LACTOBACILLUS SP. STRAIN HAVING ABILITY TO INHIBIT PROLIFERATION OF VIRGINAL PATHOGENIC MICROORGANISMS

20180117100 ยท 2018-05-03

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a novel Lactobacillus sp. isolation strain having an activity to inhibit the growth of vaginitis pathogens, and a pharmaceutical composition, a health functional food, and a cleansing product, comprising the strain as an active ingredient. Therefore, the present invention exhibits an effect of inhibiting the growth of Sneathia spp. pathogens associated with the infection with human papillomavirus (HPV) and the incidence of bacterial vaginitis, Gardnerella vaginalis as a vaginitis pathogen, and Candida albicans as a causative bacteria of Candidal vaginitis, and an effect of recovering and maintaining the vaginal microflora, and thus can be used for the prevention and treatment of female vaginitis.

    Claims

    1. A Lactobacillus sp. strain having an activity to inhibit the growth of pathogenic vaginal microorganisms.

    2. The Lactobacillus sp. strain of claim 1, wherein the pathogenic vaginal microorganism is at least one selected from the group consisting of fungi, bacteria and viruses.

    3. The Lactobacillus sp. strain of claim 2, wherein the pathogenic vaginal microorganism is at least one selected from the group consisting of a Candida sp. strain, a Sneathia spp. strain, a Gardnerella sp. strain, and human papillomavirus.

    4. The Lactobacillus sp. strain of claim 3, wherein the Sneathia spp. strain is Sneathia amnii or Sneathia sanguinegens, or the Candida sp. strain is Candida albicans, or the Gardnerella sp. strain is Gardnerella vaginalis.

    5. (canceled)

    6. The Lactobacillus sp. strain of claim 1, wherein the Lactobacillus sp. strain is at least one selected from the group consisting of Lactobacillus crispatus, Lactobacillus fermentum, Lactobacillus jensenii, and Lactobacillus gasseri.

    7. The Lactobacillus sp. strain of claim 1, wherein the Lactobacillus sp. strain is at least one selected from the group consisting of Lactobacillus crispatus SNUV 220 deposited under accession No. KCTC18374P, Lactobacillus fermentum SNUV 175 deposited under accession No. KCTC18371P, Lactobacillus jensenii SNUV 360 deposited under accession No. KCTC18372P, and Lactobacillus gasseri SNUV 281 deposited under accession No. KCTC18375P.

    8. The Lactobacillus sp. strain of claim 1, wherein the Lactobacillus sp. strain has a survival rate of 50% or higher at a concentration of 0.1% (w/v) bile salt.

    9. A pharmaceutical composition for treating or preventing vaginitis comprising, as an active ingredient, the Lactobacillus sp. strain having an activity to inhibit the growth of pathogenic vaginal microorganisms according to claim 1.

    10. The pharmaceutical composition for treating or preventing vaginitis of claim 9, wherein the pathogenic vaginal microorganism is at least one selected from the group consisting of a Candida sp. strain, a Sneathia spp. strain, a Gardnerella sp. strain, and human papillomavirus.

    11. The pharmaceutical composition for treating or preventing vaginitis of claim 10, wherein the Sneathia spp. strain is Sneathia amnii and Sneathia sanguinegens, or the Candida sp. strain is Candida albicans, or the Gardnerella sp. strain is Gardnerella vaginalis.

    12. (canceled)

    13. (canceled)

    14. A health functional food for improving, treating or preventing vaginitis comprising, as an active ingredient, the Lactobacillus sp. strain having an activity to inhibit the growth of pathogenic vaginal microorganisms according to claim 1.

    15. The health functional food for improving, treating or preventing vaginitis of claim 14, wherein the pathogenic vaginal microorganism is at least one selected from the group consisting of a Candida sp. strain, a Sneathia spp. strain, a Gardnerella sp. strain, and human papillomavirus.

    16. The health functional food for improving, treating or preventing vaginitis of claim 15, wherein the Sneathia spp. strain is Sneathia amnii and Sneathia sanguinegens or the Candida sp. strain is Candida albicans, or the Gardnerella sp. strain is Gardnerella vaginalis.

    17. (canceled)

    18. (canceled)

    19. The health functional food for improving, treating or preventing vaginitis of claim 14, wherein the health functional food is a beverage, a fermented milk, or a food additive.

