METHOD FOR CONTROLLING THE QUALITY

Abstract

The present invention refers to a method for typing Archaea and quickly discriminating contaminants in pure strain cultures of methanogenic Archaea, leading to isolation of variants with mutations from the culture population.

Claims

1. A first polymerase chain reaction (PCR) primer, the nucleotide sequence of which is selected from the group of SEQ ID NO:1; SEQ ID NO:2 or SEQ ID NO:3 combined with a second polymerase chain reaction primer, the nucleotide sequence of which is selected from the group of SEQ ID NO:4; SEQ ID NO:5 or SEQ ID NO:6, wherein each of the first and each of the second primers are capable to hybridize with the DNA of the methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590 and wherein SEQ ID NO:1 and SEQ ID NO:4; as well as SEQ ID NO:2 and SEQ ID NO:5; as well as SEQ ID NO:3 and SEQ ID NO:6 build up a primer pair to be used to PCR amplify said DNA.

2. A method for detecting the presence of methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590, comprising the steps of: a. obtaining a sample containing methanogenic microorganisms (cells) and applying means and techniques to release the DNA from the microorganisms to receive an unpurified DNA sample or obtaining a sample containing purified DNA of the methanogenic microorganisms; b. using the unpurified DNA sample or the purified DNA sample according to step a. in a PCR amplification using a primer pair comprising a first and a second primer according to claim 1, to receive an amplified DNA sequence (amplicon), wherein the amplicon comprises at least one restriction enzyme recognition sequence; c. purifying the respective amplicon; d. performing a first digestion reaction with the amplicon of step c. by incubating the amplicon in a reaction buffer with at least one first restriction enzyme, which recognizes a first recognition sequence for a time sufficient to form restriction fragments; e. determining the number of the formed restriction fragments and their size (restriction pattern), e.g. via gel electrophoresis and; f. genotyping the methanogenic microorganism on the basis of the restriction pattern; g. optionally, sequencing the purified amplicon of step c. or at least parts thereof and/or the digested amplicon of step d. or at least parts thereof and/or the amplicon following the digestion reaction of step d. or at least parts thereof.

3. The method detecting the presence of methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590 according to claim 2, further comprising the following steps: h. performing a quality control of the genotyping of step f. by performing a second digestion reaction, with the amplicon of step b. or step c. by incubating the amplicon in a reaction buffer with at least one second restriction enzyme, which recognizes a second recognition sequence, which partially overlaps with the first recognition sequence for a time sufficient to form restriction fragments (digested amplicon); i. determining the number of the formed restriction fragments and their size (restriction pattern), e.g. via gel electrophoresis; and j. genotyping the methanogenic microorganism on the basis of the restriction pattern.

4. The method according to any of claim 3, further comprising the steps of isolating the strain variant and optionally, genotyping the strain variant.

5. The method according to any of claims 2 to 4 2 to 6 for discriminating the strain Methanothermobacter thermoautotrophicus DSM3590 from other Methanothermobacter thermoautotrophicus strains, or from other Archaea selected from the group consisting of Methanothermobacterium, Methanobrevibacter, Methanothermobacter, Methanococcus, Methanosarcina, Methanopyrus, Methanospirillium, Methanosaeta, Methanogenium, Methanoculleus and Methanothermococcus and mixtures of the aforementioned.

6. The method according to claim 5, wherein the discrimination is based on at least one SNP in the amplicon, wherein this SNP is part of an overlapping sequence of the first and the second recognition sequence and wherein the SNP is selected from the group selected from SNP19, SNP11 and SNP20.

7. The method according to claim 6, wherein the SNP is SNP19 and wherein the first restriction enzyme is BamHl and the second restriction enzyme is Aval I, or wherein the SNP is SNP11 and the first restriction enzyme is Sfcl and the second restriction enzyme is BstNI or ECORII or wherein the SNP is SNP20 and the first restriction enzyme is Ndel.

8. A quality control kit for use in detecting the presence of methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590 within a given sample, comprising: at least one container a first primer according to claim 1 serving as forward primer; a second primer according to claim 1 serving as reverse primer; wherein the first and the second primer build up a primer pair capable to PCR amplify a DNA sequence of the methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590; at least one first restriction enzyme or at least one first and at least one second restriction enzyme according to claim 7; optionally at least one buffer, e.g. elution buffer, storage buffer and/or reaction buffer.

9. A methanogenic microorganism Methanothermobacter thermoautotrophicus DSM3590 variant identified and isolated with the method according to claim 4 characterized by comprising at least one SNP selected from the group of SNP19, SNP11 and SNP20.

10. The methanogenic microorganism identified according to claim 9, wherein the variant is Methanothermobacter thermoautotrophicus UC 120910.

Description

SHORT DESCRIPTION OF THE FIGURES

[0118] FIG. 1: Agarose gel showing the results of electrophoresis of PCR products generated via temperature gradient PCR for SNP11 and SNP20 amplicon with annealing temperatures tested between 55° C. and 70° C.

