NOVEL lNHIBITORS OF THE ENZYME ACTIVATED FACTOR XII (FXIIA)

Abstract

The present invention relates to a bicyclic inhibitor of the coagulation enzyme activated factor XII (FXIIa) comprising or consisting of the peptide) (X.sup.1)(X.sup.2)(X.sup.3).sub.n(X.sup.4)RL(X.sup.5)(X.sup.6).sub.m(X.sup.7)(X.sup.9).sub.l(X.sup.10)(X.sup.11)(X.sup.12)(X.sup.13)(X.sup.14).sub.k(X.sup.15)(X.sup.16), wherein (X.sup.1) is present or absent and, if present, is an amino acid; (X.sup.2) is an amino acid with a side chain; (X.sup.3) is an amino acid and n is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.4) is an aliphatic L-amino acid or a cyclic L-amino acid, preferably L, P or an aromatic L-amino acid, and most preferably an aromatic L-amino acid; (X.sup.5) is an amino acid; (X.sup.6) is an amino acid and m is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.7) is an amino acid with a side chain; (X.sup.9) is an amino acid and l is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.10) is an amino acid; (X.sup.11) is an amino acid, preferably Q; (X.sup.12) is a hydrophobic L-amino acid, preferably an aliphatic L-amino acid, and is most preferably L; (X.sup.13) is an amino acid; (X.sup.14) is an amino acid and k is between 0 and 3, preferably 0 or 1 and most preferably 0, (X.sup.15) is an amino acid with a side chain; and (X.sup.16) is present or absent and, if present, is an amino acid; and wherein the side chains of (X.sup.2), (X.sup.7) and (X.sup.15) are connected via a connecting molecule, said connecting molecule having at least three functional groups, each functional group forming a covalent bond with one of the side chains of (X.sup.2), (X.sup.7) and (X.sup.15).

Claims

1. A bicyclic inhibitor of the coagulation enzyme activated factor XII (FXIIa) comprising or consisting of the peptide (X.sup.1)(X.sup.2)(X.sup.3).sub.n(X.sup.4)RL(X.sup.5)(X.sup.6).sub.m(X.sup.7)(X.sup.9).sub.l(X.sup.10)(X.sup.11)(X.sup.12)(X.sup.13)(X.sup.14).sub.k(X.sup.15)(X.sup.16), wherein (X.sup.1) is present or absent and, if present, is an amino acid; (X.sup.2) is an amino acid with a side chain; (X.sup.3) is an amino acid and n is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.4) is an aliphatic L-amino acid or a cyclic L-amino acid, preferably L, P or an aromatic L-amino acid, and most preferably an aromatic L-amino acid; (X.sup.5) is an amino acid; (X.sup.6) is an amino acid and m is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.7) is an amino acid with a side chain; (X.sup.9) is an amino acid and I is between 0 and 3, preferably 0 or 1 and most preferably 0; (X.sup.10) is an amino acid; (X.sup.11) is an amino acid, preferably Q; (X.sup.12) is a hydrophobic L-amino acid, preferably an aliphatic L-amino acid, and is most preferably L; (X.sup.13) is an amino acid; (X.sup.14) is an amino acid and k is between 0 and 3, preferably 0 or 1 and most preferably 0, (X.sup.15) is an amino acid with a side chain; and (X.sup.16)) is present or absent and, if present, is an amino acid; and wherein the side chains of (X.sup.2), (X.sup.7) and (X.sup.15) are connected via a connecting molecule, said connecting molecule having at least three functional groups, each functional group forming a covalent bond with one of the side chains of (X.sup.2), (X.sup.7) and (X.sup.15).

2. The inhibitor of claim 1, wherein (X.sup.4) is selected from the group consisting of L, P, F, W, Y, 1-naphthylalanine, 2-naphthylalanine, 3-benzothienylalanine, 3-fluoro-phenylalanine, 3-methyl-phenylalanine, 2-amino-3-(pyridine-3-yl)propionic acid, 2-fluoro-phenylalanine, 4-fluoro-phenylalanine, and 2-nitro-phenylalanine.

3. The inhibitor of claim 1, wherein (X.sup.5) is a hydrophobic L-amino acid or a polar, uncharged L-amino acid.

4. The inhibitor of claim 1, wherein the side chains of (X.sup.2), (X.sup.7) and (X.sup.15) comprise a functional group independently selected from NH.sub.2, COOH, SH, alkene, alkyne, azide and chloroacetamide.

5. The inhibitor of claim 1, wherein (X.sup.2), (X.sup.7) and (X.sup.15) are each independently K, ornithine, thialysine, 2,3-diaminopropanoic acid, diaminobutyric acid, D, E, C, homocysteine, penicillamine or propargylglycine.

6. The inhibitor of claim 1, wherein (X.sup.2) is 5-mercapto-norvaline, homocysteine or C; and/or (X.sup.7) is homocysteine or C; and/or (X.sup.15) is 5-mercapto-norvaline, homocysteine or C.

7. The inhibitor of claim 1, wherein (X.sup.1) is D-Arg, homoarginine, L, norarginine, 4-guanidinophenylalanine, homolysine, D-Arg-D-Ser or L-Arg; and/or (X.sup.10) is G, H, or R; (X.sup.13) is A, G, (S)-3-homoarginine or R; and/or (X.sup.16) is R or absent.

8. The inhibitor of claim 1, wherein the connecting molecule is selected from 1,3,5-triacryloyl-1,3,5-triazinane (TATA), 1,3,5-tris(chloroacetyl)-1,3,5-triazinane (TCAT), 1,3,5-tris(bromoacetyl)-1,3,5-triazinane (TBAT), 1,3,5-tris(bromomethyl)benzene (TBMB) and 2,4,6-tris(bromomethyl)-1,3,5-triazine (TBMT).

9. The inhibitor of claim 1, wherein at least one of the following items (i) to (iv) applies: (i) (X.sup.1) is D-Arg-D-Ser, (ii) (X.sup.4) is 4-fluoro-phenylalanine, (iii) (X.sup.10) is H, and/or (iv) (X.sup.13) is (S)-3-homoarginine; wherein (X.sup.16) is optionally absent, and the connecting molecule is TATA.

10. The inhibitor of claim 1, wherein the inhibitor has an inhibitory constant (K.sub.i) for FXIIa of less than 100 nM.

11. An ex vivo method of inhibiting the enzymatic activity of FXIIa comprising contacting the inhibitor of claim 1 with FXIIa, wherein FXIIa is present in a blood, plasma or serum sample.

12. A pharmaceutical composition comprising the inhibitor of claim 1.

13.-14. (canceled)

15. A kit for testing blood coagulation comprising the inhibitor of claim 1.

Description

[0122] The figures show.

[0123] FIG. 1 Phage selection of bicyclic peptide FXIIa inhibitor. (a) Sequences of peptides isolated against -FXIIa after 3 selection rounds. The three cysteines highlighted in grey were cyclized with the thiol-reactive linker TATA prior to affinity panning. Sequence similarities between peptides are highlighted in color. For Kis, average values of at least two measurements are indicated. (b) Activity and specificity of the best two FXIIa inhibitors selected from the library. Standard deviations are indicated. (c) aPTT and PT of a previously developed bicyclic peptide FXIIa inhibitor (FXII402) and the two newly developed inhibitors FXII512 and FXII516. Standard deviations are indicated.

[0124] FIG. 2 Affinity maturation, specificity profiling and inhibitory activity of bicyclic peptide FXIIa inhibitors. (a) Sequences of peptides isolated from a semi-randomized peptide library based on FXII516. Sequence similarities between peptides are highlighted in color. (b) Improving binding affinity of FXII516 by three rounds of amino acid substitutions. Indicated standard deviations are calculated based on three Ki values. (c) Target selectivity of FXII618. Standard deviations are calculated based on three or more Ki values. (d) Coagulation parameters aPTT and PT, and FXII activity (FXII:c) at the indicated FXII618 concentrations. Standard deviations of aPTT, PT and FXII:c are calculated based on three measurements.

[0125] FIG. 3 Structure of CTI and bicyclic peptide FXII618. (a) Polypeptide sequences of CTI (left) and FXII618 (right). The chemical linker TATA connects the three cysteines of the bicyclic peptide via thioether bonds. Residues binding to the specificity pockets S2, S1 and S1 of FXIIa are indicated. (b) Structure models for CTI (upper figure) and FXII618 (lower) bound to FXIIa. The TATA linker of the bicyclic peptide is shown in green. (c) Superposition of the combining loops of CTI and FXII618 bound to FXIIa. (d) Dihedral angles of phi (solid lines) and psi (dashed lines) of combining loops in CTI bound to FXIIa (orange), free CTI (red) and FXIIa-bound FXII618 (blue). (e, f) Combining loops of CTI (e) and FXII618 (f) illustrating the complementarity of the inhibitors to the FXIIa active site region.

[0126] FIG. 4 Comparison of FXII618 and CTI. (a) Specificity profile and inhibitory activity of CTI (upper panel) and FXII618 (lower panel). The residual activity of several trypsin-like serine proteases is shown. Standard deviations are shown. (b) Comparison of aPTT in citrated platelet poor plasma in the presence of the same quantities of FXII618 and CTI. Standard deviations are calculated based on three measurements. (c) Thrombin generation by CAT in citrated platelet poor plasma triggered by elagic acid (intrinsic pathway activation) in the presence of various CTI (upper panel) and FXII618 concentrations (lower panel).

[0127] FIG. 5 Comparison of FXII618 and CTI in low-TF induced TGA in plasma by CAT. Thrombin generation in citrated platelet poor plasma was triggered by 0, 1 and 0.25 pM TF in the absence or presence of 100 g/mL inhibitor CTI or FXII618.

[0128] FIG. 6 Structure-activity relationship (SARI of the FXIIa inhibitor.

[0129] FIG. 7 Chemical structure of connecting molecules.

[0130] FIG. 8 Chemical ring structure of FXII618.

[0131] FIG. 9 Amino acids sequences inhibitors of the coagulation enzyme FXIIa which have been identified in connection with the present invention. The cysteins in theses amino acids sequences inhibitors are linked with TATA.

