Cherry tree (rootstock) named 'LAKE'

20180124971 ยท 2018-05-03

    Inventors

    Cpc classification

    International classification

    Abstract

    A new cherry tree variety suitable for use as rootstock.

    Claims

    1. A new and distinct variety of cherry tree substantially as described and illustrated herein.

    Description

    BRIEF DESCRIPTION OF PHOTOGRAPHS

    [0009] The accompanying photographs display flowers, leaves, leaves image 2 and fruits from a self-rooted mother block tree at Clarksville, Mich.

    [0010] FIG. 1 is a photograph of the flowers of LAKE;

    [0011] FIG. 2 is a photograph of two leaves of LAKE;

    [0012] FIG. 3 is a photograph of five leaves of LAKE with a ruler to show size;

    [0013] FIG. 4 is a photograph of cherries from and a seed from LAKE;

    [0014] FIG. 5 is a photograph of the young tree of LAKE;

    [0015] FIG. 6 is a photograph of an older tree of LAKE.

    DESCRIPTION OF THE NEW VARIETY

    [0016] The following is a detailed botanical description of the new variety of cherry tree, its flowers, foliage and fruit, as based on observations of various aged specimens grown at Clarksville, Mich. with color in accordance with The Royal Horticultural Society Colour Chart (R.H.S..), 2001 edition. [0017] Measurement details: [0018] Flowers: [0019] Inflorescence height.measured from where the flower cluster attaches to the branch to the most distal floral part. [0020] Flower diameter.measured across the petals in mm. [0021] Flower length.measured from the bottom of the pedicel to the most distal flower point (mm). [0022] Pedicel.the stem of an individual flower. It is measured from the attachment in the bud to the start of the perianth. [0023] Peduncle.a stalk supporting an inflorescence. In these selections, the cherry flowers within a flower bud all start at the same base and then the stalk separates into individual pedicels supporting each flower. [0024] Anther color.Before the anther's dehisce, when they are still bright yellow and plump. [0025] Anther length.measured for the longest anther measured from the top of the perianth tube. [0026] Style.measured above the swelled ovary. [0027] Tree.Height: Approx. 10 ft. Diameter: Approx. 10 ft. Vigor: Weak. Branching habit: spreading. Branching: strong. Hardiness: cold tolerant. Plant flowers: present. Scion compatibility confirmed: Hedelfingen, Bing, Montmorency. [0028] Stem (trunk).Strength: medium. Texture: rough. Color: grey brown. [0029] One year old shoot.Thickness: thin. Length of internode (middle third of shoot mean of 10): 1.9 cm (1.5-2.5). Pubescence (upper third): absent. Number of lenticels: medium. Anthocyanin coloration of apex: absent. Position of vegetative bud in relation to shoot: slightly-markedly held out. Size of vegetative bud: small. Shape of apex of vegetative bud: acute. Size of vegetative bud support: medium. Branching: medium. [0030] Leaves.Mature leaf arrangement: alternate. Intensity of anthocyanin coloration of you leaf (during rapid growth): weak. Leaf blade shape: obovate. Leaf blade length: short. Leaf blade width: narrow. Leaf blade: ratio length to width: medium. Leaf length-blade only (cm): 6.2. Leaf width (cm): 3.5. Leaf blade angle of apex (excluding tip): acute. Leaf blade length of tip: medium. Leaf blade shape of base: obtuse. Leaf blade shape of apex (e.g., acute): acute. Leaf blade; incisions of margin: crenate. Leaf blade: depth of incisions of margin: shallow. Leaf blade color of upper