[0119] FIG. 2: Agarose gel showing the results of electrophoresis of PCR products generated via temperature gradient PCR to determine the optimal annealing temperature for SNP19 primers (lanes 9-15). From left to right side results for SNP19 amplicon were plotted with increasing annealing temperature. The negative control of the SNP19 primers was applied to a separate gel for reasons of space.

[0120] FIG. 3: Examination of Assay Sensitivity. The PCR was carried out with all primers amplifying SNP11, SNP19 and SNP20 using different dilutions (1:10, 1:50 and 1: 100) of a 547 ng/ μl starting DNA solution as PCR template and a respective negative control (lane “NTC”).

[0121] FIG. 4: Agarose gel with loaded samples from digestion reaction of SNP19 amplicon after gel electrophoresis using purified genomic DNA samples as initial templates for PCR. The amplicon of DSM3590 and the amplicon of non-M.-t.-DSM3590 Archaea were incubated with BamHI restriction enzyme for 2 h and then applied to a 2.5% agarose gel, as well as a NTC (N) and the untreated PCR amplicon. The marker (M) used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher. Using NEBuffer in the digestion reaction the expected digestion reaction of the amplicon derived from non-M.-t.-DSM3590 Archaea sample did not happen and the amplicon was not cut. However, the switch from NEBuffer to CutSmart buffer resulted in the expected results. i.e. the amplicon derived from non-M.-t.-DSM3590 Archaea sample was cut and well visible on the gel.

[0122] FIG. 5: Agarose gel with loaded samples from digestion reaction of SNP11 amplicon after gel electrophoresis using purified genomic DNA samples as initial templates for PCR. The amplicon of DSM3590 and the amplicon of non-M.-t.-DSM3590 Archaea were incubated with Sfcl restriction enzyme for 2 h and then applied to a 2.5% agarose gel, as well as a NTC and the untreated PCR amplicon. The marker used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher.

[0123] FIG. 6: Agarose gel with loaded samples from digestion reaction of SNP20 amplicon after gel electrophoresis using purified genomic DNA samples as initial templates for PCR. The amplicon of DSM3590 and the amplicon of non-M.-t.-DSM3590 Archaea were incubated with Ndel restriction enzyme in a for 2 h and then applied to a 2.5% agarose gel, as well as a NTC (N) and the untreated PCR amplicon. The marker used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher.

[0124] FIG. 7: Agarose gel with loaded samples from first and second digestion reactions of the SNP19 amplicon following gel electrophoresis using unpurified DNA derived from a cell sample as test template and purified DNA samples as positive controls. The UC 120910 and DSM3590 amplicon were incubated with BamHI orAvall for 2h each and then applied to a 2.5% agarose gel, as well as a no template control (NTC, water instead of DNA sample) and a sample of the untreated respective PCR amplicon. The molecular marker used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher (✓: successful approach; (✓): successful approach; x: partially successful approach.

[0125] FIG. 8: Agarose gel with loaded samples from first and second digestion reactions of the SNP19 amplicon following gel electrophoresis using unpurified DNA derived from a cell sample as test template and purified DNA samples as positive controls. The UC 120910 and DSM3590 amplicon were incubated with BamHI orAvall for 2h each and then applied to a 2.5% agarose gel, as well as a negative control (water instead of DNA sample) and a sample of the untreated respective PCR amplicon. The molecular marker used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher Specific bands were received following digestion of SNP19 amplicon with BamHI. Unspecific bands were received following digestion of SNP19 amplicon with Avall for each of the purified DNA sample and the unpurified DNA sample derived from fresh cell preparation. ✓: successful approach; x: non-successful approach.

[0126] FIG. 9: Agarose gel with loaded samples from first and second digestion reactions of the SNP20 amplicon following gel electrophoresis using unpurified DNA derived from a cell sample as test template and purified DNA samples as positive controls. The UC 120910 and DSM3590 amplicon were incubated with Ndel for 2h each and then applied to a 2.5% agarose gel, as well as a negative control (water instead of DNA sample) and a sample of the untreated respective PCR amplicon. The approach with unpurified DNA of strain UC 120910 derived from a cell sample is similar to the UC 120910 positive control: The respective amplicons were only incompletely digested. ✓: successful approach; (✓): partially successful approach.

[0127] FIG. 10: Agarose gel with loaded samples from first and second digestion reactions of the SNP11 amplicon following gel electrophoresis using unpurified DNA derived from a cell sample as test template and purified DNA samples as positive controls. The UC 120910 and DSM3590 amplicon were incubated with Sfcl or BstNl for 2h each and then applied to a 2.5% agarose gel, as well as a negative control (water instead of DNA sample) and a sample of the untreated respective PCR amplicon. The molecular marker used was the GeneRuler 50 bp DNA Ladder from Thermo Fisher. Outcome: Incorrect results of the digestion reactions analysis of SNP11 using unpurified DNA samples of M. thermoautotrophicus UC 120910. The UC 120910 cell derived sample in columns 2-4 does not have the same pattern as the ECHO positive control (crossed arrows). Instead, the band pattern is similar to the positive control (arrows). ✓: successful approach; x: non-successful approach.

