METHOD FOR PRODUCING NON-HUMAN LARGE MAMMAL OR FISH EACH CAPABLE OF PRODUCING GAMETE ORIGINATED FROM DIFFERENT INDIVIDUAL
20180116191 ยท 2018-05-03
Assignee
Inventors
- Atsushi Ideta (Kato-gun, JP)
- Masato Konishi (Kato-gun, JP)
- Yutaka SENDAI (Tsukuba-shi, JP)
- Shiro YAMASHITA (Tsukuba-shi, JP)
- Ryosaku YAMAGUCHI (Sakura-shi, JP)
- Marie SOMA (Sakura-shi, JP)
Cpc classification
A01K2207/12
HUMAN NECESSITIES
A01K2217/077
HUMAN NECESSITIES
A01K67/0271
HUMAN NECESSITIES
C12N15/8509
CHEMISTRY; METALLURGY
International classification
Abstract
Disclosed is a novel means which makes it possible to steadily mass-produce knockout individuals even in large animals. The method of the present invention is a method for producing a non-human large mammal or fish (non-human animal) that produces gametes originating in a different individual, and comprises transplanting at least one pluripotent cell derived from a second non-human animal into an embryo derived from a first non-human animal, said embryo being at a cleavage stage and having a genome in which a function of nanos3 gene is inhibited, to prepare a chimeric embryo, and allowing said chimeric embryo to develop into an individual. When a pluripotent cell having a genome in which a desired gene is knocked out is used as the pluripotent cell derived from the second non-human animal, the first non-human animal capable of producing germ cells in which the desired gene is knocked out is obtained, and therefore knockout non-human animals can easily be mass-produced by mating such non-human animals.
Claims
1. A method for producing a non-human large mammal or fish that produces gametes originating in a different individual, said method comprising transplanting at least one pluripotent cell derived from a second non-human large mammal or fish into an embryo derived from a first non-human large mammal or fish, said embryo being at a cleavage stage and having a genome in which a function of nanos3 gene is inhibited, to prepare a chimeric embryo, and allowing said chimeric embryo to develop into an individual.
2. The method according to claim 1, wherein inhibition of a function of nanos3 gene is carried out by knocking out said nanos3 gene by homologous recombination.
3. The method according to claim 1 or 2, said cleavage stage is any stage between the two-cell stage and the blastocyst stage.
4. The method according to claim 1, wherein said pluripotent cell is a cell derived from a second non-human large mammal or fish having a desired genetic characteristic, and wherein said method produces a non-human large mammal or fish that produces gametes originating in a different individual that has said desired genetic characteristic.
5. The method according to claim 4, wherein said desired genetic characteristic is artificial genetic modification.
6. The method according to claim 5, said artificial genetic modification is knockout of a desired gene.
7. The method according to claim 1, said pluripotent cell is a blastomere.
8. The method according to claim 1, wherein said method is a method of producing a non-human large mammal that produces gametes originating in a different individual, said method further comprising transferring said chimeric embryo into a non-human surrogate mother to obtain an offspring.
9. The method according to claim 8, wherein at least one of said first non-human large mammal and said second non-human large mammal is cattle.
10. A method for producing an egg of a non-human large mammal or fish, said method comprising collecting an egg from a female individual of said non-human large mammal or fish produced by the method according to claim 1.
11. A method for producing sperm of a non-human large mammal or fish, said method comprising collecting sperm from a male individual of said non-human large mammal or fish produced by the method according to claim 1.
12. A method for producing a fertilized egg of a non-human large mammal or fish, said method comprising fertilizing an egg produced by the method according to claim 10 with sperm produced by the method according to claim 11 to obtain a fertilized egg.
13. A method for producing a non-human large mammal or fish, said method comprising obtaining a descendant of female and male non-human large animals or fish produced by the method according to claim 1 by natural mating, artificial insemination, or in vitro fertilization.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
MODE FOR CARRYING OUT THE INVENTION
[0033] Animals subjected to the present invention are non-human large mammals or fish. Hereinafter in the present specification, non-human large mammals and fish may both collectively be referred to as non-human animals.
