cell cycle and MAPK signaling pathways. In some embodiments, the neuronal growth factor blocker decreases neurogenesis, axonogenesis or any of the processes mentioned above by sequestering, blocking, antagonizing, degrading, or downregulating a neuronal growth factor or a neuronal growth factor receptor listed in Table 11. In some embodiments, the neuronal growth factor blocker decreases neurogenesis, axonogenesis or any of the processes mentioned above by blocking or antagonizing a signaling protein that is downstream of a neuronal growth factor. In some embodiments, the neuronal growth factor blocker decreases neurogenesis, axonogenesis or any of the processes mentioned above by blocking, disrupting, or antagonizing a synaptic or structural protein. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, synaptic stabilization, or tissue innervation can be decreased in the subject at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80% or more, compared to before the administration. Neurogenesis, axonogenesis, neuronal growth, neuronal differentiation, neurite outgrowth, synapse formation, synaptic maturation, synaptic refinement, synaptic stabilization, or tissue innervation can be decreased in the subject between 5-20%, between 5-50%, between 10-50%, between 20-80%, between 20-70%. Neuronal growth factor blockers can be administered in any of the modalities described herein (e.g., antibody, small molecule, nucleic acid, polypeptide, or viral vector).

    [0495] In some embodiments, the neuronal growth factor blocker decreases the number of nerves in an affected tissue. For example, the subject has cancer (e.g., the subject has a highly innervated tumor). For example, the neuronal growth factor blocker is administered in an amount and for a time sufficient to decrease neurogenesis/axonogenesis.

    [0496] Neuronal growth factor blockers include antibodies that bind to neuronal growth factors or neuronal growth factor receptors and decrease their signaling (e.g., blocking antibodies). Exemplary neuronal growth factor blocking antibodies are listed below in Table 12. Antibodies to neuronal growth factors listed in Table 11 can also be generated by those of skill in the art using well established and routine methods.

    TABLE-US-00021 TABLE 11 NEURONAL GROWTH FACTORS Gene Type Accession Number Entrez Gene ID ARTN Ligand Q5T4W7 9048 BDNF Ligand P23560 627 BDNF-AS Ligand 497258 BEX1 Signaling Q9HBH7 55859 BEX3 Signaling Q00994 27018 CD34 Receptor P28906 947 CDNF Ligand Q49AH0 441549 CNTF Ligand P26441 1270 CNTFR Receptor P26992 1271 CRLF1 Receptor O75462 9244 CSPG5 Ligand O95196 10675 DCLK1 Signaling O15075 9201 DISC1 Signaling Q9NRI5 27185 DNAJC5 Signaling Q9H3Z4 80331 DPYSL2 Signaling Q16555 1808 DVL1 Signaling O14640 1855 EFNA5 Ligand P52803 1946 EGR3 Signaling Q06889 1960 ENO2 Signaling P09104 2026 EphA1 Receptor P21709 2041 EphA10 Receptor Q5JZY3 284656 EphA2 Receptor P29317 1969 EphA3 Receptor P29320 2042 EphA4 Receptor P29317 2043 EphA5 Receptor P54756 2044 EphA6 Receptor Q9UF33 285220 EphA7 Receptor Q15375 2045 EphA8 Receptor P29322 2046 EphB1 Receptor P54762 2047 EphB2 Receptor P29323 2048 EphB3 Receptor P54753 2049 EphB4 Receptor P54760 2050 EphB6 Receptor O15197 2051 ETBR2 Receptor O60883 9283 FSTL4 Receptor Q6MZW2 23105 GDNF Ligand P39905 2668 GFRA1 Receptor P56159 2674 GFRA2 Receptor O00451 2675 GFRA3 Receptor O60609 2676 GFRA4 Receptor Q9GZZ7 64096 GPR37 Receptor O15354 2861 GPRIN1 Signaling Q7Z2K8 114787 GPRIN2 Signaling O60269 9721 GPRIN3 Signaling Q6ZVF9 285513 GRB2 Signaling P62993 2885 GZF1 Signaling Q9H116 64412 IFNA1 Ligand P01562 3439 IGF1 Ligand P05019 3479 IGF2 Ligand P01344 3481 IL11RA Receptor Q14626 3590 IL1B Ligand P01584 3553 IL3 Ligand P08700 3562 IL4 Ligand P05112 3565 IL6 Ligand P05231 3569 IL6R Receptor P08887 3570 IL6ST Signaling P40189 3572 INS Ligand P01308 3630 L1CAM Signaling P32004 3897 LIF Ligand P15018 3976 LIFR Receptor P42702 3977 MAGED1 Signaling Q9Y5V3 9500 MANF Ligand P55145 7873 NDNF Ligand Q8TB73 79625 NENF Ligand Q9UMX5 29937 NENFP1 Ligand 106480294 NENFP2 Ligand 100129880 NENFP3 Ligand 106481703 NGF Ligand P01138 4803 NGFR Receptor P08138 4804 NRG1 Ligand Q02297 3084 NRP1 Receptor O14786 8829 NRTN Ligand Q99748 902 NTF3 Ligand P20783 4908 NTF4 Ligand P34130 4909 NTRK1 Receptor P04629 4914 NTRK2 Receptor Q16620 4915 NTRK3 Receptor Q16288 4916 PDPK1 Signaling O15530 5170 PEDF Ligand P36955 5176 PLEKHH3 Signaling Q7Z736 79990 PSAP Ligand P07602 5660 PSEN1 Signaling P49768 5663 PSPN Ligand O70300 5623 PTN Ligand P21246 5764 RELN Ligand P78509 5649 RET Signaling P07949 5979 ROR1 Receptor Q01973 4919 ROR2 Receptor Q01974 4920 RPS6KA3 Signaling P51812 6197 SDC3 Receptor O75056 9672 SEMA3E Ligand O15041 9723 SERPINE2 Ligand P07093 5270 SERPINF1 Ligand P36955 5176 SHC1 Signaling P51812 6464 SNTG1 Biosynthesis P07602 54212 SORCS1 Receptor O75056 114815 SORCS2 Receptor O15041 57537 SORCS3 Receptor P07093 22986 SORT1 Receptor Q99523 6272 SULF1 Signaling Q8IWU6 23213 SULF2 Signaling Q8IWU5 55959 TGFB1 Ligand P01137 7040 TGFB2 Ligand P61812 7042 TGFB3 Ligand P10600 7043 TMEM158 Receptor Q8WZ71 25907 TNF Ligand P01375 7124 TPM3 Receptor P06753 7170 VEGFA Ligand P15692 7422 VEGFB Ligand P49765 7423 VGF Ligand O15240 7425 XCR1 Receptor P46094 2829 ZN274 Signaling Q96GC6 10782

    TABLE-US-00022 TABLE 12 NEURONAL GROWTH FACTOR ANTIBODIES Neuronal Growth Factor Antibody Company BDNF 38B8 (agonist antibody) Pfizer BDNF 29D7 (agonist antibody) Pfizer EphA3 KB004 KaloBios Pharmaceuticals, Inc. IFNA1 Faralimomab Creative Biolabs IFNA1 Sifalimumab (MEDI-545) MedImmune IFNA1 Rontalizumab Genentech IGF Figitumumab (CP-751,871) - an Pfizer IGR-1R MAb IGF SCH717454 (Robatumamab, Merck inhibits IGF initiated phosphorylation) IGF Cixutumumab (IGF-1R antibody) Eli Lilly IGF Teprotumumab (IGF-1R Genmab/Roche blocking antibody) IGF-2 Dusigitumab MedImmune/AstraZeneca IGF-2 DX-2647 Dyax/Shire IGF Xentuzumab Boehringer Ingelheim/Eli Lilly IGF Dalotuzumab (IGFR1 blocking Merck & Co. antibody) IGF Figitumumab (IGFR1 blocking Pfizer antibody) IGF Ganitumab (IGFR1 blocking Amgen antibody) IGF Robatumumab (IGFR1 blocking Roche/Schering-Plough antibody) IL1B Canakinumab Novartis IL1B APX002 Apexigen IL1B Gevokizumab XOMA IL4 Pascolizumab GlaxoSmithKline IL4 Dupilumab Regeneraon/Sanofi IL6 Siltuximab Janssen Biotech, Inc. IL6 Olokizumab UCB/R-Pharm IL6 Elsilimomab Orphan Pharma International IL6 Sirukumab Centocor IL6 Clazakizumab Bristol Myers Squib/Alder Biopharmaceuticals IL6 Gerilimzumab (ARGX-109) arGEN-X/RuiYi IL6 FE301 Ferring Pharmaceuticals IL6 FM101 Femta Pharmaceuticals IL-6R Sarilumab (directed against Regeneron/Sanofi IL6R) IL-6R Tocilizumab Hoffmann-La Roche/Chugai IL-6R Sapelizumab Chugai IL-6R Vobarilizumab Ablynx L1CAM AB417 Creative biolabs L1CAM L1-9.3 Creative biolabs L1CAM L1-14.10 Biolegend NGF Tanezumab Pfizer NGF Fulranumab (JNJ-42160443), Amgen NGF MNAC13 (anti-TrkA, the NGF Creative Biolabs receptor) NGF mAb 911 Rinat/Pfizer NGF Fasinumab Regeneron/Teva NRG1 538.24 Hoffman-La Roche NRP1 Vesencumab Genentech/Roche ROR1 Cirmtuzumab Oncternal Therapeutics SAP GSK2398852 GlaxoSmithKline TGFβ Fresolimumab (pan-TGFβ Genzyme/Aventis antibody) TGFβ IMC-TR1 (LY3022859) (MAb Eli Lilly against TGFβRII) TGFβ TβM1 (anti-TGFβ1 MAb) Eli Lilly TGFβ2 Lerdelimumab (CAT-152) Genzyme TGFβ1 Metelimumab Genzyme TGFβ1 LY2382770 Eli Lilly TGFβ PF-03446962 (MAb against Pfizer TGFβRI) TNF Infliximab Janssen Biotech, Inc. TNF Adalimumab AbbVie Inc. TNF Certolizumab pegol UCB TNF Golimumab Janssen Biotech, Inc. TNF Afelimomab TNF Placulumab Teva Pharmaceutical Industries, Inc. TNF Nerelimomab Chiron/Celltech TNF Ozoralizumab Pfizer/Ablynx VEGFA Bevacizumab Genentech VEGFA Ranibizumab Genentech VEGF Alacizumab pegol (anti- UCB VEGFR2) VEGFA Brolucizumab Novartis VEGF Icrucumab (anti-VEGFR1) Eli Lilly VEGF Ramucirumab (anti-VEGFR2) Eli Lilly

