BROADLY PROTECTIVE BOVINE PARAINFLUENZA 3 VIRUS AND BOVINE VIRAL DIARRHEA VIRUS VACCINE

Abstract

A vector comprising a BPI3Vc backbone and at least one antigenic insert sequence from a pathogen other than BPI3V is provided. The vector is configured to provide protection against BPI3V as well as against the pathogen from which the insert sequence was obtained.

Claims

1. A vector comprising a Bovine Parainfluenza 3 Virus Type c (BPI3Vc) backbone and at least one antigenic insert sequence from a pathogen other than BPI3V.

2. The vector of claim 1, wherein the vector has at least 80% sequence homology with an isolate selected from the group consisting of KJ647285.1, KJ647287.1, HQ530153.1, KT071671.1, JX969001.1, and LC000638.1.

3. The vector of claim 2, wherein the vector is a mosaic of a combination of these BPI3Vc isolates.

4. The vector of claim 1, wherein the antigenic insert from a pathogen other than BPI3V is from a disease-causing organism.

5. The vector of claim 1, wherein the antigenic insert from a pathogen other than BPI3V is from BVDV.

6. The vector of claim 5, wherein the antigenic insert from BVDV is at least one subunit of BVDV.

7. The vector of claim 5, wherein the antigenic insert from BVDV is selected from the group consisting of F, HN2, NS2, NS3, NS4, NS5, E2, or any combination thereof.

8. The vector of claim 1, wherein the vector has at least 90% sequence homology with SEQ ID NO. 1.

9. The vector of claim 1, wherein the antigenic insert comprises a nucleotide sequence encoding a sequence having at least 90% sequence homology with a sequence selected from the group consisting of 2, 3, 114, 115, 116, and any combination thereof.

10. The vector of claim 1, wherein the antigenic insert comprises a nucleotide sequence encoding a sequence having at least 90% sequence homology with a sequence selected from the group consisting of 2, 3, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 72, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, or any combination thereof.

11. A method of reducing the incidence of or severity of infection associated with bovine parainfluenza comprising the step of administering the vector of claim 1 to an animal in need thereof.

12. The method of claim 11, wherein administration of the vector also reduces the incidence of or severity of infection associated with at least one additional pathogen that is not bovine parainfluenza.

13. The method of claim 11, wherein the at least one additional pathogen includes BVDV.

14. The method of claim 11, wherein the vector is administered systemically.

15. The method of claim 11, wherein the antigenic insert of the vector comprises a nucleotide sequence encoding a sequence having at least 90% sequence homology with a sequence selected from the group consisting of 2, 3, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 72, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, or any combination thereof.

16. The method of claim 11, wherein the vector has at least 80% sequence homology with an isolate selected from the group consisting of KJ647285.1, KJ647287.1, HQ530153.1, KT071671.1, JX969001.1, and LC000638.1.

17. The method of claim 16, wherein the vector is a mosaic of a combination of these BPI3Vc isolates.

18. The method of claim 11, wherein the antigenic insert is from BVDV and is selected from the group consisting of F, HN2, NS2, NS3, NS4, NS5, E2, or any combination thereof.

19. The method of claim 11, wherein the vector has at least 90% sequence homology with SEQ ID NO. 1.

20. The method of claim 11, wherein the antigenic insert comprises a nucleotide sequence encoding a sequence having at least 90% sequence homology with a sequence selected from the group consisting of 2, 3, 114, 115, 116, and any combination thereof.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0033] FIG. 1 is a representation of the nucleic acid sequence (SEQ ID NO. 1) of a vector in accordance with the disclosure;

[0034] FIG. 2 is a schematic of the vector of the disclosure;

[0035] FIG. 3A is a representation of the novel mosaic fusion [F] polypeptide (SEQ ID NO. 2) generated from 62 currently sequenced BPI3V genotypes A, B, and C (polypeptide sequences are from Amino to carboxyl terminus);

[0036] FIG. 3B is a representation of the novel mosaic hemagglutinin-neuraminidase [HN] polypeptide (SEQ ID NO. 3) generated from 62 currently sequenced BPI3V genotypes A, B, and C (polypeptide sequences are from Amino to carboxyl terminus);

[0037] FIG. 4 is a schematic of an optimized T7 promoter;

[0038] FIG. 5 is a photograph of an attenuated BPI3Vc-E2.sup.b virus expressing the E2.sup.b transgene;

[0039] FIG. 6A is a photograph of a BVDV E2.sup.b transgene by BPI3Vc-E2.sup.b virus on a cell surface using anti-FLAG monoclonal antibody;

[0040] FIG. 6B is a photograph of a BVDV E2.sup.b transgene by BPI3Vc-E2.sup.b virus on a cell surface using BPI3V polyclonal antibody (detects expression of BPI3Vc antigens);

[0041] FIG. 6C is a photograph of a BVDV E2.sup.b transgene by BPI3Vc-E2.sup.b virus on a cell surface using BVDV Type 1&2 monoclonal antibody (mAb 348) against E2;

[0042] FIG. 6D is a photograph of a BVDV E2.sup.b transgene by BPI3Vc-E2.sup.b virus on a cell surface of an uninfected negative control;