EXAMPLES

[0128] The following examples illustrate viable ways of carrying out the described method as intended, without the intent of limiting the invention to said examples.

[0129] General Part

[0130] The inventors of the present invention have set themselves the task to provide a simplified method for the identification of M. thermoautotrophicus DSM3590 in a given sample comprising Archaea in comparison with time consuming state of the art methods, e.g. genome sequencing and/or amplicon sequencing.

[0131] Thus, the inventors designed many primers with the purpose that these are suitable to amplify DNA sequences of M. thermoautotrophicus DSM3590 and to be suitable to distinguish from DNA sequences of other non-Methanothermobacter thermoautotrophicus Archaea and analyzed them via test and error experimentation.

[0132] Surprisingly, the inventors found that primers according to the present invention not only amplify DNA sequences of M. thermoautotrophicus DSM3590 but also amplify some other non-Methanothermobacter thermoautotrophicus Archaea. Even more interestingly the inventors found that the amplicons generated by the primers of the present invention comprised single nucleotide variations compared to other non-Methanothermobacter thermoautotrophicus Archaea, and also to other M. thermoautotrophicus DSM3590 variants. These so called SNPs in the amplicon were later found to be suitable to perform digestion reactions using selective restriction enzymes, which recognize recognition sequences within the amplicon, wherein the presence of a recognition sequences is dependent on the identity of the respective nucleotide base of this SNP, comprised in the recognition sequence. In other words, depending on the presence of a given respective nucleotide base at this SNP location it is either recognized by the respective restriction enzyme or not, i.e. the recognition sequence is either present and readable or unreadable (destroyed) for the restriction enzyme depending on the presence of the respective SNP. Therefore, the method according to the present invention allows to directly provide evidence of the presence of nucleotide variations without further sequencing of the amplicon. It can be even used to identify the respective Archaea strain owing to said single SNP base variation.

[0133] The staining in all agarose gels tested was performed using 100 fold concentrated GelRed (Biotium, Fremont, USA) using the method of Huang et al., 2010, wherein to the gel loading buffer 100 fold concentrated GelRed was added and then mixed with the respective samples and the used size marker (Gene Ruler 50 bp DNA ladder, Fisher Scientific, Schwerte, Germany).

[0134] The nucleotide sequences of the designed primers according to the present invention are indicated in Table 1.

TABLE-US-00001 TABLE 1 IDs (primer), Primer sequence and expected PCR generated amplicon size using genomic DNA of M. thermoautotrophicus DSM3590 as PCR template. A = adenosine; C = cytosine; G = guanine; T = thymine. primer name (ID) primer sequence (5′-3′) SNP-ID amplicon size [bp] SEQ ID NO: 1 (forward) TCGGCCCAGTATTTCTCATGG SNP11 Ca. 300 SEQ ID NO: 4 (reverse) TGGGTGGAATGGGTGGAATG SEQ ID NO: 2 (forward) TGGGTCACGTGTTCGATGAC SNP20 Ca. 325 SEQ ID NO: 5 (reverse) TATGAACTCCACGAGGTGCC SEQ ID NO: 3 (forward) CTCCACAAAGACGTCCTCCC SNP19 Ca. 500 SEQ ID NO: 6 (reverse) TTTAGTTGGAGGAGGATGGGG

[0135] Initially, it was tried to develop a common protocol with the same experimental conditions for all PCR reactions using the inventive primer pairs, so that all assays can be carried out simultaneously. At the beginning purified genomic DNA was extracted from a pure M. thermoautotrophicus DSM3590 and a non-M.-t.-DSM3590 Archaea. The concentration of DNA of the obtained preparation was determined photometrically. As a first step, the amount of template that gave the best results for the PCR was experimentally determined. This was the case with the use of 10-20 ng of DNA, although sometimes significantly lower or higher concentrations enabled successful amplification of the templates. All primer combinations yielded fragments of the expected size (see Table 1).

[0136] The DNA polymerase used was AccuPOL polymerase. Due to its 3′ to 5 ‘exonuclease activity, it is able to screen inserted nucleotides. Proofreading activity results in an error rate of 1.1×10.sup.−6 per base per duplication of amplification as reported in the state of the art. Compared to Taq DNA polymerase, the accuracy is higher. The error rate of Taq DNA polymerase is 8.0×10.sup.−6 as reported in the state of the art. Based on the AccuPOL polymerase protocol, the mastermix formulation according to Table 2 is used.