    20. A cleansing product for improving, treating or preventing vaginitis comprising, as an active ingredient, the Lactobacillus sp. strain having an activity to inhibit the growth of pathogenic vaginal microorganisms according to claim 1.

    21. The cleansing product for improving, treating or preventing vaginitis of claim 20, wherein the pathogenic vaginal microorganism is at least one selected from the group consisting of a Candida sp. strain, a Sneathia spp. strain, a Gardnerella sp. strain, and human papillomavirus.

    22. The cleansing product for improving, treating or preventing vaginitis of claim 21, wherein the Sneathia spp. strain is Sneathia amnii and Sneathia sanguinegens.

    23. (canceled)

    24. The cleansing product for improving, treating or preventing vaginitis of claim 21, wherein the Candida sp. strain is Candida albicans, and the Gardnerella sp. strain is Gardnerella vaginalis.

    25. The cleansing product for improving, treating or preventing vaginitis of claim 20, wherein the cleansing product is a solid cosmetic soap, a hand cleaner, a liquid shampoo, a liquid soap, a liquid conditioner, a body cleanser, or a creamy soap.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0045] FIG. 1 is a graph showing the measurement results of bile resistance by confirming the growth rate after culturing for 24 hours in a medium containing 0.1% to 4% (w/v) of bile salt according to one embodiment of the present invention.

    [0046] FIG. 2 is a representative graph showing the measurement results of antibiotic resistance of Lactobacillus fermentum SNUV 175 and Lactobacillus jensenii SNUV 360 according to one embodiment of the present invention against nine antibiotics.

    [0047] FIG. 3 is a graph showing the relative abundance of Gardnerella vaginalis for each treatment group, which is the result of microbiome analysis after vaginal administration of four types of Lactobacillus strains according to one embodiment of the present invention into a mouse animal model infected with Gardnerella vaginalis.

    [0048] FIG. 4 is a principal component analysis (PCoA) graph showing the change in the community structure of vaginal microflora after 2 days of administration, which are the results of microbiome analysis after vaginal administration of four types of Lactobacillus strains according to one embodiment of the present invention into a mouse animal model infected with Gardnerella vaginalis.

    [0049] FIG. 5 is a graph showing the results of univariate analysis of microorganism groups with a significant change for each group, which are the results of microbiome analysis after vaginal administration of four types of Lactobacillus strains according to one embodiment of the present invention into a mouse animal model infected with Gardnerella vaginalis.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0050] Hereinafter, the present invention will be described in more detail by way of Examples. However, these Examples are given for illustrative purposes only, and the scope of the invention is not intended to be limited by these Examples.

    Example 1. Isolation and Identification of Strains

    [0051] About 190 different Lactobacillus strains were isolated from the vaginal microflora of healthy women. Specifically, the samples for the isolation of vaginal microflora were obtained from nine subjects, including three pairs of identical twins and their mothers who participated in the Korean Twin-Family Cohort Study, and were supplied from Samsung Hospital in the form of mid-vaginal swab samples (IRB No. 144-2011-07-11).

    [0052] The swab samples were transferred to the present laboratory in the form of being stored in a refrigerator within 4 hours after collection in a modified Liquid Amies solution and immediately used for the isolation of strains. The samples were sequentially diluted from 10.sup.?1 times to 10.sup.?8 times and spread on three different media of Chocolate agar, Rogosa agar, and Columbia agar, and cultured for 48 hours under anaerobic conditions.

    [0053] After the culture, purely isolated colonies were randomly selected and subjected to shake culture in brain heart infusion (BHI) broth containing 5% human serum. Genomic DNA was extracted from the cells, and PCR reaction was carried out using UnivFwd (5-AGA GTT TGA TCM TGG CTC AG-3) primer and UnivRev (5-GGY TAC CTT GTT ACG ACT T-3) primer for 16S ribosomal RNA typing. The PCR products were purified using QIAquick PCR purification kit and subjected to sequence analysis using ABI3711 automatic sequencer.

    [0054] The results are the same as those shown in Tables 1 and 2 below. Using such sequence information, the identification of the strains was finally completed by comparing with BLAST program of Genbank (www.ncbi.nlm.nhi.gov) and ExTaxon database program (www.ezbiocloud.net/eztaxon), together with the identification data of the previous result report.

