Methods for improved production of Rebaudioside D and Rebaudioside M
09957540 ยท 2018-05-01
Assignee
Inventors
- Michael Dalgaard Mikkelsen (V?rl?se, DK)
- Jorgen Hansen (Frederiksberg, DK)
- Ernesto Simon (Copenhagen, DK)
- Federico Brianza (Riehen, CH)
- Angelika Semmler (Copenhagen, DK)
- Kim Olsson (S?borg, DK)
- Simon Carlsen (Copenhagen, DK)
- Louis D?ring (Copenhagen, DK)
- Alexei Ouspenski (Mulhouse, FR)
- Paula Hicks (Bend, OR)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12P19/56
CHEMISTRY; METALLURGY
C12Y204/99
CHEMISTRY; METALLURGY
C12N9/1081
CHEMISTRY; METALLURGY
A23V2002/00
HUMAN NECESSITIES
International classification
C12P19/56
CHEMISTRY; METALLURGY
Abstract
Methods for recombinant production of steviol glycoside and compositions containing steviol glycosides are provided herein.
Claims
1. A method of producing a steviol glycoside composition in a cell culture, comprising growing a recombinant host cell, comprising: (a) a gene encoding a polypeptide capable of synthesizing geranylgeranyl pyrophosphate (GGPP) from farnesyl diphosphate (FPP) and isopentenyl diphosphate (IPP); (b) a gene encoding a polypeptide capable of synthesizing ent-copalyl diphosphate from GGPP; (c) a gene encoding a polypeptide capable of synthesizing ent-kaurene from ent-copalyl pyrophosphate; (d) a gene encoding a polypeptide capable of synthesizing ent-kaurenoic acid from ent-kaurene; (e) a gene encoding a polypeptide capable of synthesizing steviol from ent-kaurenoic acid; (f) a gene encoding a polypeptide capable of reducing cytochrome P450 complex; (g) a first gene encoding a first polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the gene has a copy number of 2 or more; and wherein the first polypeptide comprises a polypeptide having 65% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:16; and a second gene encoding a second polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the second polypeptide comprises a polypeptide having 90% or greater sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs:15 or 86; (h) a gene encoding a polypeptide capable of beta 1,3 glycosylation of the C3 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside; (i) a gene encoding a polypeptide capable of glycosylating steviol or the steviol glycoside at its C-13 hydroxyl group; and (j) a gene encoding a polypeptide capable of glycosylating steviol or the steviol glycoside at its C-19 carboxyl group; under conditions in which the genes are expressed; wherein at least one of the genes is a recombinant gene; wherein the steviol glycoside comprises steviol-13-O-glucoside, steviol-19-O-glucoside, rubusoside, stevioside, 1,2-bioside, Rebaudioside A, Rebaudioside B, Rebaudioside D, or Rebaudioside E; and wherein the steviol glycoside composition produced by the host cell comprises Rebaudioside M that is produced by the host cell at a concentration of at least about 600 mg/L of the cell culture; and further comprising isolating Rebaudioside M that is produced by the host cell from the cell culture.
2. The method of claim 1, wherein one or more of the genes is constitutively expressed and/or expression of one or more of the genes is induced.
3. The method of claim 1, wherein: (a) the second polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside comprises a polypeptide having a substitution at residues 211 and 286 of SEQ ID NO:15; (b) the polypeptide capable of beta 1,3 glycosylation of the C3 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside comprises a polypeptide having 50% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:2; (c) the polypeptide capable of glycosylating steviol or a steviol glycoside at its C-13 hydroxyl group comprises a polypeptide having 55% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:26; and (d) the polypeptide capable of glycosylating steviol or a steviol glycoside at its C-19 carboxyl group comprises a polypeptide having 55% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:19; wherein at least one of the polypeptides is a recombinant polypeptide.
4. The method of claim 3, wherein the polypeptide capable of beta 1,3 glycosylation of the C3 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside comprises at least one amino acid substitution of SEQ ID NO:2 that is Q23G, Q23H, T55K, T55E, S56A, 126F, 126W, Y128S, Y128E, T146A, T146G, T146P, H155L, H155R, Q198R, S285R, S285T, S253W, S253G, L257P, L257W, L257T, L257G, L257A, L257R, L257E, S283N, T284R, T284G, S285G, K337E, K337P or L379V of SEQ ID NO:2.
5. The method of claim 1, wherein the cell culture further comprises glucose, uridine diphosphate (UDP)-glucose, UDP-rhamnose, UDP-xylose, N-acetyl-glucosamine, and/or yeast nitrogen base (YNB).
6. The method of claim 1, wherein the host cell comprises a plant cell, a mammalian cell, an insect cell, a fungal cell, an algal cell, or a bacterial cell.
7. The method of claim 6, wherein the fungal cell comprises a yeast cell.
8. The method of claim 7, wherein the yeast cell is a cell from Saccharomyces cerevisiae, Schizosaccharomyces pombe, Yarrowia lipolytica, Candida glabrata, Ashbya gossypii, Cyberlindnera jadinii, Pichia pastoris, Kluyveromyces lactis, Hansenula polymorpha, Candida boidinii, Arxula adeninivorans, Xanthophyllomyces dendrorhous, or Candida albicans species.
9. The method of claim 7, wherein the yeast cell is a Saccharomycete.
10. The method of claim 9, wherein the yeast cell is a cell from Saccharomyces cerevisiae species.
11. The method of claim 1, wherein: (a) the polypeptide capable of synthesizing geranylgeranyl pyrophosphate (GGPP) from farnesyl diphosphate (FPP) and isopentenyl diphosphate (IPP) comprises a polypeptide having at 70% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:24; (b) the polypeptide capable of synthesizing ent-copalyl diphosphate from GGPP comprises a polypeptide having 80% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:13; (c) the polypeptide capable of synthesizing ent-kaurene from ent-copalyl pyrophosphate comprises a polypeptide having 40% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:21; (d) the polypeptide capable of synthesizing ent-kaurenoic acid from ent-kaurene comprises a polypeptide having 70% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:25; (e) the polypeptide capable of synthesizing steviol from ent-kaurenoic acid comprises a polypeptide having 60% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:11; and/or (f) the polypeptide capable of reducing cytochrome P450 complex comprises a polypeptide having 65% or greater sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs:4 or 9.
12. The method of claim 1, wherein the isolating step comprises: (a) separating a liquid phase of the cell culture from a solid phase of the cell culture to obtain a supernatant comprising the produced Rebaudioside M; and (b) contacting the supernatant with one or more adsorbent resins in order to obtain at least a portion of the produced Rebaudioside M, thereby isolating the produced Rebaudioside M.
13. The method of claim 1, wherein the isolating step comprises: (a) separating a liquid phase of the cell culture from a solid phase of the cell culture to obtain a supernatant comprising the produced Rebaudioside M; and (b) contacting the supernatant with one or more ion exchange or reversed-phase chromatography columns in order to obtain at least a portion of the produced Rebaudioside M, thereby isolating the produced Rebaudioside M.
14. The method of claim 1, wherein the isolating step comprises: (a) separating a liquid phase of the cell culture from a solid phase of the cell culture to obtain a supernatant comprising the produced Rebaudioside M; and (b) crystallizing or extracting the produced Rebaudioside M, thereby isolating the produced Rebaudioside M.
15. The method of claim 1, further comprising recovering the steviol glycoside composition comprising Rebaudioside M that is produced by the host cell, from the cell culture.
16. The method of claim 15, wherein the recovered steviol glycoside composition is enriched for Rebaudioside M relative to a steviol glycoside composition from a Stevia plant and has a reduced level of Stevia plant-derived components relative to a steviol glycoside composition obtained from a plant-derived Stevia extract.
17. The method of claim 1, wherein the cell culture comprises: (a) the steviol glycoside composition produced by the host cell, (b) glucose, uridine diphosphate (UDP)-glucose, UDP-rhamnose, UDP-xylose, and/or N-acetyl-glucosamine; and (c) supplemental nutrients comprising trace metals, vitamins, salts, yeast nitrogen base (YNB) and/or amino acids.
18. The method of claim 1, wherein the cell culture comprises: (a) the steviol glycoside composition produced by the host cell, wherein the steviol glycoside composition further comprises Rebaudioside D that is produced by the host cell; wherein Rebaudioside M and Rebaudioside D that are produced by the host cell are present at a ratio of between 1:0.1 to 0.1:1 in the cell culture; (b) glucose, uridine diphosphate (UDP)-glucose, UDP-rhamnose, UDP-xylose; and/or N-acetyl-glucosamine; and (c) supplemental nutrients comprising trace metals, vitamins, salts, yeast nitrogen base (YNB) and/or amino acid.
19. The method of claim 1, wherein the host cell is grown in a fermentor at a temperature for a period of time, wherein the temperature and period of time facilitate the production of the steviol glycoside composition.
20. The method of claim 1, wherein the host cell produces Rebaudioside M at a concentration of at least about 1000 mg/L of the cell culture.
21. The method of claim 1, wherein the host cell further produces Rebaudioside D at a concentration of at least about 1000 mg/L of the cell culture.
22. The method of claim 1, wherein the steviol glycoside composition produced by the host cell further comprises Rebaudioside D that is produced by the host cell.
23. The method of claim 1, wherein the steviol glycoside composition produced by the host cell further comprises Rebaudioside D that is produced by the host cell at a concentration of at least about 600 mg/L of the cell culture.
24. The method of claim 1, wherein the steviol glycoside composition produced by the host cell comprises Rebaudioside M and Rebaudioside D that are produced by the host cell at a ratio of at least 1:0.1 in the cell culture.
25. The method of claim 1, wherein the steviol glycoside composition produced by the host cell comprises Rebaudioside D and Rebaudioside M that are produced by the host cell at a ratio of at least 1:0.1 in the cell culture.
26. The method of claim 1, that further comprises recovering the steviol glycoside composition comprising Rebaudioside D that is produced by the host cell, alone or together with at least one other steviol glycoside from the cell culture.
27. The method of claim 26, wherein the recovered steviol glycoside composition is enriched for Rebaudioside D relative to a steviol glycoside composition from a Stevia plant and has a reduced level of Stevia plant-derived components relative to a plant-derived Stevia extract.
28. The method of claim 1, wherein the recombinant host cell is a Yarrowia lipolytica cell.
29. A method of producing a steviol glycoside composition, comprising whole-cell bioconversion of plant-derived or synthetic steviol and/or steviol glycosides in a cell culture of a recombinant host cell using: (a) a first polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the first polypeptide comprises a polypeptide having 65% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:16; and a second polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the second polypeptide comprises a polypeptide having 90% or greater sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs:15 or 86, a polypeptide having a substitution at residues 211 and 286 of SEQ ID NO:15, or a combination thereof; (b) a polypeptide capable of beta 1,3 glycosylation of the C3 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside, comprising a polypeptide having 50% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:2; (c) a polypeptide capable of glycosylating steviol or a steviol glycoside at its C-13 hydroxyl group, comprising a polypeptide having 55% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:26; and/or (d) a polypeptide capable of glycosylating steviol or a steviol glycoside at its C-19 carboxyl group, comprising a polypeptide having 55% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:19; wherein at least one of the polypeptides is a recombinant polypeptide expressed in the recombinant host cell; and producing the steviol glycoside composition thereby; wherein the steviol glycoside comprises steviol-13-O-glucoside, steviol-19-O-glucoside, rubusoside, stevioside, 1,2-bioside, Rebaudioside A, Rebaudioside B, Rebaudioside D, or Rebaudioside E; and wherein the steviol glycoside composition comprises Rebaudioside M that is produced at a concentration of at least about 600 mg/L of the cell culture; and further comprising isolating the produced Rebaudioside M from the cell culture.