[0034] Non-human large mammals subjected to the present invention may typically be domestic animals. The term large is used with intention to exclude small-sized mammals; and mammals that may be classified as middle-sized animals on detailed classification are also included in the non-human large mammals referred to in the present invention. Specific examples of the non-human large mammal include, but are not limited to, various ungulate animals including even-toed ungulates such as cattle, pigs, sheep, goats, wild boars, deer, camels, and hippopotamuses and odd-toed ungulates such as horses, rhinoceroses, and tapirs; and non-rodents excluding rabbits such as monkeys and dogs which are in general classified as large animals in classification of experimental animals; with cattle being particularly preferred.
[0035] Fish subjected to the present invention may typically be farmed fish. Farming techniques have recently been developed for various kinds of edible fish. Specific examples of the fish subjected to the present invention include, but are not limited to, tuna, yellowtail, mackerel, bonito, and horse mackerel.
[0036] In the present invention, a pluripotent cell(s) is(are) transplanted (injected) into an embryo at the cleavage stage that has a genome in which a function of nanos3 gene is inhibited, which embryo is derived from a non-human animal and which pluripotent cell(s) is(are) derived from another non-human animal. In animal individuals in which the function of the nanos3 gene is inhibited via knockout or the like, germ cells (gametes, namely sperm and eggs) are not formed. Therefore, transplantation of a pluripotent cell(s) in which nanos3 gene functions normally into an embryo in which a function of nanos3 gene is inhibited, which embryo is derived from a non-human animal and which pluripotent cell(s) is(are) derived from another non-human animal individual, results in complementation of the germ cells with the transplanted pluripotent cell(s), thereby making it possible to obtain animal individuals that produce germ cells originating in such another individual.
[0037] In the present invention, a non-human animal (a non-human large mammal or fish) to which inhibition of a function of nanos3 gene is applied is, for convenience, referred to as the first non-human animal, and a non-human animal from which the pluripotent cell(s) for complementing germ cells is derived is, for the purpose of distinguishing it from the first one, referred to as the second non-human animal. The first non-human animal and the second non-human animal may be animal individuals belonging to the same species or the same breed/strain (for example, cattle individuals, the Japanese Black individuals, and the like) or may be animals of different species or different breeds/strains (for example, sheep and cattle, Japanese Black and Holstein, and the like).
[0038] In the present invention, the phrase to inhibit a/the function of a gene refers to a decrease in or a loss/lack of production or accumulation of mRNA or protein that is originally encoded by a gene, which decrease or loss/lack is caused by, e.g., modifying at least part of a region where such a gene is present on a genome, or the like; and covers from a decrease in the function of a gene to a complete loss of the function. Gene modification methods for inhibiting the function of a particular gene are widely known in the art; and those skilled in the art can select and carry out them as appropriate. The methods are roughly divided into: gene disruption methods (knockout methods) whereby the function of a gene is deleted and gene knockdown methods whereby the function of a gene is decreased; and specific examples of the knockdown method include antisense methods and RNAi.
[0039] The inhibition of the function of nanos3 gene in the present invention is preferably loss-of-function caused by disruption (knockout) of the nanos3 gene. For example, the nanos3 gene can be knocked out by, in both alleles in a genome, deleting the coding region of nanos3 gene or a promoter region thereof or introducing mutation such as substitution or insertion to disable production of a normal nanos3 protein. For the sake of convenience in screening of a knockout cell line, all or part of the coding region of the nanos3 gene may be replaced by a marker gene sequence for drug resistance, fluorescent protein or the like.
[0040] One specific example of the gene knockout technique is a knockout method by homologous recombination using a targeting vector described in the Examples below. Other examples of the gene knockout methods include a zinc finger nuclease (ZFN) method (Porteus, M. H. et al. Gene targeting using zinc finger nucleases. Nat. Biotechnol. 23, 967-973 (2005).), a TALEN method (Christian, M. et al. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186, 757-761 (2010).), and a CRISPR/Cas9 method (Sander, J. D. et al. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol 32, 347-355 (2014).). An appropriate knockout method may be selected depending on the kind of non-human animals used for the gene knockout. In methods using a targeting vector, for example, the step of reconstructing an embryo by somatic cell nuclear transfer is required as described later; and in cases where the gene knockout is wished to be carried out in animals in which the efficiency of somatic cell nuclear transfer is low, such as pigs, or in animal species for which embryo reconstruction techniques by somatic cell nuclear transfer have not been established, the ZFN method, the TALEN method, and the CRISPR/Cas9 method, all of which do not require the step of somatic cell nuclear transfer, can be preferably employed.