    TABLE-US-00001 TABLE1 SEQ ID Species Name Nucleotidesequence(5.fwdarw.3) NO Lactobacillus SNUV TTACTTCGGCAATGACGTTAGGAAAGC 1 crispatus 220 GAGCGGCGGATGGGTGAGTAACACGTG GGGAACCTGCCCCATAGTCTGGGATAC CACTTGGAAACAGGTGCTAATACCGGA TAAGAAAGCAGATCGCATGATCAGCTT TTAAAAGGCGGCGTAAGCTGTCGCTAT GGGATGGCCCCGCGGTGCATTAGCTAG TTGGTAAGGTAAAGGCTTACCAAGGCG ATGATGCATAGCCGAGTTGAGAGACTG ATCGGCCACATTGGGACTGAGACACGG CCCAAACTCCTACGGGAGGCAGCAGTA GGGAATCTTCCACAATGGACGCAAGTC TGATGGAGCAACGCCGCGTGAGTGAAG AAGGTTTTCGGATCGTAAAGCTCTGTT GTTGGTGAAGAAGGATAGAGGTAGTAA CTGGCCTTTATTTGACGGTAATCAACC AGAAAGTCACGGCTAACTACGTGCCAG CAGCCGCGGTAATACGTAGGTGGCAAG CGTTGTCCGGATTTATTGGGCGTAAGC GAGCGCAGGCGGAAGAATAAGTCTGAT GTGAAAGCCCTCGGCTTAACCGAGGAA CTGCATCGGAAACTGTTTTTCTTGAGT GCAGAAGAGGAGAGTGGAACTCCATGT GTAGCGGTGGAATGCGTAGATATATGG AAGAACACCAGTGGCGAAGGCGGCTCT CTGGTCTGCAACTGACGCTGAGGCTCG AAAGCATGGGTAGCGAACAGGATTAGA TACCCTGGTAGTCCATGCCGTAAACGA TGAGTGCTAAGTGTTGGGAGGTTTCCG CCTCTCAGTGCTGCAGCTAACGCATTA AGCACTCCGCCTGGGGAGTACGACCGC AAGGTTGAAACTCAAAGGAATTGACGG GGGCCCGCACAAGCGGTGGAGCATGTG GTTTAATTCGAAGCAACGCGAAGAACC TTACCAGGTCTTGACATCTAGTGCC Lactobacillus SNUV CTGCCCAGAAGCGGGGGACAACATTTG 2 fermentum 175 GAAACAGATGCTAATACCGCATAACAA CGTTGTTCGCATGAACAACGCTTAAAA GATGGCTTCTCGCTATCACTTCTGGAT GGACCTGCGGTGCATTAGCTTGTTGGT GGGGTAACGGCCTACCAAGGCGATGAT GCATAGCCGAGTTGAGAGACTGATCGG CCACAATGGGACTGAGACACGGCCCAT ACTCCTACGGGAGGCAGCAGTAGGGAA TCTTCCACAATGGGCGCAAGCCTGATG GAGCAACACCGCGTGAGTGAAGAAGGG TTTCGGCTCGTAAAGCTCTGTTGTTAA AGAAGAACACGTATGAGAGTAACTGTT CATACGTTGACGGTATTTAACCAGAAA GTCACGGCTAACTACGTGCCAGCAGCC GCGGTAATACGTAGGTGGCAAGCGTTA TCCGGATTTATTGGGCGTAAAGAGAGT GCAGGCGGTTTTCTAAGTCTGATGTGA AAGCCTTCGGCTTAACCGGAGAAGTGC ATCGGAAACTGGATAACTTGAGTGCAG AAGAGGGTAGTGGAACTCCATGTGTAG CGGTGGAATGCGTAGATATATGGAAGA ACACCAGTGGCGAAGGCGGCTACCTGG TCTGCAACTGACGCTGAGACTCGAAAG CATGGGTAGCGAACAGGATTAGATACC CTGGTAGTCCATGCCGTAAACGATGAG TGCTAGGTGTTGG