    [0497] Neuronal growth factor blockers also include agents that antagonize neuronal growth factors and neuronal growth factor receptors. For example, neuronal growth factor blockers include TNF inhibitors (e.g., etanercept, thalidomide, lenalidomide, pomalidomide, pentoxifylline, bupropion, and DOI), TGFβ1 inhibitors, (e.g., disitertide (P144)), and TGFβ2 inhibitors (e.g., trabedersen (AP12009)). Exemplary neuronal growth factor antagonists are listed in Table 13.

    TABLE-US-00023 TABLE 13 NEURONAL GROWTH FACTOR AGONISTS AND ANTAGONISTS Agonist Antagonist TrkA NGF, amitriptyline, and ALE-0540 gambogic amide, gambogic acid TrkB BDNF, NT3, NT4, 3,7- ANA-12, cyclotraxin B, Dihydroxyflavone, 3,7,8,2′- and gossypetin Tetrahydroxyflavone, 4′- Dimethylamino-7,8- dihydroxyflavone, 7,3′- Dihydroxyflavone, 7,8- Dihydroxyflavone, 7,8,2′- Trihydroxyflavone, 7,8,3′- Trihydroxyflavone, Amitriptyline.sup., Deoxygedunin, Diosmetin, HIOC, LM22A-4, N-Acetylserotonin, Norwogonin (5,7,8-THF), R7, LM22A4, and TDP6 Pan-Trk entrectinib (RXDX-101), receptor AG 879, GNF 5837, GW 441756, and PF 06273340 GFRα1R GDNF and XIB4035 VEGF AEE 788, AG 879, AP 24534, receptor axitinib, DMH4, GSK 1363089, Ki 8751, RAF 265, SU 4312, SU 5402, SU 5416, SU 6668, sunitinib, toceranib, vatalanib, XL 184, ZM 306416, and ZM 323881 TGFβRI galunisertib (LY2157299), TEW-7197, SB-431542, A 83-01, D 4476, GW 788388, LY 364947, R 268712, RepSox, SB 505124, SB 525334, and SD 208

    [0498] In any of the combination therapy approaches described herein, the first and second therapeutic agent (e.g., a GRK2 inhibitor described herein and the additional therapeutic agent) are administered simultaneously or sequentially, in either order. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    [0499] Diagnosis and Prognosis of GRK2-Associated Cancer

    [0500] The methods described herein include methods of diagnosing or identifying patients with GRK2-associated cancer. Subjects who can be diagnosed or identified as having GRK2-associated cancer are subjects who have cancer (e.g., subjects identified as having cancer), or subjects suspected of having cancer. Subjects can be diagnosed or identified as having GRK2-associated cancer based on screening of patient cancer samples (e.g., tumor biopsies). GRK2 expression can be assessed in a cancer sample isolated from a subject using standard techniques known in the art, such as immunohistochemistry, western blot analysis, quantitative RT-PCR, RNA sequencing, fluorescent in situ hybridization, cDNA microarray, and droplet digital PCR. GRK2 expression can be assessed by comparing measurements obtained from subject cancer samples to measurements of GRK2 expression obtained from a reference sample (e.g., a non-cancerous cell of the same type or a cell that does not express GRK2, e.g., a HEK cell). Reference samples can be obtained from healthy subjects (e.g., subjects without cancer), or they can be obtained from databases in which average measurements of GRK2 expression are cataloged for a variety of types of healthy (e.g., non-cancerous) cells from many subjects.

    [0501] Subjects are diagnosed or identified as having GRK2-associated cancer if GRK2 expression is elevated or increased in the cancer sample compared to the reference sample. An increase of GRK2 expression of 1.1-fold or more (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0-fold or more) in the cancer sample compared to the reference indicates that the subject has GRK2-associated cancer. Subjects diagnosed or identified as having GRK2-associated cancer can be treated with the methods and compositions described herein (e.g., GRK2 inhibitors). Subjects can also be selected for treatment with the methods and compositions described herein if the cancer sample from the subject is found to express GRK2.

    [0502] The methods described herein also include methods of predicting patient response (e.g., the response of cancer in a subject) to GRK2 inhibitors in order to determine whether GRK2 inhibitors can be used for cancer treatment. In some embodiments, a cancer sample (e.g., a tumor biopsy or cancer cell) is isolated from a subject and contacted with one or more GRK2 inhibitors or GRK2-specific inhibitors (e.g., cancer samples are cultured and contacted with one or more inhibitors in vitro). The response of the cancer sample to the one or more GRK2 inhibitors or GRK2-specific inhibitors is evaluated to predict response to treatment. Responses that are evaluated include cancer cell or tumor growth, cancer cell or tumor proliferation, cancer cell or tumor migration, cancer cell or tumor metastasis, cancer cell or tumor invasion, cancer cell or tumor death, cancer or cell or tumor autophagy, cancer cell or tumor innervation, or cancer cell or tumor GRK2 expression. A decrease of at least 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or more) in cancer cell or tumor growth, cancer cell or tumor proliferation, cancer cell or tumor migration, cancer cell or tumor metastasis, cancer cell or tumor invasion, cancer cell or tumor innervation, or cancer cell or tumor GRK2 expression in treated cells compared to untreated or control-treated cells, or an increase of at least 5% or more (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 99%, or more) in cancer cell or tumor death or cancer cell or tumor autophagy in treated cells compared to untreated or control-treated cells indicates that the cancer would respond to treatment with a GRK2 inhibitor.

    [0503] The methods used above to diagnose or identify a subject with GRK2-associated cancer can also be used to predict patient response (e.g., the response of cancer in a subject) to treatment with a GRK2 inhibitor. If the expression of GRK2 is elevated or increased in a cancer sample compared to a reference (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0-fold or more higher in the cancer sample compared to the reference), the subject can be predicted to respond to treatment with a GRK2 inhibitor. Subjects predicted to respond to treatment with a GRK2 inhibitor or GRK2-specific inhibitor can be treated using the methods and compositions described herein (e.g., GRK2 inhibitors).

    [0504] Methods of Treatment

    [0505] Administration

    [0506] An effective amount of a GRK2 inhibitor described herein for treatment of cancer can be administered to a subject by standard methods. For example, the agent can be administered by any of a number of different routes including, e.g., intravenous, intradermal, subcutaneous, percutaneous injection, oral, transdermal (topical), or transmucosal. The GRK2 inhibitor can be administered orally or administered by injection, e.g., intramuscularly, or intravenously. The most suitable route for administration in any given case will depend on the particular agent administered, the patient, the particular disease or condition being treated, pharmaceutical formulation methods, administration methods (e.g., administration time and administration route), the patient's age, body weight, sex, severity of the diseases being treated, the patient's diet, and the patient's excretion rate. The agent can be encapsulated or injected, e.g., in a viscous form, for delivery to a chosen site, e.g., a tumor site. The agent can be provided in a matrix capable of delivering the agent to the chosen site. Matrices can provide slow release of the agent and provide proper presentation and appropriate environment for cellular infiltration. Matrices can be formed of materials presently in use for other implanted medical applications. The choice of matrix material is based on any one or more of: biocompatibility, biodegradability, mechanical properties, and cosmetic appearance and interface properties. One example is a collagen matrix.

    [0507] The agent (e.g., GRK2 inhibitor, e.g., polypeptide, small molecule, nucleic acid, or antibody) can be incorporated into pharmaceutical compositions suitable for administration to a subject, e.g., a human. Such compositions typically include the agent and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances are known. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions.

    [0508] A pharmaceutical composition can be formulated to be compatible with its intended route of administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

    [0509] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

    [0510] Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a GRK2 inhibitor described herein) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

    [0511] Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

    [0512] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

    [0513] The active compounds can be prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.