[0132] FIG. 10 (a) Stability of bicyclic peptides in human plasma. The apparent IC.sub.50 was determined after incubating the peptides in human plasma at 37 C. for the indicated time periods. Average values of three measurements are indicated. (b) Specificity of bicyclic peptide 73 (FXII801). Average values of at least three measurements. Standard deviations are indicated.

[0133] FIG. 11 Coagulation parameters aPTT (a) and PT (b) for bicyclic peptides 1 (FXII618), 61 (FXII800) and 73 (FXII801). Standard deviations of aPTT, PT are calculated based on three measurements.

[0134] FIG. 12 (a) Chemical structure of FXII618 (1). (b) Affinity maturation strategy. Carbon atoms are inserted into the peptide backbone by replacing -amino acids with -amino acids, or by replacing cysteines connected to the cyclization linker with cysteine homologues having longer side chains.

[0135] FIG. 13 Coagulation parameters aPIT (a) and PT (b) for FXII618, FXII700 and FXII701.

[0136] FIG. 14 Activity and specificity of FXII618-TATA, FXII618-TBAT and FXII618-TBMT. Standard deviations are indicated.

[0137] The examples illustrate the invention.

EXAMPLE 1GENERATION AND TESTING OF FXII618

Example 1.1Experimental Procedures

[0138] Phage Selections Against Activated Human FXII

[0139] The bicyclic peptide phage display libraries (library 33, 44 and 66) were produced and three rounds of phage selection were performed following previously described procedures.29 For each selection, phage were produced in 0.5 L of bacterial culture. Phage were purified by polyethylene glycol (PEG) precipitation. Cysteine residues were reduced with tris(2-carboxyethyl)phosphine (TCEP, 1 mM, 42 C., 1 h) prior to chemical reaction with thiol-reactive reagents 1,3,5-triacryloyl-1,3,5-triazinane (TATA, 150 M, 30 C., 1 h) or N,N,N-(benzene-1,3,5-triyl)-tris(2-bromoacetamide) (TBAB, 40 M, 30 C., 1 h) in 80% aqueous buffer (20 mM NH.sub.4HCO.sub.3, 5 mM EDTA, pH 8.0) and 20% acetonitrile. Human 11-FXIIa (HFXIIAB; Molecular innovations. Novi, Mich., USA) was biotinylated and 5 g immobilized on streptavidin or neutravidin magnetic beads. Binders were eluted at acidic pH. In affinity maturation selections, less biotinylated FXIIa was used: either 0.2 g in both rounds of selection or 2 g in the first round and 0.2, 0.5 or 1 g in the second round.

[0140] Cloning of the Affinity Maturation Library

[0141] Randomized DNA sequences were appended by degenerate primers to the gene of phage p3 in a PCR reaction and the product inserted into the phage vector pECO2 at the two Sill restriction sites..sup.29 Forward primer: VBfLvb21_for (TATGCGGCCCAGCCGGCCATGGCANNKTGTNNKAGGCTGNNKTGCNNKCAGITGNNKTGTNNKG GTTCTGGCGCTG) (SEQ ID NO: 91), reverse primer sfi2notfo (CCATGGCCCCCGAGGCCGCGGCCGCATTGACAGG) (SEQ ID NO: 92). Electroporation of 4.4 g ligated vector into TG1 cells yielded 8.8106 colony forming units (c.f.u.) on large (140 mm diameter) chloramphenicol (30 g/mL) 2YT agar plates Colonies were scraped off the plates with 2YT media, supplemented with 15% v/v glycerol and stored at 80 C.

[0142] aPTT, PT and FXII coagulant activity (FXII:c) measurements Coagulation times (aPTT, PT) and FXIIa activity were determined in human plasma using an automated blood coagulation analyzer (Sysmex CS-5100, Siemens, Eschborn, Germany) with according to the manufacturer's instructions (Siemens). Extrinsic coagulation was triggered with Innovin (recombinant human tissue factor, synthetic phospholipids and calcium in stabilized HEPES buffer system; Dade Behring/Simens). Intrinsic coagulation was triggered with Pathromtin* SL (Siemens). Human plasma used in this study was derived from a pool of fresh frozen plasma units provided by the Service Regional Vaudois de Transfusion Sanguine, Switzerland.

[0143] Thrombin Generation Assays: Calibrated Automated Thrombography (CAT)

[0144] Thrombin generation was performed as previously described with some modifications.30 In brief, 60 L platelet poor plasma (PPP), 20 L FXIIa inhibitor/HA buffer (Hepes 20 mM, NaCl 140 mM, pH 7.4, 5 mg/mL BSA), and 20 L PPP reagent, PPP LOW reagent, MP reagent or Actin FS (1:170 diluted in HA buffer) were mixed in a 96-well microtiter plate (Immulon 2HB; Thermo Fisher Scientific) and incubated for 15 min at 37 C. Thrombin generation was triggered by the addition of 20 L of substrate/calcium chloride buffer (FLUKA) at 37 C. Samples were tested in triplicate for each condition. Fluorogenic thrombin substrate hydrolysis was measured every 20 s for 120 min on a microplate fluorometer (Fluoroskan Ascent FL; Thermo Fisher Scientific) with a 390/460-nm (excitation/emission) filter set. Data analysis was performed on the Thrombinoscope software (Synapse By). PPP reagent (TF 5 M, PL 4 M), PPP LOW reagent (TF 1 M, PL 4 M), MP reagent (PL 4 M), thrombin calibrator and FLUKA were purchased from Synapse By.

[0145] Blood Collection for Thrombin Generation Measurement Post-Addition of the Inhibitor in Whole Blood

[0146] Venous blood was collected from healthy volunteers by antecubital venipuncture with 19-gauge needles in 3,2% (w/v) citrated Monovette plastic tubes. In order to minimize contact activation, the first collection tube containing EDTA was discarded according to standard procedures. FXII618 was added soon after the blood collection (1 min) to the tube to a final concentration of 100 g/mL. Blood was then processed to PPP by an initial centrifugation step at 2,000 g for 5 min followed by a second centrifugation step at 10,000 g for 10 min. Plasma aliquots were stored at 80 until analysis.

[0147] Bicyclic Peptide Synthesis

[0148] Peptides were synthesized in house by standard solid-phase peptide synthesis using Fmoc-protected amino acids and Rink Amide AM resin. Amino acids were coupled twice at 4-fold molar excess using HBTU and HOBt as coupling reagents. All peptides synthesized have a free N-terminus and an amidated C-terminus. Peptides were cleaved from the resin under reducing conditions (90% TFA, 2.5% H2O, 2,5% thioanisol, 2,5% phenol, 2.5% 1.2-ethanedithiol). Crude peptide at a concentration of 1 mM was reacted with either 1.5 mM TATA or TBAB in 70% aqueous buffer (20 mM NH4HCO3, 5 mM EDTA, pH 8.0) and 30% acetonitrile for 1 hour at 30 C. The cyclized peptides were purified by reversed-phase chromatography on a C18 column. Pure bicyclic peptides (>95% purify) were lyophilized and dissolved in water. Their mass was confirmed by ESI.

[0149] Protease Inhibition Assays

[0150] The inhibitory activity of bicyclic peptides was determined by incubation with proteases and quantification of their residual activity with a fluorogenic substrate. Final concentration of human b-FXIIa (HFXIIAB; Molecular Innovations) and mouse -FXIIa (MFXIIA; Molecular Innovations) was 10 nM. Dilutions of peptides were prepared ranging from 0.2-200 mM. Fluorescence intensity was measured with an Infinite M200Pro fluorescence plate reader (excitation at 355 nm, emission at 460 nm; Tecan, Mnnedorf, Switzerland). The reactions were performed at RT. Sigmoidal curves were fitted to the data using the following dose response equation wherein x=peptide concentration, y=% activity of reaction without peptide, A1=100%, A2=0%, p=1. IC50 values were derived from the fitted curve.

[00001]$y=A_1+\frac{A_2-A_1}{1+{10}^{{\left({\mathrm{LOG}}_x.Math.0-x\right)}_p}}$

[0151] The inhibitory constant Ki was calculated according to the equation of Cheng and Prusoff.sup.29 Ki=/050/(1+([S]0/Km) wherein IC50 is the functional strength of the inhibitor, [S]0 is the total substrate concentration, and Km is the Michaelis-Menten constant.

[0152] Ex Vivo Coagulation Assays

[0153] Coagulation times (aPTT, PT) and FXIIa activity were determined, at least in duplicate, in human plasma using an automated blood coagulation analyzer (Sysmex CA-7000) with standard reagents according to the manufacturer's instructions (Siemens Healthcare, Eschborn, Germany). Human plasma used in this study was derived from a pool of fresh frozen plasma units provided by the Service Regional Vaudois de Transfusion Sanguine, Switzerland.

[0154] Homology Modeling

[0155] Homology models of -FXIIa with tetrapeptides of CTI and FXII618 bound in the standard mechanism to the S2, S1, S1 and S2 sub-sites was built using X-ray cocrystal structure data sets 1PPE, 2TT and 4AOQ as templates. Non-essential water molecules and ions were deleted in the PDB files and the peptide ligands truncated to retain only the P2, P1, P1 and P2 residues. -FX is and the tetrapeptides of CTI and FXII618 were aligned with b-trypsin and the tetrapeptides of the three ligands using the alignment scripts from MODELLER software.sup.30. The proteins and peptides were aligned based on conserved amino acids. b-FXIIa shares 35.7% sequence identity and 54.4% sequence similarity with b-trypsin (amino acids 16-245, chymotrypsin numbering). A distance constrain of 2.9+/0.1 between the 11 amino groups of P1 arginine and the d oxygen of aspartic acid 189 in -XIIa was defined. The MODELLER Software was used to build models with bound peptidic tetrapeptides. The model with the lowest energy was used further for molecule dynamics simulations with Amber 11 Software (R. Salomon-Ferrer, A. W. Gtz, 2013). In the structure of FXII618, the three cysteines were manually connected with TATA. AMBER force field was used for preparing the sander input files with tleap. TIP3P waters were used to solvate the structures. The system was first minimized by holding the conformation of b-FXIIa and the bound peptide, and then only the interacting residues at S2, S1, S1 and S2 pocket. Finally the whole system was minimized. Then the system was heated to 300 K before an equilibration on the whole system. The production equilibration was run at 300 K with constant pressure and periodic boundary for 20 ns. The Langevin dynamics was used to control the temperature using a collision frequency of 1.0 ps-1. Then the final structures were analyzed. All the calculations were perform in the GPU-accelerated cluster ELECTRA provided by scientific IT and application support (SCITAS) at EPFL.