[0043] FIG. 7A is a photograph illustrating the expression and authenticity of FLAG-tagged mosaic novel fusion [F2] and HIS-tagged Hemagglutinin-Neuraminidase [HN2] proteins evaluated by immunocytometric analysis of HEK-293A cells transfected with plasmid constructs and probed with Anti-FLAG monoclonal antibody to detect the FLAG-tagged Fusion protein;

[0044] FIG. 7B is a photograph illustrating the expression and authenticity of FLAG-tagged mosaic novel fusion [F2] and HIS-tagged Hemagglutinin-Neuraminidase [HN2] proteins evaluated by immunocytometric analysis of HEK-293A cells transfected with plasmid constructs and probed with anti-HIS monoclonal antibody to detect the HIS-tagged Hemagglutinin-Neuraminidase protein;

[0045] FIG. 7C is a photograph illustrating the expression and authenticity of FLAG-tagged mosaic novel fusion [F2] and HIS-tagged Hemagglutinin-Neuraminidase [HN2] proteins evaluated by immunocytometric analysis of HEK-293A cells transfected with plasmid constructs and probed with) BPI3V polyclonal antibody; and

[0046] FIG. 7D is a photograph illustrating the expression and authenticity of FLAG-tagged mosaic novel fusion [F2] and HIS-tagged Hemagglutinin-Neuraminidase [HN2] proteins evaluated by immunocytometric analysis of HEK-293A cells transfected with plasmid constructs and probed with pCDNA construct negative control.

[0047] FIG. 8A is a photograph illustrating protein expression by BPI3Vc-E2-NS2-3b virus. Rescued recombinant BPI3Vc-E2-NS2-3b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgene using Anti-FLAG mAb;

[0048] FIG. 8B is a photograph illustrating protein expression by BPI3Vc-E2-NS2-3b virus. Rescued recombinant BPI3Vc-E2-NS2-3b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgene using BPI3V reference serum;

[0049] FIG. 8C is a photograph illustrating protein expression by BPI3Vc-E2-NS2-3b virus. Rescued recombinant BPI3Vc-E2-NS2-3b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgene using BVDV E2-specific mAb 348;

[0050] FIG. 8D is a photograph illustrating protein expression by BPI3Vc-E2-NS2-3b virus. Rescued recombinant BPI3Vc-E2-NS2-3b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgene using uninfected negative control cells probed with the anti-BPI3V reference serum;

[0051] FIG. 9A is a photograph illustrating the validation of expression of rescued recombinant BPI3Vc-NS4-5.sup.1 virus. The virus was used to infect MDBK cells and at 72 hours post infection, immunocytometric analysis was used to validate expression of the transgene using Anti-FLAG mAb;

[0052] FIG. 9B is a photograph illustrating the validation of expression of rescued recombinant BPI3Vc-NS4-5.sup.1 virus. The virus was used to infect MDBK cells and at 72 hours post infection, immunocytometric analysis was used to validate expression of the transgene using BPI3V polyclonal reference antibody;

[0053] FIG. 9C is a photograph illustrating the validation of expression of rescued recombinant BPI3Vc-NS4-5.sup.1 virus. The virus was used to infect MDBK cells and at 72 hours post infection, immunocytometric analysis was used to validate expression of the transgene using Anti-BVDV polyclonal antibody;

[0054] FIG. 9D is a photograph illustrating the validation of expression of rescued recombinant BPI3Vc-NS4-5.sup.1 virus. The virus was used to infect MDBK cells and at 72 hours post infection, immunocytometric analysis was used to validate expression of the transgene using uninfected negative control cells probed with the anti-BPI3V reference serum;

[0055] FIG. 10A is a photograph illustrating protein expression by BPI3Vc-F2-HN2 virus. Rescued recombinant BPI3Vc-F2-HN2 virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgenes FLAG-tagged F2 protein using anti-FLAG mAb [probed unfixed cells to detect surface expression];

[0056] FIG. 10B is a photograph illustrating protein expression by BPI3Vc-F2-HN2 virus. Rescued recombinant BPI3Vc-F2-HN2 virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgenes His-tagged HN2 using anti-His mAb;

[0057] FIG. 10C is a photograph illustrating protein expression by BPI3Vc-F2-HN2 virus. Rescued recombinant BPI3Vc-F2-HN2 virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgenes authenticity of the BPI3Vc, F2, and HN2 proteins using the anti-BPI3V reference serum;

[0058] FIG. 10D is a photograph illustrating protein expression by BPI3Vc-F2-HN2 virus. Rescued recombinant BPI3Vc-F2-HN2 virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgenes of uninfected negative control cells probed with the anti-BPI3V reference serum; and

[0059] FIG. 11 is a graph illustrating that BPI3Vc-F2HN2 virus is temperature sensitive.

DETAILED DESCRIPTION OF THE DISCLOSURE

[0060] This written description uses examples to describe the disclosure, including the best mode, and also to enable any person skilled in the art to practice the disclosure, including making and using any devices or systems and performing any incorporated methods. The patentable scope of the disclosure is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.

Example 1

[0061] This example generates a BPI3Vc backbone for use as a vector and for delivery and/or expression of antigens in an animal in need thereof.