    [0514] Nucleic acid molecule agents described herein can be administered directly (e.g., therapeutic mRNAs) or inserted into vectors used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see, e.g., Chen et al., PNAS 91:3054 1994). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is embedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

    [0515] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

    [0516] Methods of formulating pharmaceutical agents are known in the art, e.g., Niazi, Handbook of Pharmaceutical Manufacturing Formulations (Second Edition), CRC Press 2009, describes formulation development for liquid, sterile, compressed, semi-compressed and OTC forms. Transdermal and mucosal delivery, lymphatic system delivery, nanoparticles, controlled drug release systems, theranostics, protein and peptide drugs, and biologics delivery are described in Wang et al., Drug Delivery: Principles and Applications (Second Edition), Wiley 2016; formulation and delivery of peptide and protein agent is described, e.g., in Banga, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems (Third Edition), CRC Press 2015.

    [0517] In some embodiments, the GRK2 inhibitors described herein are formulated for delivery in exosomes, small membrane vesicles (30 nm to 100 nm in diameter) of endocytic origin that are released into the extracellular environment following fusion of multivesicular bodies with the plasma membrane. Exosomes can be loaded with varied therapeutics such as small molecule drugs and nucleic acid molecules (e.g., inhibitory RNA molecules, such as siRNA, shRNA, or miRNA, or nucleases, such as gRNAs, ZFNs, or TALENs) to form therapeutic exosomes, which constitute an attractive carrier and delivery system for therapeutics. Unlike liposomes and other synthetic nanoparticle carriers of therapeutics, exosomes contain transmembrane- and membrane-anchored proteins that likely enhance endocytosis, thus promoting more efficient delivery of their internal content. Another advantage of therapeutic exosomes over synthetic nanoparticle carriers (e.g., liposomes) is enhanced stability and reduced clearance from circulation. The use of therapeutic exosomes as carrier and delivery system for therapeutics might also minimize cytotoxic effects observed with the use of synthetic nanoparticles (e.g., liposomes) in vivo. Exosomes can be produced by the methods described in Kamerkar et al. (Nature 546(7659): 498-503, 2017), Melo et al. (Nature 523(7559): 177-182, 2015), and U.S. Pat. Nos. 9,085,778, 9,629,929, and 9,889,210, the disclosures of which are incorporated herein by reference.

    [0518] Exosomes can be isolated from supernatant of donor cells (e.g., fibroblast, fibroblast-like mesenchymal cells, mast cells, cancer cells, tumor cells, and/or cells from cancer tissue) by differential centrifugation processes. Following isolation, the donor exosomes (i.e., exosomes isolated from donor cells) can be modified so as to remove genetic materials (e.g., miRNA, and mRNA) from the donor exosomes. To avoid interference with undesirable or irrelevant genetic material, it may be preferable to use donor exosomes that lack genetic contents (e.g., miRNA, or mRNA). Empty donor exosomes can be used for direct transfer to recipient cells or for direct transfection or microinjection of a therapeutic agent into the exosomes. Methods of transferring therapeutic agents directly into exosomes include transformation, transfection and microinjection.

    [0519] Local Administration

    [0520] The GRK2 inhibitors described herein can be administered locally, e.g., to the site of cancer in the subject. Examples of local administration include epicutaneous, inhalational, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intra-lesional administration, lymph node administration, intratumoral administration and administration to a mucous membrane of the subject, wherein the administration is intended to have a local and not a systemic effect. As an example, for the treatment of a cancer described herein, the GRK2 inhibitor may be administered locally (e.g., intratumorally) in a compound-impregnated substrate such as a wafer, microcassette, or resorbable sponge placed in direct contact with the affected tissue. Alternatively, the GRK2 inhibitor is infused into the brain or CSF using standard methods. As yet another example, a pulmonary cancer described herein may be treated, for example, by administering the GRK2 inhibitor locally by inhalation, e.g., in the form of an aerosol spray from a pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide or a nebulizer. A GRK2 inhibitor for use in the methods described herein can be administered at the site of a tumor, e.g., intratumorally. In certain embodiments, the agent is administered to a mucous membrane of the subject.

    [0521] Combination Therapy

    [0522] The GRK2 inhibitors described herein may be administered in combination with one or more additional therapies (e.g., 1, 2, 3 or more additional therapeutic agents). The two or more agents can be administered at the same time (e.g., administration of all agents occurs within 15 minutes, 10 minutes, 5 minutes, 2 minutes or less). The agents can also be administered simultaneously via co-formulation. The two or more agents can also be administered sequentially, such that the action of the two or more agents overlaps and their combined effect is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one agent or treatment delivered alone or in the absence of the other. The effect of the two or more treatments can be partially additive, wholly additive, or greater than additive (e.g., synergistic). Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, oral routes, intravenous routes, intramuscular routes, local routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination may be administered by intravenous injection while a second therapeutic agent of the combination can be administered locally in a compound-impregnated microcassette. The first therapeutic agent may be administered immediately, up to 1 hour, up to 2 hours, up to 3 hours, up to 4 hours, up to 5 hours, up to 6 hours, up to 7 hours, up to, 8 hours, up to 9 hours, up to 10 hours, up to 11 hours, up to 12 hours, up to 13 hours, 14 hours, up to hours 16, up to 17 hours, up 18 hours, up to 19 hours up to 20 hours, up to 21 hours, up to 22 hours, up to 23 hours up to 24 hours or up to 1-7, 1-14, 1-21 or 1-30 days before or after the second therapeutic agent.

    [0523] For use in treating cancer, the second agent may be a checkpoint inhibitor, a chemotherapeutic drug, a biologic cancer agent (e.g., an antibody listed in Table 4), a cancer specific agent (e.g., an agent listed in Table 5), a non-drug therapy, a cytokine therapy (e.g., an interferon or interleukin, e.g., IL-2 or IL-12), CAR-T therapy, an oncolytic virus (e.g., tamilogene laherparepvec (T-VEC), maraba virus, PVS-RIPO, canerpaturev, enadenotucirev, pelareorep, pexastimogene devacirepvec (JX-594), or tasadenoturev), a neurotransmission blocker, or a neuronal growth factor blocker. In one embodiment, the inhibitor of checkpoint is an inhibitory antibody (e.g., a monospecific antibody such as a monoclonal antibody). The antibody may be, e.g., humanized or fully human. In other embodiments, the inhibitor of checkpoint is a fusion protein, e.g., an Fc-receptor fusion protein. In some embodiments, the inhibitor of checkpoint is an agent, such as an antibody, that interacts with a checkpoint protein. In other embodiments, the inhibitor of checkpoint is an agent, such as an antibody, that interacts with the ligand of a checkpoint protein. In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of CTLA-4 (e.g., an anti-CTLA4 antibody such as ipilimumab or tremelimumab). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of PD-1 (e.g., nivolumab; pembrolizumab; pidilizumab/CT-011). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of PDL1 (e.g., MPDL3280A/RG7446; MED14736; MSB0010718C; BMS 936559). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or Fc fusion or small molecule inhibitor) of PDL2 (e.g., a PDL2/Ig fusion protein such as AMP 224). In one embodiment, the inhibitor of checkpoint is an inhibitor (e.g., an inhibitory antibody or small molecule inhibitor) of B7-H3 (e.g., MGA271), B7-H4, BTLA, HVEM, TIM3, GAL9, LAG3, VISTA, KIR, 2B4, CD160, CGEN-15049, CHK 1, CHK2, A2aR, B-7 family ligands, or a combination thereof. The second agent may also be an anti-angiogenic drug, e.g., an anti-VEGF antibody, or the second agent may be an oncolytic agent e.g., a chemotherapy, a drug that targets cancer metabolism, an antibody that marks a cancer cell surface for destruction, e.g., rituximab or trastuzumab, an antibody-drug conjugate, e.g., trastuzumab emtansine, a cell therapy, or other commonly-used anti-neoplastic agent.

    [0524] Dosing

    [0525] Subjects that can be treated as described herein are subjects with cancer or at risk of developing cancer. The cancer may be a primary tumor or a metastasized tumor. In some embodiments, the cancer is a GRK2-associated cancer. Subjects who can be treated with the methods disclosed herein include subjects who have had one or more tumors resected, received chemotherapy or other pharmacological treatment for the cancer, received radiation therapy, and/or received other therapy for the cancer. Subjects who have never previously been treated for cancer can also be treated using the methods described herein.

    [0526] In some embodiments, the agent is administered in an amount and for a time effective to result in one of (or more, e.g., 2 or more, 3 or more, 4 or more of): (a) reduced tumor size, (b) reduced rate of tumor growth, (c) increased tumor cell death (d) reduced tumor progression, (e) reduced number of metastases, (f) reduced rate of metastasis, (g) reduced tumor migration, (h) reduced tumor invasion, (i) reduced tumor volume, (j) decreased tumor recurrence, (k) increased survival of subject, (l) increased progression free survival of subject.