[0156] Inhibition of FXII Activity In Vivo

[0157] Female BALB/c mice were anesthetized with 125 mg/kg pentobarbital. After five minutes, mice were injected r.o. with either 3.5 mg/kg FXII618 combined with 3.5 mg/kg PK128 (N=3), or with PBS (N=2) as a control. Five minutes later, blood was collected from the vena cava at a 1:9 blood to citrate ratio. Plasma was prepared by centrifugation at 2,400 g 10 minutes at RT. FXIIa activity was assessed as described above.

Example 1.2Screening of Structurally Diverse Bicyclic Peptide Libraries

[0158] Six combinatorial phage display libraries comprising jointly more than ten billion different bicyclic peptides were developed using novel peptide cyclization reagents and more diverse peptide formats. The libraries were panned against human -FXIIa, a naturally occurring proteolytic product of FXIIa comprising only the catalytic domain. The libraries were generated by cyclizing linear peptides of the format CXnCXnC (C=cysteine, X=random amino acid; n=3, 4, 6) displayed on phage with either of the thiol-reactive reagents 1,3,5-triacryloyl-1,3,5-triazinane (TATA) or N,N,N-(benzene-1,3,5-triyl)-tris(2-bromoacetamide) (TBAB). These chemical linkers impose different peptide backbone conformations in bicyclic peptides in comparison to the previously applied reagent 1,3,5-tris(bromomethyl)benzene (TBMB)..sup.19, 20 Affinity selections performed with TBAB-cyclized peptides led to the isolation of binders but not inhibitors. In contrast, bicyclic peptides isolated from TATA-cyclized peptide libraries yielded FXIIa inhibitors with K.sub.is for -FXIIa ranging from 0.16+/0.07 M to 10.2+/0.9 M (FIG. 1a). Further characterization of the two most potent peptides, FXII512 (K.sub.i of 0.16+/0.07 M) and FXII516 (0.16+/0.08 M) showed that they cross-react with mouse FXIIa (-FXIIa; Ki of 0.32+/0.07 M and 0.45+/0.16 M, respectively) (FIG. 1b). A specificity profiling with a panel of structurally and functionally related serine proteases showed that FXII512 inhibits human tissue-plasminogen activator (tPA; K.sub.i=8.8 M), a coagulation-associated enzyme involved in fibrinolysis. FXII516 did not inhibit significantly any of the proteases tested at a concentration as high as 50 M.

[0159] The higher selectivity of FXII516 over FXII512 in regard to FXIIa inhibition was further observed in coagulation assays. Activated partial thromboplastin time (aPTT) and prothrombin time (PT) were measured in human plasma in the presence of FXII512 or FXII516 at three different concentrations. FXII402, the previously developed inhibitor of FXIIa (cyclized with TBMB; K.sub.i=1.2 M)..sup.18 was used for comparison. aPTT and PT measure the time to coagulation upon initiation of coagulation either via the intrinsic (aPTT) or the extrinsic pathway (PT). Selective FXIIa inhibition is expected to increase aPTT but not PT. In the case of a complete FXIIa inhibition; the aPTT and PT should be comparable to those measured in FXII-deficient plasma (aPTT>170 seconds and steady-state PT; Service and Central Laboratory of Hematology; Lausanne University Hospital, Switzerland). As shown in FIG. 1c, the newly developed bicyclic peptides were more potent than FXII402 in inhibiting the intrinsic pathway of coagulation, as observed by the longer aPTT for equal inhibitor concentrations. FXII512 inhibited the strongest the intrinsic pathway but presented a prolonged, non-physiological PT at a concentration of 50 M and above. In contrast FXII516 efficiently inhibited the intrinsic pathway without affecting the extrinsic pathway, even at the highest inhibitor concentration tested (100 M), and offered a promising lead. Screening the newly developed, structurally more diverse libraries had thus yielded an inhibitor that was substantially more potent than the best peptide previously developed by phage display..sup.16

Example 1.3Engineering of a Potent and Selective FXIIa Inhibitor

[0160] The potency of FXII516 was further improved by altering amino acids outside the consensus region. Screening of a phage display library of the form XCXRLXCXQLXCX (consensus sequence is underlined, X=random amino acid) did not yield improved binders but the sequences showed an extended consensus sequence and gave hints for beneficial amino acid substitutions in FXII516 (FIG. 2a). Most notable is the convergent evolution of amino acids in position 1 to aliphatic amino acids and arginine, in position 3 and 6 to proline, in position 8 to alanine, and in position 11 to arginine. Variants of FXII516 with single amino acid substitutions showed up to 4-fold improved inhibitory activities (FIG. 2b; 1st round). Accumulation of further mutations by two iterative cycles of mutation and screening yielded peptide FXII618 that inhibits human R-FXIIa with a Ni of 22+/4 nM (FIG. 2b; 2nd and 3rd round). -FXIIa was inhibited to the same extent (Ki=19+/1 nM). FXII618 also inhibited mouse FXIIa with a Ni of 252+/29 nM, but not structurally-related or functionally-important proteases (FIG. 2c). FXII618 presents an 8-fold and a 60-fold improvement in inhibiting human FXIIa in comparison to its parent FXII516 and to the previously developed TBMB-cyclized inhibitor FXII402, respectively. The potency and specificity of FXII618 was further assessed in in vitro coagulation assays. At concentrations as low as 40 M, the bicyclic peptide completely inhibited initiation of coagulation via the intrinsic pathway (aPTT>170 seconds) without affecting the extrinsic pathway (steady-state PT). Consistently, at 50 M, FXII coagulant activity (FXII:c) was reduced to <5% (FIG. 2d).

Example 1.4FXII618 Mimics Binding Mode of Corn Trypsin Inhibitor

[0161] Comparison of the identified consensus sequences with binding loops of natural FXIIa inhibitors showed a striking similarity between the first ring of the most potent bicyclic peptide FXII618 (RCFRLPCRQLRCR) and the combining loop of corn trypsin inhibitor (CTI; . . . IGPRLPW . . . ) (identical amino acids are underlined). The homology was even mere pronounced for the consensus sequence found in the affinity maturation approach that led to the development of FXII618 (XCPRLPCXQL.sup.R/.sub.KCX; FIG. 2a) and suggested that this bicyclic peptide has the same binding mode as CTI (FIG. 3a). CTI is a 13.6 kDa protein from corn seeds that equally inhibits FXIIa and trypsin. It is broadly applied to suppress activation of contact phase in coagulation assays. The 127 amino acid protein containing 5 disulfide bridges (PBD: 1BEA) is a canonical inhibitor that obeys the so-called standard mechanism of inhibition23 in which a peptide loop of the inhibitor binds essentially as polypeptide substrates of the enzyme. Arg34 of CTI binds into the S1 specificity pocket of FXIIa..sup.2

[0162] It was tested if FXII618 can indeed adopt a conformation that is complementary to the active site of FXIIa by homology modeling and molecular dynamics simulation. As no co-crystal structure of CTI and FXIIa existed, also the CTI-FXIIa complex was modelled. The co-crystal structures of the homologous serine protease bovine -trypsin and CMTI-I (a trypsin inhibitor from squash seeds; PDB: 1PPE), SGPI-1-P02 (schistocerca gregaria protease inhibitor 1; PDB: 2TT), and SOTI-III (spinacia oleracea trypsin inhibitor PDB: 4AOQ) served as structural templates for the homology modeling. 36% of the amino acids of FXII catalytic domain (amino acids 16.254) and bovine R-trypsin are identical. CMTI-I, SGPT-1-P02 and SOTI-ill bind trypsin according to the standard mechanism. The binding loops of CTI and FXII618 formed complementary structures to FXIIa (FIG. 3b). The backbone as well as the side chain of arginine of the combining loop in CTI was superposing with the one of the first ring of FXII618 (FIG. 3c). The Ramachandran angles of the combining loop in free CTI (taken from PDB: 1BEA) remained essentially the same when the inhibitor was bound to the protease (FIG. 3d). The dihedral angles of the 4 amino acids in ring 1 of FXII618 (FRLP) were similar to those of the equivalent amino acids in the model of bound CTI (FIG. 3d). A structure representation of the enzyme-inhibitor complex underscores the complementarity of the bicyclic peptide ring 1 with the protease's active site (FIG. 30. The second ring of FXII618 (ring 2) was also fitting to the surface of FXIIa without creating any steric clashes. However, the conformation of ring 2 in the model is less certain as no specific contacts of this peptide region with the surface of FXIIa are found.

Example 1.5FXII618 is Superior to CTI in Suppressing Intrinsic Coagulation Initiation

[0163] The activity and target specificity of FX/1618 and CTI were compared side-by-side in inhibition assays (FIG. 4). FXIIa inhibition was comparable for both inhibitors. In contrast, the target selectivity of FXII618 was better than that of CTI as assessed with a panel of trypsin-like serine proteases sharing structural and functional similarity with FXII. While CTI inhibited substantially the three proteases trypsin (Ki=7+/0.5 nM), plasmin (Ki=5+/1.6 M) and factor XIa (Ki=12.5+/1,4 M) (FIG. 4, upper panel), the bicyclic peptide inhibited only trypsin (Ki=5+/0.5 M) (FIG. 4, lower panel). Compared to CTI, FXII618 inhibited trypsin around 100-fold weaker.