[0041] In the knockout method using a targeting vector, genomic sequences upstream and downstream of a region that should be deleted may be amplified from the genomic DNA of an organism of interest by using PCR to prepare an upstream homology region and a downstream homology region; these homology regions and a marker gene may be then sequentially inserted into an appropriate plasmid vector to construct a targeting vector comprising a DNA construct for gene disruption in which the upstream homology region, the marker gene, and the downstream homology region are arranged in the order mentioned; and thereafter, this vector may be introduced into somatic cells (fibroblasts and the like) derived from the organism of interest by using a conventional method such as electroporation. Introduction of such a targeting vector to cells allows the construct for gene disruption to be introduced to an intended position on the genome via homologous recombination, thereby yielding a mutant allele where all or part of the nanos3 gene is replaced by the marker gene.
[0042] The size of the upstream homology region and the downstream homology region affect the efficiency of homologous recombination, and large-sized homology regions are used for biological species in which the efficiency is low. In gene disruption in mammals, the homology regions commonly used are about several kilobases in size. Although it is common that one homology region is about 1 to 3 kb in size (short arm) whereas the other homology region is about 5 kb or more (long arm), both homology regions may be prepared to have a size of about 5 kb. The base sequences shown in SEQ ID NOs: 3 and 4 are the genomic regions upstream and downstream of bovine nanos3 gene, and these regions or partial regions thereof with an appropriate size can be used as the homology region when the bovine nanos3 gene is knocked out.
[0043] Nanos3 gene has thus far been cloned in various animals including invertebrates and vertebrates. In cases where animals in which the nanos3 gene has not yet been cloned are employed as the first non-human animal to which inhibition of the function of nanos3 gene is applied, search may be carried out against whole genome sequence information (e.g. shotgun sequences) using sequence information of the already-identified nanos3 gene, such as human or mouse nanos3 gene, to identify a putative nanos3 gene region, thereby obtaining genomic sequence information necessary for inhibiting the function of nanos3 gene, such as homology regions to be incorporated into a targeting vector.
[0044] In mammalian cells, the frequency of introduction of a construct for gene disruption into a genome via homologous recombination is very low when compared with the frequency of random introduction not via homologous recombination. Because of this, when the nanos3 gene is knocked out according to the present invention, it is preferred to use a positive selection marker that confers drug resistance and a negative selection marker that confers drug sensitivity in combination. That is, in the above-described construct for gene disruption, a positive selection marker may be used as a marker gene that is incorporated between the two homology regions, and a negative selection marker gene may be arranged outside of the two homology regions (on the 5-side of the upstream homology region, or on the 3-side of the downstream homology region). If the construct is introduced to the genome by homologous recombination, a region outside of the homology region in the construct is not introduced to the genome, and therefore the drug sensitivity is not conferred by the negative selection marker gene. On the other hand, when the construct is introduced into the genome not via homologous recombination, the negative selection marker gene is also introduced into the genome, and therefore the drug sensitivity is conferred to such a transformant cell. Thus, by introducing the construct for gene disruption into somatic cells derived from the first non-human animal and thereafter carrying out screening with positive and negative selection markers, cells in which the construct is introduced into an appropriate site by homologous recombination to disrupt the nanos3 gene can be selected in an efficient fashion.
[0045] Specific examples of the commonly-used marker gene include, but are not limited to, as for the positive selection marker, neomycin resistance gene, blasticidin resistance gene, and puromycin resistance gene; and as for the negative selection marker, thymidine kinase gene and Diphtheria toxin fragment A (DT-A). Each of the markers is used in combination with an appropriate promoter, and those skilled in the art can appropriately select it depending on the kind of marker genes.
[0046] After the selection with the markers, the disruption of the gene is checked by PCR or Southern blotting, and cells having an allele where the nanos3 gene is disrupted are obtained. Those skilled in the art can as appropriate design primers used for PCR and a probe used for Southern blotting depending on the structure of a DNA construct for gene disruption.