    [0527] The methods described herein may include a step of selecting a treatment for a patient. The method includes (a) identifying (e.g., diagnosing) a patient who has cancer or is at risk of developing cancer, and (b) selecting a GRK2 inhibitor, e.g., a GRK2 inhibitor described herein, to treat the condition in the patient. In some embodiments, the method includes administering the selected treatment to the subject. In some embodiments, a patient is identified as having cancer based on imaging (e.g., MRI, CT, or PET scan), biopsy, or blood sample (e.g., detection of blood antigen markers, circulating tumor DNA (e.g., by PCR). In some embodiments, a patient is identified as having cancer after presenting with one or more symptoms of a paraneoplastic syndrome (e.g., fever, auto-antibodies directed against nervous system proteins, ataxia, dizziness, nystagmus, difficulty swallowing, loss of muscle tone, loss of fine motor coordination, slurred speech memory loss, vision loss, sleep disturbances, dementia, seizures, dysgeusia, cachexia, anemia, itching, or sensory loss in the limbs). In some embodiments, a patient presents with symptoms of paraneoplastic syndrome and is then identified as having cancer based on imaging (e.g., CT, MRI, or PET scans).

    [0528] The method may also include (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the neoplasm for innervation, and (c) selecting a GRK2 inhibitor (e.g., a GRK2 inhibitor described herein) to treat the patient if the neoplasm is highly innervated (e.g., if the level of innervation is at least 10% higher (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80% higher) than the level of innervation in control tissue, e.g., non-cancerous tissue of the same subject). Innervation may be measured by staining tissue sections for neural markers e.g., immuno-histochemical staining for tyrosine hydroxylase, vesicular acetylcholine transporter; NGF-Inducible Large External glycoprotein, choline acetyltransferase, parvalbumin, neurofilament protein, Synapsin, synaptophysin, NeuN, NSE, MAP2, Beta III tubulin, 160 kD Neurofilament medium/200 kD Neurofilament Heavy, NSE, PSD93/PSD95, Doublecortin (DCX), c-fos, PSA-NCAM, NeuroD or Beta2, Tau, Calbindin-D28k, Calretinin, Neurofilament Protein (NFP), Glial fibrillary acidic protein (GFAP), S100β, Vimentin and CNPase; or by staining tissue sections with cell-identifying stains, e.g., H&E stain, Nissl Stain, Cresyl violet, Neutral red, Thionine and Toluidine blue, Luxol Fast blue stain, Weigert's Chromium hematoxylin method, Page's iron-eriochrome cyanine R, Dextran Conjugates (Fluorescein, Tetramethylrhodamine, Texas Red, Rhodamine Green), Hydrazides & Biocytins, Isolectin GS-1B4 conjugates, Golgi silver stain, or myelin stain; or by imaging the nervous system, e.g., by MRI, CT, PET, EEG, EMG, Myelogram, or magnetoencephalography. In some embodiments, the neoplasm is selected from: head and neck squamous cell carcinoma, adenoid cystic carcinoma, lymphoma, rhabdomyosarcoma, biliary tract cancer, gastric cancer, pancreatic cancer, prostate cancer, lung cancer, breast cancer, skin cancer (e.g., melanoma), renal cell carcinoma, or colorectal cancer. In some embodiments, the cancer is a cancer listed in Table 5. In some embodiments, the neoplasm is derived from a secretory tissue, glandular tissue, or endocrine or hormonal tissue.

    [0529] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the neoplasm for perineural invasion, and (c) selecting a GRK2 inhibitor to treat the patient if the neoplasm exhibits perineural invasion. In some embodiments, the neoplasm is selected from: head and neck squamous cell carcinoma, adenoid cystic carcinoma, lymphoma, rhabdomyosarcoma, biliary tract cancer, gastric cancer, pancreatic cancer, and prostate cancer.

    [0530] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has a neoplasm, (b) optionally evaluating the subject for metastasis to brain or spinal cord, and (c) selecting a GRK2 inhibitor to treat the patient if the neoplasm exhibits metastasis to brain or spinal cord. In some embodiments, the neoplasm is a lung cancer (e.g., small cell lung cancer, non-small cell lung cancer), breast cancer, ovarian cancer, skin cancer (e.g., melanoma), lymphoma, renal cell carcinoma, GI tract cancer (e.g., gastric cancer), head and neck cancer, prostate cancer, pancreatic cancer, or colorectal cancer.

    [0531] In one embodiment, the method includes (a) identifying (e.g., diagnosing) a patient who has cancer, (b) optionally evaluating the subject for GRK2 overexpression, and (c) selecting a GRK2 inhibitor to treat the patient if the cancer exhibits GRK2 overexpression (e.g., if the patient has GRK2-associated cancer). In some embodiments, the neoplasm is a lung cancer (e.g., small cell lung cancer, non-small cell lung cancer), breast cancer, skin cancer (e.g., melanoma), lymphoma, renal cell carcinoma, GI tract cancer, prostate cancer, ovarian cancer, uterine cancer, head and neck cancer, esophageal cancer, mesothelioma, colorectal cancer, or gastric cancer. GRK2 expression can be measured in a cancer sample collected from a subject using standard techniques known in the art, such as immunohistochemistry, western blot analysis, quantitative RT-PCR, RNA sequencing, fluorescent in situ hybridization, cDNA microarray, and droplet digital PCR. A cancer sample can be evaluated for increased expression of GRK2 by comparison to a reference sample (e.g., a non-cancerous cell of the same type).

    [0532] In some embodiments, the method includes administering the selected treatment to the subject.

    [0533] The method may also include a step of assessing the subject for a parameter of cancer progression or remission, e.g., assessing the subject for one or more (e.g., 2 or more, 3 or more, 4 or more) of: primary tumor size (e.g., by imaging), number of metastases (e.g., by imaging or biopsy), cell death in situ (e.g., by biopsy), blood antigen markers (e.g., by ELISA), circulating tumor DNA (e.g., by PCR), or function of the affected organ (e.g., by a test of circulating enzymes for liver, albuminuria for kidney, lung capacity for lung, etc.).

    [0534] In some embodiments, the tumor is treated with a GRK2 inhibitor and a second therapeutic agent. The second therapeutic agent can be selected based on tumor type, tumor tissue of origin, tumor stage, tumor innervation, or mutations in genes expressed by the tumor.

    [0535] In certain embodiments, a GRK2 inhibitor administered according to the methods described herein does not have a direct effect on the CNS or gut. Any effect on the CNS or gut is reduced compared to the effect observed if the GRK2 inhibitor is administered directly to the CNS or gut. In some embodiments, direct effects on the CNS or gut are avoided by modifying the GRK2 inhibitor not to cross the BBB, as described herein above, or administering the agent locally to a subject.

    [0536] Subjects with cancer or at risk of developing cancer are treated with an effective amount of a GRK2 inhibitor. The methods described herein also include contacting a tumor or cancer cell with an effective amount of a GRK2 inhibitor. In some embodiments, an effective amount of a GRK2 inhibitor is an amount sufficient to decrease tumor innervation or nerve activity in a tumor. In some embodiments, an effective amount of a GRK2 inhibitor is an amount sufficient to treat the cancer or tumor, cause remission, reduce tumor growth, reduce tumor volume, reduce tumor metastasis, reduce tumor invasion, reduce tumor proliferation, reduce tumor migration, or reduce tumor number, reduce GRK2 expression, increase cancer cell death, increase cancer cell autophagy, increase time to recurrence, or improve survival.

    [0537] The GRK2 inhibitors described herein are administered in an amount (e.g., an effective amount) and for a time sufficient to effect one of the outcomes described above. The GRK2 inhibitor may be administered once or more than once. The GRK2 inhibitor may be administered once daily, twice daily, three times daily, once every two days, once weekly, twice weekly, three times weekly, once biweekly, once monthly, once bimonthly, twice a year, or once yearly. Treatment may be discrete (e.g., an injection) or continuous (e.g., treatment via an implant or infusion pump). Subjects may be evaluated for treatment efficacy 1 week, 2 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more following administration of a GRK2 inhibitor depending on the GRK2 inhibitor and route of administration used for treatment. Depending on the outcome of the evaluation, treatment may be continued or ceased, treatment frequency or dosage may change, or the patient may be treated with a different GRK2 inhibitor. Subjects may be treated for a discrete period of time (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months) or until the disease or condition is alleviated, or treatment may be chronic depending on the severity and nature of the disease or condition being treated.

    Kits

    [0538] The invention also features a kit containing (a) a pharmaceutical composition including a GRK2 inhibitor described herein, and (b) instructions for administering the pharmaceutical composition to treat cancer.

    EXAMPLES

    [0539] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention; it will be understood by their exemplary nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.

    Example 1. Identification of GRK2 as Essential for Growth and Proliferation of Pancreatic Cancer

    [0540] To identify neurological genes relevant to the proliferation of pancreatic cancer, a CRISPR library of lentiviral-encoded guide RNAs (gRNA) that individually target neuronal genes was synthesized (Cellecta, Inc.), with a library coverage of six unique gRNAs per gene. Pancreatic cancer cell lines PANC1, MIAPACA2, and BXPC3, along with cell lines derived from several patient-derived xenograft (PDX) models were transduced with a lentiviral-encoded Cas9 nuclease at a high multiplicity of infection (MOI), then transduced with the gRNA lentivirus library at a low MOI of 0.5 to ensure that individual cells received no more than one gRNA. One day post transduction, cells were incubated with puromycin for four days to select for successfully transduced cells (the gRNA library vector also encodes puromycin resistance).