side: dark green. Leaf blade glossiness of upper side: strong. Leaf blade: pubescence of lower side of apex: weak. Petiole length: medium. Petiole: presence of pubescence of upper side: absent. Petiole: intensity of pubescence of upper side: weak. Petiole: depth of groove: medium. Leaf ratio length of leaf blade/length of petiole: medium-small. Leaf: presence of nectaries: present. Varieties with nectaries only: Leaf predominant number of nectaries: two. Leaf: position of nectaries: base of leaf and petiole. Nectary color: yellow. Nectary shape: reniform. Upper surface color (R.H.S.): 137A. Leaf upper surface texture/pubescence: smooth. Leaf upper surface venation color (R.H.S.): 138A. Lower surface color (R.H.S.): 137C. Leaf lower surface texture/pubescence: weak pubescence. Leaf lower surface venation color (R.H.S.): 138C. Leaf stipule frequency: absent on expanded leaves. Leaf petiole length (mm): 16. Leaf petiole diameter (mm): 1.2. Leaf petiole color (R.H.S.): 138B. [0031] Flowers.Flowers per cluster: 2 to 4. Fragrance: none. Bloom date (50%): May 6, 2016. Inflorescence height (cm): 2.8. Inflorescence diameter (cm): 2.9. Flower diameter (mm): 15. Flower length (mm): 14. Petal number per flower: 5. Petal arrangement: flat whorl. Petal length (mm): 7.5. Petal width (mm): 4.5. Petal shape: oval. Petal apex: round. Petal margin: smooth. Petal texture: smooth. Petal when fully opened upper surface (R.H.S.): 155D. Petal when fully opened lower surface (R.H.S.): 155D. Sepal number: 5 or 6. Sepal length (mm): 5. Sepal width (mm): 2.8. Sepal shape: triangle. Sepal apex: pointed. Sepal margin: slightly serrated. Sepal texture: smooth. Sepal color upper (R.H.S.): 138B. Sepal color lower (R.H.S.): 138B with some 59A. Flower pedicel length (mm): 13. Flower pedicel diameter (mm): 1. Flower pedicel angle (degrees): 20. Flower pedicel texture: smooth. Flower pedicel color (R.H.S.): 138B. Flower peduncle length (mm): 1. Flower peduncle diameter (mm): 2. Flower peduncle texture: smooth. Flower peduncle color: 138B. Pistils; number per flower: 1. Pistil length (mm): 6.5. Pistil color (R.H.S.): 149B. Style length (mm): 7. Style color (R.H.S.): 138C. Stigma shape: round/indented. Stigma color (R.H.S.): 138B. Stamens: number per flower: 24 to 28. Longest filament length (mm): 6. Filament color (R.H.S.): 155D. Longest anther length (mm): 7. Anther color (R.H.S.): 20B. Pollen color (R.H.S.): 17C. [0032] Fruit.Mature fruit shape: round. Mature fruit height (mm): 17.9. Mature fruit width 1 (mm): 16.3. Mature fruit width 2 (mm): 18.1. Mature fruit ratio height/width 2: 0.99. Mature fruit weight (g): 3.8. Mature fruit flesh taste: sour. Mature fruit skin color (R.H.S.): 53A. Mature fruit flesh color (R.H.S.): 23C. Stone color (R.H.S.): 164D. Stone shape: elongate. Stone number: 1. Stone height (mm): 11.8. Stone width 1 (mm): 7.7. Stone width 2 (mm): 6.2. Stone ratio height/width 2: 1.91. Stone weight (g): 0.31. Fruit stem length (mm): 30.

    Simple Sequence Repeat (SSR) Materials and Methods

    [0033] The use of clonally propagated Prunus sp. rootstocks in cherry production is increasing as these rootstocks provide reduced tree size and precocity. DNA markers that differentiate rootstocks are an important tool to verify identity among these rootstocks during the vegetative propagation stage. The simple sequence repeat (SSR) marker PceGA59 was previously determined to uniquely distinguish the commercially available GiSelA rootstocks (Struss et al. 2002).