[0062] The BPI3V Genotype C strain TVMDL16 was used as a vaccine strain and vector expressing BVDV E2 antigen.

[0063] Fully sequenced complete BPI3V genomes in the US were retrieved from NCBI and aligned. They cluster into 3 main clades representing Genotype A, B, and C, which is consistent with previous reports. The NC 002161.1 BPI3V complete genome, AF 178654.1 BPI3V strain Kansas/15626/84 complete genome, AF 178655.1 BPI3V Shipping Fever complete genome, KJ647288.1 BPI3V isolate TVMDL24 complete genome, and KJ647289.1 BPI3V isolate TVMDL60 complete genome were identified as belong to genotype A. The KJ647284.1 BPI3V isolate TVMDL15 complete genome, KP764763.1 BPI3V strain TtPIV-1 complete genome, and KJ647286.1 BPI3V isolate TVMDL17 complete genome were identified as belonging to genotype B. The KJ647285.1 BPI3V isolate TVMDL16 complete genome and KJ647287.1 BPI3V isolate TVMDL20 complete genome were identified as belonging to genotype C.

[0064] The BPI3V Genotypes C TVMDL16 and TVMDL20, protein and nucleotide sequences for the following BPI3V Genotype C isolates in different parts of the world were aligned as shown in Table 1.

TABLE-US-00001 TABLE 1 Virus isolate Accession # Country Bovine parainfluenza virus 3 isolate TVMDL16, complete genome KJ647285.1 USA Bovine parainfluenza virus 3 isolate TVMDL20, complete genome KJ647287.1 USA Bovine parainfluenza virus 3 strain SD0835, complete genome HQ530153.1 China Bovine parainfluenza virus 3 isolate 12Q061, complete genome JX969001.1 S. Korea Bovine parainfluenza virus 3 strain NX49, complete genome KT071671.1 China Bovine parainfluenza virus 3 viral cRNA, complete genome, isolate: HS9 LC000638.1 Japan

[0065] Following alignment, regions where an amino acid from the TVMDL16 strain differed from the TVMDL20 strain were identified. This particular site was compared to the other four aligned sequences to determine the most dominant consensus as exemplified below in Table 2 for the phosphoprotein.

[0066] Amino Acid Alignment

TABLE-US-00002 TABLE 2 with SEQ ID NOS. 10-33, respectively. AHZ90090.1 phosphoprotein  Bovine respirovirus 3 [00001] AHZ90102.1 phosphoprotein  Bovine respirovirus 3 M E D N A Q N N Q I M D S W E E R S G D K S S D I S S A L D I I E F I L S T D ADQ43752.1 phosphoprotein  P Bovine respirovirus 3 [00002] AGA95117.1 phosphoprotein  Bovine respirovirus 3 [00003] ALS45554.1 phosphoprotein  Bovine respirovirus 3 [00004] BAP75929.1 phosphoprotein  P Bovine respirovirus 3 [00005] AHZ90090.1 phosphoprotein  Bovine respirovirus 3 [00006] AHZ90102.1 phosphoprotein  Bovine respirovirus 3 N Q E A I Q G R N G R G S S S D S R T E T L V I R R I T G G S S D P D N G T E ADQ43752.1 phosphoprotein  P Bovine respirovirus 3 [00007] AGA96117.1 phosphoprotein  Bovine respirovirus 3 [00008] ALS46554.1 phosphoprotein  Bovine respirovirus 3 [00009] BAP75929.1 phosphoprotein  P Bovine respirovirus 3 [00010] AHZ90090.1 phosphoprotein  Bovine respirovirus 3 [00011] AHZ90102.1 phosphoprotein  Bovine respirovirus 3 R H T S L V T T A T P D D E E E L I L K N K R S K R H Q L T N Q R D N K E I K ADQ43752.1 phosphoprotein  P Bovine respirovirus 3 [00012] AGA95117.1 phosphoprotein  Bovine respirovirus 3 [00013] ALS45554.1 phosphoprotein  Bovine respirovirus 3 [00014] BAP75929.1 phosphoprotein  P Bovine respirovirus 3 [00015] AHZ90090.1 phosphoprotein  Bovine respirovirus 3 [00016] AHZ90102.1 phosphoprotein  Bovine respirovirus 3 I L N N K N S N R E E Q T V R N P Q R S A Y G Q K Q T M V S D R S A P E Q P V ADQ43752.1 phosphoprotein  P Bovine respirovirus 3 [00017] AGA96117.1 phosphoprotein  Bovine respirovirus 3 [00018] ALS46554.1 phosphoprotein  Bovine respirovirus 3 [00019] BAP75929.1 phosphoprotein  P Bovine respirovirus 3 [00020] [00021]

[0067] Nucleotide alignment is shown below in Table 3 which includes SEQ ID NOS. 34-57, respectively.

