DUAL-CONTROLLED DRUG AND PHOTOACTIVATABLE SYSTEM FOR SPATIOTEMPORAL CONTROL OF CELL THERAPY
20230036060 · 2023-02-02
Inventors
Cpc classification
C12N2740/15043
CHEMISTRY; METALLURGY
C12N2740/16043
CHEMISTRY; METALLURGY
C12N2830/002
CHEMISTRY; METALLURGY
C12N2800/30
CHEMISTRY; METALLURGY
C12N15/635
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are compositions, including products of manufacture and kits, and methods, for remotely-controlled and non-invasive manipulation of intracellular nucleic acid expression, genetic processes, function and activity in live cells such as a T cell, a primary T cell, a B cell, a monocyte, a macrophage, a dendritic cell or a natural killercell in vivo, for example, including activating, adding functions or changing or adding specificities for an immune cell, for monitoring physiologic processes, for the correction of pathological processes and for the control of therapeutic outcomes. Provided are tamoxifen-gated photoactivatable split-Cre recombinase optogenetic systems, called TamPA-Cre, that feature high spatiotemporal control to control or alter cell activities in vivo, for example, to limit the activity of a Chimeric Antigen Receptor (CAR)-expressing cell such as an immune cell and its activity at a tumor site for immunotherapy applications.
Claims
1. A method for remotely-controlling and non-invasively manipulating expression of an exogenous nucleic acid in a cell, or an immune cell, the method comprising: (a) inserting or expressing in a recombinantly engineered cell: (i) a tamoxifen-gated photoactivatable split-Cre recombinase (TamPA-Cre) optogenetic system comprising: (1) a nucleic acid encoding a cytosol-localizing mutant estrogen receptor ligand binding domain ERT2 fused to a N-terminal half of split Cre(2-59aa)-nMag (CreN-nMag) encoding segment, and, (2) a nucleic acid encoding an NLS-pMag-CreC protein, wherein an expressed NLS-pMag-CreC protein is nucleus-localized and the ERT2-CreN-nMag protein is cytosolically localized, and (ii) a floxed exogenous nucleic acid operatively linked to a transcriptional regulatory element, optionally a constitutive or an inducible promoter, whose expression can be activated by an active Cre-lox site recombination event; (b) administering or contacting the cell with tamoxifen or 4-hydroxytamoxifen (4-OHT), wherein a tamoxifen metabolite 4-hydroxytamoxifen (4-OHT) binds with the ERT2-CreN-nMag cytosolically localized protein to drive its nuclear localization to prime Tam PA-Cre; and (c) exposing the cell to blue light to drive nMag-pMag heterodimerization, which restores active TamPA-Cre recombinase activity within the cell nucleus, thereby allowing expression of the floxed exogenous nucleic acid.
2. The method of claim 1, wherein the recombinantly engineered cell is administered in vivo, wherein optionally the recombinantly engineered cell is administered to an individual in need thereof in vivo, and optionally the blue light is administered to only a desired area or location in the individual in need thereof, and optionally the desired area or location in the individual in need thereof is a site of a tumor or a growth, and optionally the recombinantly engineered cell is injected into and/or adjacent or approximate to a cancer of a site of a tumor or a growth.
3. The method of claim 1, wherein the expressing of the floxed exogenous nucleic acid in the cell adds a function to the cell, or immune cell, or manipulates a physiologic and/or a genetic process in the cell, or immune cell, and optionally when the upregulated nucleic acid is a nucleic acid expressing (encoding) a CAR, a single chain antibody, or a single-domain antibody (also known as sdAb or nanobody) or an antibody fragment consisting of a single monomeric variable antibody domain, thereby adding a new specificity, function or target cell to a cell, an immune cell or a T cell.
4. The method of claim 1, wherein the cell is a human cell or a mammalian cell, or is a recombinantly engineered cell engineered to be transplanted or inserted into a tissue, an organ, an organism or an individual, or is or comprises a non-human transgenic animal genetically engineered to contain one or a plurality of recombinantly engineered cells.
5. The method of claim 1, wherein the tamoxifen is administered to the individual in need thereof by oral or topical administration, and optionally the tamoxifen is formulated as tamoxifen citrate, and optionally the tamoxifen is formulated as a liquid, a gel or a solid, and optionally the liquid is formulated at about 10 mg/5 mL tamoxifen, and optionally the solid is a pill, a tablet, a geltab, a nanoparticle or a capsule, and optionally each solid formulation comprises about 15.2 mg of tamoxifen citrate which is equivalent to about 10 mg of tamoxifen, or each solid formulation comprises about 30.4 mg of tamoxifen citrate which is equivalent to about 20 mg of tamoxifen, and optionally the nanoparticle is a polylactide-co-glycolide (PLGA) nanoparticle loaded with tamoxifen or tamoxifen citrate[11].
6. The method of claim 1, wherein the cell or the individual in need thereof is first exposed to or administered tamoxifen or 4-hydroxytamoxifen (4-OHT) followed by being exposed to or administered a continuous or pulsed blue light, wherein optionally the cells are exposed to between about 400 to 600 nM 4-hydroxytamoxifen (4-OHT), or about 500 nM 4-OHT, and optionally blue light is applied to the cells between about 2 to 5 hours, or about 3 hours, following an initial exposure to tamoxifen, and optionally the blue light frequency is about 400 to 500 nM, and optionally the blue light is applied in a pulsed manner at about 1 second on to about 59 seconds off, or at about 5 seconds on to about 55 seconds off, optionally repeated over a time period of between about 1 hours and 36 hours, or between about 12 hours and 24 hours, and optionally the blue light is continuously applied to the cells for between about 1 hour and 24 hours, or between about 2 hours and 12 hours.
7. The method of claim 1, wherein a chimeric antigen receptor (CAR) is expressed on a T cell surface after exposure of the T cell to tamoxifen followed by blue light, thereby activating the T cell to attack and/or kill a cancerous tissue, a cancer cell or a tumor cell, wherein optionally the cancerous tissue, cancer cell or tumor cell is a local or skin or mucosal metastatic head/neck cancer, a melanoma, or a skin cancer or a skin growth.
8. The method of claim 1, wherein the cell is inside the body of an animal or a human in need thereof, and the recombinantly engineered cell is focused on or approximate to a tumor or a dysplastic or dysfunctional tissue.
9. The method of claim 1, wherein the method is used for the manipulation or correction of a pathological process, optionally, for eradicating a tumor or a cancer in an individual in vivo, wherein optionally the individual is a human or an animal.
10-12. (canceled)
13. A kit or formulation comprising a genetically engineered cell engineered to comprise: (a) a tamoxifen-gated photoactivatable split-Cre recombinase (Tam PA-Cre) optogenetic system comprising: (1) a nucleic acid encoding a cytosol-localizing mutant estrogen receptor ligand binding domain ERT2 fused to a N-terminal half of split Cre(2-59aa)-nMag (CreN-nMag) encoding segment, and, (2) a nucleic acid encoding an NLS-pMag-CreC protein, wherein an expressed NLS-pMag-CreC protein is nucleus-localized and the ERT2-CreN-nMaq protein is cytosolically localized, and (b) a floxed exogenous nucleic acid operatively linked to a transcriptional regulatory element, optionally a constitutive or an inducible promoter, whose expression can be activated by an active Cre-lox site recombination event.