30. An in vitro method of producing a steviol glycoside composition, comprising adding: (a) a first polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the first polypeptide comprises a polypeptide having 65% or greater sequence identity to the amino acid sequence set forth in SEQ ID NO:16; and a second polypeptide capable of beta 1,2 glycosylation of the C2 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of a steviol glycoside; wherein the second polypeptide comprises a polypeptide having 90% or greater sequence identity to the amino acid sequence set forth in any one of SEQ ID NOs:15 or 86, a polypeptide having a substitution at residues 211 and 286 of SEQ ID NO:15, or a combination thereof; and one or more of: (b) a polypeptide capable of beta 1,3 glycosylation of the C3 of the 13-O-glucose, 19-O-glucose, or both 13-O-glucose and 19-O-glucose of the steviol glycoside; (c) a polypeptide capable of glycosylating steviol or the steviol glycoside at its C-13 hydroxyl group; or (d) a polypeptide capable of glycosylating steviol or the steviol glycoside at its C-19 carboxyl group; and a plant-derived or synthetic steviol precursor, a steviol, a steviol glycoside precursor, and/or a steviol glycoside to a reaction mixture; wherein at least one of the polypeptides is a recombinant polypeptide; and producing the steviol glycoside composition thereby; and wherein the steviol glycoside composition comprises Rebaudioside M that is produced at a concentration of at least about 600 mg/L of the reaction mixture; and further comprising isolating the produced Rebaudioside M from the reaction mixture.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The following detailed description of the embodiments of the present invention can be best understood when read in conjunction with the following drawings, where like structure is indicated with like reference numerals and in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22) Skilled artisans will appreciate that elements in the Figures are illustrated for simplicity and clarity and have not necessarily been drawn to scale. For example, the dimensions of some of the elements in the Figures can be exaggerated relative to other elements to help improve understanding of the embodiment(s) of the present invention.
DETAILED DESCRIPTION OF THE INVENTION
(23) All publications, patents and patent applications cited herein are hereby expressly incorporated by reference for all purposes.
(24) Methods well known to those skilled in the art can be used to construct genetic expression constructs and recombinant cells according to this invention. These methods include in vitro recombinant DNA techniques, synthetic techniques, in vivo recombination techniques, and polymerase chain reaction (PCR) techniques. See, for example, techniques as described in Maniatis et al., 1989, M
(25) Before describing the present invention in detail, a number of terms will be defined. As used herein, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. For example, reference to a nucleic acid means one or more nucleic acids.
(26) It is noted that terms like preferably, commonly, and typically are not utilized herein to limit the scope of the claimed invention or to imply that certain features are critical, essential, or even important to the structure or function of the claimed invention. Rather, these terms are merely intended to highlight alternative or additional features that can or cannot be utilized in a particular embodiment of the present invention.
(27) For the purposes of describing and defining the present invention it is noted that the term substantially is utilized herein to represent the inherent degree of uncertainty that can be attributed to any quantitative comparison, value, measurement, or other representation. The term substantially is also utilized herein to represent the degree by which a quantitative representation can vary from a stated reference without resulting in a change in the basic function of the subject matter at issue.
(28) As used herein, the terms polynucleotide, nucleotide, oligonucleotide, and nucleic acid can be used interchangeably to refer to nucleic acid comprising DNA, RNA, derivatives thereof, or combinations thereof.
(29) As used herein, the term and/or is utilized to describe multiple components in combination or exclusive of one another. For example, x, y, and/or z can refer to x alone, y alone, z alone, x, y, and z, (x and y) or z, or x or y or z. In some embodiments, and/or is used to refer to the exogenous nucleic acids that a recombinant cell comprises, wherein a recombinant cell comprises one or more exogenous nucleic acids selected from a group. In some embodiments, and/or is used to refer to production of steviol glycosides, wherein one or more steviol glycosides selected from a group are produced. In some embodiments, and/or is used to refer to production of steviol glycosides, wherein one or more steviol glycosides are produced through one or more of the following steps: culturing a recombinant cell, synthesizing one or more steviol glycosides in a cell, and isolating one or more steviol glycosides.
(30) Highly-glycosylated steviol glycosides can be present in trace amounts in the Stevia plant, but at levels so low that extraction from the plant is impractical for use of such glycosides in food and beverage systems. See, Hellfritsch et al., J. Agric. Food Chem. 60: 6782-6793 (2012); DuBois G E, Stephenson R A., J Med Chem. January; 28:93-98 (1985); and US Patent Publication 2011-0160311.
(31) Typically, stevioside and Rebaudioside A are the primary compounds in commercially-produced stevia extracts. Stevioside is reported to have a more bitter and less sweet taste than Rebaudioside A. The composition of stevia extract can vary from lot to lot depending on the soil and climate in which the plants are grown. Depending upon the sourced plant, the climate conditions, and the extraction process, the amount of Rebaudioside A in commercial preparations is reported to vary from 20 to 97% of the total steviol glycoside content.
(32) Other steviol glycosides are present in varying amounts in stevia extracts. For example, Rebaudioside B is typically present at less than 1-2%, whereas Rebaudioside C can be present at levels as high as 7-15%. Rebaudioside D is typically present in levels of 2% or less, and Rebaudioside F is typically present in compositions at 3.5% or less of the total steviol glycosides. The amount of the minor steviol glycosides, including but not limited to Rebaudioside M, can affect the flavor profile of a Stevia extract.
(33) In addition, Rebaudioside D and other higher glycosylated steviol glycosides are thought to be higher quality sweeteners than Rebaudioside A. As such, the recombinant hosts and methods described herein are particularly useful for producing steviol glycoside compositions having an increased amount of Rebaudioside D for use, for example, as a non-caloric sweetener with functional and sensory properties superior to those of many high-potency sweeteners.
(34) Rebaudioside M, a hexa-glycosylated steviol glycoside has been reported to be present in the Stevia plant and has an IUPAC name of (2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis({[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy})oxan-2-yl(1R,5R,9S,13R)-13-{[(2S,3R,4S,5R,6R)-5-hydroxy-6-(hydroxymethyl)-3,4-bis({[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy})oxan-2-yl]oxy}-5,9-dimethyl-14-methylidenetetracyclo[11.2.1.01,10.04,9] hexadecane-5-carboxylate. See, Ohta et al., MassBank record: FU000341, FU000342, FU000343 (2010) and Ohta et al (J. Applied Glycosides, 57(3):199-209, 2010). Rebaudioside M has been given a CAS number of 1220616-44-3. See
(35) Rebaudioside D, a penta-glycosylated steviol glycoside, has also been reported to be present in the Stevia plant and has an IUPAC name of 4,5-dihydroxy-6-(hydroxymethyl)-3-{[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy}oxan-2-yl 13-{[5-hydroxy-6-(hydroxymethyl)-3,4-bis({[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy})oxan-2-yl]oxy}-5,9-dimethyl-14-methylidenetetracyclo[11.2.1..sup.01,10.0.sup.4,9]hexadecane-5-carboxylate. Rebaudioside D has been given a CAS number of 64849-39-4. See
(36) Provided herein are recombinant hosts such as microorganisms that express polypeptides useful for de novo biosynthesis of Rebaudioside M or Rebaurdioside D. Hosts described herein express one or more uridine 5-diphospho (UDP) glycosyl transferases suitable for producing steviol glycosides. Expression of these biosynthetic polypeptides in various microbial systems allows steviol glycosides to be produced in a consistent, reproducible manner from energy and carbon sources such as sugars, glycerol, CO.sub.2, H.sub.2, and sunlight. The proportion of each steviol glycoside produced by a recombinant host can be tailored by incorporating preselected biosynthetic enzymes into the hosts and expressing them at appropriate levels, to produce a sweetener composition with a consistent taste profile. Furthermore, the concentrations of steviol glycosides produced by recombinant hosts are expected to be higher than the levels of steviol glycosides produced in the Stevia plant, which improves the efficiency of the downstream purification. Such sweetener compositions advantageously contain little or no plant based contaminants, relative to the amount of contaminants present in Stevia extracts.
(37) The practice of the methods and recombinant host cells as disclosed are provided wherein at least one of the genes encoding a UGT85C2 polypeptide; a UGT74G1 polypeptide; a UGT76G1 polypeptide; or a UGT91d2 polypeptide is a recombinant gene, the particular recombinant gene(s) depending on the species or strain selected for use. Additional genes or biosynthetic modules can be included in order to increase steviol glycoside yield, improve efficiency with which energy and carbon sources are converted to steviol and its glycosides, and/or to enhance productivity from the cell culture. As used herein, biosynthetic modules refer to a collection of genes that are part of a common biosynthetic pathway and thus are often co-expressed in a recombinant organism. As used herein, such additional biosynthetic modules include genes involved in the synthesis of the terpenoid precursors, isopentenyl diphosphate and dimethylallyl diphosphate. Additional biosynthetic modules include terpene synthase and terpene cyclase genes, such as genes encoding geranylgeranyl diphosphate synthase and copalyl diphosphate synthase; these genes can be endogenous genes or recombinant genes.
(38) I. Steviol and Steviol Glycoside Biosynthesis Polypeptides
(39) A. Steviol Biosynthesis Polypeptides
(40) The biochemical pathway to produce steviol involves formation of the precursor, geranylgeranyl diphosphate (catalyzed by GGDPS), cyclization to (?) copalyl diphosphate (catalyzed by CDPS), followed by formation of (?)-kaurene (catalyzed by KS), followed by oxidation (catalyzed by KO), and hydroxylation (catalyzed by KAH) to form steviol. See
(41) Suitable KS polypeptides are known. For example, suitable KS enzymes include those made by Stevia rebaudiana, Zea mays, Populus trichocarpa, and Arabidopsis thaliana. See, Table 2 and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety. The nucleotide sequence encoding the A. thaliana KS polypeptide is set forth in SEQ ID NO:6, and the amino acid sequence of the A. thaliana KS polypeptide is set forth in SEQ ID NO:21.
(42) TABLE-US-00001 TABLE 2 Kaurene synthase (KS) clones. Enzyme Source Construct Organism gi Number Accession Number Name Length (nts) Stevia 4959241 AAD34295 MM-12 2355 rebaudiana (amino acid SEQ ID (nt SEQ ID NO: 103) NO: 27) Stevia 4959239 AAD34294 MM-13 2355 rebaudiana (amino acid SEQ ID (nt SEQ ID NO: 104) NO: 28) Zea mays 162458963 NP_001105097 MM-14 1773 (amino acid SEQ ID (nt SEQ ID NO: 105) NO: 29) Populus 224098838 XP_002311286 MM-15 2232 trichocarpa (amino acid SEQ ID (nt SEQ ID NO: 106) NO: 30) Arabidopsis 3056724 AF034774 EV-70 2358 thaliana (amino acid SEQ ID (nt SEQ ID NO: 31) NO: 32)
(43) Suitable KO polypeptides are known. For example, suitable KO enzymes include those made by Stevia rebaudiana, Arabidopsis thaliana, Gibberella fujikoroi and Trametes versicolor. See, e.g., Table 3 and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety.
(44) TABLE-US-00002 TABLE 3 Kaurene oxidase (KO) clones. Enzyme Source Construct Organism gi Number Accession Number Name Length (nts) Stevia 76446107 ABA42921 MM-18 1542 rebaudiana (amino acid SEQ ID (nt SEQ ID NO: 33) NO: 107) Arabidopsis 3342249 AAC39505 MM-19 1530 thaliana (amino acid SEQ ID (nt SEQ ID NO: 34) NO: 108) Gibberella 4127832 CAA76703 MM-20 1578 fujikoroi (amino acid SEQ ID (nt SEQ ID NO: 35) NO: 109) Trametes 14278967 BAB59027 MM-21 1500 versicolor (amino acid SEQ ID (nt SEQ ID NO: 36) NO: 110)
(45) Suitable KAH polypeptides are known. For example, suitable KAH enzymes include those made by Stevia rebaudiana, Arabidopsis thaliana, Vitis vinifera and Medicago trunculata. See, e.g., Table 4, PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, U.S. Patent Publication Nos. 2008/0271205 and 2008/0064063, and Genbank Accession No. gi 189098312 (SEQ ID NO: 37) and GenBank Accession ABD60225; GI:89242710 (SEQ ID NO: 38), which are incorporated herein by reference in their entirety. The steviol synthetase from A. thaliana is classified as a CYP714A2.