TABLE-US-00003 TABLE 3 KJ847285.1 Bovine parainfluenza virus 3 isolate TVMDL18 complete genome [00022] KJ847287.1 Bovine parainfluenza virus 3 isolate TVMDL20 complete genome A C T T C A A A G G A T C G A A G A G G A G C C A G A G HQ530153.1 Bovine parainfluenza virus 3 strain SD0835 complete genome [00023] JX969001.1 Bovine parainfluenza virus 3 isolate 12Q081 complete genome [00024] KJ071  71.1 Bovine parainfluenza virus 3 strain N  49 complete genome [00025] LC000838.1 Bovine parainfluenza virus 3 viral cRNA complete genome isolate H  [00026] KJ847285.1 Bovine parainfluenza virus 3 isolate TVMDL18 complete genome [00027] KJ847287.1 Bovine parainfluenza virus 3 isolate TVMDL20 complete genome C A T C C T G G A A C A T C C T C A A C A A C A A G A A HQ530153.1 Bovine parainfluenza virus 3 strain SD0835 complete genome [00028] JX969001.1 Bovine parainfluenza virus 3 isolate 12Q081 complete genome [00029] KJ071  71.1 Bovine parainfluenza virus 3 strain N  49 complete genome [00030] LC000838.1 Bovine parainfluenza virus 3 viral cRNA complete genome isolate H  [00031] KJ847285.1 Bovine parainfluenza virus 3 isolate TVMDL18 complete genome [00032] KJ847287.1 Bovine parainfluenza virus 3 isolate TVMDL20 complete genome C A G A C A G A T C A G C T C C C G A A C A A C C A G T HQ530153.1 Bovine parainfluenza virus 3 strain SD0835 complete genome [00033] JX969001.1 Bovine parainfluenza virus 3 isolate 12Q081 complete genome [00034] KJ071  71.1 Bovine parainfluenza virus 3 strain N  49 complete genome [00035] LC000838.1 Bovine parainfluenza virus 3 viral cRNA complete genome isolate H  [00036] KJ847285.1 Bovine parainfluenza virus 3 isolate TVMDL18 complete genome [00037] KJ847287.1 Bovine parainfluenza virus 3 isolate TVMDL20 complete genome T T A C A T T A T T A C A G A A T C T T G G T G T A A T HQ530153.1 Bovine parainfluenza virus 3 strain SD0835 complete genome [00038] JX969001.1 Bovine parainfluenza virus 3 isolate 12Q081 complete genome [00039] KJ071  71.1 Bovine parainfluenza virus 3 strain N  49 complete genome [00040] LC000838.1 Bovine parainfluenza virus 3 viral cRNA complete genome isolate H [00041] indicates data missing or illegible when filed

[0068] Based on these alignments, the total number of TVMDL16 or TVMDL20 variable sites that were similar to the rest aligned sequences were added and results obtained as shown in Table 4 below:

TABLE-US-00004 TABLE 4 Protein/Nucleotide TVMDL16 TVMDL20 Nucleoprotein  0  2 Phosphoprotein  12  2 Matrix  0  0 Fusion  0  1 Hemagglutinin-neuraminidase  3  1 Large polymerase  7  5 Total  22 11 Nucleotide genome Total 104 73

[0069] Attenuating BPIV-3 TVMDL16 (Mutation “a”).

[0070] Attenuation based on mutations obtained from current vaccine strains: The selected BPI3Vc TVMDL16 genome was aligned together with BPI3V vaccine strains in use in the US, Shipping Fever strain and Kansas/15626/84, which are both Genotype A. Other published Genotypes A and C sequences were also included in order to identify specific sites which are conserved only for the US vaccine strains. Table 5 shows the genomes used in this alignment and Table 6 provides the alignment of SEQ ID NOS. 58-85, respectively.

TABLE-US-00005 TABLE 5 Virus isolate Accession # Country Genotype Bovine parainfluenza virus 3 strain NM09 from China, complete genome JQ063064.1 China A Bovine parainfluenza virus 3 DNA, complete genome D84095.1 Japan A Bovine parainfluenza virus 3 strain Shipping Fever, complete genome AF178655.1 US A Bovine parainfluenza virus 3 isolate TVMDL24, complete genome KJ647288.1 US A Bovine parainfluenza virus 3 isolate TVMDL60, complete genome KJ647289.1 US A Bovine parainfluenza virus 3 viral cRNA, complete genome, strain: BN-1 AB770484.1 Japan A Bovine parainfluenza virus 3 viral cRNA, complete genome, strain: BN-CE AB770485.1 Japan A Bovine parainfluenza virus 3 strain Kansas/15626/84, complete genome AF178654.1 US A Bovine parainfluenza virus 3 isolate TVMDL16, complete genome KJ647285.1 USA C Bovine parainfluenza virus 3 isolate TVMDL20, complete genome KJ647287.1 USA C Bovine parainfluenza virus 3 strain SD0835, complete genome HQ530153.1 China C Bovine parainfluenza virus 3 isolate 12Q061, complete genome JX969001.1 S. Korea C Bovine parainfluenza virus 3 strain NX49, complete genome KT071671.1 China C Bovine parainfluenza virus 3 viral cRNA, complete genome, isolate: HS9 LC000638.1 Japan C

[0071] Specific amino acids variable only for the vaccine strains in US but conserved across the Genotypes A and C were identified below in Table 6.