14. The method of claim 1, wherein the method further comprises modifying or adding a target capability or a function to the cell, or immune cell.
15. The method of claim 1, wherein the immune cell is a T cell, a primary T cell, a B cell, a monocyte, a macrophage, a dendritic cell or a natural killer cell.
16. The method of claim 1, wherein the exogenous nucleic acid is contained in a vector or expression cassette.
17. The method of claim 1, wherein the exogenous nucleic acid comprises a nucleic acid encoding (expressing) a protein.
18. The method of claim 17, wherein the protein is a therapeutic protein, or a transcriptional or translational regulatory protein, or a receptor, or a recombinant or an artificial T cell receptor (also known as a chimeric T cell receptor, a chimeric immunoreceptor, a chimeric antigen receptor (CAR), an antibody, a single chain antibody, or a single-domain antibody (also known as sdAb or nanobody) or an antibody fragment consisting of a single monomeric variable antibody domain.
19. The method of claim 1, wherein the recombinantly engineered cell is an immune cell or comprises a plurality of cells or immune cells.
20. The method of claim 1, wherein the lox site is or comprises a lox P site, a lox H site, a lox 511 site, a lox 5171 site, a lox 66 site, a lox 71 site, or equivalent lox sites.
21. The method of claim 1, wherein the constitutive promoter comprises an EF-1 alpha, PGK, CMV, CAG, SFFV, SV40 or equivalent constitutive promoter.
22. The method of claim 1, wherein the TamPA-Cre) optogenetic system is stably integrated into the genome of the cell or is episomally expressed or is contained in a non-integrated vector in the cell.
23. The method of claim 1, wherein the tamoxifen-gated photoactivatable split-Cre recombinase (Tam PA-Cre) optogenetic system and/or the floxed exogenous nucleic acid is contained in a lentivirus vector.
Description
DESCRIPTION OF DRAWINGS
[0055] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0056] The drawings set forth herein are illustrative of exemplary embodiments provided herein and are not meant to limit the scope of the invention as encompassed by the claims.
[0057]
[0058] The left image schematically shows a person with Antigen1+ Antigen2+ cancerous (red) and healthy (purple) tissues in separate regions of the body, and engineered T cells express TamPA-Cre (ERT2-CreN-nMag and NLS-pMag-CreC) and the CAR Reporter genetic construct, consisting of a constitutive promoter driving expression of a foxed (purple) α-Antigen1 Receptor CDS with stop codons (black), followed by a-Antigen2 CAR (green), and upon intravenous introduction, the engineered T cells bind and localize to both cancerous (
[0059] TamPA-Cre is inactive as its NLS-pMag-CreC and ERT2-CreN-nMag protein halves nuclear and cytosolically localized, respectively, after administration of tamoxifen, metabolite 4-hydroxytamoxifen (4-OHT) binds with ERT2-CreN-nMag to drive nuclear localization (
[0060] Next, blue light is applied to the cancerous tissue region only (
[0061] The T cell is finally activated upon CAR-mediated binding to Antigen2. T cells localized to the healthy tissue region (
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093] During experiments, this
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130] Like reference symbols in the various drawings indicate like elements.
DETAILED DESCRIPTION
[0131] In alternative embodiments, provided are compositions, including products of manufacture and kits, and methods, for remotely-controlled and non-invasive manipulation of physiologic or genetic processes and/or protein expression in live cells in vivo, for example, immune cells such as T cells, monocytes/macrophages, dendritic cells, natural killercells, for example, for the controlled expression of recombinant nucleic acids or proteins such as for example, chimeric T cell or NK cell receptors, chimeric immunoreceptors or chimeric antigen receptors (CARs), for the manipulation of physiologic processes in the cell or for the correction of pathological processes (for example, non-specific targeting of the CAR-T cells against normal/nonmalignant tissues) and/or for control of therapeutic outcomes, for example, engineered immune cells (for example, T cells or NK cells) expressing CARs targeting specific cancers cells and killing them.
[0132] In alternative embodiments, provided are compositions and methods for the manipulation or correction of pathological processes, for example, for eradicating tumors and cancers in human subjects, without limitation in penetration depth of an inducible signal, that comprise use of ultrasound stimulation. In alternative embodiment, provided are compositions and methods for inducing expression of nucleic acids, for example, genes, in immune cells such as T cells, monocytes/macrophages, dendritic cells, natural killercells and the like. In alternative embodiment, provided are compositions and methods for stimulating or inhibiting ligand-receptor interactions, including any surface molecular interaction, including but not limiting to inhibitory CTLA-4 and apoptotic Fas.
[0133] In alternative embodiments, provided are compositions and methods for the treatment, amelioration, prevention or eradication of a pathologic process or a pathology, a disease, an abnormal tissue, or an infection, for example, bacterial or viral infections, with a specific cell surface marker. In alternative embodiment, provided are compositions and methods for the controlled production of RNAs (including microRNA, long non-coding RNAs), and for the epigenetic and genetic modulation of molecules for the treatment, amelioration, prevention or eradication of a pathologic process, a disease, an abnormal tissue, or an infection.
[0134] In alternative embodiments, provided are engineered cells, for example, human cells, for example, immune cells, for example, T cells, capable of inducibly expressing a nucleic acid, for example, a protein encoding nucleic acid, for example, expressing a recombinant protein such as a chimeric antigen T cell receptor (CAR), by operatively linking a gene of interest, i.e., a gene (for example, a gene expressing a CAR), to a duel tamoxifen/blue light induced nucleic acid expression system.
[0135] Engineered chimeric antigen receptor (CAR) T cells as provided herein can detect and eradicate cancer cells within patients, and provides truly cancer-specific CAR-targeting cell surface antigens to prevent potentially fatal on-target off-tumor toxicity against other healthy tissues within the body. Engineered cells as provided herein can accomplish this by use of a novel tamoxifen-gated photoactivatable split-Cre recombinase optogenetic system, called TamPA-Cre, that features high spatiotemporal control to limit CAR T cell activity to the tumor site for immunotherapy applications. We created and optimized a novel dual switch, i.e., a genetic and gate switch, by integrating the features of tamoxifen-dependent nuclear localization (with the ERT2 domain) and blue-light-inducible heterodimerization of Magnet protein domains (nMag, pMag) into split Cre recombinase. Upon blue light stimulation following tamoxifen treatment, the TamPA-Cre system exhibits sensitivity to low intensity, short durations of blue light exposure to induce robust Cre-loxP recombination efficiency.
[0136] We demonstrate that this TamPA-Cre system can be applied to specifically control localized CAR expression and subsequently T cell activation. As such, we posit that CAR T cell activity can be confined to a solid tumor site by applying an external stimulus, with high precision of control in both space and time, such as light. Furthermore, the highly controllable TamPA-Cre system as provided herein can replace virtually any Cre-loxP system. Exemplary TamPA-Cre systems as provided herein are useful alternatives to CRE-ERT2 systems, for example, in mouse lines, where spontaneous Cre-loxP background recombination in vivo is already an established problem.
[0137] TamPA-Cre system as provided herein also are readily applicable for clinical applications, for example locally metastatic head/neck cancer, melanoma, or other skin cancers, typically at superficial location, as lights (for example, blue lights) can reach these locations after the local injection of the engineered controllable CAR T cells.