    TABLE-US-00002 TABLE2 SEQ ID Species Name Nucleotidesequence(5.fwdarw.3) NO Lactobacillus SNUV AAAAGCTACTTTCGCATGAAAGAAGTT 3 jensenii 360 TAAAAGGCGGCGTAAGCTGTCGCTAAA GGATGGACCTGCGATGCATTAGCTAGT TGGTAAGGTAACGGCTTACCAAGGCGA TGATGCATAGCCGAGTTGAGAGACTGA TCGGCCACATTGGGACTGAGACACGGC CCAAACTCCTACGGGAGGCAGCAGTAG GGAATCTTCCACAATGGACGAAAGTCT GATGGAGCAACGCCGCGTGAGTGAAGA AGGTTTTCGGATCGTAAAGCTCTGTTG TTGGTGAAGAAGGATAGAGGTAGTAAC TGGCCTTTATTTGACGGTAATCAACCA GAAAGTCACGGCTAACTACGTGCCAGC AGCCGCGGTAATACGTAGGTGGCAAGC GTTGTCCGGATTTATTGGGCGTAAAGC GAGCGCAGGCGGATTGATAAGTCTGAT GTGAAAGCCTTCGGCTCAACCGAAGAA CTGCATCAGAAACTGTCAATCTTGAGT GCAGAAGAGGAGAGTGGAACTCCATGT GTAGCGGTGGAATGCGTAGATATATGG AAGAACACCAGTGGCGAAGGCGGCTCT CTGGTCTGTAACTGACGCTGAGGCTCG AAAGCATGGGTAGCGAACAGGATTAGA TACCCTGGTAGTCCATGCCGTAAACGA TGAGTGCTAAGTGTTGGGAGGTTTCCG CCTCTCAGTGCTGCAGCTAACGCATTA AGCACTCCGCCTGGGG Lactobacillus SNUV CGGATAACAACACTAGACGCATGTCTA 4 gasseri 281 GAGTTTAAAAGATGGTTCTGCTATCAC TCTTGGATGGACCTGCGGTGCATTAGC TAGTTGGTAAGGCAACGGCTTACCAAG GCAATGATGCATAGCCGAGTTGAGAGA CTGATCGGCCACATTGGGACTGAGACA CGGCCCAAACTCCTACGGGAGGCAGCA GTAGGGAATCTTCCACAATGGACGCAA GTCTGATGGAGCAACGCCGCGTGAGTG AAGAAGGGTTTCGGCTCGTAAAGCTCT GTTGGTAGTGAAGAAAGATAGAGGTAG TAACTGGCCTTTATTTGACGGTAATTA CTTAGAAAGTCACGGCTAACTACGTGC CAGCAGCCGCGGTAATACGTAGGTGGC AAGCGTTGTCCGGATTTATTGGGCGTA AAGCGAGTGCAGGCGGTTCAATAAGTC TGATGTGAAAGCCTTCGGCTCAACCGG GAATTGCATCAGAAACTGTTGAACTTG AGTGCAGAAGAGGAGAGTGGAACTCCA TGTGTAGCGGTGGAATGCGTAGATATA TGGAAGAACACCAGTGGCGAAGGCGGC TCTCTGGTCTGCAACTGACGCTGAGGC TCGAAAGCATGGGTAGCGAACAGGATT AGATACCCTGGTAGTCCATGCCGTAAA CGATGAGTGCTAAGTGTTGGGAGGTTT CCGCCTCTCAGTGCTGCAGCTAACGCA TTAAGCACTCCGCCTGGGG

    TABLE-US-00003 TABLE 3 Pairwise Diff/ Similarity Total Completeness Name Taxonomy Accession (%) nt (%) SNUV Bacteria; Firmicutes; Bacilli; Y17362 100 0/650 100 220 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus crispatus; SNUV Bacteria; Firmicutes; Bacilli; AP008937 99.86 1/715 100 175 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus fermentum; Bacteria; Firmicutes; Bacilli; AJ575812 99.86 1/715 100 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus fermentum; SNUV Bacteria; Firmicutes; Bacilli; AF243176 99.86 1/718 98.9 360 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus jensenii; Bacteria; Firmicutes; Bacilli; Y18654 99.86 1/717 95.5 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus fornicalis; SNUV Bacteria; Firmicutes; Bacilli; CP000413 99.86 1/722 100 281 Lactobacillales; Lactobacillaceae; Lactobacillus; Lactobacillus gasseri;