[0164] FXII618 and CTI were also compared side-by-side for their ability to inhibit the initiation of the intrinsic pathway in in vitro coagulation assays (FIG. 4b). As indicated in the introduction, the cost of goods is a major limiting factor in the application of CTI..sup.24 Researchers usually limit expenses by applying the minimal amount of CTI required to largely block FXIIa (30-100 g/mL). Therefore in this experiment the activity per mass of the two inhibitors was compared. The activity per molecule can be derived from the presented data by taking into account the different molecular weights of the two inhibitors (13.6 kDa [CFI]; 1956 Da [FXII618]=factor 7). In a first set of experiments, aPTT was measured in the presence of various inhibitor concentrations. FXII618 blocked contact-triggered coagulation completely at 100 g/mL (aPTT>170 seconds). The same quantity of CTI delayed coagulation to a final aPTT value of only 65.4+/0.5 seconds. At higher CTI concentrations, aPTT values appeared to converge to a plateau being far from complete inhibition. In a second set of experiments, the inhibition of contact activation by the two inhibitors was measured in a real-time thrombin generation assay (TGA).sup.25 triggered by ellagic acid (EA), using CAT (FIG. 4c). FXII618 reduced the EA-induced thrombin generation in a dose-dependent manner, reaching a complete inhibition of thrombin formation already at 20 g/mL FXII618 (>90% reduction of endogenous thrombin potential (ETP) and peak) (FIG. 4c, lower panel). Comparable TGA results were obtained with FXII-deficient plasma. Around 5-times more CTI was needed (100 g/mL) to reduce thrombin generation to background levels (90% reduction of ETP and >96% of peak; FIG. 4c, upper panel). These results show the increased potency of FXII618 over CTI in preventing activation of the intrinsic pathway. To assess the specificity of FXII618 for the intrinsic pathway, thrombin generation was induced via the extrinsic pathway using high concentration of TF (5 M). Even at the highest concentration of 100 g/mL FXII618, the peptide inhibitor did not affect TF-induced thrombin generation. Since contact activation can occur during venipuncture, the effect of adding FXII618 to whole blood directly after collection was tested. Similar results were obtained. Taken together, these data clearly demonstrate the strong potency and specificity of FXII618, which efficiently inhibits the contact system and thereby the initiation of the intrinsic pathway without having any effect on the extrinsic pathway.

Example 1.6FXII618 Efficiently Blocks Contact Activation in Low-TF Diagnostic Tests

[0165] As described in the introduction, coagulation assays triggered with low TF concentration (<1 pM) mimic best the coagulation processes under physiologic conditions. However, at the low TF trigger concentrations, contact activation contributes substantially to thrombin generation and falsifies the result. FXII618 and CTI were compared for their ability to inhibit contact activation in low-1F thrombin generation assays in plasma (FIG. 5). When thrombin generation was triggered using 1 pM TF, no significant effect of FXII618 or CTI could be observed (FIG. 5, top panel). Instead, at 0.25 pM TF, FXII618 reduced the endogenous thrombin potential to a similar extent as CTI, but delayed the lag time more potently (lag time: 12.30.3 and 8.00.2, respectively) (FIG. 5, middle panel). In thrombin generation performed in the absence of an extrinsic- or intrinsic-specific trigger, FXII618 inhibited contact activation significantly stronger than CTI (lag time: 55.83.7 and 38.71.9, and peak: 60.30.8 and 78.06.8, respectively; FIG. 5, bottom panel).

[0166] It was finally tested if the bicyclic peptide could delay even more the thrombin generation if it is added to whole blood immediately after blood sampling. Thrombin generation was tested in plasma. Similar results were found as in the experiments in which the inhibitor was added to the plasma. In the absence of an extrinsic- or intrinsic-specific trigger, FXII618 could even completely block thrombin activation. This latter finding indicates that FXII activation taking place in the blood sampling tube can be suppressed if the inhibitor is added immediately after blood collection. The improved blockade of contact activation by FXII618 in comparison to CTI unravels the potential of this synthetic inhibitor to replace CTI in low-TF diagnostic tests.

Example 1.7Selective Inhibition of Intrinsic Coagulation in Mice

[0167] FXII618 is cross-reactive with mouse FXIIa which allowed testing its activity in mice. As the Ki for mouse FXIIa (252+/29 nM) is 11-times higher than for human FXIIa (22+/4 nM), FXII618 was combined with a previously described bicyclic peptide inhibitor of plasma kallikrein (PK), PK12819. Upon activation of small amounts of FXII with negatively charged surfaces, FXIIa activates plasma kallikrein (PK) which reciprocally activates larger amounts of FXII. Inhibiting both proteases results in synergic blockade of FXIIa by inhibiting the activity of FXII as well as its activation. Administration of 3.5 mg/kg FXII618 combined with 3.5 mg/kg PK128 reduced FXII activity to 49.7+/13.9%. Consistent with the ex vivo data obtained in human plasma, PT values were comparable between inhibitor-treated (7.1+/0.2 seconds) and PBS-control mice (6.7+/0.3 seconds), showing that the extrinsic pathway remained unaffected.

EXAMPLE 2NATURAL AND UNNATURAL AMINO ACID SUBSTITUTIONS IN FXII618

Example 2.1Material and Methods

[0168] Bicyclic Peptide Synthesis:

[0169] Peptides were synthesized in house by standard solid-phase peptide synthesis using Fmoc-protected amino acids and Rink Amide AM resin. Amino acids were coupled twice at 4-fold molar excess using HBTU and HOBt as coupling reagents. Coupling of unnatural amino acids was performed manually by adding 2 eq of Fmoc-protected amino acid, 2 eq of HATU and 4 eq of DIPEA. All peptides synthesized have a free N-terminus and an amidated C-terminus. Peptides were cleaved from the resin under reducing conditions (90% TFA, 2.5% H.sub.2O, 2,5% thioanisol, 2,5% phenol, 2,5% 1.2-ethanedithiol). Crude peptide at a concentration of 1 mM was reacted with 1,5 mM TATA in 70% aqueous buffer (50 mM NH.sub.4HCO.sub.3, pH 8.0) and 30% acetonitrile for 1 hour at 30 C. The cyclized peptides were purified by reversed-phase chromatography on a C18 column. Pure bicyclic peptides (>95% purity confirmed by analytical HPLC) were lyophilized and dissolved in water. Their mass was confirmed by ESI.

[0170] Protease Inhibition Assays

[0171] The inhibitory activity of bicyclic peptides was determined by incubation with proteases and quantification of their residual activity with a fluorogenic substrate. Residual enzymatic activities were measured in buffer containing 10 mM Tris-CI, pH 7.4, 150 mM NaCl, 10 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.1% w/v BSA, 0.01% v/v Triton-X100, and 5% v/v DMSO in a volume of 150 L. In a first series of experiments 50 M of the fluorogenic substrate Z-Gly-Gly-Arg-AMC and 2.5 nM of enzyme (human p-FXIIa, HFXIIAB; Molecular Innovations) was used. Later, the more sensitive substrate Boc-Gin-Gly-Arg-AMC was used allowing to reduce the enzyme concentration to 0.5 nM and hence be able to measure lower K.sub.i values. Control experiments showed that very similar inhibitory constants of the FXIIa-inhibitors were obtained when comparing the two different fluorogenic substrates using the corresponding K.sub.e values mentioned below.

[0172] Dilutions of peptides were prepared ranging from 0.00001-4 M. Fluorescence intensity was measured with an Infinite M200Pro fluorescence plate reader (excitation at 368 nm, emission at 467 nm; Tecan, Mnnedorf, Switzerland). The reactions were performed at 25 C., Sigmoidal curves were fitted to the data using the following dose response equation wherein x=peptide concentration, y=% activity of reaction without peptide, A.sub.1=100%, A.sub.2=0%, p=1. IC.sub.50 values were derived from the fitted curve.

[00002]$y=A_1+\frac{A_2-A_1}{1+{\left({10}^{\left({\mathrm{LOG}}_x.Math.0-x\right)}\right)}_p}$

[0173] The inhibitory constant K.sub.i was calculated according to the equation of Cheng and Prusoff K.sub.i=IC.sub.50/(1+([S].sub.0/K.sub.m) wherein IC.sub.50 is the functional strength of the inhibitor, [S].sub.0 is the total substrate concentration, and K.sub.m is the Michaelis-Menten constant. K.sub.m for the two substrates Z-Gly-Gly-Arg-AMC and Boc-Gln-Gly-Arg-AMC have been determined to be 18031 and 25642 M, respectively (meanSD, n=4).

[0174] For the specificity testing the following final concentrations of human serine proteases were used: tPA (Molecular Innovations) 7.5 nM, uPA (Molecular Innovations) 1.5 nM, factor XIa (Innovative Research, Novi, Mich., U.S.) 6 nM, PK (Innovative Research) 0.25 nM, thrombin (Molecular Innovations) 1 nM, plasmin (Molecular Innovations) 2.5 nM, trypsin (Molecular Innovations) 0.05 nM, factor VIIa (Haematologic Technologies Inc.) 50 nM and factor Xa (Haematologic Technologies Inc,) 6 nM.

[0175] Dilutions of peptides were prepared ranging from 0.04 to 40 M. For the determination of the IC.sub.50 inhibitory constants, the following fluorogenic substrates were used at a final concentration of 50 M: Z-Phe-Arg-AMC (for PK; Bachem, Bubendorf, Switzerland), Boc-Phe-Ser-Arg-AMC (for factor XIa; Bachem); Z-Gly-Gly-Arg-AMC (tPA, uPA, thrombin, and trypsin; Bachem), H-D-Val-Leu-Lys-AMC (for plasmin; Bachem) and D-Phe-Pro-Arg-ANSNH-C.sub.4H, (for FVIIa and FXa; Haematologic Technologies Inc.).