[0138] While current systems that induce CAR activity via the administration or release of small molecules or proteins have allowed for some degree of temporal control, their inability to localize CAR activation to the site of the solid tumor still allows for potential on-target off-tumor toxicity (see Supplementary Table 1). Light-induced optogenetic systems offer precise control over the dosage, duration, and location of stimulation—ideal for controlling CAR expression in both space and time. However, current optogenetic systems are often weakly regulated and allow for the premature CAR expression responsible for on-target off-tumor toxicity. The TamPA-Cre, a small molecule- and light-inducible split Cre recombinase optogenetic systems as provided herein address this issue by tightly regulating CAR expression. By fusing the cytosol-localizing mutant estrogen receptor ligand binding domain (ERT2) to the N-terminal half of split Cre(2-59aa)-nMag, the TamPA-Cre protein ERT2-CreN-nMag is physically separated from its nuclear-localized binding partner, NLS-pMag-CreC(60-343aa). Without tamoxifen to drive nuclear localization of ERT2-CreN-nMag, the typically high background of the photoactivation system lacking ERT2 is significantly suppressed.
[0139] In summary, we have developed a novel logic-gated optogenetic split Cre system by integrating both ERT2-fusion proteins with the blue light-inducible nMag-pMag heterodimerizing domains to drive robust Cre-loxP recombination with significantly suppressed background. Only after treatment with tamoxifen is the TamPA-Cre system primed to be activated by short pulses of low intensity blue light stimulation. The tamoxifen gate helps prevent the spontaneous Cre-loxP recombination within cells prior to specific blue light stimulation—a weakness of other photoactivatable Cre-loxP systems. Applying the TamPA-Cre system to our foxed CAR-Reporter construct in Jurkat T cells, we were able to precisely induce CAR expression and antigen-specific T cell activation. With its unique high spatiotemporal control over T cell activation, the TamPA-Cre system could be used to locally induce T cell effector functions against cancer cells in vivo while avoiding on-target off-tumor toxicity in TAA.sup.+ healthy tissues.
[0140] Exemplary TamPA-Cre systems as provided herein also offer improved spatiotemporal control over other engineered CAR systems, like SynNotchn and SUPRA CAR..sup.42 Suicide switches.sup.43-44 and iCARs.sup.45 can be further integrated into the robust photoactivatable systems provided herein to prevent potential on-target off-tumor toxicity caused by TamPA-Cre-activated CAR T cells leaving the stimulated region following tumor eradication. CRISPR-Cas9 technology can also help integrate large TamPA-Cre and engineered CAR T cell system designs into safe and effective loci in the genome..sup.46 Furthermore, while the highly controllable TamPA-Cre system can replace virtually any Cre-loxP system, we foresee that it will serve as a particularly useful alternative to CRE-ERT2 systems in mouse lines where spontaneous Cre-loxP background recombination in vivo is already an established problem..sup.47
[0141] Exemplary TamPA-Cre systems as provided herein are applicable for clinical applications, for example locally metastatic head/neck cancer, melanoma, or other skin cancers, typically at superficial location, as lights can reach these locations after the local injection of the engineered controllable CAR T cells.
[0142] In immunotherapy, the expression of engineered CAR on the cell surface enables T cells to recognize specific antigens on the target cell. This triggers T cell activation can eventually lead to the elimination of target cells. Clinical trials involving anti-CD19 CAR T cells against B-cell malignancies have shown promising results, demonstrating the therapeutic effects of CAR T cells in cancer treatment. In alternative embodiments, compositions and methods as provided herein address the problem that occurs upon perfusion of constitutively activated CAR T cells into patients, which may have lethal consequences due to the induced cytokine storm and ‘on-target, off tumor’ toxicity, by controlling the timing and location of the activation of the perfused CAR T cells.
[0143] In alternative embodiments, methods as provided herein can remotely and non-invasively activate any cell in vivo, including immune cells such as T cells, for example, CAR T cells, with precise spatial and temporal control. In alternative embodiments, methods as provided herein are used to remotely control other stimulatory or inhibitory ligand-receptor interactions, as well as any surface molecular interaction, including but not limiting to inhibitory PD-1, CTLA-4 and apoptotic Fas.
[0144] In alternative embodiments, methods as provided herein are used in the eradication of other diseases or abnormal tissues with specific surface markers. In alternative embodiments, methods as provided herein are used to treat or eradicate bacterial or viral infections.
[0145] In alternative embodiments, methods as provided herein are used are used for the controlled production of RNAs (including microRNA, long non-coding RNAs, antisense or miRNAs), for example, for the epigenetic and genetic modulation molecules for the treatment of diseases.
[0146] After administering or contacting the cell with tamoxifen, it is the tamoxifen metabolite 4-hydroxytamoxifen (4-OHT) that binds with the ERT2-CreN-nMag cytosolically localized protein to drive its nuclear localization to prime TamPA-Cre. Plasma 4-OHT levels are expected to decay over time, varying naturally with metabolic and clearance efficiency between different individuals. The plasma concentrations of tamoxifen declines with a terminal elimination half-life of about 5 to 7 hours, see for example, Fun B J, Jordan V C (1984) The pharmacology and clinical uses of tamoxifen. Pharmacol Ther 25(2): 127-205. Thus, 4-OHT levels will not remain at therapeutic levels over the course of days.
[0147] In alternative embodiments, blue light treated areas, particularly areas that may be triggered inadvertently by sunlight or artificial light, such as exposed skin, are covered locally from light until, for example, plasma tamoxifen levels test below the therapeutic threshold, or a calculated amount of time needed for metabolite 4-OHT plasma levels to fall below effective levels.
CRISPR Systems for Genome Integration
[0148] In alternative embodiments, a CRISPR method is one alternate method of engineering the target cells (for example, for inserting the TamPA-Cre system in target cells), for example, as an alternative to using the exemplary lentivirus infection method also described herein.
[0149] For example, in alternative embodiments, a SpCas9 or equivalent protein and a guide RNA are expressed or delivered into a target cell, for example, through electroporation or equivalents. The CAR reporter as provided herein is included in a template plasmid which contains nucleic acid sequence homologous to the targeted insertion region of target cell genome, and is delivered into target cells, for example, through electroporation or equivalents. After CRISPR-mediated homology-directed repair, the CAR reporter is inserted in the target cell genome. Successful integration of the CAR reporter into the target cell genome can be verified by genotyping methods and/or function-based assays.
[0150] Regardless of which exemplary method is used (for example, lentivirus or CRISPR), the system is still a tamoxifen-gated photoactivatable split-Cre recombinase (TamPA-Cre) optogenetic system, meaning that in both cases Cre-lox will be utilized to express CAR protein from the CAR reporter nucleic acid sequence when the TamPA-Cre system is activated.
[0151] In alternative embodiments, for using CRISPR (for example, instead of the exemplary lentivirus) to engineer target cells, the components needed are: (1) SpCas9 protein (either protein form or nucleic acid form which can express SpCas9 protein when in cells); (2) a single guide RNA (sgRNA, either RNA form or nucleic acid form which can be transcribed into RNA when in cells); and (3) a template plasmid which contains the CAR reporter (including the exemplary Cre-loxP structure), flanked by nucleic acid sequence homologous to the targeted insertion locus/loci (determined by sgRNA) of genome of the cell. With all these components, the cells can go through CRISPR-mediated homology-directed repair, which can insert the CAR reporter in the genome.