    [0055] As shown in Tables 1 to 3, the results were found to be Lactobacillus crispatus, Lactobacillus fermentum, Lactobacillus jensenii, and Lactobacillus gasseri, respectively. Accordingly, they were assigned SNUV 220, SNUV 175, SNUV 360, and SNUV 281, respectively, and deposited with the Korean Collection for Type Cultures (KCTC) located in Yuseong-gu, Daejeon, South Korea and were assigned accession numbers KCTC18374P (SNUV 220, deposited on April 9), KCTC18371P (SNUV 175, deposited on April 7), KCTC18372P (SNUV 360, deposited on April 7) and KCTC18375P (SNUV 281, deposited on April 9).

    [0056] For pure isolation and long-term storage of the identified strains, glycerol (16% v/v) was added to the culture medium that reached the exponential phase, and stored at ?80? C. as a stock. In order to prepare cell culture medium for the evaluation of inhibitory activity of vaginitis pathogens for each strain, 1% of each strain was inoculated in an anaerobic MRS medium and cultured at 37? C. for 24 hours. Then, the microbial cells were removed by centrifugation at 13000?g for 10 minutes, and the supernatant was passed through a membrane filter with a pore size of 0.22 um and then stored at ?80? C. until they were used in the experiment.

    Example 2. Disk Inhibition Assay

    [0057] Each of Lactobacillus strains isolated in Example 1 was used for the assay by culturing at 37? C. for 20 hours using MRS broth (Difco, USA). The strains of Sneathia spp. and Gardnerella vaginalis were inoculated into NYCIII broth and then anaerobically cultured at 37? C. for 48 hours or 24 hours, respectively, and used in the experiment.

    [0058] As for the Sneathia spp. strains used in the experiment, two kinds of strains of Sneathia spp., which was isolated in Virginia Commonwealth University School of Medicine and has been reported in the paper, and Sneathia sanguinegens that the present inventors isolated from Korean women were used. As the Gardnerella vaginalis strain used in the experiment, KCTC 5096 strain furnished from the Korean Collection for Type Cultures (KCTC) was used.

    [0059] After dispensing and solidifying 15 ml of MRS agar medium on a plate, 7 ml of NYCIII soft agar medium (0.75% agar) inoculated with the strains of Sneathia spp. and Gardnerella vaginalis at a density of 5?10.sup.6 CFU/mL was formed as multilayer medium. Once the upper soft agar medium had been solidified, a diffusion paper disc (8 mm in diameter) was placed on the medium, and about 20 ?l of culture product of each Lactobacillus strain was absorbed thereto. Then, the plate was added to an anaerobic jar and anaerobically incubated at 37? C. for 48 hours. After the incubation, the growth inhibitory zone of the strains of Sneathia spp. and Gardnerella vaginalis appearing around the disk was measured. The inhibitory activity was expressed as the diameter (mm) of the transparent disk in which the growth of the strains was inhibited from the center of the disk.

    [0060] The disk inhibition assay was performed against the strains of Sneathia spp. and Gardnerella vaginalis with culture supernatant of isolated Lactobacillus strains, and the representative result are shown in Table 4 below.

    TABLE-US-00004 TABLE 4 disk inhibition (diameter, mm) Sn. Species Isolates_No Sn. Amnii Sanguinegens G. vaginalis Lactobacillus SNUV 220 23 46 19 crispatus Lactobacillus SNUV 175 19 fermentum Lactobacillus SNUV 360 60 60 25 jensenii Lactobacillus SNUV 281 23 19 gasseri Lactobacillus SNUV 215 crispatus Lactobacillus SNUV 110 fermentum Lactobacillus SNUV 212 jensenii Lactobacillus SNUV 445 gasseri

    [0061] As can be confirmed in Table 4, although the size of disk inhibition of the Lactobacillus culture supernatant was slightly different depending on the type of the inhibitory strains, four types of Lactobacillus isolated strains which simultaneously inhibited the growth of Sneathia spp. and Gardnerella vaginalis strains, that is, Lactobacillus crispatus SNUV 220, Lactobacillus fermentum SNUV 175, Lactobacillus jensenii SNUV 360, and Lactobacillus gasseri SNUV 281 were selected. In particular, the Lactobacillus jensenii SNUV 360 strain exhibited a most potent inhibitory activity against both strains of Sneathia spp. and Gardnerella sp.