[0047] As described above, the frequency of homologous recombination is very low in mammalian cells. The homologous recombination is highly unlikely to take place in both alleles at the same time, and thus the knockout usually occurs heterozygously. In order to obtain homozygous knockout cells, the introduction of the construct for gene disruption and the screening, both of which are described above, may be carried out again using a cell line that has been confirmed to be a heterozygous knockout cell line. The homozygous knockout cell can be appropriately selected by using a DNA construct for gene disruption comprising a drug resistant positive selection marker in preparation of heterozygous knockout cells and using a DNA construct for gene disruption comprising another drug resistant positive selection marker, which is different from the former, in preparation of homozygous knockout cells.
[0048] It is to be noted that, in order to increase the efficiency of homologous recombination, BML gene knockdown treatment may be carried out in addition to the nanos3 gene knockout treatment. It has been reported that BLM gene knockdown treatment increases the efficiency of homologous recombination in human cells (So S et al. Genes to Cells 2006; 11(4):363-371.), and thus knockdown of the BML gene is also similarly effective for improving the efficiency of homologous recombination in non-human animals subjected to the present invention. Sequence information and the like of the BML gene are also known and nucleic acid reagents for knocking down the BML gene of various animal species are commercially available, and thus those skilled in the art can carry out BML gene knockdown treatment by using as appropriate such commercially available products.
[0049] Subsequently, an embryo is reconstructed by using a somatic cell nuclear transfer technique from a cell(s) in which the function of nanos3 gene is inhibited in the manner as described above. The somatic cell nuclear transfer technique has also been an established technique in large mammals (see Nature, 385, p. 810-813, 1997; Science, 282(5396), p. 2095-2098, 1998; Science, 298, p. 1188-1190, 2000; Nature, 407, p. 86-90, 2000; Nat Biotechnol., 18, P. 1055-1059, 2000; Cloning Stem Cells 9, 571-580 (2007); and the like). Specifically, a reconstructed embryo (nuclear transfer embryo) that is derived from the first non-human large mammal and has a genome in which the function of nanos3 gene is inhibited can be obtained by preparing an in vivo matured oocyte or in vitro matured oocyte of a large mammal, enucleating the resulting ovum to obtain an enucleated egg, transplanting a cell in which nanos3 is inhibited into the enucleated egg, and fusing the cells by electrical stimulation or the like.
[0050] This reconstructed embryo is activated and cultured up to the cleavage stage, and injected with at least one pluripotent cell derived from the second non-human large mammal in which nanos3 gene is normal (i.e. its function is not inhibited) to prepare a chimeric embryo. As for the number of pluripotent cells injected, at least one cell may be required; and plurality of cells, for example, several to ten and several cells are usually injected.
[0051] A pluripotent cell derived from the second non-human animal is not particularly restricted as long as it has pluripotency. If the second non-human animal is any of animal species whose ES cell or iPS cell line has been established, the ES cell or iPS cell line can be used. In the case of animal species for which such a cell line has not been established, a blastomere(s) from a fertilized egg can, for example, be used.
[0052] The developmental stage of an embryo from the first non-human animal at the time of injection of a pluripotent cell(s) is not particularly restricted as long as it is the cleavage stage, and may be any stage from the two-cell stage to the blastocyst stage. The stage may, for example, be the 4-cell stage, the 8-cell stage, the 16-cell stage, the morula stage, or the blastocyst stage. In general, the injection is preferably carried out at the morula stage to the blastocyst stage.
[0053] In an individual obtained by allowing the above-described chimeric embryo to develop, germ cells (gametes, namely eggs or sperm) originating in the second non-human large mammal, which is a different individual, are produced. By transferring this chimeric embryo to a surrogate mother (surrogate parent) to produce an offspring, a non-human large mammal that produces such gametes originating in the different individual can be obtained. The surrogate mother into which the chimeric embryo is transferred is usually a female individual belonging to the same species as the first non-human large mammal. For example, in the case where the first non-human large mammal is sheep and the second non-human large mammal is cattle, the surrogate mother into which the chimeric embryo is transferred is usually a female sheep individual.