[0176] Plasma Stability Assays

[0177] Peptide (2 l of 2 mM in H.sub.2O) was added to 398 l human plasma (final peptide concentration was 10 M in 400 l final volume). The mixture was incubated in the water bath at 37 C. At 8 different time points (0 h, 30 min, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h and in some cases 48 h) a sample of 30 l was removed, diluted to 200 l with the same buffer used for protease inhibition assay (see above) and heat-inactivated for 20 min at 65 C. During this step proteases present in plasma are being inactivated, that would otherwise interfere with the subsequently performed enzymatic assay. Control experiments showed that incubated peptides are completely resistant to the heat-inactivation procedure and inactivated plasma without peptide inhibitors only weakly affected the activity of FXIIa in the enzymatic assay. After heat-inactivation of the plasma samples, the latter were kept at 20 C. until their inhibitory potencies against FXIIa were analyzed in a protease inhibition assay. Before analysis, plasma samples were centrifuged for 5 min at 16000 g and the supernatant was collected. A twofold dilution series ranging from 0.0005-0.5 M was prepared. IC.sub.50 values were derived from the fitted curve using the equation indicated above. Residual inhibition in % was calculated using the following formula: IC.sub.50, 0h/IC.sub.50, xh*100 wherein IC.sub.50, 0h is the functional strength of the inhibitor at time point 0 and IC.sub.50, xh the functional strength of inhibitor after one of the different plasma incubation period mentioned above.

[0178] aPTT and PT Coagulant Activity Measurements

[0179] Coagulation times (aPTT, PT) were determined in human plasma using a blood coagulation analyzer (STart. Hemostasis coagulation analyzer, Diagnostica Stago). Extrinsic coagulation was triggered with Innovin (recombinant human tissue factor, synthetic phospholipids and calcium in stabilized HEPES buffer system; Dade Behring; Siemens). Intrinsic coagulation was triggered with Pathromtin* SL (Siemens). Pooled normal human plasma used in this study was provided by Innovative research (USA).

Example 2.2Results and Discussion

[0180] In Example 2.2 reference is made peptides by numbers 1 to 73. The peptide of number I is FXII618. Structural features and inhibitory capacity of the peptide of numbers 3 to 72 are also shown in FIG. 6. The structural features and inhibitory capacity of peptide number 73 are detailed in the example.

[0181] Improving the Inhibition Activity

[0182] Based on sequence similarities of peptides isolated in the phage selections against FXIIa, the four amino acids of the first ring (Phe3, Arg4, Leu5, Pro6) and the middle two amino acids of the second ring of peptide 1 (Gin9, Leu10) appeared to be most important for the binding (FIG. 1). In a first attempt to improve the inhibitory activity of peptide 1, it was chosen to replace the amino acids in these positions with natural amino acids having similar side chains. Suitable amino acid substitutions were chosen using the two scoring matrices BLOSUM62 and PAM250 that indicate the evolutionary substitution probability of an amino acid by another one (FIG. 6). To allow precise quantification of the synthesized peptides by absorption spectrometry, a tryptophan residue was appended to the C-terminus of all peptides. This peptide 2 had a K.sub.i of 268 nM and thus an activity comparable to peptide 1. A total of 26 bicyclic peptides, each having one amino acid substituted in one of the six positions, were synthesized. None of the peptides had an improved K.sub.i but valuable structure-activity relationship data was obtained. In the position of Phe3, replacement of phenylalanine with tryptophan conserved the activity (peptide 3; K; 262). All other amino acid substitutions in this position reduced the activity more than 2-fold (tyrosine, leucine, alanine; peptides 4-6) or more than 10-fold (valine, isoleucine, proline; peptides 7-9). In position Arg4, only the substitution to lysine was tested as this residue should have a positive charge to form ionic interaction with an aspartate at the bottom of the S1 binding pocket of FXII. Lysine in this position reduced the inhibitory activity 10-fold (peptide 10; K.sub.i=28321). In the position of Leu5, all substitutions, even those with amino acids closely resembling leucine such as valine (peptide 11) or isoleucine (peptide 12), reduced the affinity more than 50-fold. Peptides containing methionine (peptide 13) or alanine (peptide 14) in this position did not inhibit FXIIa at all at the highest concentration tested (3 M). In position Pro6, two of the amino acid replacements reduced the activity less than 2-fold, namely alanine (peptide 15) and leucine (peptide 18). In the second macrocyclic ring, all substitutions reduced the activity of peptide 2 substantially. In the position of Gln9 the smallest loss was found for aspartate (peptide 21; 54-fold) and in position Leu10 for isoleucine (peptide 26; 8-fold).

[0183] In a second attempt to improve the activity of peptide 1, it was chosen to replace the amino acids with unnatural residues that structurally resemble the original ones more closely (FIG. 6). In position Phe3, unnatural amino acids were tested that resemble phenylalanine (peptides 29-32) and tryptophan (peptides 33-37), as peptides with these two natural amino acids were most active (peptides 2 and 3). Two of the phenylalanine analogues reduced the activity around 30-fold (peptides 29 and 30) and two did not inhibit FXIIa at the highest concentration tested (1 M; peptides 31 and 32). One out of the five peptides with tryptophan analogues had slightly improved activity: peptide 33 containing 2-naphtylalanine had a 2-fold improved inhibitory activity (K; =124). In position Arg4, the amino acid was replaced with one lysine analogue (homolysine; peptide 38) and three arginine analogues (homoarginine, norarginine and 4-guanidinophenylalanine; peptides 39-41). All these substitutions reduced the binding affinity of the peptides 5-fold or more. In the two positions Leu5 and Leu9, several aliphatic amino acids structurally resembling leucine were tested. In position Leu5, these substitutions reduced the binding affinity of the peptides by large factors wherein the smallest drop in affinity was found for norvaline (peptide 42). In position Leu10, all the five unnatural amino acids reduced the affinity by less than 8-fold.

[0184] Many of the 48 peptide variants described above had substantially reduced activities, despite the fact that only one amino acid was replaced at a time and that most of the inserted amino acids were structurally similar to the substituted ones. Peptide 1 most likely had evolved a shape that is complementary to the surface of FXIIa and does not tolerate larger structural changes in most of the amino acid positions. A high structural shape complementarity between ligand and target was previously found for all bicyclic peptide that were studies by X-ray crystallography. In a third attempt to improve the inhibitory activity of peptide 1, it was aimed at testing amino acid substitutions that result in even smaller structural changes in the side chains. It was chosen to modify position Phe3 as this was the only site in which two substitutions with unnatural amino acids had yielded slightly improved inhibitors (FIG. 6).

[0185] Addition of a methyl group to the phenyl ring of Phe3 in ortho- (peptide 51) and para-position (peptide 53) decreased the activity around 5-fold. In contrast, a methyl group in meta-position increased the affinity 2.5-fold (peptide 52; K.sub.i=10.40.6). These results indicated that some space around the side chain of phenylalanine is available but that this space is limited. It was subsequently turned to even smaller structural changes in which existing atoms were replaced. Replacement of a carbon atom with nitrogen in the phenyl ring in meta-position improved the activity around 3-fold (peptide 54; K.sub.i=8.40.3). The same substitution in pare-position reduced the inhibitory activity around 6-fold (peptide 55). Substitution of hydrogen atoms on the phenyl ring with halogen atoms altered the activity dramatically in both directions. Fluorine in meta-position reduced the activity around 2.5-fold (peptide 57). In contrast, fluorine in ortho- and para-position enhanced the activity 2- and 11-fold, respectively (peptide 56: K.sub.i 13.11.2; peptide 58: K.sub.i=2.310.36). The large improvement resulting from fluorine in para position is most likely resulting from a change in the electron distribution. Structural modeling of the interaction of peptide 1 and FXIIa suggested that phenylalanine is buried in an aromatic pocket and is interacting with Tyr439 and His393. Presence of electron-withdrawing groups at the phenyl ring of the peptide such as fluorine likely increase the strength of the pi-pi stacking interactions with the tyrosine residue of the protease and therefore lead to higher binding affinity. It was subsequently tested more substituents in pare position that affect the electron distribution in the phenyl ring. Addition of iodine reduced the activity more than 10-fold (peptide 59) and a nitro group improved the binding affinity 6-fold (peptide 60; =4.50.7). Finally a variant of peptide 58 was synthesized lacking the C-terminal tryptophan that was only introduced due to its large extinction coefficient at 280 nm allowing precise quantification of the concentration based on absorption. The resulting peptide 61 differing from peptide 1 only by the para-fluoro atom on phenylalanine had a K.sub.i of 2.010.07 nM. The bicyclic peptide 61 also termed FXII800 is the first synthetic FXIIa inhibitor with single-digit nanomolar inhibitory constant.

[0186] Improving the Proteolytic Stability

[0187] The bicyclic peptide 1 was found to be inactivated by proteolysis when incubated in human plasma at 37 C. for extended time periods (t.sub.1/2=3.91.9 h). While a half-life of four hours is sufficient to block contact activation in plasma samples used in in vitro applications, as demonstrated in our previous work, it may not be long enough for clinical applications in which FXIIa needs to be inhibited over longer time periods. Mass spectrometric analysis of peptide 1 incubated in human plasma showed that the first proteolytic modification is removal of a 156 Da fragment corresponding to the mass of arginine. Bicyclic peptides without the N- and C-terminal arginine had K.sub.is of 93280 nM (peptide 62) and 28.82.0 nM (peptide 63), respectively. This result suggested that plasma proteases clip off the arginine at the N-terminus. Towards the improvement of the stability, amino acid substitutions in position Arg1 were searched that i) do not reduce much the binding affinity, and ii) prevent proteolytic cleavage of the first amino acid (FIG. 6). Bicyclic peptides with Arg1 replaced were synthesized without the C-terminal tryptophan residue. Natural amino acids such as isoleucine, valine and alanine in place of Arg1 all reduced the affinity >5-fold (peptides 64-66). Replacement with lysine conserved the binding affinity (peptide 67; 27.43.8), suggesting that a positive charge in the side chain is important, D-arginine reduced the binding affinity 3-fold (peptide 68; =89.42.3). Based on this structure-activity data, a number of unnatural amino acids having positively charged side chains were tested (peptides 69-72). Peptides with these amino acids had either a slightly worse or better affinity, the K.sub.is being between 18.5 and 43.1 nM.