[0152] In alternative embodiments, any CRISPR system can be used to practice embodiments as provided herein, for example, as described in U.S. Pat. Nos. 10,767,168; 10,760,081; 10,745,716; 10,711,285; 10,711,284; 10,668,173; and/or 10,577,630.
Products of manufacture and Kits
[0153] Provided are products of manufacture and kits for practicing methods as provided herein; and optionally, products of manufacture and kits can further comprise instructions for practicing methods as provided herein.
[0154] Any of the above aspects and embodiments can be combined with any other aspect or embodiment as disclosed here in the Summary and/or Detailed Description sections.
[0155] As used in this specification and the claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.
[0156] Unless specifically stated or obvious from context, as used herein, the term “or” is understood to be inclusive and covers both “or” and “and”.
[0157] Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About (use of the term “about”) can be understood as within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12% 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”
[0158] Unless specifically stated or obvious from context, as used herein, the terms “substantially all”, “substantially most of”, “substantially all of” or “majority of” encompass at least about 90%, 95%, 97%, 98%, 99% or 99.5%, or more of a referenced amount of a composition.
[0159] The entirety of each patent, patent application, publication and document referenced herein hereby is incorporated by reference. Citation of the above patents, patent applications, publications and documents is not an admission that any of the foregoing is pertinent prior art, nor does it constitute any admission as to the contents or date of these publications or documents. Incorporation by reference of these documents, standing alone, should not be construed as an assertion or admission that any portion of the contents of any document is considered to be essential material for satisfying any national or regional statutory disclosure requirement for patent applications. Notwithstanding, the right is reserved for relying upon any of such documents, where appropriate, for providing material deemed essential to the claimed subject matter by an examining authority or court.
[0160] Modifications may be made to the foregoing without departing from the basic aspects of the invention. Although the invention has been described in substantial detail with reference to one or more specific embodiments, those of ordinary skill in the art will recognize that changes may be made to the embodiments specifically disclosed in this application, and yet these modifications and improvements are within the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element(s) not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of”, and “consisting of” may be replaced with either of the other two terms. Thus, the terms and expressions which have been employed are used as terms of description and not of limitation, equivalents of the features shown and described, or portions thereof, are not excluded, and it is recognized that various modifications are possible within the scope of the invention. Embodiments of the invention are set forth in the following claims.
[0161] The invention will be further described with reference to the examples described herein; however, it is to be understood that the invention is not limited to such examples.
EXAMPLES
[0162] Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols, for example, as described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Other references for standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK). Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR—Basics: From Background to Bench, First Edition, Springer Verlag, Germany.
Example 1: Acoustic Thermogenetics for Remote-Controlled Gene Expression and T Cell Activation
[0163] This example demonstrates that methods and recombinantly engineered cells as provided are effective and can be used to treat cancer and tumors.
[0164] An exemplary mechanism of an exemplary TamPA-Cre activation system is illustrated in
Testing Photoactivatable Split-Cre Systems
[0165] To develop the optogenetic circuit, we first tested the two most recently developed blue light photoactivatable split-Cre systems. The PA-Cre-2.0 system (hereafter referred to as PA-Cre-C) relies on the blue-light-induced heterodimerization between CIB1 and CRY2(L348F) domains (Arabidopsis thaliano, heterodimer half-life: 24 min) to reconstruct functional Cre recombinase from the split CreN(19-104) and CreC(106-343) components..sup.30 The PA-Cre system (hereafter referred to as PA-Cre-M) utilizes the Neurospora crassa-derived Vivid photoreceptor mutant heterodimers negative Magnet (nMag) and positive Magnet (pMag) to reconstitute its split CreN(19-59) and CreC(60-343) components into functional Cre with blue light (heterodimer half-life: 1.8 hours)..sup.29 To compare these two systems (Fig. S1A-C), we developed a puromycin-selected HEK293T cell line that stably expresses the Cre-loxP deletion-based EGFP Reporter construct (
[0166] To compare the two photoactivatable split-Cre systems, EGFP Reporter HEK293T cells were or were not (Reporter) transiently transfected with either PA-Cre-C, PA-Cre-M, or Cre constructs (Fig. S1A-D). Then, cells either were (Light) or were not (Dark) briefly stimulated with a single pulse of blue light (472±29 nm, 30 W/m2, 30 s). The percentage of EGFP.sup.+ recombined cells in each cell group was determined by flow cytometry 24 h later. All EGFP Reporter HEK293T cell groups were normalized to the mean EGFP.sup.+ percentage of cells in the maximally recombined corresponding Cre.sup.+ positive control groups to account for differences in transfection efficiency between experiments.