    [0034] A targeted approach was used to develop a second SSR that was capable of providing differentiation of the rootstock selections of the invention and others by the inventors. The approach used was based on the ability to obtain genome-wide SNP (Single Nucleotide Polymorphism) data using the Illumina Infinium cherry SNP array (Peace et al. 2012). An analysis of genome-wide SNP data for the rootstocks resulted in the identification of a genomic region on linkage group 4 that was likely to differ among the MSU rootstocks.

    [0035] Using the peach genome sequence, an SSR marker was designed to target this region. This SSR marker, termed PruG4RS, successfully differentiated the MSU rootstocks. The development of PruG4RS and its combined use with PceGA59 has successfully circumvented the limitations of each individual marker and proven effective for use as a quality control DNA diagnostic tool for the commercial GiSelA rootstocks as well as the MSU breeding program rootstock selections.

    SSR markers used

    [0036] Fingerprinting was performed using two simple sequence repeat (SSR) markers: PceGA59 and PruG4RS. The forward and reverse primers sequences for these two SSR markers are as follows:

    TABLE-US-00001 Primername Primersequence5 .fwdarw. 3 PceGA59_redesigned_F TGAACCCCTCTACAAATTTTCC PceGA59_redesigned_R GACTGTAGAACCCAAAAGAACG PruG4RS-F TCAGAAAAGAAATTGCAACGGG PruG4RS-R CTTAGTGGTCTAGTCTGCATGC

    [0037] The first primer pair, PceGA59, was published in Struss et al. (2002). However, the primer sequence reflects the addition of GC clamps. Based on genetic data for the MSU cherry rootstocks we designed a second primer, PruG4RS (Andersen et al. 2015)

    Plant material used and DNA extraction

    [0038] Cherry DNA was extracted from young unfolded leaf blades using the procedure of Edge-Garza et al. (2014).

    Polymerase Chain Reaction (PCR)

    [0039] PCR amplification was performed for the two SSRs using the following conditions: 94 C. for 5 min followed by 9 cycles of 94 C. for 30 s, 60 C. for 45 s (1 C. per cycle), 72 C. for 1 min and then 24 cycles of 94 C. for 30 s, 55 C. for 45 s, 72 C. for 1 min with an elongation step of 72 C. for 5 min.

    Gel Electrophoresis and Fragment Visualization

    [0040] The PCR products were visualized by electrophoresis on a 6% denaturing polyacrylamide gel in a 50 cm Sequi-Gen GT vertical sequencing apparatus (Bio-Rad Laboratories, Hercules, Calif.) for 2.5 hours at 70 watts with 1TBE buffer. Following electrophoresis, the gels were stained with the Silver Sequence DNA Sequencing System (Promega Corporation, Madison, Wisc.) and dried for 24 hours. DNA fragment sizes were scored visually using 10 and 50 base pair ladders (Invitrogen Corporation, Carlsbad, Calif.).

    DNA Fingerprint Data

    [0041]

    TABLE-US-00002 PceGA59 PruG4RS Allele (bp) 182 186 189 194 226 172 182 190 192 196 198 200 Lake + + + + + + GiSelA 5 + + + + + GiSelA 6 + + + + +

    [0042] The following references for determination of various alleles, are hereby incorporated in their entirety.

    [0043] Struss D, Boritzki M, Karle R, and Iezzoni AF. 2002. Microsatellite markers differentiate eight Giessen cherry rootstocks. Hort Science 37: 191-193.

    [0044] Andersen K, Sebolt A, Stegmeir T, Iezzoni A. 2015. Development of the Simple Sequence Repeat marker PruG4RS for the differentiation of cherry rootstocks. American Society for Horticultural Sciences Annual Conference, New Orleans, La., Aug 4-7, Poster #023.

    [0045] Edge-Garza, D., Rowland, T., Haendiges, S. and Peace, C. 2014. A high-throughput and cost-efficient DNA extraction protocol for the tree fruit crops apple, sweet cherry, and peach relying on silica beads during tissue sampling. Molecular Breeding 34:2225-2228.