TABLE-US-00006 TABLE 6 AEU04137.1 phosphoprotein Bovine respirovirus 3 [00042] BAA12214.1 P protein Bovine respirovirus 3 [00043] AAF28261.1 phosphoprotein P Bovine respirovirus 3 [00044] AHZ90108.1 phosphoprotein Bovine respirovirus 3 [00045] AHZ90114.1 phosphoprotein Bovine respirovirus 3 [00046] BAM72618.1 phosphoprotein P Bovine respirovirus 3 [00047] BAM72624.1 phosphoprotein P Bovine respirovirus 3 [00048] AAF28255.1 phosphoprotein P Bovine respirovirus 3 [00049] AHZ90090.1 phosphoprotein Bovine respirovirus 3 [00050] AHZ90102.1 phosphoprotein Bovine respirovirus 3 [00051] ADQ43752.1 phosphoprotein P Bovine respirovirus 3 [00052] AGA96117.1 phosphoprotein Bovine respirovirus 3 [00053] ALS46554.1 phosphoprotein Bovine respirovirus 3 [00054] BAP75929.1 phosphoprotein P Bovine respirovirus 3 [00055]     105        115 AEU04137.1 phosphoprotein Bovine respirovirus 3 [00056] BAA12214.1 P protein Bovine respirovirus 3 [00057] AAF28261.1 phosphoprotein P Bovine respirovirus 3 [00058] AHZ90108.1 phosphoprotein Bovine respirovirus 3 [00059] AHZ90114.1 phosphoprotein Bovine respirovirus 3 [00060] BAM72618.1 phosphoprotein P Bovine respirovirus 3 [00061] BAM72624.1 phosphoprotein P Bovine respirovirus 3 [00062] AAF28255.1 phosphoprotein P Bovine respirovirus 3 [00063] AHZ90080.1 phosphoprotein Bovine respirovirus 3 [00064] AHZ90102.1 phosphoprotein Bovine respirovirus 3 [00065] ADQ43752.1 phosphoprotein P Bovine respirovirus 3 [00066] AGA96117.1 phosphoprotein Bovine respirovirus 3 [00067] ALS46554.1 phosphoprotein Bovine respirovirus 3 [00068] BAP75929.1 phosphoprotein P Bovine respirovirus 3 [00069] [00070]

[0072] A sample of these sites that formed the basis of creating exact mutations on the TVMDL16 strain to create a mutant BPI3V TVMDL16 is shown below in Table 7, which includes SEQ ID NOS. 86-100, respectively. The complete mutated sequence is provided in the sequence listing as SEQ ID NO. 1 and is shown in FIG. 1.

TABLE-US-00007 TABLE 7 C A A A A C A A C A G A A A C A A G C A A G G A A A A T A G T G G A C C A G C T A A C A A A A A T C G A C A G T T T G [00071] G A A A T C A A C A A A G A C A G G C G A G G A A A A T A G T G G A C C A A C T A A C G A A G A T C G A C A G C T T G A G A T A G A A A T G T T A A T C A G G A G A C T G T A C A G G G A G A A T A T A G G A G A G G A A G C A G C C C A G [00072] A G A T A G A G T T G T T A A T C A G G A A G C T G T A C A G A G A A G A A A T A G G A G A G G A A G C A G C C C A G A A T C T C C A G A A G C A G C C C A G A T C C T A A C A A T G G A A C C C A A A T C C A G G A A G A T A T T G A T T A A T C A C C G G A G G C A G C T C A G A T C C T G A C A A T G G A A C C G A A A T C C A G G A A A A T C T T G A T T A A T C A C C G G A G G C A G C T C A G A T C C T G A C A A T G G A A C C G A A A T C C A G G A A A A T C T T G A T T [00073] [00074] T A C T A A G G G G A A A G T G C G A C A A C T T G A  A A A T G T T C C A G T C A A G G T A C C A G G A A G T G A T G T G A T G A T G G A A G A G G C C T G G A A T C T A T C A G T A C A T T T G A T T C A G G A T A T A C C A G T A T A G T G A T G A T G G A G G A A G C C T G G A A T C T A T C A G T A C A C C T A A T C C A A G A C A T A C T A G C C T A G T G A T G A T G G A G G A G G C C T G G A A T C T A T C A G T A C A C C T A A T C C A A G A C A T A C T A G C C T A G indicates data missing or illegible when filed

[0073] Temperature sensitive attenuating mutation (mutation “b”). A distinct temperature sensitive single substitution in the polymerase gene, I 1103 V (change from Isoleucine to Valine in position 1103) was previously identified to cause temperature sensitive (ts) and attenuated phenotype in the reference Kansas/15626/84 vaccine strain. In this regard, this substitution was also made in some forms of the mutant BPI3V TVMDL16 genome at position 1103 from Isoleucine (ATA) to Valine (GTA).

[0074] The combination of mutation a and mutation b form a preferred form of the BPI3Vc vector platform shown below in Table 8, which includes SEQ ID NOS. 101-113, respectively.