    Example 3. Inhibitory Activity of Lactobacillus Isolates Against Candida albicans

    [0062] In order to confirm the inhibitory activity against Candida albicans strain, which is a causative bacteria of Candidal vaginitis of the four kinds of Lactobacillus strains screened in Example 2 above, Candida albicans ATCC44858 strain (American Type Culture Collection), and MYA4788 strain (American Type Culture Collection), which has been proven to cause vaginitis in animal experiments, were selected as target strains for selection of Lactobacillus isolates having an inhibitory function, and the experiments was conducted accordingly.

    [0063] Specifically, the Candida albicans strains were evaluated using a 96-well diffusion test. For the experiment, 50 ul of Candida albicans ATCC44858 (or Candida albicans M4788) culture media diluted by adding 100 ul of YM medium and 100 ul of Lactobacillus culture supernatant was added to a well of 96-well plate, and then cultured at 37? C. for 24 hours. Thereafter, the growth of inhibited Candida strains was estimated by measurement of absorbance at 600 nm, and the results are shown in Table 5.

    TABLE-US-00005 TABLE 5 optical density after 24 h (O.D. at 600 nm) Candida Candida 44858 MYA4788 Species Isolates_No (co-culture) (co-culture) Negative control group 1 1 Lactobacillus crispatus SNUV 220 0.028 0.007 Lactobacillus SNUV 175 0.003 fermentum Lactobacillus jensenii SNUV 360 0.007 Lactobacillus gasseri SNUV 281 0.012 0.010

    [0064] As can be confirmed in Table 5, all the selected Lactobacillus crispatus SNUV 220, Lactobacillus fermentum SNUV 175, Lactobacillus jensenii SNUV 360, and Lactobacillus gasseri SNUV 281 had a killing activity against Candida strains close to 100%. Accordingly, all four isolated strains have been shown to have a significant effect on the prevention of vaginitis.

    Example 4. Hydrogen Peroxide-Producing Activity of Lactobacillus isolates

    [0065] In order to investigate the degree of hydrogen peroxide production, a TMB agar medium was prepared as shown in Table 6 below (medium composition per 1 L).

    TABLE-US-00006 TABLE 6 Difco Lactobacilli MRS medium 55 g TMB 250 mg Starch, soluble 100 g Hemnin solution 10 mL Vitamin K solution 0.2 mL Peroxidase solution (1 mg/mL) 10 mL

    [0066] Subsequently, each of Lactobacillus crispatus SNUV 220, Lactobacillus fermentum SNUV 175, Lactobacillus jensenii SNUV 360, and Lactobacillus gasseri SNUV 281, which are the four types of Lactobacillus strains screened in Example 2, was cultured in MRS broth at 37? C. for 20 hours, inoculated onto the TMB agar plate, and then anaerobically cultured at 37? C. for 2 days. After the culture, the plate was exposed to the air for 30 minutes and evaluated via a qualitative experiment in which the color of the colonies turns to blue. The extent to which the color of colonies turned to blue was observed with the naked eye, and the results are shown in Table 7 below.

    TABLE-US-00007 TABLE 7 Species Isolates_No H.sub.2O.sub.2 production Lactobacillus crispatus SNUV 220 ? Lactobacillus fermentum SNUV 175 +++ Lactobacillus jensenii SNUV 360 +++ Lactobacillus gasseri SNUV 281 ++

    [0067] As can be confirmed in Table 7, the hydrogen peroxide-producing activity of each strain showed a different pattern, and it was confirmed that the production of hydrogen peroxide actively occurred in Lactobacillus fermentum SNUV 175, Lactobacillus jensenii SNUV 360, and Lactobacillus gasseri SNUV 281. Accordingly, the inhibitory activity of the selected strains is expected to show a difference in the mechanism of action.

    Example 5. Evaluation of Acid Resistance of Lactobacillus Isolates

    [0068] The acid resistance of the strains was determined by comparing the growth rate when cultured at 37? C. for 24 hours in acidic broth prepared by titrating MRS broth (pH 6.7) to pH 2 and pH 3, and the growth rate under basic broth conditions of pH 6.7, and the results are shown in Table 8 below.