TABLE-US-00002 TABLE 2 Master Mix for a PCR Approach. Final volume per concentration components reaction [μl] or amount water 15.48 — 10× PCR buffer.sup.a) 2.0 1× dNTPs (each 12.5 mM) 0.32 Each 200 μM forward primer (10 μM) 0.4 0.2 μM reverse primer (10 μM) 0.4 0.2 μM AccuPOL DNA polymerase 57 1 unit (2.5 units/μl) DNA template 72 ca.50 ng .sup.a)indicates: Key Buffer, VWR International, Darmstadt, Germany (comprising Tris-HCl, pH 8.8, (NH.sub.4).sub.2SO.sub.4, 15 mM MgCl.sub.2,1% Tween 20).

[0137] To avoid the formation of experimental artifacts, the elongation time was reduced as much as possible without affecting the amplification of the longest amplicon. To minimize the total time required for amplification, the denaturation time per cycle and the initial denaturation were also shortened, resulting in significant time savings. To increase the yield and the stringency of the PCR, a temperature gradient PCR was performed for all primers. As an example, FIG. 1 shows the result for SNP11 and SNP20 and FIG. 2 shows the results for SNP19. For primers amplifying SNP11 and SNP19, the PCR with the annealing temperature 57.5° C. led to the strongest bands. Noteworthy, primers amplifying SNP19 produced only a weak band at the previous annealing temperature of 55.1° C.

[0138] The primers amplifying SNP20 worked best at the highest temperature of 70.1° C. There was a visible amount PCR product/temperature gradient. At 55.1° C. no band was visible on the gel. As the annealing temperature increased, the intensity of the bands was also increased.

[0139] The experimentally determined ideal reaction conditions were then adopted for all respective primers in the standard protocol, i.e. an annealing temperature of 57.1° C. for the primers amplifying SNP11 and SNP19 and an annealing temperature of 70.1° C. for the primers amplifying SNP20.

[0140] In order to further increase the specificity of the PCR reactions, a touchdown program was established for all assays, as far as the determined ideal annealing temperature allowed (not in case of SNP 20). This program provided fora 1° C. decrease in the annealing temperature per cycle before further amplification over several cycles at the final elongation temperature.

[0141] The applied parameters of the touchdown-PCR for the primer pairs to amplify SNP 11 (SEQ ID NO:1 (forward); SEQ ID NO:4 (reverse)) and SNP19 (SEQ ID NO:2 (forward), SEQ ID NO:5 (reverse)) are shown in Table 3.

TABLE-US-00003 TABLE 3 Parameters of the touchdown-PCR for the primer pairs designed to amplify SNP11 (SEQ ID NO:1 (forward); SEQ ID NO:4 (reverse)) and SNP19 (SEQ ID NO:2 (forward), SEQ ID NO:5 (reverse)). amplification temperature duration number of steps [° C.] [mm:ss] PCR-cycles Initial denaturation 95 1:00 denaturation 95 0:30 annealing .sup. 70.sup.a) 0:30 {close oversize brace} 14× elongation 72 1:00 denaturation 95 0:30 annealing 57 0:30 elongation 72 1:00 {close oversize brace} 16× final elongation 72 5:00 .sup.a)indicates that per cycle the annealing temperature is reduced by 1° C.

[0142] The primer pairs to amplify SNP 20 (SEQ ID NO:3 (forward); SEQ ID NO:6 (reverse)) have an optimal annealing temperature of 70° C. A touchdown PCR is therefore not feasible. Thus, the new annealing temperature was integrated into the improved PCR program of Table 4. The duration of each step, as well as the number of cycles has not been changed. The PCR program for amplification of SNP20 is described in Table 4.

TABLE-US-00004 TABLE 4 The PCR program for amplification of SNP20 using SEQ ID NO:3 (forward); SEQ ID NO:6 (reverse). temperature duration number of amplification steps [° C.] [mm:ss] PCR-cycles Initial denaturation 95 1:00 denaturation 95 0:30 annealing 70 0:30 {close oversize brace} 30× elongation 72 1:00 final elongation 72 5:00

[0143] Using the PCR protocol now established, the sensitivity of the assays was examined by making a dilution series of the DNA template. The original concentration of the undiluted DNA template was determined photometrically and was 547 ng/pl. From this DNA solution, a 1:10, 1:50, and 1: 100 dilution were made, and these solutions were each used as templates for a PCR approach with the different primer combinations (FIG. 3).

[0144] In two of the different assays (SNP11, SNP19) consistently reliable results were achieved regardless of the amount of template used. Only in the case of the SNP19 assay did the amplicon yield decrease with increasing dilution of the template. Based on these results, by default about 5 ng genomic DNA was used as template for the positive control for all further experiments, only about 50 ng template were used by default for the SNP19 PCR.

Digestion of PCR Amplicons: Testing and Optimization

[0145] All used restriction enzymes were purchased from New England BioLabs, Frankfurt am Main. Following optimization of the amplification protocol, the selected restriction enzymes were tested in a first digestion reaction to specifically not cut the amplicons generated with DNA of M. thermoautotrophicus DSM3590, which should remain undigested.