[0054] The ZFN method, the TALEN method, and the CRISPR/Cas9 method, which are gene knockout methods that can be used in addition to a method using a targeting vector, are all techniques using an artificial nuclease prepared by fusing, to a nuclease, a DNA recognition site designed so that a desired base sequence is specifically recognized thereby (a zinc finger domain in the ZFN method, a DNA-binding domain of a TAL effector derived from the plant pathogen Xanthomonas in the TALEN method, and a guide RNA comprising a sequence complementary to a DNA sequence that should be cut in the CRISPR/Cas9 method). When a pair of these artificial nucleases (designed for each of the plus strand and the minus strand) is introduced into a cell, a double-stranded DNA is cut at an intended site to cause substitution, deletion, and/or insertion of bases due to repair failure during the process of repairing by non-homologous end joining (NHEJ), which leads to disruption of a gene of interest. By introducing a DNA construct for gene disruption comprising two homology regions as described above and the artificial nuclease into a cell, the construct for gene disruption is inserted into a target site during the process of repairing by homology-directed repair (HDR), and thus a desired sequence such as a marker gene sequence can be inserted into the target site.
[0055] According to those techniques, an artificial nuclease designed so that the nanos3 gene is targeted thereby is introduced into a fertilized egg from the first non-human animal to disrupt the nanos3 gene, and a fertilized egg with homozygous disruption is produced, thereby obtaining a fertilized egg (embryo) having a genome in which the nanos3 gene is knocked out. Hence, according to those techniques, a somatic cell nuclear transfer manipulation does not need to be carried out. Accordingly, in the case of animal species in which the efficiency of somatic cell nuclear transfer is low, these techniques may more preferably be used than the gene knockout method using a targeting vector. These techniques can also be used preferably in production of fish in which the nanos3 gene is knocked out.
[0056] The subsequent steps are the same as the steps explained above in the technique using a targeting vector. That is, a pluripotent cell(s) derived from the second non-human animal may be transplanted into the fertilized egg (embryo) in which the nanos3 gene on the genome is homozygously disrupted that is obtained in the manner as described above, to prepare the chimeric embryo. By allowing this chimeric embryo to develop, a non-human animal individual that produces gametes originating in a different individual can be obtained. In the case of mammals, the chimeric embryo may be transferred into a surrogate mother (surrogate parent) to yield an offspring. Naturally, in the case of fish, this embryo transfer step is not necessary.
[0057] Descendants of the non-human animal that produces gametes originating in a different individual obtained by allowing the chimeric embryo to develop can be obtained from the female and the male of such a non-human animal by natural mating or by artificial insemination or in vitro fertilization. In the case of in vitro fertilization, although an in vitro fertilized egg is usually transferred into a female individual of the non-human animal that produces gametes originating in a different individual produced by the method of the present invention, the in vitro fertilized egg may be transferred into a non-human animal different from the above-mentioned animal (for example, an individual belonging to the same species as the second non-human animal).
[0058] According to the present invention, it is, for example, possible to allow domestic animals that can be raised at a low cost to produce sperm or eggs of domestic animals that have to be raised expensively. Specific examples include sheep and goats, which can be raised at a low cost because they are more robust and can survive on poor food as compared with cattle, and moreover, show good reproductive efficiency thanks to their precocity Therefore, by using sheep or goats as the first non-human animal and using cattle as the second non-human animal, sheep or goat that produce bovine gametes can be obtained, and thus it becomes possible to provide bovine sperm for artificial insemination and bovine fertilized eggs under low cost management. Similarly, by using horse mackerel or mackerel as the first non-human animal and using tuna as the second non-human animal, horse mackerel or mackerel that produce tuna gametes can be obtained, and thus it becomes possible to mass-produce juvenile tuna for tuna farming at a low cost.
[0059] According to the method of the present invention, it is further possible to make a certain non-human animal produce gametes having desired genetic characteristics that the second non-human animal different from the former certain non-human animal possesses. Once a phyletic line of a non-human animal producing such gametes has been established, non-human animal individuals having the desired genetic characteristics can be mass produced by mating the female and the male (natural mating, artificial insemination, or in vitro fertilization) without resorting to somatic cell cloning techniques.
[0060] The term desired genetic characteristics include both genetic characteristics that occurred naturally in the second non-human animal and artificial genetic modification. Examples of the former include a characteristic of having a very high breeding value (for example, very high gain ability). The artificial genetic modification may be, for example, inhibition of the function of a desired gene, typically knockout of a desired gene.