(46) TABLE-US-00003 TABLE 4 Steviol synthetase (KAH) clones. Enzyme Source Accession Plasmid Construct Organism gi Number Number Name Name Length (nts) Stevia * (amino acid SEQ pMUS35 MM-22 1578 rebaudiana ID NO: 43) (nt SEQ ID NO: 111) Stevia 189418962 ACD93722 pMUS36 MM-23 1431 rebaudiana (amino acid SEQ (nt SEQ ID NO: 112) ID NO: 39) Arabidopsis 15238644 NP_197872 pMUS37 MM-24 1578 thaliana (amino acid SEQ (nt SEQ ID NO: 113) ID NO: 40) Vitis vinifera 225458454 XP_002282091 pMUS38 MM-25 1590 (amino acid SEQ (nt SEQ ID NO: 114) ID NO: 41) Medicago 84514135 ABC59076 pMUS39 MM-26 1440 trunculata (amino acid SEQ (nt SEQ ID NO: 115) ID NO: 42) * = Sequence is identified with sequence identifier number 2 as shown in U.S. Patent Publication No. 2008-0064063.
(47) In addition, a KAH polypeptide from Stevia rebaudiana that was identified as described in PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety, is particularly useful in a recombinant host. The nucleotide sequence encoding the S. rebaudiana KAH (SrKAHe1) is set forth in SEQ ID NO:91. A nucleotide sequence encoding the S. rebaudiana KAH that has been codon-optimized for expression in yeast is set forth in SEQ ID NO:8, and the amino acid sequence of the S. rebaudiana KAH polypeptide is set forth in SEQ ID NO:11. When expressed in S. cerevisiae, the S. rebaudiana KAH (SEQ ID NO:11) shows significantly higher steviol synthase activity as compared to the A. thaliana ent-kaurenoic acid hydroxylase described by Yamaguchi et al. (U.S. Patent Publication No. 2008/0271205 A1) and other S. rebaudiana KAH enzymes described in U.S. Patent Publication No. 2008/0064063 as well as the protein sequence deposited in GenBank as ACD93722. The S. rebaudiana KAH polypeptide (SEQ ID NO:11) has less than 20% identity to the KAH from U.S. Patent Publication No. 2008/0271205 and less than 35% identity to the KAH from U.S. Patent Publication No. 2008/0064063.
(48) For example, the steviol synthase encoded by SrKAHe1 is activated by the S. cerevisiae CPR encoded by gene NCP1 (YHR042W). Greater activation levels of the steviol synthase encoded by SrKAHe1 is observed when the A. thaliana CPR encoded by the gene ATR2 (SEQ ID NO:10) and the S. rebaudiana CPR encoded by the gene CPR8 (SEQ ID NO:5) are co-expressed. The amino acid sequence of the A. thaliana ATR2 is set forth in SEQ ID NO:9, and the amino acid sequence for S. rebaudiana CPR8 polypeptides is set forth in SEQ ID NO:4.
(49) In some embodiments, a recombinant microorganism contains a recombinant gene encoding a KO, KS, and a KAH polypeptide. Such microorganisms also typically contain a recombinant gene encoding a cytochrome P450 reductase (CPR) polypeptide, since certain combinations of KO and/or KAH polypeptides require expression of an exogenous CPR polypeptide. In particular, the activity of a KO and/or a KAH polypeptide of plant origin can be significantly increased by the inclusion of a recombinant gene encoding an exogenous CPR polypeptide. Suitable CPR polypeptides are known. For example, suitable CPR enzymes include those made by S. rebaudiana and A. thaliana. See, e.g., Table 5 and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety.
(50) TABLE-US-00004 TABLE 5 Cytochrome P450 reductase (CPR) Clones. Enzyme Source Accession Plasmid Construct Organism gi Number Number Name Name Length (nts) Stevia 93211213 ABB88839 pMUS40 MM-27 2133 rebaudiana (amino acid SEQ (nt SEQ ID NO: 116) ID NO: 44) Arabidopsis 15233853 NP_194183 pMUS41 MM-28 2079 thaliana (amino acid SEQ (nt SEQ ID NO: 117) ID NO: 45) Giberella 32562989 CAE09055 pMUS42 MM-29 2142 fujikuroi (amino acid SEQ (nt SEQ ID NO: 118) ID NO: 46)
(51) The yeast gene DPP1 and/or the yeast gene LPP1 can reduce the yield of steviol by converting the GGPP and FPP precursors by these enzymes. These genes can be disrupted or deleted such that the degradation of farnesyl pyrophosphate (FPP) to farnesol is reduced and the degradation of geranylgeranylpyrophosphate (GGPP) to geranylgeraniol (GGOH) is reduced. Alternatively, the promoter or enhancer elements of an endogenous gene encoding a phosphatase can be altered such that the expression of their encoded proteins is altered. Homologous recombination can be used to disrupt an endogenous gene. For example, a gene replacement vector can be constructed in such a way to include a selectable marker gene. The selectable marker gene can be operably linked, at both 5 and 3 end, to portions of the gene of sufficient length to mediate homologous recombination using methods known to those skilled in the art.
(52) A selectable marker can be one of any number of genes that complement host cell auxotrophy, provide antibiotic resistance, or result in a color change. Linearized DNA fragments of the gene replacement vector then are introduced into the cells using methods well known in the art (see below). Integration of the linear fragments into the genome and the disruption of the gene can be determined based on the selection marker and can be verified by, for example, Southern blot analysis. Subsequent to its use in selection, a selectable marker can be removed from the genome of the host cell by, e.g., Cre-IoxP systems (see, e.g., Gossen et al., 2002, Ann. Rev. Genetics 36:153-173 and U.S. Application Publication No. 20060014264). Alternatively, a gene replacement vector can be constructed in such a way as to include a portion of the gene to be disrupted, where the portion is devoid of any endogenous gene promoter sequence and encodes none, or an inactive fragment of, the coding sequence of the gene.
(53) An inactive fragment is a fragment of the gene that encodes a protein having, e.g., less than about 10% (e.g., less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, less than about 1%, or 0%) of the activity of the protein produced from the full-length coding sequence of the gene. Such a portion of a gene is inserted in a vector in such a way that no known promoter sequence is operably linked to the gene sequence, but that a stop codon and a transcription termination sequence are operably linked to the portion of the gene sequence. This vector can be subsequently linearized in the portion of the gene sequence and transformed into a cell. By way of single homologous recombination, this linearized vector is then integrated in the endogenous counterpart of the gene with inactivation thereof.
(54) Expression in a recombinant microorganism of these genes can result in the conversion of geranylgeranyl diphosphate to steviol.
(55) B. Steviol Glycoside Biosynthesis Polypeptides
(56) Recombinant host cells are described herein that can convert steviol to a steviol glycoside. Such hosts (e.g., microorganisms) contains genes encoding one or more UDP Glycosyl Transferases, also known as UGTs. UGTs transfer a monosaccharide unit from an activated nucleotide sugar to an acceptor moiety, in this case, an OH or COOH moiety on steviol or steviol derivative or an OH moiety on a glucose already attached to the steviol backbone. UGTs have been classified into families and subfamilies based on sequence homology. See Li et al., 2001, J. Biol. Chem. 276:4338-4343.
(57) Rubusoside Biosynthesis Polypeptides
(58) Biosynthesis of rubusoside involves glycosylation of the 13-OH and the 19-COOH of steviol. See
(59) A suitable UGT85C2 functions as a uridine 5-diphosphoglucosyl:steviol 13-OH transferase, and a uridine 5-diphosphoglucosyl:steviol-19-O-glucoside 13-OH transferase. Exemplary reactions for UGT85C2 include conversion of steviol and UDP-glucose to Steviol-13-O-glucoside or conversion of Steviol-19-O-glucoside and UDP-glucose to Rubusoside. See
(60) A suitable UGT74G1 polypeptide functions as a uridine 5-diphospho glucosyl: steviol 19-COOH transferase and a uridine 5-diphospho glucosyl: steviol-13-O-glucoside 19-COOH transferase. Exemplary reactions of 74G1 include conversion of steviol to steviol-19-O-glucoside and conversion of steviol-13-O-glucoside to Rubusoside. See
(61) A recombinant microorganism expressing a functional UGT74G1 and a functional UGT85C2 can make rubusoside and both steviol monosides (i.e., steviol 13-O-monoglucoside and steviol 19-O-monoglucoside) when steviol is used as a feedstock in the medium. Typically, however, genes encoding UGT74G1 and UGT85C2 are recombinant genes that have been transformed into a host (e.g., microorganism) that does not naturally possess them.
(62) As used herein, the term recombinant host is intended to refer to (including but not limited to) a host cell, the genome of which has been augmented by at least one incorporated DNA sequence; extrachromosomal examples, like plasmids in bacteria and episomes comprising the 2-micron circle in yeast. Such DNA sequences include but are not limited to genes that are not naturally present, DNA sequences that are not normally transcribed into RNA or translated into a protein (expressed), and other genes or DNA sequences which one desires to introduce into the non-recombinant host. It will be appreciated that typically the genome of a recombinant host described herein is augmented through the stable introduction of one or more recombinant genes. Generally, the introduced DNA is not originally resident in the host that is the recipient of the DNA, but it is within the scope of the invention to isolate a DNA segment from a given host, and to subsequently introduce one or more additional copies of that DNA into the same host, e.g., to enhance production of the product of a gene or alter the expression pattern of a gene. In some instances, the introduced DNA will modify or even replace an endogenous gene or DNA sequence by, e.g., homologous recombination or site-directed mutagenesis. Suitable recombinant hosts include microorganisms, mammalian cells, insect cells, fungal cells, plant cells, and plants.
(63) The term recombinant gene refers to a gene or DNA sequence that is introduced into a recipient host, regardless of whether the same or a similar gene or DNA sequence can already be present in such a host. Introduced, or augmented in this context, is known in the art to mean introduced or augmented by the hand of man. Thus, a recombinant gene can be a DNA sequence from another species, or can be a DNA sequence that originated from or is present in the same species, but has been incorporated into a host by recombinant methods to form a recombinant host. It will be appreciated that a recombinant gene that is introduced into a host can be identical to a DNA sequence that is normally present in the host being transformed, and is introduced to provide one or more additional copies of the DNA to thereby permit overexpression or modified (including but not limited to regulated or inducible) expression of the gene product of that DNA.
(64) Suitable UGT74G1 and UGT85C2 polypeptides include those made by S. rebaudiana. Genes encoding functional UGT74G1 and UGT85C2 polypeptides from Stevia are reported in Richman et al., 2005, Plant J. 41: 56-67. Amino acid sequences of S. rebaudiana UGT74G1 (SEQ ID NO: 19) and UGT85C2 (SEQ ID NO: 26) polypeptides are set forth in SEQ ID NOs: 1 and 3, respectively, of PCT Application No. PCT/US2012/050021, as are nucleotide sequences that encode UGT74G1 and UGT85C2 that have been optimized for expression in yeast and DNA 2.0 codon-optimized sequence for UGTs 85C2, 91D2e, 74G1 and 76G1. The Gene Art codon optimized nucleotide sequence encoding a S. rebaudiana UGT85C2 is set forth in SEQ ID NO:3. See also, the UGT85C2 and UGT74G1 variants described below in the Functional Homolog section. For example, a UGT85C2 polypeptide can contain substitutions at any one of the positions 65, 71, 270, 289, and 389 (e.g., A65S, E71Q, T270M, Q289H, and A389V) or a combination thereof.
(65) In some embodiments, the recombinant host is a microorganism. Recombinant microorganism can be grown on media containing steviol in order to produce rubusoside. In other embodiments, however, the recombinant microorganism expresses genes involved in steviol biosynthesis, e.g., a CDPS gene, a KS gene, a KO gene, and a KAH gene. Suitable CDPS polypeptides are known. For example, suitable CDPS enzymes include those made by S. rebaudiana, Streptomyces clavuligerus, Bradyrhizobium japonicum, Zea mays, and Arabidopsis sp. See, e.g., Table 6 and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety.