[0167] As can be seen in
[0168] However, despite the high recombination efficiencies of the Light PA-Cre-M groups, the Dark PA-Cre-M groups suffered from high background levels of spontaneous Cre-loxP recombination (26.7±2.0%), which was found to be proportional to PA-Cre-M protein expression levels (Fig. S3A). Furthermore, while stimulating the PA-Cre-M system in EGFP Reporter HEK293T cells with a pulsatile light protocol intended to improve its performance (15 W/m.sup.2, is per min, 24 h), we found it necessary to actively protect non-blue-light-stimulated (Dark) cell groups from all light sources. Without protection, a small but significant additional percentage of cells underwent Cre-loxP recombination (Ambient: 28.9±4.8%, Dark: 20.4±2.4%), presumably driven by incidental exposure to the blue wavelengths of the laboratory's ambient white room lighting while in the incubator (0.34-0.78 W/m.sup.2,
Testing Cre-ERT2 Systems
[0169] We focused on suppressing background Cre-loxP recombination in non-stimulated cells by spatially segregating one of the PA-Cre-M heterodimer split-Cre protein halves outside of the nucleus, since neither nuclear localization sequence (NLS) tagged CreN-nMag-NLS nor NLS-pMag-CreC protein halves alone were able to drive significant recombination (Fig. S1C, S3B). Although this could be achieved in a number of different ways (for example using the AsLOV2-based blue-light-inducible nuclear localization signal system),.sup.31 it was preferable to find an orthogonally-inducible, well-gated, and robust system compatible with use in vivo. The US Food and Drug Administration-approved drug tamoxifen and its active metabolites have been widely used to induce nuclear translocation of proteins, including Cre, which are fused to the T2 mutant Estrogen Receptor ligand binding domain (ERT2),.sup.32-34 particularly to induce genomic changes in vivo in transgenic mouse models..sup.35
[0170] Because tamoxifen and its active metabolites are known to be somewhat photosensitive,.sup.22 we examined whether or not relevant amounts of blue light stimulation interfered with the tamoxifen-gated ERT2-Cre-ERT2 Cre-loxP recombination system (
[0171] Tamoxifen-induced nuclear import translocation dynamics in HEK293T cells were further characterized using an ERT2-mCherry fusion protein (Fig. S1F). Using time-lapse fluorescence microscopy, we discovered that nuclear translocation driven by 4-OHT (500 nM) occurred on the order of hours. ERT2-mCherry protein was only clearly nuclear-localized (with a nuclear-to-cytosolic mean fluorescence intensity ratio≥2) after approximately three hours (
Design and Function of TamPA-Cre
[0172] We therefore integrated components of both the Tamoxifen-ERT2 and Photoactivatable-Cre systems to create a novel genetically-encoded AND gate in which both tamoxifen and blue light stimulation are needed to drive Cre-loxP recombination (
[0173] The mechanism of TamPA-Cre activation is illustrated in
Optimizing Tamoxifen and Blue Light Stimulation
[0174] To optimize Cre-loxP recombination, we tested the TamPA-Cre system in EGFP Reporter HEK293T cells with a variety of tamoxifen and blue light stimulation protocols. Two parameters were found to be particularly important: the light stimulation pattern (pulsatile versus continuous exposure), and the time at which light was started relative to 4-OHT addition. Drawn from the 3 h short illumination pattern shown to improve PA-Cre-M function,.sup.29
[0175] Under Protocol A, light-stimulated TamPA-Cre drove Cre-loxP recombination in only a minor percentage of EGFP Reporter HEK cells (17.3±1.1%,
[0176] TamPA-Cre-mediated recombination was also improved to a similar extent by administering light in a pulsatile pattern started concurrently with tamoxifen stimulation (25.4±3.5%, Fig. S5B). p Therefore, Protocol B was created to merge the advantages of both a delay in light stimulation and a pulsatile light pattern. In EGFP Reporter HEK293T cells exposed to the same total three hours of blue light stimulation but delivered in a pulsatile pattern (7.5 s per min, 24 h) started three hours post-tamoxifen stimulation (Protocol B), TamPA-Cre drove robust levels of Cre-loxP recombination (79.9±10.1%,
[0177] With the AND gate working as intended, we further investigated whether the reported 13-fold increase in heterodimerization between the pMag and nMagHigh1 domains.sup.38 would additionally improve recombination efficiency as TamPA-Cre-nH1 (Fig. S1I). Under Protocol B, a greater percentage of TamPA-Cre-nH1.sup.+ EGFP Reporter HEK cells did indeed undergo Cre-loxP recombination (125.0±13.3%,
Design and function of the CAR Reporter
[0178] The TamPA-Cre system was next applied to induce CAR expression in the physiologically relevant Jurkat T cell line. To demonstrate our overall concept outlined in
[0179] The CAR and Receptor constructs were next integrated into several different foxed reporter designs to achieve the initial expression of the tumor-anchoring myc-α-CD38 Receptor, and α-CD19 CAR expression only upon induction via TamPA-Cre-mediated Cre-loxP recombination. After testing the TamPA-Cre system with several different reporter configurations (Fig. S7), the deletion-based Cre-loxP recombination CAR Reporter was selected to create the CAR Reporter Jurkat T cell line (
[0180] Both components of either the PA-Cre-M or TamPA-Cre system were transduced into CAR Reporter Jurkat T cells sequentially at high copy number and maintained via puromycin selection to create stable cell lines. CAR Reporter Jurkat T cells transduced with only one of the two TamPA-Cre components were unable to undergo Cre-loxP recombination indicating that, like PA-Cre-M, both split-Cre protein halves are necessary for function (Fig. S6E). The PA-Cre-W and TamPA-Cre.sup.+ CAR Reporter Jurkat T lines were protected from light whenever possible during cell line development and culture to minimize potential ambient light-driven background recombination.