TABLE-US-00008 TABLE 8 T G G T A T G T T G G A T A C A A C A A A A T C A C T A A T T C G A G T A G G G A T A A G C A G A G G A G G A T T A A C C T A T A A C T T A T T A A G A G G A A T G C T G G A C A C A A C A A A A T C G T T A A T T C G A G T A G G G A T A A A T C G A G G A G G G T T A A C T T A T A G T T T G T T A A G A G G A A T G C T G G A C A C A A C A A A A T C G T T A A T T C G A G T A G G G A T A A A T C G A G G A G G G T T A A C T T A T A G T T T G T T A A G A G G A A T G C T G G A C A C A A C A A A A T C G T T A A T T C G A G T A G G G A T A A A T C G A G G A G G G T T A A C T T A T A G T T T G T T A A G [00075] [00076] [00077] [00078] T A A G T A T G A A G A T A T G T G C T C A G T A G A C C T A G C C A T A T G A T T A A G A C A A A A A A T G T G G A T G G A T T T A T C A G G A G G A A A G T A T G A A G A C A T G T G C T C G G T A G A T C T A G C T A T C T C G T T A A G A C A A A A A A T G T G G A T G C A T T T A T C A G G A G G A A A G T A T G A A G A C A T G T G C T C G G T A G A T C T A G C T A T C T C G T T A A G A C A A A A A A T G T G G A T G C A T T T A T C A G G A G G A A A G T A T G A A G A C A T G T G C T G G G T A G A T C T A G C T A T C T C G T T A A G A C A A A A A A T G T G G A T G C A T T T A T C A G G A G G A A G A A T G A T A A A T G G A C T T G A A A C T C G A G A T C C T T T A G A G T T A C T G T C T G G A G T A A T A A T A A C A G G A T C T G A A C A indicates data missing or illegible when filed

[0075] The above mentioned modifications (a and b) created the ‘Mutant BPI3V TVMDL16 genome.

[0076] Design of a Vaccine Vector from Mutant BPIV3 TVMDL16 Genome.

[0077] Insert position and design: BPI3Va has previously been used as a vaccine vector for expressing foreign proteins of Human parainfluenza virus-3 and Respiratory syncytial virus, while being able to retain its infectivity and immunogenicity. The position of insertion in the parainfluenza virus genome determines the level of expression of gene of interest. Higher levels of expression are observed with inserts placed at closer to the 3′ end of the negative sense genome and level of expression decreases with downstream insert positions.

[0078] Mutant BPI3V TVMDL16 was therefore designed for the insertion to be placed closer to 3′ end of the genome, immediately downstream of the Nucleoprotein as illustrated in FIG. 2. As can be seen in FIG. 2, which provides the design of the BPI3Vc-E2.sup.b backbone, the BVDV E2.sup.b transgene is located between N and P, which has been shown to be suitable transgene insertion site for generation of recombinant BPI3V constructs. The green dots indicate location of attenuating mutations based on the current BPI3Va vaccine virus strain [Kansas/15626/84]. Specifically, I 1103 V mutation in the polymerase gene (L) is responsible for temperature sensitive [Ts mutant] attenuation.

[0079] With the intention of expressing the insertion sequence on the surface of the virus, the idea will be to mimic the assembly of the BPI3V Fusion protein. Hence a Fusion (F) gene start sequence, transmembrane, cytoplasmic domains flank the insertion sequence. PAM sites for possible exploration with CRISPR and restriction sites are placed as shown above in order to allow insertion of target genes

[0080] Optimized T7 Expression Promoter:

[0081] Reverse genetics system for rescue of negative stranded RNA Paramyxoviruses from plasmids employs the bacteriophage T7 RNA polymerase. This can be obtained in three ways (i) co-infecting cells with vaccinia virus expressing T7, transfecting cell lines that constitutively co-express T7, or (iii) co-transfecting cells with a plasmid expressing T7 polymerase. Rescue efficiency was demonstrated to be significantly increased by use of a T7 polymerase gene codon optimized for expression in mammalian cells (BSR-T7/5 cells) which also constitutively express T7 polymerase. In this case, the promoter sequence in the vector backbone is also respectively codon optimized in line with the optimized polymerase gene. Additionally, an autocatalytic hammerhead ribozyme sequence (Hh-Rbz) introduced downstream of the Optimal T7 promoter self-cleaves immediately before the start of the antigenome therefore ensuring that the rule of six is adhered to. The variable region at the start of the Hh-Rbz is the reverse complement of the start of the antigenome, while the constant region is fixed. The BPI3Vc vector was modified to have similar Optimal T7 promoter and Hh-Rbz as shown in the figure below. We also obtained the Optimized T7 polymerase gene in pCAGGSS (Plasmid #65974) deposited to Addgene by the authors and as shown in FIG. 4.

[0082] The entire modified BPI3Vc vector containing a codon-optimized gene encoding BVDV-Ib E2 mosaic antigen fused in-frame to FLAG tag was synthesized and cloned into pUC-SP (outsourced from Bio Basic, Canada) to generate a construct designated pUCBPI3Vc-E2.sup.b(insert sequence). Upon receipt of the synthesized product and conducting QC by restriction digest, the pUCBPI3Vc-E2.sup.b(insert sequence) was then used as a template to PCR virus rescue helper genes: i.e. the N gene, P gene, and L gene.

[0083] Cloning of Helper Plasmids.