(66) In some embodiments, CDPS polypeptides that lack a chloroplast transit peptide at the amino terminus of the unmodified polypeptide can be used. For example, the first 150 nucleotides from the 5 end of the Zea mays CDPS coding sequence (SEQ ID NO:12) can be removed, the truncated nucleotide sequence is shown in SEQ ID NO:133. Doing so removes the amino terminal 50 residues of the amino acid sequence shown in SEQ ID NO:13, which encode a chloroplast transit peptide; the truncated amino acid sequence is shown in SEQ ID NO:134. The truncated CDPS gene can be fitted with a new ATG translation start site and operably linked to a promoter, typically a constitutive or highly expressing promoter. When a plurality of copies, including but not limited to, one copy, two copies or three copies of the truncated coding sequence are introduced into a microorganism, expression of the CDPS polypeptide from the promoter results in an increased carbon flux towards ent-kaurene biosynthesis.
(67) TABLE-US-00005 TABLE 6 CDPS Clones. Enzyme Source Plasmid Construct Organism gi Number Accession Number Name Name Length (nts) Stevia 2642661 AAB87091 pMUS22 MM-9 2364 rebaudiana (amino acid SEQ (nt SEQ ID NO: 119) ID NO: 48) Streptomyces 197705855 EDY51667 pMUS23 MM-10 1584 clavuligerus (amino acid SEQ (nt SEQ ID NO: 120) ID NO: 49) Bradyrhizobium 529968 AAC28895.1 pMUS24 MM-11 1551 japonicum (amino acid SEQ (nt SEQ ID NO: 121) ID NO: 50) Zea mays 50082774 AY562490 EV65 2484 (amino acid SEQ (nt SEQ ID NO: 51) ID NO: 52) Arabidopsis 18412041 NM_116512 EV64 2409 thaliana (SEQ ID NO: 54) (nt SEQ ID NO: 53)
(68) CDPS-KS bifunctional proteins also can be used. Nucleotide sequences encoding the CDPS-KS bifunctional enzymes shown in Table 7 were modified for expression in yeast (see PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety). A bifunctional enzyme from Gibberella fujikuroi also can be used.
(69) TABLE-US-00006 TABLE 7 CDPS-KS Clones. Enzyme Source Accession Construct Organism gi Number Number Name Length (nts) Phomopsis 186704306 BAG30962 MM-16 2952 amygdali (amino acid (nt SEQ ID SEQ ID NO: NO: 122) 55) Physcomitrella 146325986 BAF61135 MM-17 2646 patens (amino acid (nt SEQ ID SEQ ID NO: NO: 123) 56) Gibberella 62900107 Q9UVY5.1 2859 fujikuroi (amino acid (nt SEQ ID SEQ ID NO: NO: 124) 57)
(70) Thus, a microorganism containing a CDPS gene, a KS gene, a KO gene and a KAH gene in addition to a UGT74G1 and a UGT85C2 gene is capable of producing both steviol monosides and rubusoside without the necessity for using steviol as a feedstock.
(71) In some embodiments, the recombinant microorganism further expresses a recombinant gene encoding a geranylgeranyl diphosphate synthase (GGPPS). Suitable GGPPS polypeptides are known. For example, suitable GGPPS enzymes include those made by S. rebaudiana, Gibberella fujikuroi, Mus musculus, Thalassiosira pseudonana, Streptomyces clavuligerus, Sulfulobus acidocaldarius, Synechococcus sp. and A. thaliana. See, Table 8 and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety.
(72) TABLE-US-00007 TABLE 8 GGPPS Clones. Enzyme Source gi Accession Plasmid Construct Length Organism Number Number Name Name (nts) Stevia 90289577 ABD92926 pMUS14 MM-1 1086 rebaudiana (amino acid SEQ (nt SEQ ID NO: 58) ID NO: 125) Gibberella 3549881 CAA75568 pMUS15 MM-2 1029 fujikuroi (amino acid SEQ (nt SEQ ID NO: 59) ID NO: 126) Mus musculus 47124116 AAH69913 pMUS16 MM-3 903 (amino acid SEQ (nt SEQ ID NO: 60) ID NO: 127) Thalassiosira 223997332 XP_002288339 pMUS17 MM-4 1020 pseudonana (amino acid SEQ (nt SEQ ID NO: 61) ID NO: 128) Streptomyces 254389342 ZP_05004570 pMUS18 MM-5 1068 clavuligerus (amino acid SEQ (nt SEQ ID NO: 62) ID NO: 129) Sulfulobus 506371 BAA43200 pMUS19 MM-6 993 acidocaldarius (amino acid SEQ (nt SEQ ID NO: 63) ID NO: 130) Synechococcus 86553638 ABC98596 pMUS20 MM-7 894 sp. (amino acid SEQ (nt SEQ ID NO: 64) ID NO: 131) Arabidopsis 15234534 NP_195399 pMUS21 MM-8 1113 thaliana (amino acid SEQ (nt SEQ ID NO: 63) ID NO: 132)
(73) In some aspects, the KAH gene encoding the KAH polypeptide set forth in SEQ ID NO:11, comprising a recombinant cell of the invention is overexpressed. In some aspects, the KAH gene can be present in (including but not limited to) one, two or three copies. In some aspects, the KS gene encoding the KS polypeptide, set forth in SEQ ID NO:21, comprising a recombinant cell of the invention is overexpressed. In some aspects, the KS gene can be present in (including but not limited to) one, two or three copies.
(74) In some embodiments, the recombinant microorganism further can express recombinant genes involved in diterpene biosynthesis or production of terpenoid precursors, e.g., genes in the methylerythritol 4-phosphate (MEP) pathway or genes in the mevalonate (MEV) pathway discussed below, have reduced phosphatase activity, and/or express a sucrose synthase (SUS) as discussed herein.
(75) Rebaudioside A, Rebaudioside D, and Rebaudioside E Biosynthesis Polypeptides
(76) Biosynthesis of Rebaudioside A involves glucosylation of the aglycone steviol. Specifically, Rebaudioside A can be formed by glucosylation of the 13-OH of steviol which forms the 13-O-steviolmonoside, glucosylation of the C-2 of the 13-O-glucose of steviolmonoside which forms steviol-1,2-bioside, glucosylation of the C-19 carboxyl of steviol-1,2-bioside which forms stevioside, and glucosylation of the C-3 of the C-13-O-glucose of stevioside to produce Reb A. The order in which each glucosylation reaction occurs can vary. See
(77) Biosynthesis of Rebaudioside E and/or Rebaudioside D involves glucosylation of the aglycone steviol. Specifically, Rebaudioside E can be formed by glucosylation of the 13-OH of steviol which forms steviol-13-O-glucoside, glucosylation of the C-2 of the 13-O-glucose of steviol-13-O-glucoside which forms the steviol-1,2-bioside, glucosylation of the C-19 carboxyl of the 1,2-bioside to form 1,2-stevioside, and glucosylation of the C-2 of the 19-O-glucose of the 1,2-stevioside to form Rebaudioside E. Rebaudioside D can be formed by glucosylation of the C-3 of the C-13-O-glucose of Rebaudioside E. The order in which each glycosylation reaction occurs can vary. For example, the glucosylation of the C-2 of the 19-O-glucose can be the last step in the pathway, wherein Rebaudioside A is an intermediate in the pathway. See
(78) Rebaudioside M Polypeptides
(79) As provided herein, conversion of steviol to Rebaudioside M in a recombinant host can be accomplished by expressing combinations of the following functional UGTs: 91D2, EUGT11, 74G1, 85C2, and 76G1. See
(80) Targeted production of individual Rebaudiosides can be accomplished by differential copy numbers of the UGT-encoding genes (see
(81) In some embodiments, UGT76G1 catalyzes glycosylation of steviol and steviol glycosides at the 19-O position. Thus, in some embodiments, one or more of RebM, RebQ, RebI, di-glycosylated steviol glycoside (13-hydroxy kaur-16-en-18-oic acid, [2-O-?-D-glucopyranosyl-?-D-glucopyranosyl] ester), or tri-glycosylated steviol glycoside ((13-hydroxy kaur-16-en-18-oic acid; [2-O-?-D-glucopyranosyl-3-O-?-D-glucopyranosyl-?-D-glucopyranosyl] ester) are produced in a recombinant host expressing a recombinant gene encoding a UGT76G1 polypeptide, through bioconversion, or through catalysis by UGT76G1 in vitro. In some embodiments, UGT76G1 catalyzes the glycosylation of steviol and steviol glycosides at the 13-O position and preferentially glycosylates steviol glycoside substrates that are 1,2-di-glycosylated at the 13-O position or mono-glycosylated at the 13-O position. In some embodiments, UGT76G1 does not show a preference for the glycosylation state of the 19-O position.
(82) In some aspects, a recombinant host cell of the invention comprises the gene encoding the UGT76G1 polypeptide set forth in SEQ ID NO:2. In some aspects, the gene encoding the UGT76G1 polypeptide set forth in SEQ ID NO:2, comprising a recombinant cell of the invention is overexpressed. In some aspects, the gene can be present in (including but not limited to) two or three copies.
(83) In some embodiments, the gene encoding the UGT76G1 polypeptide set forth in SEQ ID NO:2 is present in one copy. As shown in
(84) In some embodiments, less than five (e.g., one, two, three, or four) UGTs are expressed in a host. For example, a recombinant microorganism expressing a functional EUGT11 can make Rebaudioside D when Rebaudioside A is used as a feedstock. A recombinant microorganism expressing a functional UGT76G1 can make Rebaudioside M when Rebaudioside D or Rebaudioside E is used as a feedstock. Rebaudioside M can be formed from either Rebaudioside D or Rebaudioside E by glucosylation of the C-3 of the 19-O-glucose of Rebaudioside D or Rebuadioside E; in the case of Rebaudioside E a second glucosylation is required, of the 13-O-glucose to produce Rebaudioside M.
(85) A recombinant microorganism expressing EUGT11, 74G1 or 76G1, and 91D2 can make Rebaudioside D or Rebaudioside M when rubusoside or 1,2-stevioside is used as a feedstock. As another alternative, a recombinant microorganism expressing EUGT11, 74G1, 76G1, and 91D2 can make Rebaudioside D or Rebaudioside M when the monoside, steviol-13-O-glucoside are added to the medium. Similarly, conversion of steviol-19-O-glucoside to Rebaudioside D in a recombinant microorganism can be accomplished by expressing in the cell genes encoding UGTs EUGT11, 85C2, 76G1, and 91D2e, when fed steviol-19-O-glucoside.
(86) Suitable UGT74G1 and UGT85C2 polypeptides include those discussed above. A suitable UGT76G1 adds a glucose moiety to the C-3 of the C-13-O-glucose of the acceptor molecule, a steviol 1,2 glycoside. UGT76G1 functions, for example, as a uridine 5-diphospho glucosyl: steviol 13-O-1,2 glucoside C-3 glucosyl transferase and a uridine 5-diphospho glucosyl: steviol-19-O-glucose, 13-O-1,2 bioside C-3 glucosyl transferase. Functional UGT76G1 polypeptides can also catalyze glucosyl transferase reactions that utilize steviol glycoside substrates that contain sugars other than glucose, e.g., steviol rhamnosides and steviol xylosides. See,
(87) A suitable EUGT11 or UGT91D2 polypeptide functions as a uridine 5-diphospho glucosyl: steviol-13-O-glucoside transferase (also referred to as a steviol-13-monoglucoside 1,2-glucosylase), transferring a glucose moiety to the C-2 of the 13-O-glucose of the acceptor molecule, steviol-13-O-glucoside.