[0181] In order to preemptively address reported blue light phototoxicity concerns in T cells,.sup.40 we further reduced the total amount of blue light stimulation time from 3 h in Protocol B to 2 h in Protocol E (5 W/m2, 5 s per min, 24 h,
[0182] Following Protocol E with 24 h of blue light stimulation, the percentage of TamPA-Cre.sup.+ CAR Reporter Jurkat T cells expressing myc-α-CD38 Receptor and α-CD19 CAR-EGFP was tracked over several days (
[0183] An exemplary nucleic acid sequence for an exemplary EF1α promoter is:
TABLE-US-00007 (SEQ ID NO: 7) Ggctccggtgcccgtcagtgggcagagcgcacatcg cccacagtccccgagaagttggggggaggggtcgg caattgaaccggtgcctagagaaggtggcgcgggt aaactgggaaagtgatgtcgtgtactggctccgcc tttttcccgagggtgggggagaaccgtatataagt gcagtagcgccgtgaacgttctttttcgcaacggg tttgccgccagaaacacaggtaagtgccgtgtgtg gttcccgcgggccttggcctctttacgggttatgg cccttgcgtgccttgaattacttccacctggctgc agtacgtgattcttgatcccgagcttcgggttgga agtgggtgggagagttcgaggccttgcgcttaagg agccccttcgcctcgtgcttgagttgaaggcctgg cctgggcgctggggccgccgccgcgtgcgaatctg gtggcaccttcgcgcctgtctcgctgctttcgata agtctctagccatttaaaatttttgatgacctgct gcgacgctttttttctggcaagatagtcttgtaaa tgcgggccaagatctgcacactggtatttcggttt ttggggccgcgggcggcgacggggcccgtgcgtcc cagcgcacatgttcggtgaggcggggcctgcgagc gcggccaccgagaatcggacgggggtagtctcaag ctggccggcctgctctggtgcctggcctcgcgccg ccgtgtatcgccccgccctgggcggcaaggctggc ccggtcggcaccagttgcgtgagcggaaagatggc cgcttcccggccctgctgcagggagctcaaaatgg aggacgcgggcgctcgggagagcgggcgggtgagt cacccacacaaaggaaaagggcctttccgtcctca gccgtcgcttcatgtgactccacggagtaccgggc gccgtccaggcacctcgattagttctcgagctttt ggagtacgtcgtcttaggttggggggaggggtttt atgcgatggagttccccacactgagtgggtggaga ctgaagttaggccagcttggcacttgatgtgtaat tctccttggaatttgcccttttgagtttggatctt ggttcattctcaagcctcagacagtggttcaaagt ttttttcttccatttcaggtgtcgtga
[0184] An exemplary nucleic acid sequence for an exemplary myc-α-CD38-Receptor is:
TABLE-US-00008 (SEQ ID NO: 8) Atggagtttggactgagctggttgttcctcgtagc tattctgaagggcgttcagtgctctgagcaaaagt tgatctcagaagaggacctggacatccagttgacc cagagtagctcctccttctctgtgagcctgggaga tcgggtgactattacctgtaaagcgtctgaagata tttacaaccgcctggcgtggtaccagcagaaacca ggaaacgccccaagacttctcatatctggagccac tagccttgaaactggcgtaccctcccgattttccg ggtccggaagtggcaaagattataccctctccatt acctctcttcagacggaggacgtggcaacatacta ttgtcaacagtactggtctacacctacctttggtg ggggaaccaagctggaaatcaagagggccgatgcc gctcccactgtttcaatcttcccaccctctggcgg cggcgggagcggcggtggtggcagcgggggtggtg ggtccggaggtggggggtcacaggtccagctgaag caaagcggccctagtctcgtccagccctcacaaag actgtccatcacctgtaccgtcagcggcttttctc tgatcagctatggagtccattgggtgaggcaatct cctggaaagggactggaatggctgggggtgatctg gaggggcgggtccaccgattacaacgccgcattca tgtcacgcctgtccatcactaaagacaactccaaa tctcaagtgttctttaaaatgaactccctgcaggc tgatgacaccgctatctacttctgtgcaaaaacgc tgataactacgggttacgccatggattactggggc cagggtacctccgtcaccgttagctctGCCGC AGCTATCGAGGTCATGTACCCGCCACCCTATCT CGATAACGAAAAATCCAACGGGACAATCATACACG TAAAGGGCAAGCATTTGTGCCCCTCCCCTTTGTTC CCAGGGCCGTCAAAACCATTCTGGGTCTTGGTAGT CGTAGGAGGTGTGCTTGCTTGTTACTCACTGTTGG TTACTCTTGCGTTCATAATCTTTTGGGTGCGGTCA AAACGCTCC
[0185] An exemplary nucleic acid sequence for an exemplary α-CD19CAR-EGFP is:
TABLE-US-00009 (SEQ ID NO: 9) ATGGCTCTCCCAGTGACTGCCCTACTGCTTCCCCT AGCGCTTCTCCTGCATGCAGAGGTGAAGCTGCAGC AGTCTGGGGCTGAGCTGGTGAGGCCTGGGTCCTCA GTGAAGATTTCCTGCAAGGCTTCTGGCTATGCATT CAGTAGCTACTGGATGAACTGGGTGAAGCAGAGGC CTGGACAGGGTCTTGAGTGGATTGGACAGATTTAT CCTGGAGATGGTGATACTAACTACAATGGAAAGTT CAAGGGTCAAGCCACACTGACTGCAGACAAATCCT CCAGCACAGCCTACATGCAGCTCAGCGGCCTAACA TCTGAGGACTCTGCGGTCTATTTCTGTGCAAGAAA GACCATTAGTTCGGTAGTAGATTTCTACTTTGACT ACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCA GGTGGAGGTGGATCAGGTGGAGGTGGATCTGGTGG AGGTGGATCTGACATTGAGCTCACCCAGTCTCCAA AATTCATGTCCACATCAGTAGGAGACAGGGTCAGC GTCACCTGCAAGGCCAGTCAGAATGTGGGTACTAA TGTAGCTGGTATCAACAGAAACCAGGACAATCTCC TAAACCACTGATTTACTCGGCAACCTACCGGAACA GTGGAGTCCCTGATCGCTTCACAGGCAGTGCATCT GGGACAGATTTCACTCTCACCATCACTAACGTGCA GTCTAAAGACTTGGCAGAaATTTCTGTCAACAATA TAACAGGTATCCGTACACGTCCGGAGGGGGGACCA AGGCTGGAGATCAAACGGGCGGCCGCAattgaagt tatgtatcctccttacctagacaatgagaagagca atggaaccattatccatgtgaaagggaaacacctt tgtccaagtcccctatttcccggaccttctaagcc cttttgggtgctggtggtggttggtggagtcctgg cttgctatagcttgctagtaacagtggcctttatt attttctgggtgaggagtaagaggagcaggctcct gcacagtgactacatgaacatgactccccgccgcc ccgggcccacccgcaagcattaccagccctatgcc ccaccacgcgacttcgcagcctatcgctccCGTTT CTCTGTTGTTAAACGGGGCAGAAAGAACCTCCTGT ATATATTCAAACAACCATTTATGAGACCAGTACAA ACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATT TCCAGAAGAAGAAGAAGGAGGATGTGAACTGCTTT ACTGCAACCACAGAGTGAAGTTCAGCAGGAGCGCA GAGCCCCCCGCGTACCAGCAGGGCCAGAACCAGCT CTATAACGAGCTCAATCTAGGACGAAGAGAGGAGT ACGATGTTTTGGACAAGAGACGTGGCCGGGACCCT GAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCA GGAAGGCCTGTACAATGAACTGCAGAAAGATAAGA TGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGC GAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTA CCAGGGTCTCAGTACAGCCACCAAGGACACCTACG ACGCCCTTCACATGCAGGCCCTGCCCCCTCGCGGT GGAAGTGGCGGTACCATGGTGAGCAAGGGCGAGGA GCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGC TGGACGGCGACGTAAACGGCCACAAGTTCAGCGTG TCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAA .GCTGACCCTGAAGTTCATCTGCACCACCGGCAAC TCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCC TGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCC GACCACATGAAGCAGCACGACTTCTTCAAGTCCGC CATGCCCGAAGGCTACGTCCAGGAGCGCACCATCT TCTTCAAGGACGACGGCAACTACAAGACCCGCGCC GAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCG CATCGAGCTGAAGGGCATCGACTTCAAGGAGGACG GCAACATCCTGGGGGCACAAGCTGGAGTACAACTA CAACAGCCACAACGTCTATATCATGGCCGACAAGC AGAAGAACGGCATCAAGGTGAACTTCAAGATCCGC CACAACATCGAGGACGGCAGCGTGCAGCTCGCCGA CCACTACCAGCAGAACACCCCCATCGGCGACGGGC CCGTGCTGCTGCCCGACAACCACTACCTGAGCACC CAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCG CGATCACATGGTCCTGCTGGAGTTCGTGACCGCCG CCGGGATCACTCTCGGCATGGACGAGCTGTACAAG
