METHODS OF TREATING EYE DISEASES ASSOCIATED WITH INFLAMMATION AND VASCULAR PROLIFERATION
20180117051 ยท 2018-05-03
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K31/167
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
A61K31/4412
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
A61K31/4425
HUMAN NECESSITIES
International classification
A61K31/167
HUMAN NECESSITIES
A61K31/5377
HUMAN NECESSITIES
A61K31/192
HUMAN NECESSITIES
A61K31/4425
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
A61K31/196
HUMAN NECESSITIES
Abstract
Methods for treating eye diseases associated with inflammation and/or vascular proliferation in subjects are disclosed. The methods include administering therapeutically effective amounts of a tranilast compound, in particular (E)-2-[[3-(3-Methoxy-4-propargyloxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid or (E)-2-[[3,4-Bis(difluoromethoxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid or pharmaceutically acceptable salts or solvates thereof.
Claims
1-41. (canceled)
42. A method for treating an eye disease associated with inflammation and/or vascular proliferation in a subject comprising administering to the subject a therapeutically effective amount of a compound of the formula ##STR00076## or a pharmaceutically acceptable salt thereof.
43. The method of claim 42, wherein the eye disease is selected from the group consisting of diabetic retinopathy, corneal edema, anterior and posterior uveitis, pterygium, corneal diseases, dry eye, conjunctivitis, allergy- and laser-induced exudation, non-age related macular degeneration, macular edema, age-related macular degeneration, and ocular von Hippel-Lindau disease.
44. The method of claim 42, wherein the eye disease is age-related macular degeneration.
45. The method of claim 42, wherein the eye disease is non-age related macular degeneration.
46. The method of claim 42, wherein the eye disease is macular edema.
47. The method of claim 42, wherein the eye disease is dry eye.
48. The method of claim 1, wherein the eye disease is diabetic retinopathy.
49. The method of claim 42, wherein the administration of the compound to the subject reduces the number of acellular capillaries in the retina of the subject.
50. The method of claim 42, wherein the administration of the compound to the subject reduces the level of ICAM-1 mRNA in the retina of the subject.
51. The method of claim 42, wherein the administration of the compound to the subject reduces the level of VEGF mRNA in the retina of the subject.
52. The method of claim 42, wherein the administration of the compound to the subject reduces the number of leukocytes in the retina of the subject.
53. The method of claim 42, comprising administering a therapeutically effective amount of the compound to the eye of the subject.
54. The method of claim 42, comprising administering a therapeutically effective amount of the compound orally to the subject.
55. The method of claim 42, wherein treating the eye disease includes inhibiting the progression of the eye disease, preventing the eye disease, and/or ameliorating a symptom of the eye disease.
56. The method of claim 42, wherein the corneal disease is caused by infection from a microbe or microorganism.
57. The method of claim 56, wherein the microbe or microorganism is bacteria, viruses, fungi, amoeba, or parasites.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269] Embodiments of the invention will now be discussed in more detail with reference to the following examples and figures which are provided for exemplification only and which should not be considered limiting on the scope of the invention in any way.
EXAMPLES
[0270] Animals
[0271] The animal studies were conducted with the approval from the Animal Welfare and Ethics Committee (St Vincent's Hospital and the National Health and Medical Research Foundation of Australia). All rats received normal rat chow (Certified Rodent Diet #5002, LabDiet, USA) and drinking water ad libitum. All animals were housed in a stable environment maintained at 22?1? C. with a 12-hour light/dark cycle commencing at 6am.