(88) A suitable EUGT11 or UGT91D2 polypeptide also functions as a uridine 5-diphospho glucosyl: rubusoside transferase transferring a glucose moiety to the C-2 of the 13-0-glucose of the acceptor molecule, rubusoside, to produce stevioside. EUGT11 polypeptides also can transfer a glucose moiety to the C-2 of the 19-O-glucose of the acceptor molecule, rubusoside, to produce a 19-O-1,2-diglycosylated rubusoside (see
(89) Functional EUGT11 or UGT91D2 polypeptides also can catalyze reactions that utilize steviol glycoside substrates other than steviol-13-O-glucoside and rubusoside. For example, a functional EUGT11 polypeptide can utilize stevioside as a substrate, transferring a glucose moiety to the C-2 of the 19-O-glucose residue to produce Rebaudioside E (see
(90) In addition, a functional EUGT11 exhibits significant C-2 19-O-diglycosylation activity with rubusoside or stevioside as substrates, whereas UGT91D2e has no detectable diglycosylation activity with these substrates under some conditions. Thus, a functional EUGT11 can be distinguished from UGT91D2e by the differences in steviol glycoside substrate-specificity.
(91) A functional EUGT11 or UGT91D2 polypeptide does not transfer a glucose moiety to steviol compounds having a 1,3-bound glucose at the C-13 position, i.e., transfer of a glucose moiety to steviol-1,3-bioside and 1,3-stevioside (RebG) does not occur.
(92) Functional EUGT11 and UGT91D2 polypeptides can transfer sugar moieties from donors other than uridine diphosphate glucose. For example, a functional EUGT11 or UGT91D2 polypeptide can act as a uridine 5-diphospho D-xylosyl: steviol-13-O-glucoside transferase, transferring a xylose moiety to the C-2 of the 13-O-glucose of the acceptor molecule, steviol-13-O-glucoside. As another example, a functional EUGT11 or UGT91D2 polypeptide can act as a uridine 5-diphospho L-rhamnosyl: steviol-13-O-glucoside transferase, transferring a rhamnose moiety to the C-2 of the 13-O-glucose of the acceptor molecule, steviol-13-O-glucoside.
(93) Suitable EUGT11 polypeptides are described herein and can include the EUGT11 polypeptide from Oryza sativa (GenBank Accession No. AC133334; SEQ ID NO:16). For example, an EUGT11 polypeptide can have an amino acid sequence with at least 70% sequence identity (e.g., at least 75, 80, 85, 90, 95, 96, 97, 98, or 99% sequence identity) to the amino acid sequence set forth in SEQ ID NO:16. The nucleotide sequence encoding the amino acid sequence of EUGT11 also is set forth in SEQ ID NO:17, as is a codon optimized nucleotide sequence for expression in yeast (SEQ ID NO:18).
(94) Suitable functional UGT91D2 polypeptides include, e.g., the polypeptides designated UGT91D2e and UGT91D2m and functional homologs as described herein. The amino acid sequence of an exemplary UGT91D2e polypeptide from S. rebaudiana is set forth in SEQ ID NO:15, as is the nucleotide sequence encoding the UGT91D2e polypeptide that has been codon optimized for expression in yeast (SEQ ID NO:89). The amino acid sequences of exemplary UGT91D2m (SEQ ID NO:86) polypeptides from S. rebaudiana are set forth as SEQ ID NO: 10 in PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety. In addition, UGT91D2 variants containing a substitution at amino acid residues 206, 207, and 343 can be used. For example, the amino acid sequence having G206R, Y207C, and W343R mutations with respect to wild-type UGT91D2e can be used. In addition, a UGT91D2 variant containing substitutions at amino acid residues 211 and 286 can be used. For example, a UGT91D2 variant can include a substitution of a methionine for leucine at position 211 and a substitution of an alanine for valine at position 286 (referred to as UGT91D2e-b). These variants, L211M and V286A, are variants of SEQ ID NO: 5 from PCT/US2012/050021, which is disclosed herein as SEQ ID NO: 66. Additional variants can include variants (except T144S, M152L, L213F, S364P, and G384C variants) described in Table 12 and Example 11 of the PCT/US2012/050021, which is incorporated herein by reference in its entirety.
(95) As indicated above, UGTs designated herein as SMI2UGT can be substituted for UGT91D2. Suitable functional SMI2UGT polypeptides include those made by Ipomoea purpurea (Japanese morning glory) and described in Morita et al., 2005, Plant J. 42, 353-363. The amino acid sequence encoding the I. purpurea IP3GGT (SEQ ID NO: 67) (which is set forth in PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety) as a nucleotide sequence (SEQ ID NO: 68) that encodes the polypeptide and that has been codon optimized for expression in yeast. Another suitable SM12UGT polypeptide is a UGT94B1 polypeptide having an R25S mutation (Bp94B1 polypeptide). See Osmani et al., 2008, Plant Phys. 148: 1295-1308 and Sawada et al., 2005, J. Biol. Chem. 280:899-906. The amino acid sequence of the Bellis perennis (red daisy) UGT94B1 (SEQ ID NO: 69) and the nucleotide sequence that has been codon optimized for expression in yeast (SEQ ID NO: 70) are set forth in PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety.
(96) In some embodiments, the recombinant microorganism is grown on media containing steviol-13-O-glucoside or steviol-19-O-glucoside in order to produce Rebaudioside M. In such embodiments, the microorganism contains and expresses genes encoding a functional EUGT11, a functional UGT74G1, a functional UGT85C2, a functional UGT76G1, and a functional UGT91D2, and is capable of accumulating Rebaudioside A, Rebaudioside D, Rebaudioside M or a combination thereof, depending on the relative levels of UDP-glycosyl transferase activities, when steviol, one or both of the steviolmonosides, or rubusoside is used as feedstock.
(97) In other embodiments, the recombinant microorganism is grown on media containing rubusoside in order to produce Rebaudioside A, D, or M. In such embodiments, the microorganism contains and expresses genes encoding a functional EUGT11, a functional UGT76G1, and a functional UGT91D2, and is capable of producing Rebaudioside A, D, M or a combination thereof, depending on the relative levels of UDP-glycosyl transferase activities, when rubusoside is used as feedstock.
(98) In other embodiments the recombinant microorganism expresses genes involved in steviol biosynthesis, e.g., a CDPS gene, a KS gene, a KO gene and/or a KAH gene. Thus, for example, a microorganism containing a CDPS gene, a KS gene, a KO gene and a KAH gene, in addition to a EUGT11, a UGT74G1, a UGT85C2, a UGT76G1, and a functional UGT91D2 (e.g., UGT91D2e), is capable of producing Rebaudioside A, D, E, and/or M without the necessity of including steviol in the culture media.
(99) In some embodiments, the recombinant host further contains and expresses a recombinant GGPPS gene in order to provide increased levels of the diterpene precursor geranylgeranyl diphosphate, for increased flux through the steviol biosynthetic pathway.
(100) In some embodiments, the recombinant host further contains a construct to silence expression of non-steviol pathways consuming geranylgeranyl diphosphate, ent-Kaurenoic acid or farnesyl pyrophosphate, thereby providing increased flux through the steviol and steviol glycosides biosynthetic pathways. As discussed below, flux to sterol production pathways such as ergosterol can be reduced by downregulation of the ERG9 gene. In cells that produce gibberellins, gibberellin synthesis can be downregulated to increase flux of ent-kaurenoic acid to steviol. In carotenoid-producing organisms, flux to steviol can be increased by downregulation of one or more carotenoid biosynthetic genes. In some embodiments, the recombinant microorganism further can express recombinant genes involved in diterpene biosynthesis or production of terpenoid precursors, e.g., genes in the MEP or MEV pathways discussed below, have reduced phosphatase activity, and/or express a SUS as discussed herein.
(101) One with skill in the art will recognize that by modulating relative expression levels of different UGT genes, a recombinant host can be tailored to specifically produce steviol glycoside products in a desired proportion. Transcriptional regulation of steviol biosynthesis genes and steviol glycoside biosynthesis genes can be achieved by a combination of transcriptional activation and repression using techniques known to those in the art. For in vitro reactions, one with skill in the art will recognize that addition of different levels of UGT enzymes in combination or under conditions which impact the relative activities of the different UGTS in combination will direct synthesis towards a desired proportion of each steviol glycoside. One with skill in the art will recognize that a higher proportion of Rebaudioside D or M, or more efficient conversion to Rebaudioside D or M can be obtained with a diglycosylation enzyme that has a higher activity for the 19-O-glucoside reaction as compared to the 13-O-glucoside reaction (substrates Rebaudioside A and stevioside).
(102) In some embodiments, a recombinant host such as a microorganism produces Rebaudioside M-enriched steviol glycoside compositions that have greater than at least 3% Rebaudioside M by weight total steviol glycosides, e.g., at least 4% Rebaudioside M, at least 5% Rebaudioside M, at least 10-20% Rebaudioside M, at least 20-30% Rebaudioside M, at least 30-40% Rebaudioside M, at least 40-50% Rebaudioside M, at least 50-60% Rebaudioside M, at least 60-70% Rebaudioside M, or at least 70-80% Rebaudioside M. Other steviol glycosides present can include those depicted in
(103) In some embodiments, Rebaudioside M can be produced using in vitro methods while supplying the appropriate UDP-sugar and/or a cell-free system for regeneration of UDP-sugars. In some embodiments, sucrose and a sucrose synthase can be provided in the reaction vessel in order to regenerate UDP-glucose from the UDP generated during glycosylation reactions. The sucrose synthase can be from any suitable organism. For example, a sucrose synthase coding sequence from A. thaliana, S. rebaudiana, or Coffea arabica can be cloned into an expression plasmid under control of a suitable promoter, and expressed in a host such as a microorganism or a plant.
(104) Conversions requiring multiple reactions can be carried out together, or stepwise. For example, Rebaudioside M can be produced from Rebaudioside D or Rebaudioside E that is commercially available as an enriched extract or produced via biosynthesis, with the addition of stoichiometric or excess amounts of UDP-glucose and UGT76G1. As an alternative, Rebaudioside D and Rebaudioside M can be produced from steviol glycoside extracts that are enriched for stevioside and Rebaudioside A, using EUGT11 and a suitable UGT76G1 enzyme. In some embodiments, phosphatases are used to remove secondary products and improve reaction yields. UGTs and other enzymes for in vitro reactions can be provided in soluble forms or in immobilized forms.
(105) In some embodiments, Rebaudioside M can be produced using whole cells that are fed raw materials that contain precursor molecules such as steviol and/or steviol glycosides, including mixtures of steviol glycosides derived from plant extracts. The raw materials can be fed during cell growth or after cell growth. The whole cells can be in suspension or immobilized. The whole cells can be entrapped in beads, for example calcium or sodium alginate beads. The whole cells can be linked to a hollow fiber tube reactor system. The whole cells can be concentrated and entrapped within a membrane reactor system. The whole cells can be in fermentation broth or in a reaction buffer. Similar methodology can be applied to fermentation of recombinant cells.
(106) In some embodiments, a permeabilizing agent is utilized for efficient transfer of substrate into the cells. In some embodiments, the cells are permeabilized with a solvent such as toluene, or with a detergent such as Triton-X or Tween. In some embodiments, the cells are permeabilized with a surfactant, for example a cationic surfactant such as cetyltrimethylammonium bromide (CTAB). In some embodiments, the cells are permeabilized with periodic mechanical shock such as electroporation or a slight osmotic shock. The cells can contain one recombinant UGT or multiple recombinant UGTs. For example, the cells can contain UGT76G1, 91D2e, 85C2, 74G1 and EUGT11 such that mixtures of steviol and/or steviol glycosides are efficiently converted to Rebaudioside M. In some embodiments, the whole cells are the host cells described below. In some embodiments, the whole cells are a Gram-negative bacterium such as E. coli. In some embodiments, the whole cell is a Gram-positive bacterium such as Bacillus. In some embodiments, the whole cell is a fungal species such as Aspergillus, or yeast such as Saccharomyces. In some embodiments, the term whole cell biocatalysis is used to refer to the process in which the whole cells are grown as described above (e.g., in a medium and optionally permeabilized) and a substrate such as Rebaudioside D, Rebaudioside E, or stevioside is provided and converted to the end product using the enzymes from the cells. The cells can or cannot be viable, and can or cannot be growing during the bioconversion reactions. In contrast, in fermentation, the cells are cultured in a growth medium and fed a carbon and energy source such as glucose and the end product is produced with viable cells.