[0061] In cases where gametes of a non-human animal in which a desired gene has been knocked out are made to be produced by another non-human animal, it is only required that the desired gene be knocked out in a pluripotent cell derived from the second non-human animal to be used for production of a chimeric embryo. Such a pluripotent cell derived from the second non-human animal having a genome in which the desired gene is knocked out can be basically obtained by using appropriate cells derived from the second non-human animal in the same procedure as described in the knockout of the nanos3 gene. In cases where a knockout method using a targeting vector is employed, a blastomere of a reconstructed embryo in which the desired gene is homozygously knocked out can be used as such a pluripotent cell. In cases where a knockout method using an artificial nuclease is employed, a blastomere of a fertilized egg in which the desired gene is homozygously knocked out can be used as such a pluripotent cell.
[0062] By using the method of the present invention, eggs and sperm in which a desired gene is knocked out can be steadily produced by non-human animal individuals in which the said gene is not knocked out. Non-human animals in which a particular gene is knocked out can be steadily obtained by natural mating or by artificial insemination or in vitro fertilization between female and male non-human animals created according to the method of the present invention that produce gametes in which a desired gene has been knocked out. According to the present invention, steady supply of individuals in which a particular gene is knocked out becomes practicable even in large animals.
EXAMPLES
[0063] The present invention is described below more concretely by way of Examples. However, the present invention is not limited to the following Examples.
1. Object
[0064] By taking advantage of a somatic cell nuclear transfer cloning technique and a gene recombination technique, production of gene knockout (KO) individuals has become possible even in large and medium-sized domestic animals. These techniques are the most effective techniques in functional analysis of a particular gene that is necessary for genetic breeding of domestic animals. However, the efficiency of producing an individual by using a somatic cell nuclear transfer cloning technique is very low, and as it stands, steady production of a large number of KO individuals is not practicable under the present circumstances. It has recently been reported in mice that, when a hybrid embryo is prepared by combining a gene KO early embryo with a normal embryo, the hybrid embryo shows normal development and birth while compensating deficiencies (such as deficient cell differentiation and organ deficiency) caused by cells originating in the KO embryo (Kobayashi et al., Cell 142, 787-799 (2010)). It has also been reported in mice that KO of a gene associated with germ cell differentiation, nanos3, results in no formation of eggs and sperm (Tsuda et al., SCIENCE 301, 1239-1241 (2003)). In this study, we investigated whether an individual that generates only gene-KO eggs (or sperm) can be produced when an embryo in which the nanos3 gene is knocked out and an embryo in which a particular gene is knocked out are combined to prepare a complemented embryo by using the blastocyst complementation method shown above. If such a technique is demonstrated to work, it becomes possible to steadily produce only KO individuals by mating and artificial insemination (
2. Test Methods and Materials
A. Construction of Bovine Nanos3 Gene Genome DNA KO Vector
[0065] A KO vector for a gene associated with germ cell differentiation, nanos3 gene, was constructed based on information of genomic structure of bovine nanos3 gene disclosed in the NCBI database.
[0066] In order to construct a KO vector (pNOS3-KOn) for use in hetero KO manipulation, genomic regions flanking to the nanos3 gene (1.5 kb and 6.5 kb fragments:
[0067] A KO-knock in (KI) vector (pNOS3-huKO-KIb) was constructed as a vector for use in homozygous KO manipulation, the vector having a structure in which part of a protein coding region of the nanos3 gene was replaced by cDNA encoding a fluorescent protein, Kusabira-Orange (huKO) (
B. Introduction of KO Vector into Fibroblasts Derived from Bovine Fetus, Selection Culturing, and Establishment of KO Cell Line
[0068] Introduction of the pNOS3-KOn vector to fibroblasts (#906 female cell line) derived from a bovine (the Japanese Black) fetus, selection culturing, and establishment of a KO cell line were carried out according to methods previously reported (Sendai, Study Reports of Central Institute for Feed and Livestock, 1501-622 (2009); and Sendai, Y. et al., Transplantation 81, 706-766 (2006)). In addition, because it had been reported that the efficiency of homologous recombination was increased by knocking down the BLM gene in human cells (So S et al. Genes to Cells 2006; 11(4):363-371.), bovine BML gene was also knocked down for the purpose of increasing the efficiency of homologous recombination in the nanos3 knocking down. Knocking down of bovine BML gene was carried out according to a method previously reported (Sendai, Study Reports of Central Institute for Feed and Livestock, 1501-604 (2009)) using stealth RNA for bovine BML (synthesis position 2656) which was prepared by Invitrogen by contract. In the establishment of the homozygous KO cell line, pNOS3-huKO-KIb vector was introduced into a cell line (line #3933) derived from a nanos3 heterozygous KO fetus, and the resulting cells were cultured in a medium containing two kinds of selection agents (neomycin: G418 and blasticidin S).