    [0541] Following transduction and selection, 10×10.sup.6 cells were harvested to serve as the “baseline” population from which the growth effects of individual genes would be compared. For the in vitro arm, 10×10.sup.6 cells were plated in manufacturer's recommended medium and split twice weekly for four weeks, always re-plating 10×10.sup.6 cells. For the in vivo subcutaneous arm, 5×10.sup.6 cells were implanted subcutaneously into NOD-SCID mice, with three mice per replicate, and allowed to grow for four weeks. For the in vivo orthotopic arm, 5×10.sup.5 cells were implanted orthotopically into the pancreas of NOD-SCID mice, with 10 mice per replicate, and allowed to grow for four weeks.

    [0542] Following the four weeks of cell/tumor growth, DNA from in vitro and in vivo samples was isolated by tissue homogenization and lysis using Qiagen DNeasy Blood and Tissue Kit, and concentrated by ethanol precipitation. The DNA samples were amplified by two rounds of PCR using manufacturer recommended primers and analyzed by next-generation sequencing (BGIAmerica).

    [0543] Sequencing results were analyzed to call hits using a Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGeCK) algorithm as described by Li W et al., Genome Biology 2014 and Li W et al., Genome Biology 2015. Essentially, sequencing reads were normalized to their medians, the variance of read counts for individual gRNAs were estimated and normalized, and individual gRNA read count differences were ranked against each other. Essential genes were called based on whether multiple of the gRNAs targeting this gene rank near the top of the gRNA ranking list. The gRNAs that were used to target GRK2 were encoded by DNA molecules with the sequences listed in Table 14.

    TABLE-US-00024 TABLE 14 DNA SEQUENCES ENCODING GRK2-TARGETING gRNA Gene DNA sequence encoding GRK2-targeting gRNA GRK2 TGTCATGCAGAAGTACCTGG (SEQ ID NO: 1) GRK2 GATTTGTCAAAACCTCCGAG (SEQ ID NO: 2) GRK2 GGTCCCGGTAGACCACGAAG (SEQ ID NO: 3) GRK2 GCACCCCAGAGAGAACCAGT (SEQ ID NO: 4) GRK2 CTTTCTTGCGAGCCTCCAGC (SEQ ID NO: 5) GRK2 GCTGCGCGACGCCTACCGCG (SEQ ID NO: 6)

    [0544] Significant genes were quantified along three parameters: the Beta score, essentially the magnitude of the effect (log-fold change in gRNA count); the p-value; and the false discovery rate (FDR). Beta scores <0 indicated that the six gRNAs targeting a single gene were absent from the late stage sample compared to the baseline sample, and are a good indication that the gene is “dropping out” in the course of tumor growth. P-value and FDR both reflect the confidence that the result is not spurious, with a lower value indicating higher confidence. Thresholds for calling hits were P-value <0.1 and FDR <0.5.

    [0545] GRK2 showed up as a significant hit in multiple model systems, as shown in Table 15 below. The data indicate that GRK2 is essential to the growth and proliferation of pancreatic cancer and suggest that inhibiting GRK2 may be useful for the treatment of cancer.

    TABLE-US-00025 TABLE 15 GRK2 CRISPR RESULTS Gene B-score P-value FDR Condition GRK2 −0.73 0.00025 0.0069 in vitro BXPC3 GRK2 −0.56 0 0 21 d in vitro PAXF1657 GRK2 −0.89 0 0 28 d in vitro PAXF1657 GRK2 −1.4 0.002 0.18 Ortho PAXF1657 GRK2 −0.71 0.024 0.37 SubQ PAXF1657

    [0546] To validate the findings from the CRISPR screen, Cas9-expressing pancreatic cell lines were generated that express doxycycline inducible sgRNAs targeting GRK2. Treatment of these cells with 100 ng/ml doxycycline for 3, 7 or 10 days induced a time-dependent depletion of Grk2 protein, confirming the on-target efficacy of the sgRNAs. Grk2 levels were measured using Western Blot analysis, and the results are shown in Table 16.

    TABLE-US-00026 TABLE 16 GRK2 SGRNAS REDUCED GRK2 PROTEIN LEVELS GAPDH GRK2 GRK2/ GRK2/GAPDH Avg. Avg. GAPDH normalized Cell Line sgRNA Days Dox Intensity Intensity ratio to −dox Miapaca sgNTC D 3 − 850,134.00 100,566.00 0.12 Miapaca sgNTC D 3 + 720,778.00 68,452.00 0.09 0.80 Miapaca sgNTC D 7 − 977,426.00 125,362.00 0.13 Miapaca sgNTC D 7 + 1,304,839.00 184,822.00 0.14 1.10 Miapaca sgNTC D 10 − 1,031,499.00 136,972.00 0.13 Miapaca sgNTC D 10 + 996,960.00 112,064.00 0.11 0.85 Miapaca sgGRK2- D 3 − 730,069.00 29,494.00 0.04 pooled Miapaca sgGRK2- D 3 + 686,300.00 7,540.00 0.01 0.27 pooled Miapaca sgGRK2- D 7 − 909,144.00 52,534.00 0.06 pooled Miapaca sgGRK2- D 7 + 950,955.00 −4,392.00 0.00 −0.08 pooled Miapaca sgGRK2- D 10 − 778,200.00 37,758.00 0.05 pooled Miapaca sgGRK2- D 10 + 953,273.00 1,128.00 0.00 0.02 pooled Panc1 sgNTC D 3 − 660,115.00 113,134.00 0.17 Panc1 sgNTC D 3 + 680,708.00 114,472.00 0.17 0.98 Panc1 sgNTC D 7 − 1,123,100.00 201,864.00 0.18 Panc1 sgNTC D 7 + 791,235.00 202,452.00 0.26 1.42 Panc1 sgNTC D 10 − 458,807.00 83,888.00 0.18 Panc1 sgNTC D 10 + 527,138.00 88,814.00 0.17 0.92 Panc1 sgGRK2- D 3 − 101,675.00 9,250.00 0.09 pooled Panc1 sgGRK2- D 3 + 286,459.00 3,152.00 0.01 0.12 pooled Panc1 sgGRK2- D 7 − 663,706.00 33,356.00 0.05 pooled Panc1 sgGRK2- D 7 + 777,941.00 1,264.00 0.00 0.03 pooled Panc1 sgGRK2- D 10 − 379,379.00 17,864.00 0.05 pooled Panc1 sgGRK2- D 10 + 380,889.00 −1,010.00 0.00 −0.06 pooled BXPC3 sgNTC D 3 − 138,204.00 3,882.00 0.03 BXPC3 sgNTC D 3 + 774,148.00 81,590.00 0.11 3.75 BXPC3 sgNTC D 7 − 200,710.00 104,800.00 0.52 BXPC3 sgNTC D 7 + 1,171,479.00 211,288.00 0.18 0.35 BXPC3 sgNTC D 10 − 1,100,387.00 151,640.00 0.14 BXPC3 sgNTC D 10 + 1,207,918.00 173,510.00 0.14 1.04 BXPC3 sgGRK2- D 3 − 716,863.00 138,426.00 0.19 pooled BXPC3 sgGRK2- D 3 + 1,019,754.00 120,906.00 0.12 0.61 pooled BXPC3 sgGRK2- D 7 − 485,164.00 97,116.00 0.20 pooled BXPC3 sgGRK2- D 7 + 889,095.00 115,170.00 0.13 0.65 pooled BXPC3 sgGRK2- D 10 − 604,521.00 131,636.00 0.22 pooled BXPC3 sgGRK2- D 10 + 864,103.00 85,668.00 0.10 0.46 pooled PAXF1997 sgNTC D 3 − 1,495,184.00 258,488.00 0.17 PAXF1997 sgNTC D 3 + 1,730,788.00 332,610.00 0.19 1.11 PAXF1997 sgNTC D 7 − 1,921,289.00 260,904.00 0.14 PAXF1997 sgNTC D 7 + 2,102,602.00 381,128.00 0.18 1.33 PAXF1997 sgNTC D 10 − 1,918,507.00 429,332.00 0.22 PAXF1997 sgNTC D 10 + 2,588,082.00 537,898.00 0.21 0.93 PAXF1997 sgGRK2- D 3 − 1,929,746.00 292,512.00 0.15 pooled PAXF1997 sgGRK2- D 3 + 1,516,350.00 61,756.00 0.04 0.27 pooled PAXF1997 sgGRK2- D 7 − 2,165,121.00 394,554.00 0.18 pooled PAXF1997 sgGRK2- D 7 + 2,343,604.00 133,038.00 0.06 0.31 pooled PAXF1997 sgGRK2- D 10 − 2,108,003.00 489,080.00 0.23 pooled PAXF1997 sgGRK2- D 10 + 2,366,810.00 81,574.00 0.03 0.15 pooled PAXF1997 sgGRK2 D 3 − 657,735.68 1,900,268.97 0.35 pooled PAXF1997 sgGRK2 D 3 + 204,037.28 1,881,941.79 0.11 0.31 pooled PAXF1997 sgGRK2 D 7 − 676,658.40 1,980,927.72 0.34 pooled PAXF1997 sgGRK2 D 7 + 264,522.88 2,296,446.76 0.12 0.34 pooled PAXF1997 sgGRK2 D 10 − 787,256.80 1,828,088.97 0.43 pooled PAXF1997 sgGRK2 D 10 + 135,021.12 1,464,604.41 0.09 0.21 pooled PAXF1997 sgGRK2 D 14 − 749,224.16 1,757,432.97 0.43 pooled PAXF1997 sgGRK2 D 14 + 148,905.28 1,468,029.79 0.10 0.24 pooled PAXF1997 sgGRK2 D 18 − 348,556.16 1,540,794.90 0.23 pooled PAXF1997 sgGRK2 D 18 + 111,389.76 1,759,827.31 0.06 0.28 pooled PAXF1657 sgNTC 3 − 1,648,078.11 6,387,847.41 0.26 PAXF1657 sgNTC 3 + 2,330,340.78 5,279,594.79 0.44 1.71 PAXF1657 sgNTC 7 − 3,709,716.22 4,510,160.86 0.82 PAXF1657 sgNTC 7 + 3,301,525.00 4,306,119.99 0.77 0.93 PAXF1657 sgGRK2-1 7 − 619,833.22 3,759,964.63 0.16 (SEQ ID NO: 1) PAXF1657 sgGRK2-1 7 + 190,054.33 4,541,178.51 0.04 0.25 (SEQ ID NO: 1) PAXF1657 sgGRK2-2 7 − 939,202.78 3,309,926.48 0.28 (SEQ ID NO: 3) PAXF1657 sgGRK2-2 7 + 119,039.00 2,133,921.03 0.06 0.20 (SEQ ID NO: 3) PAXF1657 sgGRK2-3 7 − 1,090,217.00 1,925,734.51 0.57 (SEQ ID NO: 4) PAXF1657 sgGRK2-3 7 + 318,007.56 2,026,964.66 0.16 0.28 (SEQ ID NO: 4) PAXF1657 sgGRK2- 7 − 2,668,943.00 4,579,845.04 0.58 pooled PAXF1657 sgGRK2- 7 + 473,372.00 5,793,544.31 0.08 0.14 pooled