(107) C. Other Polypeptides
(108) Genes for additional polypeptides whose expression facilitates more efficient or larger scale production of steviol or a steviol glycoside can also be introduced into a recombinant host. For example, a recombinant microorganism, plant, or plant cell can also contain one or more genes encoding a geranylgeranyl diphosphate synthase (GGPPS, also referred to as GGDPS). As another example, the recombinant host can contain one or more genes encoding a rhamnose synthetase, or one or more genes encoding a UDP-glucose dehydrogenase and/or a UDP-glucuronic acid decarboxylase. As another example, a recombinant host can also contain one or more genes encoding a cytochrome P450 reductase (CPR). Expression of a recombinant CPR facilitates the cycling of NADP+ to regenerate NADPH, which is utilized as a cofactor for terpenoid biosynthesis. Other methods can be used to regenerate NADHP levels as well. In circumstances where NADPH becomes limiting, for example, strains can be further modified to include exogenous transhydrogenase genes. See, e.g., Sauer et al., 2004, J. Biol. Chem. 279: 6613-6619. Other methods are known to those with skill in the art to reduce or otherwise modify the ratio of NADH/NADPH such that the desired cofactor level is increased.
(109) As another example the recombinant host can contain one or more genes encoding a sucrose synthase, and additionally can contain sucrose uptake genes if desired. The sucrose synthase reaction can be used to increase the UDP-glucose pool in a fermentation host, or in a whole cell bioconversion process. This regenerates UDP-glucose from UDP produced during glycosylation and sucrose, allowing for efficient glycosylation. In some organisms, disruption of the endogenous invertase is advantageous to prevent degradation of sucrose. For example, the S. cerevisiae SUC2 invertase can be disrupted. The sucrose synthase (SUS) can be from any suitable organism. For example, a sucrose synthase coding sequence from, without limitation, A. thaliana, S. rebaudiana, or C. arabica can be cloned into an expression plasmid under control of a suitable promoter, and expressed in a host (e.g., a microorganism or a plant). The sucrose synthase can be expressed in such a strain in combination with a sucrose transporter (e.g., the A. thaliana SUC1 transporter or a functional homolog thereof) and one or more UGTs (e.g., UGT85C2, UGT74G1, UGT76G1, and UGT91D2e, EUGT11 or functional homologs thereof). Culturing the host in a medium that contains sucrose can promote production of UDP-glucose, as well as one or more glucosides (e.g., steviol glycosides).
(110) Expression of the ERG9 gene, which encodes squalene synthase (SQS), also can be reduced in recombinant hosts such that there is a build-up of precursors to squalene synthase in the recombinant host. SQS is classified under EC 2.5.1.21 and is the first committed enzyme of the biosynthesis pathway that leads to the production of sterols. It catalyzes the synthesis of squalene from farnesyl pyrophosphate via the intermediate presqualene pyrophosphate, wherein two units of farnesyl pyrophosphate are converted into squalene. This enzyme is a branch point enzyme in the biosynthesis of terpenoids/isoprenoids and is thought to regulate the flux of isoprene intermediates through the sterol pathway. The enzyme is sometimes referred to as farnesyl-diphosphate farnesyltransferase (FDFT1). In addition, a recombinant host can have reduced phosphatase activity as discussed herein.
(111) MEP Biosynthesis Polypeptides
(112) As another example, the recombinant host can contain one or more genes encoding one or more enzymes in the MEP pathway or the mevalonate pathway. Such genes are useful because they can increase the flux of carbon into the diterpene biosynthesis pathway, producing geranylgeranyl diphosphate from isopentenyl diphosphate and dimethylallyl diphosphate generated by the pathway. The geranylgeranyl diphosphate so produced can be directed towards steviol and steviol glycoside biosynthesis due to expression of steviol biosynthesis polypeptides and steviol glycoside biosynthesis polypeptides. See, e.g., Brandle et al., 2007, Phytochemistry 68:1855-1863.
(113) In some embodiments, a recombinant host contains one or more genes encoding enzymes involved in the methylerythritol 4-phosphate (MEP) pathway for isoprenoid biosynthesis. Enzymes in the MEP pathway include deoxyxylulose 5-phosphate synthase (DXS), D-1-deoxyxylulose 5-phosphate reductoisomerase (DXR), 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase (CMS), 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (CMK), 4-diphosphocytidyl-2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MCS), 1-hydroxy-2-methyl-2(E)-butenyl 4-diphosphate synthase (HDS) and 1-hydroxy-2-methyl-2(E)-butenyl 4-diphosphate reductase (HDR). One or more DXS genes, DXR genes, CMS genes, CMK genes, MCS genes, HDS genes and/or HDR genes can be incorporated into a recombinant microorganism. See, Rodriguez-Concepcion and Boronat, Plant Phys. 130: 1079-1089 (2002).
(114) Suitable genes encoding DXS, DXR, CMS, CMK, MCS, HDS and/or HDR polypeptides include those made by E. coli, A. thaliana and Synechococcus leopoliensis. Nucleotide sequences encoding DXR polypeptides (e.g., SEQ ID NO: 71) are described, for example, in U.S. Pat. No. 7,335,815.
(115) Mevalonate Biosynthesis Polypeptides
(116) S. cerevisiae contains endogenous genes encoding the enzymes of a functional mevalonate pathway for isoprenoid synthesis. In some embodiments, a recombinant host also contains one or more heterologous genes encoding enzymes involved in the mevalonate pathway. Genes suitable for transformation into a host encode enzymes in the mevalonate pathway such as a truncated 3-hydroxy-3-methyl-glutaryl (HMG)-CoA reductase (tHMG), and/or a gene encoding a mevalonate kinase (MK), and/or a gene encoding a phosphomevalonate kinase (PMK), and/or a gene encoding a mevalonate pyrophosphate decarboxylase (MPPD). Thus, one or more HMG-CoA reductase genes, MK genes, PMK genes, and/or MPPD genes can be incorporated into a recombinant host such as a microorganism.
(117) Suitable genes encoding mevalonate pathway polypeptides are known. For example, suitable polypeptides include those made by E. coli, Paracoccus denitrificans, S. cerevisiae, A. thaliana, Kitasatospora griseola, Homo sapiens, Drosophila melanogaster, Gallus gallus, Streptomyces sp. KO-3988, Nicotiana attenuata, Kitasatospora griseola, Hevea brasiliensis, Enterococcus faecium and Haematococcus pluvialis. See, e.g., Table 9, U.S. Pat. Nos. 7,183,089, 5,460,949, and 5,306,862, and PCT Application Nos. PCT/US2012/050021 and PCT/US2011/038967, which are incorporated herein by reference in their entirety.
(118) TABLE-US-00008 TABLE 9 Sources of HMG CoA Reductases and other Mevalonate Genes Size Gene Accession# Organism Enzyme (nt) name XM_001467423 Leishmania Acetyl-CoA 1323 MEV-4 (amino acid SEQ infantum C-acetyltransferase (nt SEQ ID NO: 72) ID NO: 94) YML075C Saccharomyces Truncated HMG 1584 tHMG1 (amino acid SEQ cerevisiae (tHMG1) (nt SEQ ID NO: 73) ID NO: 95) EU263989 Ganoderma 3-HMG-CoA 3681 MEV-11 (amino acid SEQ lucidum reductase (nt SEQ ID NO: 74) ID NO: 96) BC153262 Bos taurus 3-HMG-CoA 2667 MEV-12 (amino acid SEQ reductase (nt SEQ ID NO: 75) ID NO: 97) AAD47596 Artemisia 3-HMG-CoA 1704 MEV-13 (amino acid SEQ annua reductase (nt SEQ ID NO: 76) ID NO: 98) AAB62280 Trypanosoma 3-HMG-CoA 1308 MEV-14 (amiono acid SEQ cruzi reductase (nt SEQ ID NO: 77) ID NO: 99) CAG41604 Staph aureus 3-HMG-CoA 1281 MEV-15 (amino acid SEQ reductase (nt SEQ ID NO: 78) ID NO: 100) DNA2.0 sequence Archaeoglobus 3-HMG-CoA 1311 HMG (amino acid SEQ fulgidus reductase (nt SEQ reductase ID NO: 92) ID NO: 101) DNA2.0 sequence Pseudomonas 3-HMG-CoA 1287 HMG (amino acid SEQ mevalonii reductase (nt SEQ reductase ID NO: 93) ID NO: 102)
Sucrose Synthase Polypeptides
(119) Sucrose synthase (SUS) can be used as a tool for generating UDP-sugar, in particular UDP-glucose. SUS (EC 2.4.1.13) catalyzes the formation of UDP-glucose and fructose from sucrose and UDP. UDP generated by the reaction of UGTs thus can be converted by SUS into UDP-glucose in the presence of sucrose. See, e.g., Chen et al., 2001, J. Am. Chem. Soc. 123:8866-8867; Shao et al., 2003, Appl. Env. Microbiol. 69:5238-5242; Masada et al., 2007, FEBS Lett. 581:2562-2566; and Son et al., 2009, J. Microbiol. Biotechnol. 19:709-712.
(120) Sucrose synthases can be used to generate UDP-glucose and remove UDP, facilitating efficient glycosylation of compounds in various systems. For example, yeast deficient in the ability to utilize sucrose can be made to grow on sucrose by introducing a sucrose transporter and a SUS. For example, S. cerevisiae does not have an efficient sucrose uptake system, and relies on extracellular SUC2 to utilize sucrose. The combination of disrupting the endogenous S. cerevisiae SUC2 invertase and expressing recombinant SUS resulted in a yeast strain that was able to metabolize intracellular but not extracellular sucrose (Riesmeier et al., 1992, EMBO J. 11:4705-4713). The strain was used to isolate sucrose transporters by transformation with a cDNA expression library and selection of transformants that had gained the ability to take up sucrose.
(121) The combined expression of recombinant sucrose synthase and a sucrose transporter in vivo can lead to increased UDP-glucose availability and removal of unwanted UDP. For example, functional expression of a recombinant sucrose synthase, a sucrose transporter, and a glycosyltransferase, in combination with knockout of the natural sucrose degradation system (SUC2 in the case of S. cerevisiae) can be used to generate a cell that is capable of producing increased amounts of glycosylated compounds such as steviol glycosides. This higher glycosylation capability is due to at least (a) a higher capacity for producing UDP-glucose in a more energy efficient manner, and (b) removal of UDP from growth medium, as UDP can inhibit glycosylation reactions.
(122) The sucrose synthase can be from any suitable organism. For example, a sucrose synthase coding sequence from, without limitation, A. thaliana (e.g. SEQ ID NO: 79 or 80), or C. arabica (e.g., SEQ ID NO: 81) (see e.g., SEQ ID NOs: 178, 179, and 180 of PCT/US2012/050021, which is incorporated herein by reference in its entirety) includes the amino acid sequence of the sucrose transporter SUC1 from A. thaliana (SEQ ID NO: 80), and the amino acid sequence of the sucrose synthase from coffee (SEQ ID NO: 81).
(123) The sucrose synthase can be from any suitable organism. For example, a sucrose synthase coding sequence from, without limitation, A. thaliana, S. rebaudiana, or C. arabica (see e.g., SEQ ID NOs: 79-81) can be cloned into an expression plasmid under control of a suitable promoter, and expressed in a host (e.g., a microorganism or a plant). A SUS coding sequence can be expressed in a SUC2 (sucrose hydrolyzing enzyme) deficient S. cerevisiae strain, so as to avoid degradation of extracellular sucrose by the yeast.
(124) The sucrose synthase can be expressed in such a strain in combination with a sucrose transporter (e.g., the A. thaliana SUC1 transporter or a functional homolog thereof) and one or more UGTs (e.g., UGT85C2, UGT74G1, UGT76G1, EUGT11, and UGT91D2e, or functional homologs thereof). Culturing the host in a medium that contains sucrose can promote production of UDP-glucose, as well as one or more glucosides (e.g., steviol glucoside). It is to be noted that in some cases, a sucrose synthase and a sucrose transporter can be expressed along with a UGT in a host cell that also is recombinant for production of a particular compound (e.g., steviol).