[0084] Primers were designed to PCR the N, P, and L genes from the pUCBPI3Vc-E2.sup.b(insert sequence) construct. The Optimized T7 promoter region was included in the primer design in order to clone the genes in a suitable cloning vector and be able to increase the expression efficiency in the BSR-T7/5 cells while using the Optimized T7 polymerase gene. Using the same format for the codon optimized T7 expression of the vector, the variable region of each helper plasmid was designed according to its respective reverse complement of the start of its respective antigenome.

TABLE-US-00009 BPI3V N Fwd (SEQ ID NO. 4) 5′ GCGTCGACTAATACGACTCACTATAGGGAGAAACATCTGATGAGTCC GTGAGGACGAAACGGAGTCTAGACTCCGTCATGTTGAGTCTGTTTGATAC ATTCAGTGCACGCA 3′ BPI3V N Rev (SEQ ID NO. 5) 5′ GCAAGCTTTTAGCTACTTCCGAATGCGCTGAACAGGTC 3′ BPI3V P Fwd (SEQ ID NO. 6) 5′ GCGTCGACTAATACGACTCACTATAGGGAGATCCATCTGATGAGTCC GTGAGGACGAAACGGAGTCTAGACTCCGTCATGGAAGACAATGTTCAAAA CAATCAAATCATGG 3′ BPI3V P Rev (SEQ ID NO. 7) 5′ GCAAGCTTCTATTGGGAGCTAATGTCTTCATTAAACATATCCATCAA TTCAGATACTTCT 3′ BPI3V L Fwd-1 (SEQ ID NO. 8) 5′ GCCCCGGGTAATACGACTCACTATAGGGAGATCCATCTGATGAGTCC GTGAGGACGAAACGGAGTCTAGACTCCGTCATGGACACCGAATTCAGCGG TGGC 3′ BPI3V L Rev (SEQ ID NO. 9) 5′ GCAAGCTTTTAATCAATATCAAATTCATTATCATATTCATAATCTGG ATATGATTGGTGT 3′

[0085] PCR amplified N, P, and L genes were cloned into pCR4-TOPO vector and QC by restriction digest and sequencing.

[0086] Recombinant BPI3Vc-E2.sup.b(Insert Sequence) Virus Rescue and Amplification.

[0087] Virus Rescue and Amplification

[0088] Seed BSR-T7/5 cells at 4×10.sup.5 per well in a 6-well plate in order to achieve ˜50% confluence on the next day of transfection.

[0089] Transfection constructs: Use the following amounts of N, P, and L helper plasmid constructs, and a plasmid encoding T7 polymerase:

[0090] 5 μg pUCBPI3Vc-E2.sup.b (insert sequence) construct

[0091] 1.5 μg N construct

[0092] 0.8 μg P construct

[0093] 0.1 μg L construct

[0094] 5 μg of T7 polymerase construct

[0095] Transfection Reagents:

[0096] Set up 1:

[0097] 5.5 μl PLUS reagent

[0098] 9 μl Lipofectamine LTX

[0099] 200 μl Opti-MEM

[0100] Set up 2:

[0101] 2.5 μl PEI per microgram of DNA

[0102] 200 μl Opti-MEM

[0103] Add the transfection reagents (PEI or Lipofectamine/PLUS reagent diluted in 25 μl Optimem) to the plasmid constructs (diluted in 25 μl Optimem) and mix by pipetting gently.

[0104] Transfer the constructs/transfection reagents to 150 μl of Optimem.

[0105] Incubate at room temperature for 30 min.

[0106] Add the transfection mixture gently onto the cells (It is critical that mixture not be agitated before adding to cells, as mixing can disrupt the liposomes at this point).

[0107] Incubate at 37° C. for 72 hours (3 days).

[0108] At 72 hours post-transfection, harvest the P (0) media and cells and freeze-thaw only the cells (one cycle). Spin down and mix the clean supernatant. Use this to infect fresh MDBK cell monolayer. Stain a portion of the 6 well plate with anti-Flag/E2-specific mAb or sera/anti-BPI3V reference serum to confirm virus assembly.

[0109] Infect fresh monolayer of MDBK cells in a T25 flask with the lysate to generate P1 virus stock. Incubate at 37° C. for 5 days.

[0110] Stain a portion of the T25 flask as above to confirm virus replication.

[0111] Harvest the P (1) virus stock as above and infect fresh monolayer of MDBK cells in a T75 flask.

[0112] Incubate at 37° C. for 5 days, harvest P (2) virus and infect a 6 well MDBK plate for 3 days (72 hours) for staining as shown below;

[0113] Stain the 6 well plate with:

[0114] Anti-Flag antibody—confirm insert sequence expression.

[0115] Anti-BPI3V IgG polyclonal antibody—confirm that the virus assembled is BPI3V.

[0116] Anti-E2 monoclonal antibody—confirm E2 protein insert sequence expression.

[0117] Amplify virus in T7 then T175 flasks and conduct confirmatory QC at each time point QC (by staining as above). Purify virus by sucrose gradient and determine virus titer. Conduct QC of the purified virus and conduct in vivo studies to determine attenuation and vaccine efficacy.