[0146] A series of preliminary experiments revealed that a reliable digestion reaction required purification of the PCR amplicons (data not shown). Purification of the amplicons is necessary to remove salts, primers, nucleotides and other inhibiting substances before restriction digestion. For this purpose, various purification kits were first tested (e.g. QIAquick PCR Purification Kit, Qiagen, Hilden, Germany and Roti-Prep PCR purification Kit, Carl Roth, Karlsruhe, Germany). The comparison of the kits showed that all the tested products resulted in a comparable good purified end product and therefore henceforth the kit with the lowest initial cost was used (GF-1 PCR Clean-up Kit, GeneOn, Ludwigshafen, Germany).

[0147] In a first step all of the digestion reactions were tested and optimized with amplicons prepared using purified genomic DNA as a PCR template. In a second step, the established digestion reactions were then assayed in triplicate (n=3) with amplicons generated using non-purified cell samples (see below).

Performance of the Digestion Reaction

[0148] The amplicons generated with the designed primers of the present invention were used in a first digestion reaction. Test samples were the same as above, i.e. on the one hand purified genomic DNA extracted from M. thermoautotrophicus DSM3590, which does not carry the recognition sequence for the applied restriction enzyme(s) within the DNA sequence to be amplified by the present specific primers and on the other hand purified genomic DNA extracted from an Archaea (non-M.-t.-DSM3590 Archaea), which does carry the recognition sequence for the applied restriction enzyme(s) within the DNA sequence to be amplified. Respective no template controls (NTC) or also called negative controls contained the respective SNP specific master mix but water (H20) instead of the DNA template.

[0149] Each amplicon template was digested with each of the amplicon-specific enzymes. Restriction was performed according to the manufacturer's instructions. According to the manufacturer (New England Biolabs), the samples can be incubated for 5-15 minutes, but also overnight, without inducing DNA degradation. An incubation period of two hours was (initially) selected. Preferably, the digestion reaction is performed in a thermocycler or in an incubator (37° C.).

Snp19

[0150] Digestion of the SNP19 PCR product with BamHI was first performed in NEBuffer 3.1 as recommended by the manufacturer, but both the M. thermoautotrophicus DSM3590 and the amplicon derived from non-M.-t.-DSM3590 Archaea genomic DNA remained undigested following a digestion reaction. Even when increasing the incubation times to 4 h up to an overnight incubation did not improve the result. In further tests, in addition to the NEBuffer 3.1, the CutSmart buffer (New England Biolabs, Frankfurt am Main, Germany) was used, which, according to the manufacturer, also leads to 100% activity of the enzyme. With the alternative buffer, the corresponding PCR product was hydrolyzed after only 2 h in the case of the genomic DNA of non-M.-t.-DSM3590 Archaea (see FIG. 4). Therefore, in the further experiments with the SNP19 and the restriction enzyme BamHI the CutSmart buffer was used.

SNP11

[0151] As expected in the case of the amplicon generated with the purified genomic DNA of M. thermoautotrophicus DSM3590 (positive control), the restriction of the amplicon did not happen and the length of the detected fragment in the agarose gel corresponded to the size of the full length PCR product initially applied in the digestion reaction. However, in the case where the sample was a specific purified non-M.-t.-DSM3590 Archaea, the genomic DNA digestion reaction of the purified SNP11 PCR product with Sfcl revealed cleavage of amplicon of the non-M.-t.-DSM3590 Archaea as expected in two fragments of different length (ca. ca. 200 bp and ca. ca. 100 bp), which could be clearly visually distinguished on the applied agarose gel following gel electrophoresis (see FIG. 5).

SNP20

[0152] Similar to the digestion of the SNP11 amplicon, the digestion reaction of the SNP20 PCR product was carried out by the restriction enzyme Ndel (FIG. 6). The M. thermoautotrophicus DSM3590 amplicon remained undigested, i.e., was of the same size after incubation with the restriction enzyme Ndel as the untreated PCR product (ca. ca. 325 bp). However, in the case where the sample was a purified genomic DNA of a specific non-M.-t.-DSM3590 Archaea the digestion reaction of the purified SNP20 PCR product with Ndel revealed cleavage of the DNA-generated amplicon in two fragments of different length, which following gel electrophoresis could be clearly visually seen on the used agarose gel (see FIG. 6).