    [0547] Next, experiments were performed to evaluate whether GRK2 knockout induced by doxycycline treatment results in a proliferation defect in pancreatic cancer cells. Pancreatic cancer cell lines expressing GRK2 sgRNAs as well as RFP were plated in a ratio of 1:1 with GFP expressing pancreatic cancer cells. Co-plated cells were cultured in the presence or absence of 100 ng/ml doxycycline over the course of 21 days, and the percentage of GFP and RFP-expressing cells was measured over time. In this competition assay, knockout of GRK2 by individual or pooled sgRNAs showed an anti-proliferative effect in all pancreatic cancer cell lines tested, with the strongest phenotypes observed in PAXF1657, BXPC3 and PAXF1997, correlating with the pooled CRISPR screen results. These data are shown in Tables 17A-17E, below, with the RFP/GFP ratio +dox normalized to RFP/GFP ratio −dox.

    TABLE-US-00027 TABLE 17A DOXYCYCLINE-INDUCED GRK2 KNOCKOUT- PAXF1657 sgGRK2-1 sgGRK2-2 sgGRK2-3 sgGRK2 (SEQ ID (SEQ ID (SEQ ID days sgNTC sgPCNA pooled NO: 1) NO: 3) NO: 4) 3 0.96 0.95 0.87 0.98 1.00 0.92 7 1.05 0.57 0.85 0.91 0.89 0.83 10 1.12 0.29 0.65 0.85 0.76 0.64 14 1.04 0.17 0.49 0.78 0.69 0.44 17 0.90 0.11 0.40 0.68 0.57 0.27 21 0.95 0.11 0.40 0.53 0.44 0.24

    TABLE-US-00028 TABLE 17B DOXYCYCLINE-INDUCED GRK2 KNOCKOUT- MIAPACA2 days sgNTC sgPCNA sgGRK2 pooled 3 0.95 0.77 0.91 7 0.92 0.22 0.82 14 0.97 0.09 0.66 18 0.95 0.07 0.60 21 0.94 0.05 0.56

    TABLE-US-00029 TABLE 17C DOXYCYCLINE-INDUCED GRK2 KNOCKOUT- PANC1 days sgNTC sgPCNA sgGRK2 pooled 3 1.01 0.62 0.83 7 0.93 0.14 0.65 14 0.86 0.02 0.45 18 0.98 0.02 0.48 21 0.94 0.01 0.49

    TABLE-US-00030 TABLE 17D DOXYCYCLINE-INDUCED GRK2 KNOCKOUT- BXPC3 days sgNTC sgPCNA sgGRK2 pooled 3 0.93 0.99 0.86 7 1.01 0.94 0.82 14 0.91 0.41 0.53 18 1.01 0.32 0.50 21 0.94 0.29 0.39

    TABLE-US-00031 TABLE 17E DOXYCYCLINE-INDUCED GRK2 KNOCKOUT- PAXF1997 days sgNTC sgPCNA sgGRK2 pooled 3 1.07 1.00 0.90 7 1.09 0.81 0.78 14 1.12 0.49 0.55 18 1.16 0.39 0.46 21 1.28 0.30 0.32

    Example 2. The Anti-Proliferative Effect of GRK2 Inhibition is Due to Loss of Grk2 Kinase Activity

    [0548] To test whether the Grk2 sgRNAs act through targeting Grk2, and to test whether the anti-proliferative effect results from loss of the Grk2 kinase activity, Grk2 sgRNA expressing PAXF1657 cell lines overexpressing Cas9/sgRNA-cleavage-resistant Grk2 wild-type or kinase-dead cDNA constructs were generated. Re-expression of Cas9/sgRNA-cleavage-resistant Grk2 wild-type or kinase-dead cDNA constructs led to increased Grk2 protein levels, as measured by Western Blot analysis and shown in Table 18. Re-expression of Grk2 wild-type cDNA in sgGrk2-2 (SEQ ID NO: 3) expressing PAXF1657 cells reduced the sgRNA-induced growth inhibition, whereas re-expression of the Grk2 kinase-dead cDNA did not, as shown in Table 19 (values represent the RFP/GFP ratio +dox normalized to RFP/GFP ratio −dox). This suggests that the kinase activity of Grk2 is essential for the role of Grk2 on cell survival. In the context of sgGrk2-3 (SEQ ID NO: 4) expressing PAXF1657 cells, rescue of growth inhibition by re-expression of Grk2 wild-type cDNA was less efficient, potentially due to lower re-expression of Grk2 in these cells or due to some off-target activity of the sgRNA.

    TABLE-US-00032 TABLE 18 GRK2 LEVELS IN PAXF1657 CELL LINES OVEREXPRESSING CAS9/SGRNA- CLEAVAGE-RESISTANT GRK2 WT OR KINASE-DEAD CDNA CONSTRUCTS GRK2/ GAPDH GRK2 GAPDH GRK2/ normalized Cell Line cDNA Treatment Adj. Vol. (Int) Adj. Vol. (Int) GAPDH to −dox PAXF1657- Empty −dox 517,219.94 12,741,232.67 0.04 sgNT vector PAXF1657- Empty +dox 690,882.92 21,016,384.00 0.03 0.81 sgNT vector PAXF1657- sgGRK2#2 −dox 10,343,005.94 23,974,881.67 0.43 sgNT res PAXF1657- sgGRK2#2 +dox 5,659,532.02 20,612,415.33 0.27 0.64 sgNT res PAXF1657- sgGRK2#2 −dox 1,273,895.69 9,517,351.33 0.13 sgNT KD res PAXF1657- sgGRK2#2 +dox 1,556,476.86 11,498,672.00 0.14 1.01 sgNT KD res PAXF1657- sgGRK2#3 −dox 6,501,271.10 18,889,385.00 0.34 sgNT res PAXF1657- sgGRK2#3 +dox 8,133,567.10 20,580,295.67 0.40 1.15 sgNT res PAXF1657- sgGRK2#3 −dox 3,037,131.76 23,103,834.33 0.13 sgNT KD res PAXF1657- sgGRK2#3 +dox 3,610,963.69 20,987,549.33 0.17 1.31 sgNT KD res PAXF1657- Empty −dox 933,193.82 18,372,389.33 0.05 sgGRK2-2 vector PAXF1657- Empty +dox −189,385.63 15,831,400.67 −0.01 −0.24 sgGRK2-2 vector PAXF1657- sgGRK2#2 −dox 10,774,146.31 14,680,373.00 0.73 sgGRK2-2 res PAXF1657- sgGRK2#2 +dox 9,575,312.76 13,308,717.33 0.72 0.98 sgGRK2-2 res PAXF1657- sgGRK2#2 −dox 2,591,844.94 13,897,219.33 0.19 sgGRK2-2 KD res PAXF1657- sgGRK2#2 +dox 4,784,299.06 13,531,826.33 0.35 1.90 sgGRK2-2 KD res PAXF1657- Empty −dox 293,372.12 17,075,476.00 0.02 sgGRK2-3 vector PAXF1657- Empty +dox −514,147.69 12,133,157.00 −0.04 −2.47 sgGRK2-3 vector PAXF1657- sgGRK2#3 −dox 3,254,562.84 24,094,330.00 0.14 sgGRK2-3 res PAXF1657- sgGRK2#3 +dox 4,806,774.61 15,187,382.00 0.32 2.34 sgGRK2-3 res PAXF1657- sgGRK2#3 −dox 6,259,054.49 17,030,119.33 0.37 sgGRK2-3 KD res PAXF1657- sgGRK2#3 +dox 9,225,716.59 13,838,994.33 0.67 1.81 sgGRK2-3 KD res