[0069] PCR analysis for confirming KO was carried out according to a conventional method. The base sequences of primers used in the analysis are shown below.
TABLE-US-00001 P1: (SEQIDNO:10) AACACGGTGAAGCTCACTTAGG P2: (SEQIDNO:11) CATGCTCCAGACTGCCTTGG P3: (SEQIDNO:12) CTCTCCGTTGCATCCATGCC P4: (SEQIDNO:13) CTTCATCTCGGGCTTGATCGTCG P5: (SEQIDNO:14) GCTTCATCCTTGAGCACGTGG P6: (SEQIDNO:15) CCACGTGCTCAAGGATGAAGC P7: (SEQIDNO:16) CTGATACGTAAGCCTAGCTACTCG
[0070]
C. Somatic Cell Nuclear Transfer and Collection of Fetus
[0071] Using a cell line in which heterozygous KO or homozygous KO of the nanos3 gene had been confirmed by the PCR analysis as a nuclear donor, somatic cell nuclear transfer procedures were carried out according to a previous report (Ideta, A. et al. Cloning Stem Cells 9, 571-580 (2007)) to prepare a nuclear transfer embryo (reconstructed embryo). Briefly, the procedure is described as follows.
[0072] A follicular ova were collected by aspiration from bovine ovary from a slaughterhouse and subjected to maturation culture for about 20 hours. Cumulus cells were removed by using hyaluronidase (Sigma) and then eggs in which extrusion of the first polar body was confirmed were picked out. A nuclear donor was inserted into the perivitelline space of an enucleated recipient egg and the cells were fused by electrical stimulation. The resultant was artificially activated by using calcium ionophore (Sigma) or the like for the purpose of promoting development of a reconstructed embryo. Subsequently, the resultant was cultured in vitro in a culture medium for development, and the development was monitored.
[0073] The nuclear transfer embryo was implanted into a bovine recipient. A fetus at about 200 days of gestation was taken out by caesarean section and the ovary of the fetus was observed. Tissue of the ovary was fixed with a 10% neutral buffered formalin solution and subjected to a paraffin embedding procedure to prepare tissue sections. The sections were stained with hematoxylin-eosin (HE), and the tissue was observed in optical microscopy.
D. Complementation of Germ Cells in Nanos3-KO Cattle
[0074] Blastomeres (7 to 10 blastomeres) of Holstein embryo that had been fertilized in vitro were injected into a nanos3-KO nuclear transfer embryo (morula), and the resultant was cultured in vitro for two days. The grown chimeric embryo was implanted into a bovine recipient. A fetus at about 140 days of gestation was taken out by caesarean section, and the ovary of the fetus was observed. In addition, a chimeric rate (the content of Holstein cells) of each organ of the chimeric fetus was examined by using a real time PCR method.