Example 1
Test Compound (FT011)
(E)-2-[[3-(3-Methoxy-4-propargyloxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid (FT011) has the structure
[0272] ##STR00074##
[0273] Diabetic Retinopathy Rats
[0274] Ninety, six-week old female, heterozygous (mRen-2)27 rats (St. Vincent's Hospital Animal House, Melbourne, Australia) were assigned to receive either 55 mg/kg of streptozotocin (STZ) (Sigma, St. Louis, U.S.A.) diluted in 0.1 M citrate buffer, pH 4.5 or citrate buffer alone (non-diabetic control) by tail vein injection following an overnight fast. In short term study, rats were randomly assigned to receive (n=10/group) treatment with either FT011 (100 mg/kg bid gavage) or vehicle for 8 weeks. Non-diabetic animals (n=10) served as controls. In the long term study, at 16 weeks of STZ diabetes rats were randomly assigned to either treatment (n=15/group) with, FT011 (50 mg/kg/day BID), FT011 (100 mg/kg BID) or no treatment for a further 16 weeks. Non-diabetic animals (n=15) served as controls. Each week, rats were weighed and their blood glucose levels were measured (Accu-check Advantage II Blood Glucose Monitor, Roche Diagnostics, U.S.A.) and only STZ-treated animals with blood glucose>15 mmol/L were considered diabetic. Every 4 weeks, SBP was determined in preheated conscious rats via tail-cuff plethysmography using a non-invasive blood pressure (NIBP) controller and Powerlab (AD instruments, NSW, Australia). Haemoglobin A1c (HbA1c) was measured by HPLC at the end of the study in the Department of Pathology, St Vincent's Hospital. Diabetic rats received a daily injection of insulin (2-4 units intraperitoneally; Humulin NPH, Eli Lilly and Co., Indianapolis, Ind.) to reduce mortality and to promote weight gain.
[0275] Leukostasis (Short Term Study)
[0276] At the end of the short term 8 week study, rats were anaesthetized with Lethobaib (60 mg/kg) and the chest cavity was opened. Animals were perfused via the left ventricle with 0.1M phosphate buffered saline (PBS) to remove non-adherent blood cells. The rats were then perfused with rhodamine-coupled Concanavalin A (25 mg/kg, Vector Laboratories) to stain endothelium and adherent leukocytes. Eyes were enucleated and fixed with 4% paraformaldehyde in 0.1M PBS for 30 minutes. Retinae were dissected and flat mounted on microscope slides then visualised on an epi-fluorescent microscope. The total number of leukocytes was counted per retina. The investigator was masked to the group.
[0277] Real Time PCR (Short Term Study)
[0278] At the end of the short term 8 week study, rats were anaesthetized with lethobarb (60 mg/kg), eyes were enucleated and retinae dissected and placed in RNAlater (#R0901, Sigma-Aldrich). Total RNA was extracted with an RNeasy Mini Kit (#74104, Qiagen) according to manufacturers' instructions. RNA concentration was determined on a Nanodrop 3.1.2, after which 1 ?g of RNA was DNase treated (DNA-free kit, Ambion) and reverse transcribed (First Strand cDNA Synthesis Kit for RT-PCR, Roche). Primers, probes (See Table) and cDNA were mixed with Taqman Universal Master Mix (#4304437, Applied Biosystems) and real-time PCR was conducted using an ABI 7900 HT Sequence Detection System (Applied Biosystems). mRNA was normalised to 18S rRNA endogenous control and the relative fold difference in expression calculated using the 2.sup.???CT method.
TABLE-US-00001 PrimerandprobeforICAM-1 Accession PrimersandTaqman Gene Species number probe(MGB,FAMlabel) ICAM1 rat NM_012967 ForwardPrimer: AGTGCTGTACCATGATCAGAATACCT Probe:TGATCATTGCGGGCT ReversePrimer: TAAATGGACGCCACGATCAC 18S eukaryote X03205.1 AppliedBiosystems geneexpression assay-endogenous control-VIClabel
[0279] Trypsin Digest (Long Term Study 32 Weeks)
[0280] At the end of long term 32 week study, rats were anaesthetised with Lethobarb (60 mg/kg), and then eyes were enucleated and fixed in 2% Carsons Fixative overnight. Retinae were dissected and washed in 0.2M Tris Buffer (pH 8.0) followed by digestion in 1% Trypsin (#T4799, Sigma-Aldrich) in 0.2M Tris buffer at 37? C. for one hour. Retinae were then incubated in 1% Triton X in 0.2M Tris buffer for approximately one hour. Subsequently, retinae were flat mounted on a microscope slide and dried overnight. Slides were stained with Periodic Acid Schiff's Stain to observe acellular capillaries.
[0281] Quantification was performed by scanning the entire retina with a 10? objective on a Zeiss Observer microscope system. Random 600 ?m?800 ?m fields were placed over the entire retina using Adobe Photoshop CS2. Acellular capillaries were counted per field with 10 retinae per group quantitated. Investigators were masked to the group. Data was analysed as an average of acellular capillaries per field.