    TABLE-US-00033 TABLE 19 GROWTH OF PAXF1657 CELL LINES OVEREXPRESSING CAS9/SGRNA- CLEAVAGE-RESISTANT GRK2 WT OR KINASE-DEAD CDNA CONSTRUCTS sgNTC- sgNTC- sgGRK2- sgNTC- +GRK2 +GRK2 sgGRK2- 2 +GRK2 sgGRK2- sgGRK2- +GRK2 kinase sgNTC- kinase 2 +GRK2 kinase 3 +GRK2 3 +GRK2 wild-type dead +GRK2 dead wild-type dead wild-type kinase cDNA cDNA wt cDNA cDNA cDNA cDNA cDNA dead cDNA sgNTC (res. to (res. to (res. to (res. to sgGRK2-2 + (res. to (res. to sgGRK2-3 + (res. to (res. to empty sgRNA2 sgRNA2 sgRNA3 sgRNA3 empty sgRNA2 sgRNA2 empty sgRNA3 sgRNA3 days vector cleavage) cleavage) cleavage) cleavage) vector cleavage) cleavage) vector cleavage) cleavage) 3 1.09 1.02 0.83 0.97 0.83 0.92 0.85 0.85 0.79 0.97 0.90 7 0.85 0.93 1.07 0.81 1.18 0.66 0.99 1.06 0.78 0.78 0.82 10 0.99 1.05 0.91 0.91 0.99 0.40 0.75 0.68 0.61 0.73 0.49 14 0.76 0.85 1.00 0.85 0.88 0.28 0.91 0.45 0.38 0.57 0.39 17 0.76 0.89 1.59 0.81 1.08 0.17 0.53 0.23 0.27 0.54 0.26 21 0.84 0.88 1.23 1.13 0.85 0.10 0.69 0.15 0.24 0.34 0.23

    Example 3. The GRK2 Small Molecule Antagonist of Formula III-26 Reduces Pancreatic Cancer Cell Proliferation

    [0549] The GRK2 small molecule antagonist of Formula III-26 was used to evaluate the effect of a small molecule GRK2 antagonist on the proliferation of pancreatic cancer cell lines Miapaca2, Panc1, BXPC3, PAXF1657, PAXF1997 and Capan1. Values represent percent viability normalized to DMSO. As shown in Table 20, the compound having the structure of Formula III-26 reduced cell proliferation.

    TABLE-US-00034 TABLE 20 PROLIFERATION OF CELLS TREATED WITH THE COMPOUND OF FORMULA III-26 Dose Miapaca2 Panc1 BXPC3 PAXF1657 PAXF1997 Capan1 (μM) Avg STDV Avg STDV Avg STDV Avg STDV Avg STDV Avg STDV 30.000 40.0 1.36 86.2 6.34 75.8 1.55 69.0 1.72 81.4 0.56 95.4 1.61 10.000 66.1 3.16 85.2 6.10 77.0 3.20 88.6 0.31 83.7 0.91 90.0 1.52 3.333 86.6 5.87 100.2 7.60 91.5 4.60 101.7 2.47 104.1 3.75 100.4 2.04 1.111 99.3 4.12 112.8 9.04 102.4 1.72 109.5 3.56 110.0 3.24 106.4 2.94 0.370 113.7 7.43 113.3 13.07 107.6 1.22 115.4 0.40 118.2 5.74 111.9 4.53 0.123 110.9 4.88 112.7 8.48 104.0 0.74 117.6 2.83 113.8 5.50 114.2 3.76 0.041 108.3 3.10 113.4 6.92 104.4 2.94 116.0 1.34 111.5 6.27 112.3 4.07 0.014 104.8 5.68 112.4 9.69 104.6 2.49 110.8 0.98 111.3 3.65 108.4 2.57 0.005 102.4 6.89 103.1 5.49 105.8 1.78 111.4 1.49 111.2 3.73 107.2 2.46 0.000 100.0 4.31 100.0 5.82 100.0 1.85 100.0 2.50 100.0 2.15 100.0 2.67

    [0550] Different concentrations of the compound of Formula III-26 were then used to evaluate its effect on pancreatic cancer cell line proliferation in a long-term colony formation assay (10-14 days). As shown in Table 21, the GRK2 inhibitor of Formula III-26 also reduced pancreatic cancer cell line proliferation in this assay.

    TABLE-US-00035 TABLE 21 PROLIFERATION OF CELLS TREATED WITH THE COMPOUND OF FORMULA III-26 - COLONY FORMATION ASSAY Concentration Mean Normalized Cell Line Drug μM intensity to DMSO BXPC3 Compound of Formula III-26 0.1 μM 396.24 0.99 BXPC3 Compound of Formula III-26 0.3 μM 445.015 1.11 BXPC3 Compound of Formula III-26 1 μM 418.98 1.04 BXPC3 Compound of Formula III-26 3 μM 189.24 0.47 BXPC3 Compound of Formula III-26 10 μM 82.2 0.20 BXPC3 Compound of Formula III-26 30 μM 76.19 0.19 BXPC3 DMSO 401.82 1.00 Miapaca Compound of Formula III-26 0.1 μM 447.5 1.09 Miapaca Compound of Formula III-26 0.3 μM 461.465 1.13 Miapaca Compound of Formula III-26 1 μM 398.675 0.97 Miapaca Compound of Formula III-26 3 μM 386.35 0.94 Miapaca Compound of Formula III-26 10 μM 80.16 0.20 Miapaca Compound of Formula III-26 30 μM 75.66 0.18 Miapaca DMSO 409.79 1.00 Panc1 Compound of Formula III-26 0.1 μM 477.265 1.16 Panc1 Compound of Formula III-26 0.3 μM 478.195 1.17 Panc1 Compound of Formula III-26 1 μM 509.365 1.24 Panc1 Compound of Formula III-26 3 μM 504.735 1.23 Panc1 Compound of Formula III-26 10 μM 254.47 0.62 Panc1 Compound of Formula III-26 30 μM 181.7 0.44 Panc1 DMSO 409.78 1.00 PAXF1657 Compound of Formula III-26 0.1 μM 617.13 0.97 PAXF1657 Compound of Formula III-26 0.3 μM 660.9 1.04 PAXF1657 Compound of Formula III-26 1 μM 574.375 0.90 PAXF1657 Compound of Formula III-26 3 μM 410.77 0.64 PAXF1657 Compound of Formula III-26 10 μM 326.68 0.51 PAXF1657 Compound of Formula III-26 30 μM 271.275 0.43 PAXF1657 DMSO 637.245 1.00 PAXF1997 Compound of Formula III-26 0.1 μM 461.65 1.07 PAXF1997 Compound of Formula III-26 0.3 μM 500.34 1.16 PAXF1997 Compound of Formula III-26 1 μM 455.7 1.06 PAXF1997 Compound of Formula III-26 3 μM 379.285 0.88 PAXF1997 Compound of Formula III-26 10 μM 296.635 0.69 PAXF1997 Compound of Formula III-26 30 μM 288.38 0.67 PAXF1997 DMSO 431.47 1.00

    [0551] To assess the target specificity of the GRK2 small molecule antagonist of Formula III-26, sgGRK2-expressing cells were treated with the compound of Formula III-26. If GRK2 knockout is complete and the compound of Formula III-26 inhibits only GRK2, the addition of the compound of Formula III-26 should not induce any additional growth defect compared to sgRNA KO alone. Indeed, in Miapaca2, addition of 1 μM or 3 μM the compound of Formula III-26 to sgGrk2-expressing cells plated in a colony formation assay did not have any additional anti-proliferative effect compared to knockout alone. In contrast, in PAXF1657, addition of the compound of Formula III-26 further decreased the growth of PAXF1657 cells in the presence of GRK2 knockout, as shown in Table 22. This is potentially due to the lower GRK2 knockout efficiency that can be achieved in PAXF1657 compared to Miapaca2, as shown in Table 16.