3. Results and Discussion
(1) Cloning of Bovine Nanos3 Gene Genome and Construction of Gene KO Vector
[0075] It has been reported that, in an experiment to produce a KO individual using mice, when a gene associated with germ cell differentiation, nanos3, is knocked out, division potential of primordial germ cells present at an early developmental stage decreases and migration into the genital ridge does not take place, resulting in no formation of eggs and sperm in the ovary and the testis of born KO individuals (Tsuda et al., SCIENCE 301, 1239-1241 (2003)). In addition, recent studies have showed that, in mice and pigs, when an early embryo which has become incapable of forming an organ or the like because of KO of a particular gene is combined with an undifferentiated cell derived from a normal early embryo, the cell derived from the normal embryo complements the KO deficient cell in the developing hybrid embryo (blastocyst complementation), resulting in formation of a normal organ (Kobayashi et al., Cell 142, 787-799 (2010) and Matsunari et al., PNAS 110(12), 4557-4562 (2013)). These results suggest that when an embryo in which nanos3 gene is knocked out is combined with an embryo in which a particular gene is knocked out to prepare a hybrid complemented embryo, an individual that generates only eggs (or sperm) in which the particular gene is knocked out may be produced, and also suggest that a system for steadily producing individuals in which the particular gene is knocked out may be realized (
[0076] Bovine nanos3 gene was deduced (XM_002688743, SEQ ID NO: 1) from genomic information. We deduced bovine exons by comparing sequence information deposited under XM_002688743 with exon information of human nanos3 gene to find two putative exons. The sequences of these putative exons (1 and 2) were analyzed by using NCBI BLAST, and as a result, the chromosome (chromosome 7) on which each of the bovine nanos3 exons was located and a flanking gene sequence thereof (NC007305.5, region 10061880) were acquired. From the above results, the presence of nanos3 gene in cattle was confirmed, and it was revealed that, similarly to the murine gene, the gene was constituted by two exons (
[0077] Because the nanos3 gene is not expressed in fibroblasts, a positive-negative selection type was adopted as the KO vector, and the vector was constructed so that the entire nanos3 gene was deleted (
(2) Establishment of Bovine Nanos3 Gene KO Cell Line
[0078] Using the constructed KO vector (pNOS3-KOn), fibroblasts derived from a female fetus of the Japanese Black (line #906 (female)) was subjected to KO manipulation, and a heterozygous KO cell line was first established. An experiment for establishing the KO cell line was carried out four times, and nine wells out of 411 wells tested were judged to be knocked out (Table 1). It was suggested from a detailed PCR analysis that cells which were derived from a single colony and in which a homologous recombination reaction took place at the correct position were proliferating in each of the four wells out of those nine wells that were judged to be knocked out (lines #2-4, #4-24, #4-25, #4-68) (
TABLE-US-00002 TABLE 1 Establishment of bovine nanos3 heterozygous KO cell lines G418/GCV resistant well KO well Experiment 1 111 0 Experiment 2 81 2 (#2-4) Experiment 3 78 1 Experiment 4 141 6 (#4-24, #4-25, #4-68) 411 9 Cell line: 906 (?) (nanos3 wt/wt) The number of cells: 5 ? 10.sup.6 (BLM-RNAi treatment: cultured for 24 hr) Introduction: TV 5 ?g, Electroporation (220 V, 950 ?F), seeded into four 6-well plates.
[0079] Subsequently, we tried to establish a homozygous KO cell line by introducing the KO-huKO-KI vector (pNOS3-huKO-KIb) into the established heterozygous KO cells (line #3933). An experiment for the establishment was carried out twice, and as a result, 15 wells out of 221 wells tested were judged to be homozygous KO-huKO-KI (Table 2). It was suggested from a detailed PCR analysis that one well out of these 15 wells that were judged to be homozygous KO-huKO-KI contained cells that were derived from a single colony and exhibited proliferative properties and in which a homologous recombination reaction took place at a correct position (line #2-36) (
TABLE-US-00003 TABLE 2 Establishment of bovine nanos3 homozygous KO cell lines G418 + Blast/GCV resistant well KO-KI well Experiment 1 110 12 Experiment 2 111 3 (#2-36) 221 15 Cell line: nanos3 heterozygous KO fetal cell line (#3933: nanos3 /wt) The number of cells: 5 ? 10.sup.6 (BLM-RNAi treatment: cultured for 24 hr) Introduction: TV 5 ?g, Electroporation (220 V, 950 ?F), seeded into four 6-well plates.
(3) Lack of Germ Cells in Nanos3 Homozygous KO Fetus
[0080] Tissue images of the ovary of the nanos3 homozygous KO fetus are shown in
(4) Complementation of Germ Cells in Nanos3 Homozygous KO Cattle
[0081]
[0082] A chimeric rate (the content of Holstein cells) of each organ of the chimeric fetus was examined by real time PCR, and as a result, the following rates were found: the brain, 12.1%; the heart, 20.2%; the liver, 1.8%; the uterus, 22.4%; and the ovary, 15.8%. It follows that the bovine fetus produced here is a chimeric individual between the Japanese Black and Holstein, and Holstein's germ cells are formed in the ovary.