[0282] Statistics
[0283] Statistics were performed using the Shapiro Wilkinson test for normality. A Krukal-Wallis test followed by Mann Whitney U test was performed for statistical significance of nonparametric data.
[0284] Results
TABLE-US-00002 TABLE 1 Animal characteristics (8 weeks study) Body SBP HbA1C Group Weight (g) (mmHg) (%) Control 289 ? 4 179 ? 8 3.7 ? 0.06 Diabetes 274 ? 6 217 ? 10* 11 ? 0.19** Diabetic + FT011 278 ? 12 190 ? 14 8.9 ? 0.50.sup.# (200 mg/kg/day) *P < 0.05 and **P < 0.01 versus control; .sup.#P < 0.05 versus untreated diabetes
TABLE-US-00003 TABLE 2 Animal characteristics (32 weeks study) Body SBP HbA1C Group Weight (g) (mmHg) (%) Control 353 ? 11 152 ? 7 5.4 ? 0.5 Diabetes 324 ? 7 160 ? 8 8.4 ? 0.29* Diabetic + FT011 322 ? 8 176 ? 10 7.65 ? 0.25* (100 mk/kg/day) Diabetic + FT011 313 ? 9 170 ? 7 6.58 ? 0.37.sup.# (200 mk/kg/day) *P < 0.05 versus control; .sup.#P < 0.05 versus untreated diabetes
[0285]
[0286] The representative micrographs in
[0287]
[0288] In
[0289] The representative micrographs in
Example 2
Test Compound (FT061)
(E)-2- [[3,4-Bis(difluoromethoxy)phenyl)-1-oxo-2-propenyl]amino]benzoic acid (FT061) has the structure
[0290] ##STR00075##
[0291] Diabetic Retinopathy Rats
[0292] Sixty, six-week old female, heterozygous (mRen-2)27 rats (St. Vincent's Hospital Animal House, Melbourne, Australia) were assigned to receive either 55 mg/kg of streptozotocin (STZ) (Sigma, St. Louis, U.S.A.) diluted in 0.1 M citrate buffer, pH 4.5 or citrate buffer alone (non-diabetic control) by tail vein injection following an overnight fast. Rats were randomly assigned to receive (n=15/group) treatment with either FT061 (100 mg/kg/day gavage) or vehicle for 8 weeks. Non-diabetic animals (n=15) served as controls. Each week, rats were weighed and their blood glucose levels were measured (Accu-check Advantage II Blood Glucose Monitor, Roche Diagnostics, U.S.A.) and only STZ-treated animals with blood glucose>15 mmol/L were considered diabetic. Every 4 weeks, SBP was determined in preheated conscious rats via tail-cuff plethysmography using a non-invasive blood pressure (NIBP) controller and Powerlab (AD instruments, NSW, Australia). Diabetic rats received a daily injection of insulin (2-4 units intraperitoneally; Humulin NPH, Eli Lilly and Co., Indianapolis, Ind.) to reduce mortality and to promote weight gain.
[0293] Leukostasis
[0294] At the end of the study, rats were anaesthetized with Lethobarb (60 mg/kg) and the chest cavity was opened. Animals were perfused via the left ventricle with 0.1M phosphate buffered saline (PBS) to remove non-adherent blood cells. The rats were then perfused with rhodamine-coupled Concanavalin A (25 mg/kg, Vector Laboratories) to stain endothelium and adherent leukocytes. Eyes were enucleated and fixed with 4% paraformaldehyde in 0.1M PBS for 30 minutes. Retinae were dissected and flat mounted on microscope slides then visualised on an epi-fluorescent microscope. The total number of leukocytes was counted per retina. The investigator was masked to the group.
[0295] Real Time PCR
[0296] At the end of the study, rats were anaesthetized with lethobarb (60 mg/kg), eyes were enucleated and retinae dissected and placed in RNAlater (#R0901, Sigma-Aldrich). Total RNA was extracted with an RNeasy Mini Kit (#74104, Qiagen) according to manufacturers' instructions. RNA concentration was determined on a Nanodrop 3.1.2, after which 1 ?g of RNA was DNase treated (DNA-free kit, Ambion) and reverse transcribed (First Strand cDNA Synthesis Kit for RT-PCR, Roche). Primers, probes (See Table) and cDNA were mixed with Taqman Universal Master Mix (#4304437, Applied Biosystems) and real-time PCR was conducted using an ABI 7900 HT Sequence Detection System (Applied Biosystems). mRNA was normalised to 18S rRNA endogenous control and the relative fold difference in expression calculated using the 2.sup.???CT method.