[0186] An exemplary nucleic acid sequence for an exemplary CAR Reporter (EF1α promoter-LoxP-myc-α-CD30-Receptor-LoxP-α-CD19CAR-EGFP) is:
TABLE-US-00010 (SEQ ID NO: 10) ggctccggtgcccgtcagtgggcagagcgcacatc gcccacagtccccgagaagttggggggaggggtcg gcaattgaaccggtgcctagagaaggtggcgcggg gtaaactgggaaagtgatgtcgtgtactggctccg cctttttcccgagggtgggggagaaccgtatataa gtgcagtagtcgccgtgaacgttctttttcgcaac gggtttgccgccagaacacaggtaagtgccgtgtg tggttcccgcgggcctggcctctttacgggttatg gcccttgcgtgccttgaattacttccacctggctg cagtacgtgattcttgatcccgagcttcgggttgg aagtgggtgggagagttcgaggccttgcgcttaag gagccccttcgcctcgtgcttgagttgaggcctgg cctgggcgctggggccgccgcgtgcgaatctggtg gcaccttcgcgcctgtctcgctgctttcgataagt ctcagccatttaaaattttgatgacctgctgcgac gcttttttctggcaagatagtcttgtaaatgcggg ccaagatctgcacactggtatttcggtttttgggg ccgcgggcggcgacggggcccgtgcgtcccagcgc acatgttcggcgaggcggggcctgcgagcgcggcc accgagaatcggacgggggtagtctcaagctggcc ggcctgctctggtgcctggcctcgcgccgccgtgt atcgccccgccctgggcggcaaggctggcccggtc ggcaccagttgcgtgagcggaaagatggccgcttc ccggcctgctgcagggagctcaaaatggaggacgc ggcgctcgggagagcgggcgggtgagtcacccaca caaaggaaaagggcctttccgtcctcagccgtcgc ttcatgtgactccacggagtaccgggcgccgtcca ggcacctcgattagttctcgaagcttttggagtac gtcgtcttaggttggggggaggggttttatgcgat ggagtttccccacactgagtgggtggagactgaag ttaggccagcttggcacttgatgtaattctccttg gaattgcccttttgagtttggatcttggttcattc tcaagcctcagacagtggttcaaagtttttttctt ccatttcaggtgtcgtgaggaattgatccttcgaa ctagtttctgcagtcgacCGGATTATAACTTCGTA TAGCATACATTATACGAAGTTATAATTCTGCAGAT ATCCAGCACAGTGGCGGCCACCatggagtttggac tgagctggttgttcctcgtagctattctgaagggc gttcagtgctctgagcaaaagttgatctcagaaga ggacctggacatccagttgacccagagtagctcct ccttctctgtgagcctgggagatcgggtgact&tt acetgtaaagcgtctgaagatatttacaacegcct ggcgtggtaccagc&gaaaccaggaaacgccccaa gacttctcatatctggagccactagccttgaaact ggcgtaccctcccgattttccgggtccggaagtgg caaagtggggggaaccaagctggaaatcaagaggg ccgatgccgctcccactgtttcaatcttcccaccc tctggcggcggcgggagcggcggtggtggcagcgg gggtggtgggtccggaggtggggggtcacaggtcc agtagaagcaaagcggccctagtctcgtccagccc tcacaaagactgtccatcacctgtaccgtcagcgg cttttctctgatcagctatggagtccattgggtga ggcaatctcctggaaagggactggaatggctgggg gtgatctggaggggcgggtccaccgattacaacgc cgcattcatgtcacgcctgtccatcactaaagaca actccaaatctcaagtgttctttaaaatgaactcc ctgcaggctgatgacaccgctatctacttctgtgc aaaaacgctgataactacgggttacgecatggatt actggggccagggtacctccgtcaccgttagctct GCCGCAGCTATCGAGGTCATGTACCCGCCACCCTA TCTCGATAACGAAAAATCCAACGGGACAATCATAC ACGTAAAGGGCAAGCATTTGTGCCCCTCCCCTTTG TTCCCAGGGCCGTCAAAACCATTCTGGGTCTTGGT AGTCGTAGGAGGTGTGCTTGCTTGTTACTCACTGT TGGTTACTGTTGCGTTCATAATCTTTTGGGTGCGG TCAAAACGCTCCtgataagctagcTGAATAAGGCC GCTCGAATAACTTCGTATAGCATACATTATACGAA GtTAXGTTTcgggAATTCGATGGCTCTCCCAGTGA CTGCCCTACTGCTTCCCCTAGCGCTTCTCCTGCAT GCAGAGGTGAAGCTGCAGCAGTCTGGGGCTGAGCT GGTGAGGCCTGGGTCCTCAGTGAAGATTTCCTGGA AGGCTTCTGGCTATGCATTCAGTAGCTACTGGATG AACTGGGTGAAGCAGAGGCCTGGACAGGGTCTTGA GTGGATTGGACAGATTTATCCTGGAGATGGTGATA CTAACTACAATGGAAAGTTCAAGGGTCAAGCCACA CTGACTGCAGACAAATCCTCCAGCACAGCCTACAT GGAGCTCAGCGGCCTAACATCTGAGGACTCTGCGG TCTATTTCTGTGCAAGAAAGACCATTAGTTCGGTA GTAGATTTCTACTTTGACTACTGGGGCCAAGGACC ACGGTCACCGTCTCCTCAGGTGGAGGTGGATCAGG TGGAGGTGGATCTGGTGGAGGTGGATCTGACATTG AGCTCACCCAGTCTCCAAAATTCATGTCCACATCA GTAGGAGACAGGGTCAGCGTCACCTGCAAGGCCAG TCAGAATGTGGGTACTAATGTAGCCTGGTATCAAC AGAAACCAGGACAATCTCCTAAACCACTGATTTAC TCGGCAACCTACCGGAACAGTGGAGTCCCTGATCG CTTCACAGGCAGTGGATGTGGGACAGATTTCACTC TCAGGATCACTAACGTGCAGTCTAAAGACTTGGCA GACTATTTCTGTCAACAATATAACAGGTATCCGTA CACGTCCGGAGGGGGGACCAAGCTGGAGATCAAAC GGGCGGCCGCAattgaagttatgtatcctcctcct tacctagacaatgagaagagcaatggaaccattat ccatgtgaaagggaaacacctttgtccaagtcccc tatttcccggaccttctaagcccttttgggtgctg gtggtggttggtggagtcctggcttgctatagctt gctagtaacagtggcctttattattttctgggtga ggagtaagaggagcaggctcctgcacagtgactac atgaacatgactccccgccgccccgggcccacccg caagcattaccagccctatgccccaccacgcgact tcgcagcctatcgctccCGTTTCTCTGTTGTTAAA CGGGGCAGAAAAGAAGCTCCTGTATATATTCAAAC AACCATTTATGAGACCAGTACAAACTACTCAAGAG GAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGA AGAAGGAGGATGTGAACTGCTTTACTGCAACCACA GAGTGAAGTTCAGCAGGAGCGCAGAGCCCCCCGCG TACCAGCAGGGCCAGAACCAGCTCTATAACGAGCT CAATCTAGGACGAAGAGAGGAGTACGATGTTTTGG ACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGA AAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTA CAATGAACTGCAGAAAGATAAGATGGCGGAGGCCT ACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGG GGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAG TACAGCCACCAAGGACACCTACGACGCCCTTCACA TGCAGGCCCTGCCCCCTCGCGGTGGAAGTGGCGGT ACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGG GGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACG TAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGC GAGGGCGATGCCACCTACGGCAAGCTGACCCTGAA GTTCATCTGCACCACCGGCAAGCTGCCCCGTGCCC TGGCCCACCCTCGTGACCACCCTGACCTACGGCGT GCAGTGCTTCAGCCGCTACCCCGACCACATGAAGC AGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGC TACGTCCAGGAGCGCACCATCTTCTTCAAGGACGA CGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCG AGGGCGACAGGGTGGTGAACCGCATCGAGCTGAAG GGCATCGACTTCAAGGAGGACGGCAACATCCTGGG GCACAAGCTGGAGTACAACTACAACAGCCACAACG TCTATATCATGGCCGACAAGCAGAAGAACGGCATC AAGGTGAACTTCAAGATCCGCCACAACATCGAGGA CGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGA ACACCCCATCGGCGACGGCCCCGTGCTGCTGCCCG ACAACCACTACCTGAGCACCCAGTCCGCCCTGAGC AAAGACCCCAACGAGAAGCGCGATCACATGGTCCT GCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCG GCATGGACGAGCTGTACAAGtaatag
[0187] In alternative embodiments, although the exemplary construct uses the linkers:
TABLE-US-00011 (SEQ ID NO: 11) tgataagctagc, and, (SEQ ID NO: 12) GTTTcgggAATTCG
[0188] any linker known in the art can be used in place of SEQ ID NO:11 or SEQ ID NO:12, there is no specific minimum or maximum length for a linker that can be used in constructs as provided herein, and there is no specific sequence or structural requirement for any linker that can be used in this or any construct as provided herein.