Testing of the Designed Primers Using Fresh Archaea Cell Samples Derived from a Running Bioreactor without a Preceding DNA Purification

[0153] In a next step after the protocols for the detection reactions of the three SNPs had been established, DNA of fresh, living cells derived from a running bioreactor cell sample was used as template for the PCR amplification and prepared according to the method of the present invention. The cells of the bioreactor cell sample were only mechanically disrupted by repeated freeze (at −80° C.) -and thaw cycles, thereby releasing the DNA. The amount of released genomic DNA (unpurified DNA) was sufficient to produce comparable PCR product yields using the protocols previously developed for purified DNA (data not shown). The time consuming isolation of the genomic DNA of state of the art methods could be advantageously omitted here using the method according to the present invention. The subsequent digestion reaction of the generated amplicons was analogous to the previously examined samples. It was only to observe that the digestion reaction tended to be incomplete somewhat more frequently when using DNA from fresh cell samples of a bioreactor which was not purified before the PCR were applied than when using purified DNA for the PCR.

Assessment of Assay Reliability

[0154] Following the optimization of the test protocol, the reliability of the strain identification test was examined. For this purpose, the PCR amplification and digestion reactions of all three SNP amplicons were independently tested on three consecutive days. As a sample to be identified, Archaea cells from a running bioreactor experiment were used, which were believed to be pure M. thermoautotrophicus DSM3590. All primer pairs were tested under the conditions described above. Positive controls were on the one hand extracted purified DNA of M. thermoautotrophicus DSM3590, which does not carry the recognition sequence for the applied restriction enzymes within the DNA sequence to be amplified by the specific primers of the present invention and on the other hand specific extracted purified DNA of non-M.-t.-DSM3590 Archaea, which does carry the recognition sequence for the applied restriction enzymes within the DNA sequence to be amplified. The negative control (no template control, NTC) contained water rather than a template.

SNP19

[0155] Surprisingly, the inventors of the present invention found that the amplicon derived from Archaea cell samples, which were harvested from a running bioreactor were cut in the digestion reaction by the applied restriction enzyme BamHI at least to some extent into two fragments (see FIG. 7, lane 3), while -as expected- the amplicon derived from purified genomic DNA of M. thermoautotrophicus DSM3590 remained undigested (see FIG. 7, lane 10). To rule out that this was an experimental artifact, the experimentation was repeated several times even with new prepared reaction components and new prepared genomic DNA harvested from another sample of said bioreactor and even tested in a purified form (data not shown). Nevertheless, in all cases the outcome stayed comparably the same as before, i.e., following digestion reaction the amplicon was obviously cut at least to a certain extent into two distinctive sized fragments of ca. ca. 400 bpand ca. ca. 100 bp, while some of the applied amplicons sometimes remained undigested (ca. ca. 500 bp) as visible on agarose gel (see FIG. 7, lane 3). These two restriction fragments were also received following digestion reaction when using respective purified DNA samples harvested from said Archaea cell samples of the running bioreactor instead of the non-purified ones, further excluding an experimental artifact (data not shown).

[0156] To further analyze this unexpected outcome the inventors performed another parallel digesting reaction using the same amplicon samples received from the non-purified DNA approach as before for the experiment with BamHI, but instead of BamHI used another restriction enzyme, namely Avail. This revealed a restriction pattern as can be seen on FIG. 7, lanes 2, 6 and 9. The SNP19 amplicon (ca. 500 bp) derived from the bioreactor cell sample was cut to receive three good distinguishable different sized restriction fragments (ca. 320 bp, ca. 130 bp, ca. 50 bp, see FIG. 7, lane 2). Moreover, as expected the amplicon derived from purified genomic DNA of M.

[0157] thermoautotrophicus DSM3590 (full length ca. 500 bp) received four different sized restriction fragments (ca. 230 bp, ca. 130 bp, ca. 100 bp, ca. 50 bp; see FIG. 7, lane 9.

[0158] However, in the first round as depicted in FIG. 7, lane 6, the positive control for non-M.-t.-DSM3590 Archaea revealed weak, but specific bands in addition to the predicted bands by digesting with Avail. This had not been observed before. In another experimentation positive control for non-M.-t.-DSM3590 Archaea was cut as expected using Avail (data not shown), demonstrating that the results concerning that positive control of the first test run were seemingly an experimental artefact.

[0159] By subsequent amplicon sequencing it was found out that the methanogenic organism of the cell sample derived from the bioreactor is a pure culture of M. thermoautotrophicus UC 120910. Using a proven purified genomic DNA sample of M. thermoautotrophicus UC 120910 applying the method according to the present invention showed a comparable restriction pattern as compared with the cell samples of the beforementioned of M. thermoautotrophicus UC 120910. In more detail: The generated PCR amplicon of the purified genomic DNA sample of M. thermoautotrophicus UC 120910 using the SNP19 primers (see FIG. 7, lane 8) was digested using BamHI and Aval I to receive the same restriction pattern on the agarose gel as the DNA received from the aforementioned tested cell sample, which turned out to be M. thermoautotrophicus UC 120910, thus confirming the amplicon sequencing outcome (cf. FIG. 7, lanes 4 and 8 (PCR product); lanes 3 and 7 (BamHI digestion); lanes 2 and 9 (Avail digestion)). The restriction efficiency for unpurified DNA samples from strain UC 120910 cell samples and UC 120910 purified DNA controls was the same in all cases, however, it could not be clarified why full digestion using BamHI for both, the non-purified DNA derived from cell samples and the purified DNA of M. thermoautotrophicus UC 120910 was not achieved (cf. FIG. 7, lanes 3 and 7).