TABLE-US-00004 PrimerandprobeforICAM-1andVEGF Primersand Accession Taqmanprobe Gene Species number (MGB,FAMlabel) ICAM1 rat NM_012967 ForwardPrimer: AGTGCTGTACCATGAT CAGAATACCT Probe: TGATCATTGCGGGCT ReversePrimer TAAATGGACGCCACGATCAC VEGF rat NM_031836.2 AppliedBiosystems NM_001110333.1 geneexpression NM_001110334.1 assay-FAMlabel 18S eukaryote X03205.1 AppliedBiosystems geneexpression assay-endogenous control-VIClabel
[0297] Statistics
[0298] Statistics were performed using the Shapiro Wilkinson test for normality. A Krukal-Wallis test followed by Mann Whitney U test was performed for statistical significance of nonparametric data.
[0299] Results
TABLE-US-00005 TABLE 1 Animal characteristics Body SBP Group Weight (g) (mmHg) Control 308 ? 8 192 ? 6 Diabetes 292 ? 10 201 ? 10 Diabetic + FT061 282 ? 4# 178 ? 4 #P < 0.05 versus control
[0300]
[0301] The representative photomicrographs in
[0302]
[0303] In
[0304] It will of course be realised that the above has been given only by way of illustrative example of the invention and that all such modifications and variations thereto as would be apparent to persons skilled in the art are deemed to fall within the broad scope and ambit of the invention as herein set forth.
REFERENCES
[0305] Adamis, A. P. (2002). Is diabetic retinopathy an inflammatory disease? Br J Ophthalmol 86(4): 363-5. [0306] Aiello, L. M. (2003). Perspectives on diabetic retinopathy. Am J Ophthalmol 136(1): 122-35. [0307] Arita, R., Y. Hata, et al. ROCK as a Therapeutic Target of Diabetic Retinopathy. J Ophthalmol 2010: 175163. [0308] Cheung, A. K., M. K. Fung, et al. (2005). Aldose reductase deficiency prevents diabetes-induced blood-retinal barrier breakdown, apoptosis, and glial reactivation in the retina of db/db mice. Diabetes 54(11): 3119-25. [0309] Joussen, A. M., V. Poulaki, et al. (2004). A central role for inflammation in the pathogenesis of diabetic retinopathy. Faseb J 18(12): 1450-2. [0310] Joussen, A. M., V. Poulaki, et al. (2002). Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy via TNF-alpha suppression. Faseb J. 16(3): 438-40. [0311] Joussen, A. M., V. Poulaki, et al. (2002). Retinal vascular endothelial growth factor induces intercellular adhesion molecule-1 and endothelial nitric oxide synthase expression and initiates early diabetic retinal leukocyte adhesion in vivo. Am J Pathol 160(2): 501-9. [0312] Khalfaoui, T., G. Lizard, et al. (2009). Immunohistochemical analysis of cellular adhesion molecules (ICAM-1, VCAM-1) and VEGF in fibrovascular membranes of patients with proliferative diabetic retinopathy: preliminary study. Pathol Biol (Paris) 57(7-8): 513-7. [0313] Klein, R., B. E. Klein, et al. (2004). The relation of retinal vessel caliber to the incidence and progression of diabetic retinopathy: XIX: the Wisconsin Epidemiologic Study of Diabetic Retinopathy. Arch Ophthalmol 122(1): 76-83. [0314] Santos, K. G., B. Tschiedel, et al. (2005). Prevalence of retinopathy in Caucasian type 2 diabetic patients from the South of Brazil and relationship with clinical and metabolic factors. Braz J Med Biol Res 38(2): 221-5. [0315] Sarlos, S., B. Rizkalla, et al. (2003). Retinal angiogenesis is mediated by an interaction between the angiotensin type 2 receptor, VEGF, and angiopoietin. Am J Pathol 163(3): 879-87. [0316] Watkins, P. J. (2003). Retinopathy. Bmj 326(7395): 924-6. [0317] Zammit, S. C., A. J. Cox, et al. (2009). Evaluation and optimization of antifibrotic activity of cinnamoyl anthranilates. Bioorg Med Chem Lett 19(24): 7003-6.