[0188] Next the stability of the bicyclic peptides 69-72 was tested by incubating them at a concentration of 10 M in human plasma at 37 C. for different time periods, and measuring the residual inhibitory activity. The activity of the plasma proteases was heat-inactivated by incubation of the samples at 65 C. for 10 minutes. The heat-treatment did not affect the activity of the bicyclic peptides. Two of the four peptides had an improved stability compared to peptide 1 (FIG. 10a). The longest half-life was found for peptide 71 having a norarginine residue at the N-terminus. It had a half-life of 21.72.5 h and thus a 5.5-fold improved stability compared to peptide 1. Then the norarginine substitution was combined with the amino acid replacement that improved best the inhibitory activity of peptide 1 (4-fluoro-phenylalanine in position 3). The resulting peptide 73, also termed FXII801 had a K.sub.i of 3.900.43 nM and plasma half-life of 15.53.9 h.

[0189] Target Selectivity

[0190] The target selectivity of peptide 73 was assessed by measuring the inhibition of structurally related or functionally important proteases, and compared to the specificity profile of peptide 1. Eight of the ten proteases were inhibited less than 20% at the highest concentration tested (40 M). Only two of the paralogous proteases were inhibited by peptide 73, namely trypsin (1.300.01 M) and plasma kallikrein (45.11.5 M). The same two proteases were also inhibited by peptide 1 at similar extents. These results thus showed that the affinity towards FXIIa could be improved while the activity towards other proteases remained essentially unchanged. The new FXIIa inhibitor peptide 73 thus exhibits a good selectivity of 300-fold over trypsin (a protease that is not present in the blood) and at least a 11,000-fold selectivity over other plasma proteases.

[0191] Inhibition of the Intrinsic Coagulation Pathway

[0192] The ability to selectively suppress the intrinsic coagulation pathway was assessed in in vitro coagulation assays. Activated partial thromboplastin time (aPTT) and prothrombin time (PT) measure the time to coagulation upon initiation of coagulation either via the intrinsic (aPTT) or the extrinsic pathway (PT). These tests have been performed in human plasma in the presence of different concentrations of FXIIa-inhibitors. Selective FXIIa inhibition is expected to increase aPTT but not PT. The coagulation tests were carried out with peptide 61 having an excellent inhibitory activity, and the slightly less active but more stable variant peptide 73, and for comparison with the previously developed FXIIa-inhibitor peptide I. The presence of peptide inhibitor prolonged aPTT in a concentration dependent manner (FIG. 11a), whereas PT remained almost unaffected at a concentration of 40 M for all peptides tested (FIG. 11b). At a concentration of 5 M peptide inhibitor no coagulation via the intrinsic pathway occurred within 120 s. Additionally, there was a correlation between inhibitory activity against FXIIa and extent of aPTT prolongation. Peptide 61 and 73 significantly increased aPTT prolongation when compared with peptide 1.

EXAMPLE 3ALTERATIONS WITHIN MACROCYCLIC RINGS OF FXII618

Example 3.1Material and Methods

[0193] Materials

[0194] Fmoc-L--amino acids, O-(benzotriazol-1-yl)-N,N,N,N-tetramethyluronium hexafluorophosphate (HBTU), 1-hydroxybenzotriazole hydrate (HOBt), and Rink Amide AM resin were purchased from GL Biochem (China). Fmoc-8-amino acids were purchased from Chemimpex (USA) and Polypeptide (France).

[0195] Peptide synthesis Peptides were synthesized on an Advanced ChemTech 348- peptide synthesizer (Aapptec, USA) by solid phase peptide synthesis using standard Fmoc procedures (0.03 mmol scale). Rink Amide AM resin was used as solid support and DMF as solvent. Each amino acid was coupled twice (4 eq, 0.2 M in DMF) using HBTU/HOBt (4 eq, 0.45 M in DMF) and DIPEA (6 eq, 0.5M in DMF). The resin was washed four times with DMF after the coupling reaction. The N-terminal Fmoc protecting group was removed with 20% (v/v) piperidine in DMF (RT, 25 min, 400 rpm). The resin was washed five times with DMF after deprotection.

[0196] Peptide Cleavage from the Resin

[0197] Peptides were side chain deprotected and cleaved from the Rink Amide AM resin by incubation with 5 mL cleavage cocktail (90% v/v TFA, 2.5% v/v 1,2-ethanedithiol, 2.5% w/v phenol, 2.5% v/v thioanisole, 2.5% v/v H2O) for 2 h with shaking. The resin was removed by vacuum filtration, and the peptides were precipitated with ice-cold diethyl ether (50 mL), incubated for 30 min at 20 C, and pelleted by centrifugation for 5 min at 4000 rpm (2700 g). The diethyl ether was discarded, and the precipitate was then washed twice with diethyl ether. The remaining solvent was evaporated at RT.

[0198] Peptide Cyclization with TATA:

[0199] The crude peptide (typically 50 mg) was dissolved in 6 mL 33% MeCN and 67% H.sub.2O (giving a concentration of 3.5 mM). To the solution 1,3,5-triacryloyl-1,3,5-triazinane (TATA) (10 mM, 1.2 eq) in MeCN was added. The reaction was started by the addition of degassed aqueous NH4HCO3 buffer (60 mM, pH 8.0) until a final peptide concentration of 1 mM. The reaction was left for 1 h at a 30 C. water bath and then lyophilized.

[0200] Peptide Purification by Reversed-Phase HPLC

[0201] Modified peptide powder was dissolved in 1 mL DMSO, 2 mL MeCN containing 0.1% TFA, and 7 mL H2O containing 0.1% TFA, and purified on a preparative C18 column (Vydac C18 TP1022 250, 22 mm, 10 mm) using a linear gradient of solvent B (MeCN 0.1% v/v TFA) over solvent A (H2O, 0.1% v/v TFA) (13 min, 15-28%, flow rate: 20 mLmin.sup.1). Peaks of the desired product were identified by ESI-MS analysis and lyophilized.

[0202] Protease Inhibition Assays

[0203] The inhibitory activity of the synthesized bicyclic peptides was determined by incubation with the protease and quantification of the residual activity at various peptide concentrations using a fluorogenic substrate. A 2 mM (by weight) stock solution in H.sub.2O was made for each peptide. For the assay, serial dilutions were made from the peptide stock solution using aqueous buffer containing 10 mM TRIS, 150 mM NaCl, 10 mM MgCl (hexahydrate), 1 mM CaCl.sub.2 (dihydrate), 0.01% (v/v) Triton X-100, 0.1% (w/v) BSA and pH adjusted to 7.4. The final concentration of human 3-FXIIa (HFXIIAB; Molecular Innovations) was 1 nM or 0.5 nM. Dilutions of peptides were made in the range 3000-0.1 nM, depending on affinity. The final concentration of the fluorogenic substrate Boc-Q-G-R-AMC (Bachem) was 50 M and the final DMSO content was 5%. The fluorescence was measured using an Infinite M200 Pro plate reader (Tecan) with filters 368 nm for excitation and 467 nm for emission. The measurement was performed for 60 min with a read every minute at 25 C. IC50 and K.sub.i values were calculated using GraphPad Prism 5 software.

[0204] Coagulation Assays

[0205] Coagulation times (aPTT and PT) were determined in human plasma using a STAGO STart4 Coagulation analyzer (Diagnostica) according to the manufacturer's instructions. Extrinsic coagulation was triggered with Innovin (recombinant human tissue factor, synthetic phospholipids, and calcium in stabilized HEPES buffer system; Dade Behring/Siemens). Intrinsic coagulation was triggered with Pathromtin* SL (Siemens). Human single donor plasma used in this study was provided by Innovative research (USA).

Example 3.2 Results and Discussion

[0206] In Example 3.2 reference is made to peptides by numbers 1 and 74 to 107. The peptide of number 1 is FXII618. Structural features and inhibitory capacity of the peptide of numbers 74 to 106 are also shown in FIG. 6. The structural features and inhibitory capacity of peptide number 107 are detailed in the example.

[0207] In this example the bicyclic peptide FXII inhibitor FXII618 has been affinity maturated (1) by altering the backbone rather than the side chains. Specifically, it was proposed to insert carbon atoms in different positions of the macrocyclic ring. It was reasoned that peptides with a ring size enlarged were not sampled in the phage display screen. It was further speculated that inserting carbon atoms in some sites of the backbone might allow a better positioning of some groups in the cyclic peptide and that this in turn could potentially improve the strength of existing molecular interactions. Inserting or deleting single carbon atoms at different positions in macrocyclic rings of peptide ligands has not been reported as a systematic approach for improving binding affinity. In several examples described in the literature, atoms were inserted or deleted at the sites where the peptides are cyclized.

[0208] A technically simple and fast strategy for inserting carbon atoms into the macrocyclic rings of peptides is by replacing the canonical -amino acids with 6-amino acids that contain an additional carbon atom between the amino and carboxyl group (FIG. 12a). -amino acids were widely used to improve the stability of -helical peptides..sup.31-34 In some studies, -amino acids had improved in addition to the stability also the binding affinity, as for example in an analogue of parathyroid hormone receptor-1 agonist.sup.35 or an engineered VEGF signaling inhibitor based on the Z-domain..sup.36 Towards the affinity maturation of FXII618 (1), it was chosen to substitute -amino acids in different positions of the two macrocyclic rings with -amino acids.

[0209] In order to identify amino acid positions in which insertion of a carbon atom could potentially improve the binding affinity of FXII618..sup.37 two series of peptide variants were synthesized: one having individual amino acids replaced by 6-alanine, and the other one having them replaced by glycine (FIG. 6). Comparison of the peptides containing -alanine and glycine in a specific position allowed understanding if the additional carbon atom enhances binding to FXII, independent of the amino acid side chain. Substitution of Phe3, Arg4 and Leu5 to -alanine (74, 76, 78) inactivated the inhibitor completely, allowing no comparison with the peptides having glycine in these positions (75, 77, 79; no inhibition at 2 M). Substitution of Pro6 to 6-alanine (80) and glycine (81) reduced the affinity around 5.5- and 22-fold, respectively. The smaller loss in binding affinity found for the -alanine variant indicated that insertion of one carbon atom in this position enhances the binding to FXII. Most likely, the additional flexibility allowed the bicyclic peptide adopting a conformation in which one or several of the existing non-covalent interactions were strengthened. Amino acid replacement at Arg8 had the opposite effect, giving a larger affinity drop for the peptide with the 6-alanine (82, 83). In the positions Gln9 and Leu10 substitutions to -alanine and glycine reduced affinity by around the same factor of 200 (84, 85, 86, 87). Finally, in position Arg11, the loss in affinity was small and similar for the -alanine (88) and glycine variants (89) (5-fold). Given the small loss in affinity, there was a realistic chance that insertion of -amino acids having arginine side chains can improve the affinity of FXII618 (1).