    TABLE-US-00008 TABLE 8 Species Isolates_No pH 6.7 pH 3 pH 2 Lactobacillus SNUV 220 +++ + ? crispatus Lactobacillus SNUV 175 +++ +++ + fermentum Lactobacillus SNUV 360 +++ + ? jensenii Lactobacillus SNUV 281 ++ + + gasseri

    [0069] As can be confirmed in Table 8, all four strains showed the growth under the culture conditions of pH 3, and in particular, SNUV 175 strain and SNUV 281 strain showed the growth even under the condition of pH 2, indicating that they have a strong acid resistance.

    Example 6. Evaluation of Bile Resistance in Lactobacillus Isolates

    [0070] For the evaluation of bile resistance, the growth rate of Lactobacillus isolates was measured after culturing in the media containing 0.1% to 4% of bile salt for 24 hours or more, and the results are shown in Table 9 and FIG. 1.

    TABLE-US-00009 TABLE 9 bile salts bile salts bile salts bile salts bile salts Species 4% 2% 1% 0.5% 0.1% Negative control group 100 100 100 100 100 Lactobacillus crispatus 2.1 13.7 12.1 27.0 81.8 SNUV 220 Lactobacillus fermentum 75.1 88.0 96.5 104.9 127.1 SNUV 175 Lactobacillus jensenii SNUV 13.5 12.6 22.8 24.1 59.3 360 Lactobacillus gasseri SNUV 2.2 16.2 15.3 24.4 76.9 281

    [0071] As can be confirmed in Table 9 and FIG. 1, all four strains generally showed a growth rate of 50% or higher at the concentration of 0.1% bile salt. In particular, Lactobacillus fermentum SNUV 175 strain maintained the growth rate of 104.9% to 75.1%, compared to the non-treatment group at the concentration ranging from 0.5% to 4% of bile salt, showing a very high resistance to bile acid. Accordingly, it is expected to maintain a high survival rate even when orally administered.

    Example 7. Evaluation of Antibiotic Resistance in Lactobacillus Isolates

    [0072] In order to confirm the safety when applied to functional food materials, etc., antibiotic resistance of the novel Lactobacillus sp. isolates having an activity to inhibit the growth of pathogenic vaginal microorganisms was evaluated. Currently, codes and standards concerning antibiotic resistance when utilizing Lactobacillus-based lactic acid bacteria in the food were not established, and thus it was evaluated based on the EFSA standard which is the international standard concerning antibiotic resistance of microorganisms added to animal feeds.

    [0073] Specifically, the evaluation of the antibiotic resistance in Lactobacillus strains was performed according to the European Food Safety Authority (EFSA)'s guidelines for nine antibiotics including ampicillin (AMP), chloramphenicol (CHR), clindamycin (CLM), erythromycin (ERY), gentamycin KAN), streptomycin (STR), tetracycline (TET), vancomycin (VAN) and the like. The test method used in the evaluation on the antibiotic resistance was performed according to ISO 10932:2010 (IDF 223: 2010), which is the SOP standard for antibiotic resistance test of lactic acid bacteria. Each Lactobacillus strain was inoculated at a density of ?6?10.sup.6 CFU/mL in LSM-broth (90% IsoSensitest- and 10% MRS-broth; Oxoid), and then MIC test strip (Liofilchem, Italy) for each antibiotic was placed thereon. The degree of inhibition and MIC were evaluated after anaerobic culture at 37? C. for 48 hours, and the results are shown in Table 10 and FIG. 2

    TABLE-US-00010 TABLE 10 L. jensenii SNUV EFSA L. fermentum EFSA antibiotics 360 guideline SNUV 175 guideline AMP 0.094 1 0.125 2 CHL 3 4 2 4 CLM 0.38 1 0.064 1 ERY 0.19 1 0.38 1 GEN 2 16 1 16 KAN 4 16 24 32 STR 3 16 12 64 TET 0.75 4 2 8 VAN 0.5 2 64 Not required