[0160] In a next step the method according to the present invention was tested using a cell sample of a known M. thermoautotrophicus DSM3590 source. The PCR amplicon of the cell sample and the purified DNA sample was of the expected size (cf. FIG. 8, lane 14 and 17). Also, as expected was the outcome of the first digestion reaction using BamHI, which did not digest the PCR amplicon of

[0161] DSM3590 at all (cf. FIG. 8, cell sample and purified DNA sample lane 13 and 16). However, unexpectedly the second digestion reaction using Avall showed a less specific restriction pattern, i.e. more than the four expected fragments (ca. 230 bp, ca. 130 bp, ca. ca. 100 bp, ca. 50 bp) were received.

[0162] Therefore, a clear identification of the M. thermoautotrophicus DSM3590 could not be done on the basis of the Avall digestion reaction. However, the results of the initial testing of the primer pair for SNP19 showed that at least with purified DNA of the M. thermoautotrophicus DSM3590 also the second digestion reacting using Avall was working as expected, thus arguing that the assay is principally working.

[0163] Therefore, the method according to the present invention can be used to test for the presence of M. thermoautotrophicus DSM3590 and to differentiate it towards the presence of M. thermoautotrophicus DSM3590 variants as M. thermoautotrophicus UC 120910. The received variant characteristic restriction pattern (number and size of the restriction fragments) revealed in both digestion reaction assays of the DNA derived from bioreactor cell samples of M. thermoautotrophicus DSM3590 and M. thermoautotrophicus UC 120910 can be used to genotype the methanogenic microorganism behind. Moreover, the method according to the present invention can be also further used to isolate the genotyped methanogenic microorganism behind.

[0164] The restriction efficiency for strain UC 120910 cell samples and UC 120910 purified DNA controls was the same in all cases. However, given the fact, that BamHI does not digest the DNA of M. thermoautotrophicus DSM3590 at all, the differentiation between the latter mentioned and M. thermoautotrophicus UC 120910, which shows a specific restriction pattern of at least two restriction fragments following a digesting reaction using BamHl allows to clearly differentiate between the both.

[0165] Based on the principally positive experimentation results with said cell samples from a running bioreactor containing pure M. thermoautotrophicus UC 120910, these were also used in the further analysis using SNP11 and SNP20 primer pairs according to the present invention. Also, the mentioned purified DNA of a proven M. thermoautotrophicus UC 120910 was used in any further experimentation as a positive control.

SNP11

[0166] In the first digestion reaction using the first restriction enzyme Sfcl the positive controls led to the expected results in all of the runs, i.e. the amplicon was either not digested at all in the case of purified DNA of M. thermoautotrophicus DSM3590 or digested to result in two fragments of different and expected size in the case of purified DNA of M. thermoautotrophicus UC 120910. The PCR was successful in all cases, but generated weaker bands (data not shown). The analysis of the fresh cell samples from the running bioreactor, i.e. cell samples of pure M. thermoautotrophicus UC 120910, which should result in two fragments of different and expected size as the corresponding positive control, did not function as the amplicon of these test samples was not digested at all using the M. thermoautotrophicus UC 120910 specific first restriction enzyme Sfcl (see FIG. 10).

[0167] In the second digestion reaction using the second restriction enzyme BstNI the positive controls led to results in all of the runs, i.e. the amplicon was either not digested at all in the case of purified DNA of M. thermoautotrophicus UC 120910 or digested to result in two fragments of different and expected size in the case of purified DNA of M. thermoautotrophicus DSM3590. The PCR was successful in all cases (data not shown).

[0168] More interestingly, the digestion of the SNP11 amplicon derived from M. thermoautotrophicus UC 120910 using the second restriction enzyme BstNI resulted in a DSM3590 related restriction pattern. However, BstNI should be DSM3590 specific and should not digest the amplicon of strain UC 120910 due to a SNP in the recognition sequence for that enzyme.

SNP20

[0169] Analysis of the SNP20 amplicon provided reproducible results. Restriction of the strain UC 120910 cell sample with the first restriction enzyme Ndel was successful in all cases. However, partial digestion was also partially observed in the case of the strain UC 120910 positive control and the delineation to the DSM3590 strain was clearly possible because the corresponding DSM3590 amplicon remained undigested in all cases. In more detail: The hydrolysis of the UC 120910 purified DNA (positive control) and the unpurified DNA sample derived from a fresh cell sample was in the right place in all cases: The DSM3590 control was not hydrolyzed. However, both the digestion of the unpurified DNA template and the purified DNA template were both incomplete, as shown in FIG. 9 (cf. lanes 2 and 5). However, the regular bands typical of this primer pair appeared in each run. Nevertheless, it was possible to assign the restriction pattern clearly to the UC 120910 (cf. FIG. 9).