(125) Modulating Expression of ERG9 Gene
(126) Expression of the endogenous ERG9 gene can be altered in a recombinant host described herein using a nucleic acid construct. The construct can include two regions that are homologous to parts of the genome sequence within the ERG9 promoter or 5 end of the ERG9 open reading frame (ORF), respectively. The construct can further include a promoter, such as either the wild type ScKex2 or wild type ScCyc1, and the promoter further can include a heterologous insert such as a hairpin at its 3-end. The polypeptide encoded by the ORF advantageously has at least 70% identity to a squalene synthase (EC 2.5.1.21) or a biologically active fragment thereof, said fragment having at least 70% sequence identity to said squalene synthase in a range of overlap of at least 100 amino acids. See, for example, PCT/US2012/050021 (incorporated herein for all purposes in its entirety).
(127) The heterologous insert can adapt the secondary structure element of a hairpin with a hairpin loop. The heterologous insert sequence has the general formula (I):
-X1-X2-X3-X4-X5, wherein
(128) X2 comprises at least 4 consecutive nucleotides being complementary to, and forming a hairpin secondary structure element with at least 4 consecutive nucleotides of X4, and
(129) X3 is optional and if present comprises nucleotides involved in forming a hairpin loop between X2 and X4, and
(130) X1 and X5 individually and optionally comprise one or more nucleotides, and
(131) X2 and X4 can individually consist of any suitable number of nucleotides, so long as a consecutive sequence of at least 4 nucleotides of X2 is complementary to a consecutive sequence of at least 4 nucleotides of X4. In some embodiments, X2 and X4 consist of the same number of nucleotides.
(132) The heterologous insert is long enough to allow a hairpin to be completed, but short enough to allow limited translation of an ORF that is present in-frame and immediately 3 to the heterologous insert. Typically, the heterologous insert is from 10-50 nucleotides in length, e.g., 10-30 nucleotides, 15-25 nucleotides, 17-22 nucleotides, 18-21 nucleotides, 18-20 nucleotides, or 19 nucleotides in length. As provided herein:
(133) X2 can for example consist of in the range of 4 to 25 nucleotides, such as in the range of 4 to 20, 4 to 15, 6 to 12, 8 to 12, or 9 to 11 nucleotides.
(134) X4 can for example consist of in the range of 4 to 25 nucleotides, such as in the range of 4 to 20, 4 to 15, 6 to 12, 8 to 12, or 9 to 11 nucleotides.
(135) In some embodiments, X2 consists of a nucleotide sequence that is complementary to the nucleotide sequence of X4, all nucleotides of X2 are complementary to the nucleotide sequence of X4.
(136) X3 can be absent, i.e., X3 can consist of zero nucleotides. It is also possible that X3 consists of in the range of 1 to 5 nucleotides, such as in the range of 1 to 3 nucleotides.
(137) X1 can be absent, i.e., X1 can consist of zero nucleotides. It is also possible that X1 consists of in the range of 1 to 25 nucleotides, such as in the range of 1 to 20, 1 to 15, 1 to 10, 1 to 5, or 1 to 3 nucleotides.
(138) X5 can be absent, i.e., X5 can consist of zero nucleotides. It is also possible that X5 can consist of in the range 1 to 5 nucleotides, such as in the range of 1 to 3 nucleotides.
(139) The heterologous insert can be any suitable sequence fulfilling the requirements defined herein. For example, the heterologous insert can comprise tgaattcgttaacgaattc (SEQ ID NO: 82), tgaattcgttaacgaactc (SEQ ID NO: 83), tgaattcgttaacgaagtc (SEQ ID NO: 84), or tgaattcgttaacgaaatt (SEQ ID NO: 85).
(140) Without being bound to a particular mechanism, ERG9 expression can be decreased by at least partly, sterically hindering binding of the ribosome to the RNA thus reducing the translation of squalene synthase. Thus, the translation rate of a functional squalene synthase (EC 2.5.1.21) can be reduced, for example. Using such a construct also can decrease turnover of farnesyl-pyrophosphate to squalene and/or enhance accumulation of a compound selected from the group consisting of farnesyl-pyrophosphate, isopentenyl-pyrophosphate, dimethylallyl-pyrophosphate, geranyl-pyrophosphate and geranylgeranyl-pyrophosphate.
(141) In some instances it can be advantageous to include a squalene synthase inhibitor when culturing recombinant hosts described herein. Chemical inhibition of squalene synthase, e.g., by lapaquistat, is known in the art. Other squalene synthase inhibitors include Zaragozic acid and RPR 107393. Thus, in one embodiment the culturing step of the method(s) defined herein are performed in the presence of a squalene synthase inhibitor.
(142) In some embodiments, the recombinant hosts described herein contain a mutation in the ERG9 open reading frame.
(143) In some embodiments, the recombinant hosts described herein contain an ERG9[Delta]::HIS3 deletion/insertion allele.
(144) D. Functional Homologs
(145) Functional homologs of the polypeptides described above are also suitable for use in producing steviol or steviol glycosides in a recombinant host. A functional homolog is a polypeptide that has sequence similarity to a reference polypeptide, and that carries out one or more of the biochemical or physiological function(s) of the reference polypeptide. A functional homolog and the reference polypeptide can be natural occurring polypeptides, and the sequence similarity can be due to convergent or divergent evolutionary events. As such, functional homologs are sometimes designated in the literature as homologs, or orthologs, or paralogs. Variants of a naturally occurring functional homolog, such as polypeptides encoded by mutants of a wild type coding sequence, can themselves be functional homologs. Functional homologs can also be created via site-directed mutagenesis of the coding sequence for a polypeptide, or by combining domains from the coding sequences for different naturally-occurring polypeptides (domain swapping). Techniques for modifying genes encoding functional UGT polypeptides described herein are known and include, inter alia, directed evolution techniques, site-directed mutagenesis techniques and random mutagenesis techniques, and can be useful to increase specific activity of a polypeptide, alter substrate specificity, alter expression levels, alter subcellular location, or modify polypeptide:polypeptide interactions in a desired manner. Such modified polypeptides are considered functional homologs. The term functional homolog is sometimes applied to the nucleic acid that encodes a functionally homologous polypeptide.
(146) Functional homologs can be identified by analysis of nucleotide and polypeptide sequence alignments. For example, performing a query on a database of nucleotide or polypeptide sequences can identify homologs of steviol or steviol glycoside biosynthesis polypeptides. Sequence analysis can involve BLAST, Reciprocal BLAST, or PSI-BLAST analysis of nonredundant databases using a GGPPS, a CDPS, a KS, a KO or a KAH amino acid sequence as the reference sequence. Amino acid sequence is, in some instances, deduced from the nucleotide sequence. Those polypeptides in the database that have greater than 40% sequence identity are candidates for further evaluation for suitability as a steviol or steviol glycoside biosynthesis polypeptide. Amino acid sequence similarity allows for conservative amino acid substitutions, such as substitution of one hydrophobic residue for another or substitution of one polar residue for another. If desired, manual inspection of such candidates can be carried out in order to narrow the number of candidates to be further evaluated. Manual inspection can be performed by selecting those candidates that appear to have domains present in steviol biosynthesis polypeptides, e.g., conserved functional domains.
(147) Conserved regions can be identified by locating a region within the primary amino acid sequence of a steviol or a steviol glycoside biosynthesis polypeptide that is a repeated sequence, forms some secondary structure (e.g., helices and beta sheets), establishes positively or negatively charged domains, or represents a protein motif or domain. See, e.g., the Pfam web site describing consensus sequences for a variety of protein motifs and domains on the World Wide Web at sanger.ac.uk/Software/Pfam/ and pfam.janelia.org/. The information included at the Pfam database is described in Sonnhammer et al., Nucl. Acids Res., 26:320-322 (1998); Sonnhammer et al., Proteins, 28:405-420 (1997); and Bateman et al., Nucl. Acids Res., 27:260-262 (1999). Conserved regions also can be determined by aligning sequences of the same or related polypeptides from closely related species. Closely related species preferably are from the same family. In some embodiments, alignment of sequences from two different species is adequate.
(148) Typically, polypeptides that exhibit at least about 40% amino acid sequence identity are useful to identify conserved regions. Conserved regions of related polypeptides exhibit at least 45% amino acid sequence identity (e.g., at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% amino acid sequence identity). In some embodiments, a conserved region exhibits at least 92%, 94%, 96%, 98%, or 99% amino acid sequence identity.
(149) For example, polypeptides suitable for producing steviol glycosides in a recombinant host include functional homologs of EUGT11 (SEQ ID NO: 16), UGT91D2e (SEQ ID NO: 15), UGT91D2m (SEQ ID NO: 86), UGT85C (SEQ ID NO: 26), and UGT76G (SEQ ID NO:2). Such homologs have greater than 90% (e.g., at least 95% or 99%) sequence identity to the amino acid sequence of EUGT11, UGT91D2e, UGT91D2m, UGT85C, or UGT76G disclosed herein or in PCT Application No. PCT/US2012/050021, which is incorporated herein by reference in its entirety. Variants of EUGT11, UGT91D2, UGT85C, and UGT76G polypeptides typically have 10 or fewer amino acid substitutions within the primary amino acid sequence, e.g., 7 or fewer amino acid substitutions, 5 or conservative amino acid substitutions, or between 1 and 5 substitutions. However, in some embodiments, variants of EUGT11, UGT91D2, UGT85C, and UGT76G polypeptides can have 10 or more amino acid substitutions (e.g., 10, 15, 20, 25, 30, 35, 10-20, 10-35, 20-30, or 25-35 amino acid substitutions). The substitutions can be conservative, or in some embodiments, non-conservative. Non-limiting examples of non-conservative changes in UGT91D2e polypeptides include glycine to arginine and tryptophan to arginine. Non-limiting examples of non-conservative substitutions in UGT76G polypeptides include valine to glutamic acid, glycine to glutamic acid, glutamine to alanine, and serine to proline. Non-limiting examples of changes to UGT85C polypeptides include histidine to aspartic acid, proline to serine, lysine to threonine, and threonine to arginine.
(150) In some embodiments, a useful UGT91D2 homolog can have amino acid substitutions (e.g., conservative amino acid substitutions) in regions of the polypeptide that are outside of predicted loops, e.g., residues 20-26, 39-43, 88-95, 121-124, 142-158, 185-198, and 203-214 are predicted loops in the N-terminal domain and residues 381-386 are predicted loops in the C-terminal domain of 91D2e (see SEQ ID NO:15). For example, a useful UGT91D2 homolog can include at least one amino acid substitution at residues 1-19, 27-38, 44-87, 96-120, 125-141, 159-184, 199-202, 215-380, or 387-473. In some embodiments, a UGT91D2 homolog can have an amino acid substitution at one or more residues selected from the group consisting of residues 30, 93, 99, 122, 140, 142, 148, 153, 156, 195, 196, 199, 206, 207, 211, 221, 286, 343, 427, and 438. For example, a UGT91D2 functional homolog can have an amino acid substitution at one or more of residues 206, 207, and 343, such as an arginine at residue 206, a cysteine at residue 207, and an arginine at residue 343. Other functional homologs of UGT91D2 can have one or more of the following: a tyrosine or phenylalanine at residue 30, a proline or glutamine at residue 93, a serine or valine at residue 99, a tyrosine or a phenylalanine at residue 122, a histidine or tyrosine at residue 140, a serine or cysteine at residue 142, an alanine or threonine at residue 148, a methionine at residue 152, an alanine at residue 153, an alanine or serine at residue 156, a glycine at residue 162, a leucine or methionine at residue 195, a glutamic acid at residue 196, a lysine or glutamic acid at residue 199, a leucine or methionine at residue 211, a leucine at residue 213, a serine or phenylalanine at residue 221, a valine or isoleucine at residue 253, a valine or alanine at residue 286, a lysine or asparagine at residue 427, an alanine at residue 438, and either an alanine or threonine at residue 462. In another embodiment, a UGT91D2 functional homolog contains a methionine at residue 211 and an alanine at residue 286.