    [0074] As can be confirmed in Table 10 and FIG. 2, among the four isolation strains, Lactobacillus jensenii SNUV 360 and Lactobacillus fermentum SNUV 175 strains showed antibiotic susceptibility satisfying the EFSA criteria for all nine antibiotics used (EFSA guideline in Table 10), and thus it is expected to be used as a health functional food through oral administration

    Example 8. Evaluation of Inhibitory Activity of Lactobacillus Isolates on Gardnerella vaginalis Infection

    [0075] The hormone control and estrous cycle were induced by intraperitoneally injecting 0.5 mg of beta-esteradiol 3-benzonate to female mice (BALB/c mice). After three days, they were directly infected with Gardnerella vaginalis in the vagina at a concentration of 1?10.sup.7 CFU per mouse to establish a vaginitis animal model.

    [0076] Thereafter, four kinds of Lactobacillus isolates corresponding to 10.sup.8 to 10.sup.9 CFU per mouse were vaginally administered (7 mice per group). On day 2, the total bacterial DNA was extracted from the vaginal samples washed with 0.1 mL of PBS (Phosphate Buffered Saline) and microbiome community analysis was performed to measure the relative abundance of Gardnerella vaginalis and other vaginal microbiota. The DNA extraction from the vaginal fluid samples was performed using Mobio PowerSoil DNA extraction kit, and for the community analysis, the DNA was amplified via PCR using a primer corresponding to the V4 region of 16S rDNA, and next-generation sequencing analysis was carried out using Illumina Miseq equipment.

    [0077] The analyzed sequences were subjected to microbiome analysis including taxon profile, ?-diversity and ?-diversity showing the difference in community structure between groups through Qiime pipeline, and the change in the amount of Gardnerella vaginalis pathogens upon the administration of Lactobacillus isolates was evaluated by calculating relative abundances (/% GV treatment group). The results are shown in Table 11 and FIGS. 3 to 5.

    [0078] Gardnerella vaginalis treatment group, Lactobacillus crispatus SNUV 220 treatment group after infection with Gardnerella vaginalis, Lactobacillus jensenii SNUV 360 treatment group after infection with Gardnerella vaginalis, Lactobacillus fermentum SNUV 175 treatment group after infection with Gardnerella vaginalis, Lactobacillus gasseri SNUV 281 treatment group after infection with Gardnerella vaginalis, and metronidazole (0.75%) antibiotics treatment group as a positive control group after infection with Gardnerella vaginalis were designated as GV, SNUV 220, SNUV 360, SNUV 175, SNUV 281 and MTZ, respectively.

    TABLE-US-00011 TABLE 11 Relative abundance (/% GV group) GV 100 SNUV 220 18.0 SNUV 360 5.3 SNUV 175 2.6 SNUV 281 6.9 MTZ 74.9

    [0079] As can be confirmed in Table 11 and FIG. 3, the strains of Lactobacillus crispatus SNUV 220, Lactobacillus jensenii SNUV 360, Lactobacillus fermentum SNUV 175, Lactobacillus gasseri of the present invention have been found to reduce the amount of Gardnerella vaginalis pathogens in in vivo vaginitis model.

    [0080] As can be confirmed in FIG. 4, when the four Lactobacillus strains of the present invention were administered, it was found that the community structure of the vaginal microflora was all changed compared to Gardnerella vagina/is-infected control group. The changes in the community structure after administration of Gardnerella and Lactobacillus strains were measured using Unweighted UniFrac distance and are shown in FIG. 4. During the vaginal administration of metronidazole, a positive control currently used as a therapeutic agent for vaginitis disease, there was no change in the community structure observed in the treatment group of Lactobacillus strains.

    [0081] In addition to confirming that the microbial community structure in the vagina, significantly changed taxon profile was analyzed by LefSe program after administration of Lactobacillus strains to Gardnerella vagina/is-infected mouse.

    [0082] The results are as shown in cladogram of FIG. 5. From the above analysis, it was confirmed that Gardnerella vaginalis and Staphylococcus spp. were significantly increased in group (C) infected with Gardnerella alone, and the Lactobacillus strains were significantly increased in groups (D, E, G) in which the Lactobacillus strains of the present invention were administered once after infection with Gardnerella vaginalis, thereby the administration of Lactobacillus strains changed the vaginal community structure and taxa profile and had a modulatory effect on the vaginal microflora.