[0170] Table 5 indicates the parameters and characteristics of the first digestion reaction and Table 6 indicates the parameters and characteristics of the second digestion reaction each for the respective SNPs and the different Archaea variant tested, i.e., Methanothermobacter thermoautotrophicus (M. t.) DSM3590 strain and M. t. UC 12091 strain. The used restriction enzymes as well as the number and size of the eventually generated restriction fragments following the digestion reaction are also indicated.

TABLE-US-00005 TABLE 5 Parameters and characteristics of the performed first digestion reaction. Targeted SNP SNP11 SNP20 SNP19 Amplicon size [bp] ca. 300 ca. 325 ca. 500 Used first restriction Sfcl Ndel BamHI enzyme temperature used in the 37° C. 37° C. 37° C. digestion reaction incubation time of the 2 h 2 h 2 h digestion reaction first recognition C{circumflex over ( )}TRYAG CA{circumflex over ( )}TA_TG C{circumflex over ( )}GATCC sequence (5′-3′) number of restriction 2 2 2 fragments after digestion reaction using a pure M. t. strain UC 120910 sample restriction fragment size ca. 200 bp + ca. 170 bp + ca. 400 bp + using a pure M. t. strain ca. 100 bp ca. 160 bp ca. 100 UC 120910 sample bp number of restriction 1 1 1 fragments after digestion (original (original (original reaction using a pure M. t. amplicon) amplicon) amplicon) strain DSM3590 sample restriction fragments after ca. 300 bp ca. 325 bp ca. 500 bp digestion reaction using a pure M. t. strain DSM3590 sample R = A oder G (Purin); Y = C oder T (Pyrimidin); W = A oder T. “{circumflex over ( )}” = clevage site of restriction enzyme. “_” = frame shift.

TABLE-US-00006 TABLE 6 Parameters and characteristics of the performed second digestion reaction. Targeted SNP SNP11 SNP19 Amplicon size [bp] ca. 300 ca. 500 Used second restriction BstNI Avail enzyme temperature used in the 37° C. 37° C. digestion reaction incubation time of the 2 h 2 h digestion reaction second recognition CC{circumflex over ( )}WGG G{circumflex over ( )}GWCC sequence (5′-3′) number of restriction 1 3 fragments after digestion (original reaction using a pure M. t. amplicon) strain UC 120910 sample restriction fragment size ca.300 bp 329 bp + using a pure M. t. strain UC 133 bp + 120910 sample 58 bp number of restriction 2 4 fragments after digestion reaction using a pure M. t. strain DSM3590 sample restriction fragments after 208 + 214 230 bp + digestion reaction using a 133 bp + ca. pure M. t. strain DSM3590 100 bp + 58 bp sample W = A oder T. “{circumflex over ( )}” = clevage site of restriction enzyme. “_” = frame shift.

[0171] The results of the independent reliability tests for all four SNP PCR products (amplicons) are summarized in Table 7. The amplification of the examined genome regions from unpurified DNA derived from cell samples and genome regions from purified DNA was always successful using the established test protocol.

TABLE-US-00007 TABLE 7 Results of the independent reliability tests for all four SNP PCR products (amplicons). Expected restriction Cell sample restriction fragments (unpurified DNA) Purified DNA Amplicon template enzyme [bp] 1 2 3 1 2 3 SNP11 undigested — ca. 300 ✓ ✓ ✓ ✓ ✓ ✓ amplicon strain UC Sfcl ca. 200 + x x x ✓ ✓ ✓ 120910 ca. 100 DSM3590 Sfcl ca. 300 — — — ✓ ✓ ✓ strain SNP20 undigested — ca. 325 ✓ ✓ ✓ ✓ ✓ ✓ amplicon strain UC Ndel.sup.a) ca. 170 +  ✓.sup.a)  ✓.sup.a)  ✓.sup.a) ✓  ✓.sup.a) ✓ 120910 ca. 160 DSM3590 Ndel ca. 325 — — — ✓ ✓ ✓ strain SNP19 undigested — ca. 500 ✓ ✓ ✓ ✓ ✓ ✓ amplicon strain UC BamHI.sup.a) ca. 400 + ✓  ✓.sup.b) ✓ ✓  ✓.sup.b) ✓ 120910 ca. 100 DSM3590 BamHI — — — — ✓ ✓ ✓ strain ✓ = successful approach; (✓) = partially successful approach; x = non-successful approach; .sup.a)= incomplete digestion; .sup.b)amplicon mostly not digested.

[0172] Overall, the three SNP tests used may be considered as complementary and may be performed together in parallel. In the event that contradictory results are obtained and one of the assays differs from the other, sequencing of the amplicons in question should in each case be performed in order to genotype the Archaea strain comprised in the cell sample to be analyzed.