[0189] In alternative embodiments, although the exemplary construct uses the stop codon cassette sequence: TGAATAAGGCCGCTCGA (SEQ ID NO:13), alternative stop codon cassettes can be used, for example, codons or cassettes that comprise TAA, TAG or TGA stop codons.
[0190] In alternative embodiments, although the exemplary construct comprises use of the two stop codons taatag at the end of the construct's sequence (to signal the termination of the translation process of the encoded protein), any stop codon cassette comprising taa or tga or tag can be used; for example, in alternative embodiments, equivalent sequences for tatag can be any two combination of taa or tga or tag, for example, such as taataa, taatga, and/or taatag.
TamPA-Cre Drives CAR-Mediated T Cell Activation
[0191] In a head-to-head comparison, CAR Reporter Jurkat T cell lines expressing TamPA-Cre, PA-Cre-M, or neither (Reporter) were (Light) or were not (Dark) subjected to tamoxifen and/or blue light stimulation in accordance with Protocol E. Two days after the start of light stimulation, each group of cells either were (+Target) or were not (-Target) co-cultured for 24 h with an equal number of CD19.sup.+ Toledo Target cells. All groups were then analyzed 24 h later for the expression of α-CD19 CAR-EGFP and the early T cell activation marker CD69 via flow cytometry. The percentage of recombined CAR-EGFP.sup.+ cells and the percentage of activated CD69.sup.+ cells in each CAR Reporter Jurkat T cell group were normalized to maximal recombination calculated from the initial percentage of myc-α-CD38 Receptor.sup.+ cells capable of undergoing Cre-loxP recombination.
[0192] In a trend consistent with HEK293T experiments, light stimulation drove a significant 4.1-fold increase in the normalized percentage of recombined PA-Cre-M.sup.+ CAR Reporter Jurkat T cells (Light: 21.2±1.9%, Dark: 5.2±0.7%), whereas tamoxifen- and blue light-stimulated TamPA-Cre.sup.+ cells exhibited a robust 27.1-fold increase (Light+4-OHT: 52.4±1.5%, Dark+4-OHT: 1.9±0.5%,
[0193] While the suppression of partially-stimulated cells was not perfect, the TamPA-Cre system's high recombination efficiency upon complete stimulation makes it amenable to further means of suppression (for example lowering TamPA-Cre expression, additional gating, etc.) Moreover, exposing TamPA-Cre.sup.+ CAR Reporter Jurkat T cells to 48 h of ambient light did not drive any additional background recombination, unlike PA-Cre-M.sup.+ cells (Fig. S6F). Therefore, without tamoxifen stimulation, cells expressing the TamPA-Cre system are relatively safe from background CAR expression—a requirement for practical applications. As such, with robust and well-gated tamoxifen- and blue light-inducible CAR expression and T cell activation, the TamPA-Cre system proves to be an effective tool with which to control localized CAR-mediated T cell activation.
REFERENCES
[0194] 1. Wu, C. Y., et al., Remote control of therapeutic T cells through a small molecule-gated chimeric receptor. Science 2015, 350 (6258). [0195] 1. Wu, C. Y., et al., Remote control of therapeutic T cells through a small molecule-gated chimeric receptor. Science 2015, 350 (6258). [0196] 2. Kloss, C. C., et al., Combinatorial antigen recognition with balanced signaling promotes selective tumor eradication by engineered T cells. Nat Biotechnol 2013, 31 (1), 71-+. [0197] 3. Roybal, K. T., et al., Precision Tumor Recognition by T Cells With Combinatorial Antigen-Sensing Circuits. Cell 2016, 164 (4), 770-9. [0198] 4. Taslimi, A., et al., Optimized second-generation CRY2-CIB dimerizers and photoactivatable Cre recombinase. Nat Chem Biol 2016, 12 (6), 425-30. [0199] 5. Kawano, F., et al., A photoactivatable Cre-loxP recombination system for optogenetic genome engineering. Nat Chem Biol 2016, 12 (12), 1059-+. [0200] 6. Komatsubara, A. T.; Matsuda, M.; Aoki, K., Quantitative analysis of recombination between YFP and CFP genes of FRET biosensors introduced by lentiviral or retroviral gene transfer. Sci Rep 2015, 5, 13283. [0201] 7. Kawano, F.; Suzuki, H.; Furuya, A.; Sato, M., Engineered pairs of distinct photoswitches for optogenetic control of cellular proteins. Nat Commun 2015, 6, 6256. [0202] 8. Cho, J. H.; Collins, J. J.; Wong, W. W., Universal Chimeric Antigen Receptors for Multiplexed and Logical Control of T Cell Responses. Cell 2018. [0203] 9. Di Stasi, A.; Tey, S. K.; Dotti, G.; Fujita, Y.; Kennedy-Nasser, A.; Martinez, C.; Straathof, K.; et al., Inducible Apoptosis as a Safety Switch for Adoptive Cell Therapy. New Engl J Med 2011, 365 (18), 1673-1683. [0204] 10. Gargett, T.; Brown, M. P., The inducible caspase-9 suicide gene system as a “safety switch” to limit on-target, off-tumor toxicities of chimeric antigen receptor T cells. Front Pharmacol 2014, 5, 235. [0205] 11. Fedorov, V. D.; et al., PD-1-and CTLA-4-Based Inhibitory Chimeric Antigen Receptors (iCARs) Divert Off-Target Immunotherapy Responses. Sci Transl Med 2013, 5 (215). [0206] 12. Eyquem, J.; et al., Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature 2017, 543 (7643), 113-117. [0207] 13. Kristianto, J., et al., Spontaneous recombinase activity of Cre-ERT2 in vivo. Transgenic Res 2017, 26 (3), 411-417. [0208] 14. Niopek, D., et al., Engineering light-inducible nuclear localization signals for precise spatiotemporal control of protein dynamics in living cells. Nature Communications 2014, 5. [0209] 15. Feil, R.; Wagner, J.; Metzger, D.; Chambon, P., Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem Bioph Res Co 1997, 237 (3), 752-757. [0210] 16. Hirrlinger, J.; et al., Split-CreERT2: Temporal Control of DNA Recombination Mediated by Split-Cre Protein Fragment Complementation. Plos One 2009, 4 (12). [0211] 17. Besser, S., et al., Split-Cre and Split-Creert2: Versatile Genetic Coincidence Detectors for Precise Analysis of Cell Populations in Vivo. Glia 2011, 59, S100-S100. [0212] 18. Feil, S.; Valtcheva, N.; Feil, R., Inducible Cre mice. Methods Mol Blot 2009, 530, 343-63. [0213] 19. Sinha, D. K.; et al., Photocontrol of protein activity in cultured cells and zebrafish with one- and two-photon illumination. Chembiochem 2010, 11 (5), 653-63. [0214] 20. Casanova, E.; et al., ER-based double iCre fusion protein allows partial recombination in forebrain. Genesis 2002, 34 (3), 208-14. [0215] 21. Drent, E., et al., Pre-clinical evaluation of CD38 chimeric antigen receptor engineered T cells for the treatment of multiple myeloma. Haematologica 2016, 101 (5), 616-25. [0216] 22. Phototoxicity revisited. Nat Methods 2018, 15 (10), 751.
[0217] A number of embodiments of the invention have been described. Nevertheless, it can be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.