    TABLE-US-00036 TABLE 22 PROLIFERATION OF SGGRK2-EXPRESSING CELLS TREATED WITH THE COMPOUND OF FORMULA III-26 Difference between rel +dox Cell Line Treatment sgRNA Rel −dox Rel +dox and −dox signal PAXF1657 DMSO sgNTC 1.00 0.84 0.16 PAXF1657 DMSO sgGRK2-2 1.00 0.79 0.21 (SEQ ID NO: 3) PAXF1657 DMSO sgGRK2-3 1.00 0.64 0.36 (SEQ ID NO: 4) PAXF1657 DMSO sgGRK2-pooled 1.00 0.65 0.35 PAXF1657 1 μM Compound of sgNTC 0.73 0.78 −0.04 Formula III-26 PAXF1657 1 μM Compound of sgGRK2-2 0.89 0.44 0.45 Formula III-26 (SEQ ID NO: 3) PAXF1657 1 μM Compound of sgGRK2-3 0.78 0.40 0.37 Formula III-26 (SEQ ID NO: 4) PAXF1657 1 μM Compound of sgGRK2-pooled 0.78 0.49 0.29 Formula III-26 PAXF1657 3 μM Compound of sgNTC 0.57 0.56 0.01 Formula III-26 PAXF1657 3 μM Compound of sgGRK2-2 0.67 0.41 0.26 Formula III-26 (SEQ ID NO: 3) PAXF1657 3 μM Compound of sgGRK2-3 0.55 0.22 0.32 Formula III-26 (SEQ ID NO: 4) PAXF1657 3 μM Compound of sgGRK2-pooled 0.59 0.48 0.11 Formula III-26 Miapaca DMSO sgNTC 1.00 1.08 −0.08 Miapaca DMSO sgGRK2-pooled 1.00 0.78 0.22 Miapaca 1 μM Compound of sgNTC 0.81 0.77 0.05 Formula III-26 Miapaca 1 μM Compound of sgGRK2-pooled 0.75 0.76 0.00 Formula III-26 Miapaca 3 μM Compound of sgNTC 0.65 0.53 0.12 Formula III-26 Miapaca 3 μM Compound of sgGRK2-pooled 0.47 0.43 0.04 Formula III-26

    Example 4. Evaluating the Effect of GRK2 Small Molecule Antagonists on Cancer Cell Proliferation

    [0552] Cellular anti-proliferative activity of GRK2 small molecule antagonists was assessed using pancreatic cancer cell line PAXF1657 stably overexpressing GRK2 cDNA or the control empty vector or a stable clone of GRK2 knockout. Cell lines were seeded into tissue culture treated, white-walled, 96-well plates at a density of 500 cells/well in RPM11640 media supplemented with 10% H.I. FBS and penicillin/streptomycin. Plates were incubated overnight at 37° C., 5% CO.sub.2 to allow cells to adhere to the wells. GRK2 small molecule antagonists were added to the cells using a ten-point or five-point dilution series with a final concentration ranging from 10 mM-0.015 mM in 0.1% DMSO. At the time of compound addition, a set of plates that were not treated with compounds were collected and cell viability was measured using CellTiter-Glo (Promega). CellTiter-Glo reagent was added to the plates and luminescence was measured using a Biotek Synergy plate reader. The compound treated cells were incubated for 3 days at 37° C., 5% CO.sub.2. The media was then aspirated from each well and replaced with fresh media containing GRK2 small molecule antagonists. The compound treated cells were then incubated for another 4 days at 37° C., 5% CO.sub.2 and cell viability was assessed at the end of the 7-day compound treatment by CellTiterGlo. The results of this experiment are shown below in Table 23.

    TABLE-US-00037 TABLE 23 PROLIFERATION OF PAXF1657 CELLS TREATED WITH GRK2 SMALL MOLECULE ANTAGONISTS Maximum % GI50, Growth inhibition geometric relative to DMSO, sgRNA cDNA Compound ID Treatment mean, μM geometric mean sgNTC pReceiver- Compound of 5 point dose 1.49 43.3 empty vector Formula II-26 curve of compound sgNTC pReceiver- Compound of 10 point dose 9.49 61 empty vector Formula III-26 curve of compound sgNTC pReceiver- Compound of 10 point dose 2.52 89 empty vector Formula III-54 curve of compound sgNTC pReceiver- Compound of 10 point dose 0.11 82.3 empty vector Formula III-55 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 46.5 empty vector Formula III-56 curve of compound sgNTC pReceiver- Compound of 10 point dose 0.68 83.6 empty vector Formula III-35 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 31.6 empty vector Formula III-31 curve of compound sgNTC pReceiver- Compound of 5 point dose 6.27 42.7 empty vector Formula II-33 curve of compound sgNTC pReceiver- Compound of 10 point dose 4.91 73.1 empty vector Formula III-30 curve of compound sgNTC pReceiver- Compound of 10 point dose 0.653 76.8 empty vector Formula III-28 curve of compound sgNTC pReceiver- Compound of 10 point dose 3.37 99.3 empty vector Formula II-35 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 25.5 GRK2 Formula II-26 curve of compound sgNTC pReceiver- Compound of 10 point dose >10 24.8 GRK2 Formula III-26 curve of compound sgNTC pReceiver- Compound of 10 point dose 2.71 87.3 GRK2 Formula III-54 curve of compound sgNTC pReceiver- Compound of 10 point dose 0.17 85.9 GRK2 Formula III-55 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 28.3 GRK2 Formula III-56 curve of compound sgNTC pReceiver- Compound of 10 point dose 0.614 81.4 GRK2 Formula III-35 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 29.8 GRK2 Formula III-31 curve of compound sgNTC pReceiver- Compound of 5 point dose >10 0 GRK2 Formula II-33 curve of compound sgNTC pReceiver- Compound of 10 point dose 3.4 65.5 GRK2 Formula III-30 curve of compound sgNTC pReceiver- Compound of 10 point dose 14.7 64.7 GRK2 Formula III-28 curve of compound sgNTC pReceiver- Compound of 10 point dose 5.94 99.3 GRK2 Formula II-35 curve of compound sgGRK2 #2, none Compound of 5 point dose not tested not tested clonal KO Formula II-26 curve of compound sgGRK2 #2, none Compound of 10 point dose not tested not tested clonal KO Formula III-26 curve of compound sgGRK2 #2, none Compound of 10 point dose not tested not tested clonal KO Formula III-54 curve of compound sgGRK2 #2, none Compound of 10 point dose not tested not tested clonal KO Formula III-55 curve of compound sgGRK2 #2, none Compound of 5 point dose not tested not tested clonal KO Formula III-56 curve of compound sgGRK2 #2, none Compound of 10 point dose not tested not tested clonal KO Formula III-35 curve of compound sgGRK2 #2, none Compound of 5 point dose not tested not tested clonal KO Formula III-31 curve of compound sgGRK2 #2, none Compound of 5 point dose not tested not tested clonal KO Formula II-33 curve of compound sgGRK2 #2, none Compound of 10 point dose >30 63.5 clonal KO Formula III-30 curve of compound sgGRK2 #2, none Compound of 10 point dose 17.9 78.8 clonal KO Formula III-28 curve of compound sgGRK2 #2, none Compound of 10 point dose 8.8 99.3 clonal KO Formula II-35 curve of compound

    Example 5. Generation of a GRK2-Specific Inhibitory Antibody

    [0553] The protein sequence of GRK2 is recombinantly expressed from a mammalian cell culture system, e.g., HEK or CHO cells. Using routine methods such as phage display, yeast display, or animal immunization, an antibody is raised that is specific to GRK2 as measured by ELISA.

    Example 6. Treatment of a Patient with Cancer with a GRK2 Inhibitor

    [0554] According to the methods disclosed herein, a physician of skill in the art can treat a patient, such as a human patient with cancer (e.g., pancreatic cancer), so as to inhibit cancer growth, reduce tumor burden, increase cancer cell death, or slow disease progression. The method of treatment can include diagnosing or identifying a patient as a candidate for treatment with a GRK2 inhibitor based on GRK2 expression in a biopsy. For example, a tissue sample can be collected from a patient's cancer and analyzed for RNA expression by qPCR or RNAseq analysis, and the cancer can be found to express high levels of GRK2. To treat the patient, a physician of skill in the art can administer a GRK2 inhibitor that decreases GRK2 expression or function (e.g., an inhibitory RNA or nuclease directed to GRK2 or a GRK2 small molecule antagonist, e.g., a small molecule antagonist described herein, such as an antagonist having a structure of Formula I (e.g., having the structure of any one of Formula I-1 to I-39), Formula II (e.g., having the structure of any one of Formula II-1 to II-35), Formula III (e.g., having the structure of any one of Formula III-1 to III-56), or Formula IV (e.g., having the structure of any one of Formula IV-1 to IV-80), or any one of Compounds 1-70). The GRK2 inhibitor can be administered locally (e.g., injected into the tumor or tumor microenvironment) to decrease tumor growth or volume. The GRK2 inhibitor is administered in a therapeutically effective amount, such as from 10 μg/kg to 500 mg/kg (e.g., 10 μg/kg, 100 μg/kg, 500 μg/kg, 1 mg/kg, 10 mg/kg, 50 mg/kg, 100 mg/kg, 250 mg/kg, or 500 mg/kg). In some embodiments, the GRK2 inhibitor is administered bimonthly, once a month, once every two weeks, or at least once a week or more (e.g., 1, 2, 3, 4, 5, 6, or 7 times a week or more).

    [0555] The GRK2 inhibitor is administered to the patient in an amount sufficient to decrease tumor growth, decrease tumor burden, increase cancer cell death, or increase progression free survival by 10% or more (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more). Tumor growth and tumor burden can be assessed using standard imaging methods (e.g., digital radiography, PET scan, CT scan, or MRI scan). Images from before and after administration of the GRK2 inhibitor can be compared to evaluate the efficacy of the treatment, and the rate of disease progression can be assessed by comparison to the patient's medical history prior to administration of the GRK2 inhibitor. A finding of a reduction in the total number of tumors, number of primary tumors, volume of tumors, growth of tumors, or rate of disease progression indicates that the GRK2 inhibitor has successfully treated the cancer.

    OTHER EMBODIMENTS

    [0556] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims. Other embodiments are within the claims.