[0210] Based on the results of the -alanine/glycine screen, Pro6 and Arg11 were considered as the most promising sites for insertion of 6-amino acids with suitable side chains. -amino acids can have side chains at either the alpha (C2) carbon or the beta (C3) carbon and are denoted .sup.2- and .sup.3-residues, respectively. Given that these carbon atoms can have R or S configuration, four diastereoisomeric 6-amino acids exist for any given side chain. Pro6 was first substituted with a range of cyclic 6-amino acids (FIG. 6). All these substitutions reduced the inhibitor activity at least 100-fold or inactivated it completely (90-94). The cyclic 6-amino acids apparently imposed conformational constraints onto FXII618 that hindered efficient binding to FXII. Peptides in which Pro6 was substituted with acyclic -amino acids having methyl groups linked to either the carbon 3, carbon 2 or the amino group were subsequently synthesized (95-99; FIG. 6). It was reasoned that the methyl groups could replace interactions that were formed by one of the three carbon atoms in the side chain of proline. Three of these peptides had inhibitory constants in the medium micromolar range (95, 98, 99), but they all had weaker K.sub.is than the peptide with -alanine in this position. The second one of the positions that were identified to tolerate the -alanine substitution was Arg11. This amino acid was replaced with the .sup.3-amino acid resembling structurally best L-Arg (S configuration in C3; (S)-.sup.3-homoarginine) (100). This substitution yielded a peptide with a 4-fold improved (the bicyclic peptide is named FXII700; 5.40.1 nM; FIG. 6). Given that the two peptides with -alanine and glycine in this position had a comparable affinity, it is likely that the large affinity improvement achieved with (S)-.sup.3-homoarginine results from interactions of the arginine side chain that are better for the .sup.3-amino acid than for L-Arg.

[0211] Another efficient synthetic strategy for inserting carbon atoms into the ring systems of bicyclic peptide FXII618 (1) is by substituting the cysteines with homocysteine or 5-mercapto-norvaline, having one and two additional carbons in the side chains, respectively. Six variants of FXII618 (1) were synthesized, each having one of the three cysteines replaced by either of the two cysteine homologues (FIG. 6). Replacement of the Cys12 with homocysteine improved the binding 1.3-fold, (K.sub.i of 105=16.33 nM). Replacement of the other two cysteines reduced the binding. The bicyclic peptide 105 having an excellent K.sub.i was named FXII701. The two modifications that gave excellent affinity improvement, Arg11 to (S)-.sup.3-homoarginine and Cys12 to homocysteine, were subsequently combined. The resulting peptide (107) had a K.sub.i of 182 nM, showing that the two modifications provide no further affinity enhancement. Given the proximity of Arg11 and Cys12, it could be that the molecular basis for the affinity improvement achieved with the two modifications is related, and thus not additive. It is tempting to speculate that the insertion of a carbon atom in the two positions allows a small conformational change in this region of the macrocycle and that the quality of a molecular interaction, as for example an interaction of the arginine side chain, is improved.

[0212] In summary, the binding affinity of in vitro evolved cyclic peptide ligands can be improved by varying the size of the macrocyclic rings by one or two carbon atoms. It is reasoned that this chemical space is not sampled by screening genetically encoded cyclic peptide libraries and could potentially offer a rich source for slightly improved ligands. Indeed, synthesis and screening of only 34 peptide variants of the bicyclic peptide FXII inhibitor FXII618 yielded two inhibitors with substantially improved K.sub.is.

EXAMPLE 4SUBSTITUTION OF THE CONNECTING MOLECULE OF FXII618

[0213] Peptide FXII618 (RCFRLPCRQLRCR) was modified by the following linkers

##STR00001##

[0214] Modification Protocol:

[0215] The synthetic peptides were dissolved in aqueous buffer NH.sub.4HCO.sub.3 (60 mM) pH 8.0 at a final concentration of 1 mM. The linkers dissolved in acetonitrile were added to the peptides to obtain the final concentrations of 1.5 mM and 20% acetonitrile. The reaction solutions were kept in a 30 C. water bath for 1 h. The reaction product was purified by reversed-phase HPLC.

[0216] Protease Inhibition Assays:

[0217] Residual activities were measured in buffer (150 L) containing 10 mM TrisCl, pH 7.4, 150 mM NaCl, 10 mM MgCl.sub.2, 1 mM CaCl.sub.2, 0.1% w/v bovine serum albumin (BSA), 0.01% v/v Triton-X100, and 5% v/v DMSO. Final concentrations of human factor XII beta (Innovative Research) 10 nM; Z-Gly-Gly-Arg-AMC (7-amino-4-methylcoumarin)-derived fluorogenic substrate (Bachem) were used at final concentrations of 50 M. Fluorescence intensity was measured with a Tecan Infinite M 200 Pro plate reader (excitation at 368 nm, emission at 468 nm). The readings were measured in triplicate.

[0218] The inhibitory constant (Ki) was calculated according to the Cheng-Prusoff equation: IC.sub.50/(1+([S].sub.0/K.sub.m)), where IC.sub.50 is the functional strength of the inhibitor, [S].sub.0 is the total substrate concentration, and K.sub.M is the Michaelis-Menten constant. K.sub.M for Z-Gly-Gly-Arg-AMC is 180 M.

[0219] K.sub.i values:

[0220] FXII618-TATA: 24.95.7 nM

[0221] FXII618-TBAT: 33832 nM

[0222] FXII618-TBMT: 121894 nM

[0223] The activity and specificity of FXII618-TATA, FXII618-TEAT and FXII618-TBMT are also shown in FIG. 14.

EXAMPLE 5VARIATION OF ARGININES IN FXII618 AND COMBINATION OF ADVANTAGEOUS AMINO ACID SUBSTITUTIONS IN FXII618

Example 5.1Variation of Amino Acids in Positions Arg8 and Arg11 of FXII618

[0224] These two positions were not exhaustively modified in the first affinity maturation efforts. Peptides with substitutions in these two positions were synthesized and tested for inhibition of human FXIIa, mouse FXIIa and for stability. The following peptide showed improved activity on mouse FXIIa and had a much improved stability.

TABLE-US-00001 Human Mouse altered amino acid FXIIa K.sub.i FXIIa K.sub.i peptids amino acid substitution [nM] [nM] JS17m Arg8 His 21.6 4 80 30

Example 5.2Variation of Amino Acid Arg1 of FXII618 to Improve the Proteolytic Stability

[0225] To further increase the proteolytic stability of the inhibitor, additional amino acids at the N-terminus were tested. Specifically, D-amino acids were screened, wherein the L-Arg in position 1 (Arg1) was replaced by two D-amino acids. Among the Arg1 substitutions, the following peptide showed the best inhibitory activity.

TABLE-US-00002 Human altered amino acid FXIIa K.sub.i peptide amino acid substitution [nM] JS7m Arg1 D-Arg-D-Ser 18 4

Example 5.3Combination of Beneficial Mutations

[0226] Overview of Amino Acid Substitutions in FXII618 (Living Substantial Improvements:

[0227] Arg1.fwdarw.D-Arg-D-Ser (rs) K.sub.i (human FXIIa)=184 nM

[0228] Phe3.fwdarw.4-fluoro-phenylalanine (F.sup.4F) K.sub.i (human FXIIa)=2.00.3 nM

[0229] Arg8.fwdarw.His (H) K.sub.i (human FXIIa)=21.64 nM

[0230] Arg11.fwdarw.(S)-3-homoarginine (R.sup.b) K.sub.i (human FXIIa)=5.40.1 nM

[0231] Combination of 3 or 4 of the Beneficial Mutations:

TABLE-US-00003 Human t.sub.1/2 human Sequence FXIIa K.sub.i [nM] plasma (h) FXII618 RCFRLPCRQLRCR 22 4 3.9 1.9 JS33 rsCF.sup.4FRLPCHQLR.sup.bCR 0.36 0.2 144 30 JS34 rsCF.sup.4FRLPCHQLRCR 0.64 0.1 38.7 JS35 rsCF.sup.4FRLPCRQLR.sup.bCR 0.32 0.1 21.9 JS36 rsCFRLPCHQLR.sup.bCR 1.0 0.2 N.D JS33-R rsCF.sup.4FRLPCHQLR.sup.bC 0.4 0.1 127 N.D. = not determined