[0118] FIG. 5 illustrates an attenuated BPI3Vc-E2.sup.b virus expressing the E2.sup.b transgene. For this figure, the recombinant BPI3Vc virus expressing the FLAG-tagged E2.sup.b transgene was rescued by transfecting BSR-T7/5 cells, which constitutively express the T7 RNA polymerase with the pBPI3Vc-E2.sup.b construct in the presence of the pCR4-N, pCR4-P, and pCR4-L helper constructs. Lysate and supernatant from the transfected cells was used to infect MDBK and 72 hrs. post-infection, expression of the FLAG-tagged E2.sup.b was evaluated by immunocytometric analysis using anti-FLAG monoclonal antibody. The rescued virus can be scaled up, and tested for attenuation in vitro and in vivo. It can also be used to conduct a pilot immunogenicity and protective efficacy against BPI3V genotype C strains.

[0119] FIGS. 6A-6D are photographs illustrating the surface display of a BVDV E2.sup.b transgene on cells infected with BPI3Vc-E2.sup.b virus. Rescued recombinant BPI3Vc-E2.sup.b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis of unfixed cells was used to validate expression of BVDV E2b transgene by BPI3Vc-E2b virus on cell surface using (FIG. 6A) anti-FLAG monoclonal antibody; (FIG. 6B) BPI3V polyclonal antibody (detects expression of BPI3Vc antigens); (FIG. 6C) BVDV Type 1&2 monoclonal antibody (mAb 348) against E2; and (FIG. 6D) uninfected negative control. This is QC data shows that the BVDV E2.sup.b transgene is expressed on the surface of cells infected with the BPI3Vc-E2.sup.b virus [6A, 6C]. The data [6B] also shows that the rescued virus is strongly recognized by BPI3V reference serum (APHIS 475 BDV 0601).

[0120] FIGS. 7A-D are photographs illustrating the authenticity of mosaic BPI3V F2-HN2 expressed by plasmid constructs. The expression and authenticity of FLAG-tagged mosaic novel fusion [F2] and HIS-tagged Hemagglutinin-Neuraminidase [HN2] proteins was evaluated by immunocytometric analysis of HEK-293A cells transfected with plasmid constructs and probed with (FIG. 7A) Anti-FLAG monoclonal antibody to detect the FLAG-tagged Fusion protein; (FIG. 7B) Anti-HIS monoclonal antibody to detect the HIS-tagged Hemagglutinin-Neuraminidase protein; (FIG. 7C) BPI3V polyclonal antibody and (FIG. 7D) pCDNA construct negative control. In some forms, the F2-HN2 open-reading frame is separated by a 2A autocleavable motif to allow generation of the individual F2 and HN2 antigens. This data shows expression of the novel mosaic F2HN2 antigens. Antigen expression was validated using anti-tag mAbs and then authenticated using the BPI3V reference serum mentioned above.

Example 2

[0121] Recombinant BPI3Vc viruses that are efficiently expressing the encoded novel F2-HN2, or the E2-NS2-5 mosaic antigens were generated, and showed that they are temperature sensitive.

[0122] Rescued recombinant BPI3Vc-E2-NS2-3b virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgene using: A) Anti-FLAG mAb (FIG. 8A); B) BPI3V reference serum (FIG. 8B); C) BVDV E2-specific mAb 348 (FIG. 8C); and D) uninfected negative control cells probed with the anti-BPI3V reference serum (FIG. 8D). Staining unfixed cells (FIG. 8C) showed that the E2 antigen is surface displayed. Similar results were obtained for the BPI3Vc virus expressing E2-NS2-3.sup.a; and E2-NS2-3.sup.2. The virus dose used was not normalized.

[0123] Rescued recombinant BPI3Vc-NS4-5.sup.1 virus was used to infect MDBK cells and at 72 hours post infection, immunocytometric analysis was used to validate expression of the transgene using: A) Anti-FLAG mAb (FIG. 9A); B) BPI3V polyclonal reference antibody (FIG. 9B); C) Anti-BVDV polyclonal antibody (FIG. 9C); and D) uninfected negative control cells probed with the anti-BPI3V reference serum (FIG. 9D). Similar results were obtained for BPI3Vc-NS4-5.sup.2 virus.

[0124] Rescued recombinant BPI3Vc-F2-HN2 virus was used to infect MDBK cells and at 72 hours post-infection, immunocytometric analysis was used to validate expression of the transgenes: A) FLAG-tagged F2 protein using anti-FLAG mAb [probed unfixed cells to detect surface expression] (FIG. 10A); B) His-tagged HN2 using anti-His mAb (FIG. 10B); C) authenticity of the BPI3Vc, F2, and HN2 proteins was validated using the anti-BPI3V reference serum (FIG. 10C); and D) uninfected negative control cells probed with the anti-BPI3V reference serum (FIG. 10D).

[0125] Finally, BPI3Vc-F2HN2 virus was shown to be temperature sensitive [ts]. In a preliminary study, purified IgGs from the anti-BPI3V reference serum were used to enumerate infected cells by immunocytometric analysis of Vero cells infected with either wildtype BPI3Vc [BPI3Vc-wt] virus or the recombinant BPI3Vc-F2HN2 virus incubated for 4 days at the indicated temperature. The results are provided in FIG. 11.