REFERENCES

[0232] (1) Behnke, C. A., Yee, V. C., Trong, I. L., Pedersen, L. C., Stenkamp, R. E., Kim, S. S., Reeck, G. R., and Teller, D. C. (1998) Structural determinants of the bifunctional corn Hageman factor inhibitor: x-ray crystal structure at 1.95 A resolution, Biochemistry 37, 15277-15288. [0233] (2) Mahoney, W. C., Hermodson, M. A., Jones, B., Powers, D. D., Coffman, R. S., and Reeck, G. R. (1984) Amino acid sequence and secondary structural analysis of the corn inhibitor of trypsin and activated Hageman Factor, J Biol Chem 259, 8412-8416. [0234] (3) Hansson, K. M., Nielsen, S., Elg, M., and Deinum, J. (2014) The effect of corn trypsin inhibitor and inhibiting antibodies for FXIa and FXIIa on coagulation of plasma and whole blood, Journal of thrombosis and haemostasis: JTH 12, 1678-1686. [0235] (4) Hagedorn, I., Schmidbauer, S., Pleines, I., Kleinschnitz, C., Kronthaler, U., Stoll, G., Dickneite, G., and Nieswandt, B. (2010) Factor XIIa inhibitor recombinant human albumin Infestin-4 abolishes occlusive arterial thrombus formation without affecting bleeding, Circulation 121, 1510-1517. [0236] (5) Kleinschnitz, C., Stoll, G., Bendszus, M., Schuh, K., Pauer, H. U., Burfeind, P., Renne, C., Gailani, D., Nieswandt, B., and Renne, T. (2006) Targeting coagulation factor XII provides protection from pathological thrombosis in cerebral ischemia without interfering with hemostasis. The Journal of experimental medicine 203, 513-518. [0237] (6) Larsson, M., Rayzman, V., Nolte, M. W., Nickel, K. F., Bjorkqvist, J., Jamsa, A., Hardy, M. P., Fries, M., Schmidbauer, S., Hedenqvist, P., Broome, M., Pragst, I., Dickneite, G., Wilson, M. J., Nash, A. D., Panousis, C., and Renne, T. (2014) A factor XIIa inhibitory antibody provides thromboprotection in extracorporeal circulation without increasing bleeding risk, Science translational medicine 6, 222ra217. [0238] (7) Matafonov, A., Leuno, P. Y., Gailani, A. E., Grach, S. L., Puy, C., Cheng, Q., Sun, M. F., McCarty, O. J., Tucker, E. I., Kataoka, H., Renne, T., Morrissey, J. H., Gruber, A., and Gailani, D. (2014) Factor XII inhibition reduces thrombus formation in a primate thrombosis model, Blood 123, 1739-1746. [0239] (8) Renne, T., Pozgajova, M., Gruner, S., Schuh, K., Pauer, H. U., Burfeind, P., Gailani, D., and Nieswandt, B. (2005) Defective thrombus formation in mice lacking coagulation factor XII, The Journal of experimental medicine 202, 271-281. [0240] (9) Woodruff, R. S., Xu, Y., Layzer, J., Wu, W., Ogletree, M. L., and Sullenger, B, A. (2013) Inhibiting the intrinsic pathway of coagulation with a factor XII-targeting RNA aptamer, Journal of thrombosis and haemostasis: JTH 11, 1364-1373. [0241] (10) Xu, Y., Cai, T. O., Castriota, G., Zhou, Y., Hoos, L., Jochnowitz, N., Loewrigkeit, C., Cook, J. A., Wickham, A., Metzger, J. M., Ogletree, M. L., Seifert, D. A., and Chen, Z. (2014) Factor XIIa inhibition by Infestin-4: in vitro mode of action and in vivo antithrombotic benefit, Thrombosis and haemostasis 111, 694-704. [0242] (11) Renne, T., Schmaier, A. H., Nickel, K. F., Blomback, M., and Maas, C. (2012) In vivo roles of factor XII, Blood 120, 4296-4303. [0243] (12) Endler, G., Marsik, C., Jilma, B., Schickbauer, T., Quehenberger, P., and Mannhalter, C. (2007) Evidence of a U-shaped association between factor XII activity and overall survival, Journal of thrombosis and haemostasis: JTH 5, 1143-1148. [0244] (13) Schloesser, M., Zeededer, S., Lutze, G., Halbmayer, W. M., Hofferbert, S., Hinney, B., Koestering, H., Lammie, B., Pindur, G., Thies, K., Kohler, M., and Engel, W. (1997) Mutations in the human factor XII gene, Blood 90, 3967-3977. [0245] (14) Halbmayer, W. M., Haushofer, A., Schon, R., Mannhalter, C., Strohmer, E., Baumgarten, K., and Fischer, M. (1994) The prevalence of moderate and severe FXII (Hageman factor) deficiency among the normal population: evaluation of the incidence of FXII deficiency among 300 healthy blood donors, Thrombosis and haemostasis 71, 68-72. [0246] (15) Campos, I, T., Amino, R., Sampaio, C. A., Auerswald, E. A., Friedrich, T., Lemaire, H. G., Schenkman, S., and Tanaka, A. S. (2002) Infestin, a thrombin inhibitor presents in Triatoma infestans midgut, a Chagas' disease vector: gene cloning, expression and characterization of the inhibitor. Insect Biochem Mol Biol 32, 991-997. [0247] (16) Campos, I. T., Tanaka-Azevedo, A. M., and Tanaka, A. S (2004) Identification and characterization of a novel factor XIIa inhibitor in the hematophagous insect, Triatoma infestans (Hemiptera: Reduviidae), FEBS letters 577, 512-516. (17) Robert, S., Bertolla, C., Masereel, B., Dogne, J. M., and Pochet, L. (2008) Novel 3-carboxamide-coumarins as potent and selective FXIIa inhibitors, Journal of medicinal chemistry 51, 3077-3080. [0248] (18) Baeriswyl, V., Calzavarini, S., Gerschheimer, C., Diderich, P., Angelillo-Scherrer, A., and Heinis, C, (2013) Development of a selective peptide macrocycle inhibitor of coagulation factor XII toward the generation of a safe antithrombotic therapy, Journal of medicinal chemistry 56, 3742-3746. [0249] (19) Chen, S., Bertoldo, D., Angelini, A., Pojer, F., and Heinis, C. (2014) Peptide ligands stabilized by small molecules, Angewandte Chemie 53, 1602-1606. [0250] (20) Chen, S., Morales-Sanfrutos, J., Angelini, A., Cutting. B., and Heinis, C, (2012) Structurally diverse cyclisation linkers impose different backbone conformations in bicyclic peptides, Chembiochem 13, 1032-1038. [0251] (21) Hojima, Y., Pierce, J. V., and Pisano, J. J. (1980) Hageman factor fragment inhibitor in corn seeds: purification and characterization. Thrombosis research 20, 149-162, [0252] (22) Spronk, H. M., Dielis, A. W., Panova-Noeva, M., van Oerle, R., Govers-Riemslag, J. W., Hamulyak, K., Falange, A., and Cate, H. T. (2009) Monitoring thrombin generation: is addition of corn trypsin inhibitor needed?, Thrombosis and haemostasis 101, 1156-1162. [0253] (23) Laskowski, M., and Qasim, M. A. (2000) What can the structures of enzyme-inhibitor complexes tell us about the structures of enzyme substrate complexes?, Biochimica et biophysics acta 1477, 324-337. [0254] (24) Van Veen, J. J., Gatt, A., Cooper, P. C., Kitchen, S., Bowyer, A. E., and Makris, M. (2008) Corn trypsin inhibitor in fluorogenic thrombin-generation measurements is only necessary at low tissue factor concentrations and influences the relationship between factor VIII coagulant activity and thromblogram parameters, Blood Coagul Fibrin 19, 183-189, [0255] (25) Campo, G., Pavasini, R., Pollina, A., Fileti, L., Marchesini, J., Tebaldi, M., and Ferrari, R. (2012) Thrombin generation assay: a new tool to predict and optimize clinical outcome in cardiovascular patients?, Blood coagulation & fibrinolysis: an international journal in haemostasis and thrombosis 23, 680-687. [0256] (26) Chitlur, M., Rivard, G. E., Lillicrap, D., Mann, K., Shima, M., Young, G., and Haemostasi, I. S. T. (2014) Recommendations for performing thromboelastography/thromboelastometry in hemophilia: communication from the SSC of the ISTH, Journal of Thrombosis and Haemostasis 12, 103-106. [0257] (27) Alibeik, S., Zhu, S., Yau, J. W., Weitz, J. I., and Brash. J. L. (2011) Surface modification with polyethylene glycol-corn trypsin inhibitor conjugate to inhibit the contact factor pathway on blood-contacting surfaces, Acta biomaterialia 7, 4177-4186. [0258] (28) Yau, J. W., Stafford, A. R., Liao, P., Fredenburgh, J. C., Roberts, R., Brash, J. L., and Weitz, J. I. (2012) Corn trypsin inhibitor coating attenuates the prothrombotic properties of catheters in vitro and in vivo, Acta biomaterialia 8, 4092-4100. [0259] (29) Rentero Rebollo, I., and Heinis, C. (2013) Phage selection of bicyclic peptides, Methods 60, 46-54. [0260] (30) Hemker, H. C., Giesen, P., Al Dieri, R., Regnault, V., de Smedt, E., Wagenvoord, R., Lecompte, T., and Beguin, S. (2003) Calibrated automated thrombin generation measurement in clotting plasma, Pathophysiology of haemostasis and thrombosis 33, 4-15. [0261] (31) Seebach, ID.; Matthews, J. L. beta-peptides: a surprise at every turn. Chemical Communications 1997, 2015-2022. [0262] (32) Horne, W. S.; Johnson, L. M.; Ketas, T. J.; Nasse, P. J.; Lu, M.; Moore, J. P.; Gellman, S, H. Structural and biological mimicry of protein surface recognition by alpha/beta-peptide foidamers. Proceedings of the National Academy of Sciences of the U.S. Pat. No. 2,009,106, 14751-14756. [0263] (33) Johnson, L. M.; Gellman, S. H. alpha-Helix Mimicry with alpha/beta-Peptides. Methods in Protein Design 2013, 523, 407-429. [0264] (34) Johnson, L. M.; Barrick, S.; Hager, M. V.; McFedries, A.; Homan, E. A.; Rabaglia, M. E.; Keller, M. P.; Attie, A, D.; Saghatelian, A.; Bisello, A.; Gellman, S. H. A Potent alphaibeta-Peptide Analogue of GLP-1 with Prolonged Action in Vivo. Journal of the American Chemical Society 2014, 136, 12848-12851. [0265] (35) Cheloha, R. W.; Maeda, A.; Dean, T.; Gardella, T. J.; Gellman, S. H. Backbone modification of a polypeptide drug alters duration of action in vivo. Nature Biotechnology 2014, 32, 653-+. [0266] (36) Checco, J. W.; Kreitler, D. F.; Thomas, N. C.; Belair, D. G.; Rettko, N. J.; Murphy, W. L.; Forest, K. T.; Gellman, S. H. Targeting diverse protein-protein interaction interfaces with alpha/beta-peptides derived from the Z-domain scaffold. Proceedings of the National Academy of Sciences of the U.S. Pat. No. 2,015,112, 4552-4557. [0267] (37) Baeriswyl, V.; Calzavarini, S.; Chen, S.; Zorzi, A.; Bologna, L.; Angelillo-Scherrer, A.; Heinis, C. A Synthetic Factor XIIa Inhibitor Blocks Selectively Intrinsic Coagulation Initiation, ACS Chem Biol 2015, 10, 1861-70.