(151) In some embodiments, a useful UGT85C homolog can have one or more amino acid substitutions at residues 9, 10, 13, 15, 21, 27, 60, 65, 71, 87, 91, 220, 243, 270, 289, 298, 334, 336, 350, 368, 389, 394, 397, 418, 420, 440, 441, 444, and 471. Non-limiting examples of useful UGT85C homologs include polypeptides having substitutions (with respect to SEQ ID NO: 26) at residue 65 (e.g., a serine at residue 65), at residue 65 in combination with residue 15 (a leucine at residue 15), 270 (e.g., a methionine, arginine, or alanine at residue 270), 418 (e.g., a valine at residue 418), 440 (e.g., an aspartic acid at residue at residue 440), or 441 (e.g., an asparagine at residue 441); residues 13 (e.g., a phenylalanine at residue 13), 15, 60 (e.g., an aspartic acid at residue 60), 270, 289 (e.g., a histidine at residue 289), and 418; substitutions at residues 13, 60, and 270; substitutions at residues 60 and 87 (e.g., a phenylalanine at residue 87); substitutions at residues 65, 71 (e.g., a glutamine at residue 71), 220 (e.g., a threonine at residue 220), 243 (e.g., a tryptophan at residue 243), and 270; substitutions at residues 65, 71, 220, 243, 270, and 441; substitutions at residues 65, 71, 220, 389 (e.g., a valine at residue 389), and 394 (e.g., a valine at residue 394); substitutions at residues 65, 71, 270, and 289; substitutions at residues 220, 243, 270, and 334 (e.g., a serine at residue 334); or substitutions at residues 270 and 289. The following amino acid mutations did not result in a loss of activity in 85C2 polypeptides: V13F, F15L, H60D, A65S, E71Q, I87F, K220T, R243W, T270M, T270R, Q289H, L334S, A389V, 1394V, P397S, E418V, G440D, and H441N. Additional mutations that were seen in active clones include K9E, K10R, Q21H, M27V, L91P, Y298C, K350T, H368R, G420R, L431P, R444G, and M471T. In some embodiments, an UGT85C2 contains substitutions at positions 65 (e.g., a serine), 71 (a glutamine), 270 (a methionine), 289 (a histidine), and 389 (a valine).
(152) In some embodiments, a useful UGT76G1 homolog (SEQ ID NO: 2) can have one or more amino acid substitutions at residues 29, 74, 87, 91, 116, 123, 125, 126, 130, 145, 192, 193, 194, 196, 198, 199, 200, 203, 204, 205, 206, 207, 208, 266, 273, 274, 284, 285, 291, 330, 331, and 346 (see TABLE 10). Non-limiting examples of useful UGT76G1 homologs include polypeptides having substitutions at residues 74, 87, 91, 116, 123, 125, 126, 130, 145, 192, 193, 194, 196, 198, 199, 200, 203, 204, 205, 206, 207, 208, and 291; residues 74, 87, 91, 116, 123, 125, 126, 130, 145, 192, 193, 194, 196, 198, 199, 200, 203, 204, 205, 206, 207, 208, 266, 273, 274, 284, 285, and 291; or residues 74, 87, 91, 116, 123, 125, 126, 130, 145, 192, 193, 194, 196, 198, 199, 200, 203, 204, 205, 206, 207, 208, 266, 273, 274, 284, 285, 291, 330, 331, and 346. See, Table 10.
(153) TABLE-US-00009 TABLE 10 Clone Variants 76G_G7 M29I, V74E, V87G, L91P, G116E, A123T, Q125A, I126L, T130A, V145M, C192S, S193A, F194Y, M196N, K198Q, K199I, Y200L, Y203I, F204L, E205G, N206K, I207M, T208I, P266Q, S273P, R274S, G284T, T285S, 287-3 bp deletion, L330V, G331A, L346I 76G_H12 M29I, V74E, V87G, L91P, G116E, A123T, Q125A, I126L, T130A, V145M, C192S, S193A, F194Y, M196N, K198Q, K199I, Y200L, Y203I, F204L, E205G, N206K, I207M, T208I, P266Q, S273P, R274S, G284T, T285S, 287-3 bp deletion 76G_C4 M29I, V74E, V87G, L91P, G116E, A123T, Q125A, I126L, T130A, V145M, C192S, S193A, F194Y, M196N, K198Q, K199I, Y200L, Y203I, F204L, E205G, N206K, I207M, T208I
(154) Methods to modify the substrate specificity of, for example, EUGT11 or UGT91D2e, are known to those skilled in the art, and include without limitation site-directed/rational mutagenesis approaches, random directed evolution approaches and combinations in which random mutagenesis/saturation techniques are performed near the active site of the enzyme. For example see Sarah A. Osmani, et at, Phytochemistry 70 (2009) 325-347.
(155) A candidate sequence typically has a length that is from 80 percent to 200 percent of the length of the reference sequence, e.g., 82, 85, 87, 89, 90, 93, 95, 97, 99, 100, 105, 110, 115, 120, 130, 140, 150, 160, 170, 180, 190, or 200 percent of the length of the reference sequence. A functional homolog polypeptide typically has a length that is from 95 percent to 105 percent of the length of the reference sequence, e.g., 90, 93, 95, 97, 99, 100, 105, 110, 115, or 120 percent of the length of the reference sequence, or any range between. A percent identity for any candidate nucleic acid or polypeptide relative to a reference nucleic acid or polypeptide can be determined as follows. A reference sequence (e.g., a nucleic acid sequence or an amino acid sequence described herein) is aligned to one or more candidate sequences using the computer program ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid or polypeptide sequences to be carried out across their entire length (global alignment). Chenna et al., Nucleic Acids Res., 31(13):3497-500 (2003).
(156) ClustalW calculates the best match between a reference and one or more candidate sequences, and aligns them so that identities, similarities and differences can be determined. Gaps of one or more residues can be inserted into a reference sequence, a candidate sequence, or both, to maximize sequence alignments. For fast pairwise alignment of nucleic acid sequences, the following default parameters are used: word size: 2; window size: 4; scoring method: percentage; number of top diagonals: 4; and gap penalty: 5. For multiple alignment of nucleic acid sequences, the following parameters are used: gap opening penalty: 10.0; gap extension penalty: 5.0; and weight transitions: yes. For fast pairwise alignment of protein sequences, the following parameters are used: word size: 1; window size: 5; scoring method: percentage; number of top diagonals: 5; gap penalty: 3. For multiple alignment of protein sequences, the following parameters are used: weight matrix: blosum; gap opening penalty: 10.0; gap extension penalty: 0.05; hydrophilic gaps: on; hydrophilic residues: Gly, Pro, Ser, Asn, Asp, Gln, Glu, Arg, and Lys; residue-specific gap penalties: on. The ClustalW output is a sequence alignment that reflects the relationship between sequences. ClustalW can be run, for example, at the Baylor College of Medicine Search Launcher site on the World Wide Web (searchlauncher.bcm.tmc.edu/multi-align/multi-align.html) and at the European Bioinformatics Institute site on the World Wide Web (ebi.ac.uk/clustalw).
(157) To determine percent identity of a candidate nucleic acid or amino acid sequence to a reference sequence, the sequences are aligned using ClustalW, the number of identical matches in the alignment is divided by the length of the reference sequence, and the result is multiplied by 100. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.
(158) It will be appreciated that functional UGTs can include additional amino acids that are not involved in glucosylation or other enzymatic activities carried out by the enzyme, and thus such a polypeptide can be longer than would otherwise be the case. For example, a EUGT11 polypeptide can include a purification tag (e.g., HIS tag or GST tag), a chloroplast transit peptide, a mitochondrial transit peptide, an amyloplast peptide, signal peptide, or a secretion tag added to the amino or carboxy terminus. In some embodiments, a EUGT11 polypeptide includes an amino acid sequence that functions as a reporter, e.g., a green fluorescent protein or yellow fluorescent protein.
(159) II. Steviol and Steviol Glycoside Biosynthesis Nucleic Acids
(160) A recombinant gene encoding a polypeptide described herein comprises the coding sequence for that polypeptide, operably linked in sense orientation to one or more regulatory regions suitable for expressing the polypeptide. Because many microorganisms are capable of expressing multiple gene products from a polycistronic mRNA, multiple polypeptides can be expressed under the control of a single regulatory region for those microorganisms, if desired. A coding sequence and a regulatory region are considered to be operably linked when the regulatory region and coding sequence are positioned so that the regulatory region is effective for regulating transcription or translation of the sequence. Typically, the translation initiation site of the translational reading frame of the coding sequence is positioned between one and about fifty nucleotides downstream of the regulatory region for a monocistronic gene.
(161) In many cases, the coding sequence for a polypeptide described herein is identified in a species other than the recombinant host, i.e., is a heterologous nucleic acid. Thus, if the recombinant host is a microorganism, the coding sequence can be from other prokaryotic or eukaryotic microorganisms, from plants or from animals. In some case, however, the coding sequence is a sequence that is native to the host and is being reintroduced into that organism. A native sequence can often be distinguished from the naturally occurring sequence by the presence of non-natural sequences linked to the exogenous nucleic acid, e.g., non-native regulatory sequences flanking a native sequence in a recombinant nucleic acid construct. In addition, stably transformed exogenous nucleic acids typically are integrated at positions other than the position where the native sequence is found.
(162) Regulatory region refers to a nucleic acid having nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5 and 3 untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, introns, and combinations thereof. A regulatory region typically comprises at least a core (basal) promoter. A regulatory region also can include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). A regulatory region is operably linked to a coding sequence by positioning the regulatory region and the coding sequence so that the regulatory region is effective for regulating transcription or translation of the sequence. For example, to operably link a coding sequence and a promoter sequence, the translation initiation site of the translational reading frame of the coding sequence is typically positioned between one and about fifty nucleotides downstream of the promoter. A regulatory region can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site, or about 2,000 nucleotides upstream of the transcription start site.
(163) The choice of regulatory regions to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and preferential expression during certain culture stages. It is a routine matter for one of skill in the art to modulate the expression of a coding sequence by appropriately selecting and positioning regulatory regions relative to the coding sequence. It will be understood that more than one regulatory region can be present, e.g., introns, enhancers, upstream activation regions, transcription terminators, and inducible elements.
(164) One or more genes can be combined in a recombinant nucleic acid construct in modules useful for a discrete aspect of steviol and/or steviol glycoside production. Combining a plurality of genes in a module, particularly a polycistronic module, facilitates the use of the module in a variety of species. For example, a steviol biosynthesis gene cluster, or a UGT gene cluster, can be combined in a polycistronic module such that, after insertion of a suitable regulatory region, the module can be introduced into a wide variety of species. As another example, a UGT gene cluster can be combined such that each UGT coding sequence is operably linked to a separate regulatory region, to form a UGT module. Such a module can be used in those species for which monocistronic expression is necessary or desirable. In addition to genes useful for steviol or steviol glycoside production, a recombinant construct typically also contains an origin of replication, and one or more selectable markers for maintenance of the construct in appropriate species.
(165) It will be appreciated that because of the degeneracy of the genetic code, a number of nucleic acids can encode a particular polypeptide; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. Thus, codons in the coding sequence for a given polypeptide can be modified such that optimal expression in a particular host is obtained, using appropriate codon bias tables for that host (e.g., microorganism). As isolated nucleic acids, these modified sequences can exist as purified molecules and can be incorporated into a vector or a virus for use in constructing modules for recombinant nucleic acid constructs.
(166) In some cases, it is desirable to inhibit one or more functions of an endogenous polypeptide in order to divert metabolic intermediates towards steviol or steviol glycoside biosynthesis. For example, it can be desirable to downregulate synthesis of sterols in a yeast strain in order to further increase steviol or steviol glycoside production, e.g., by downregulating squalene epoxidase. As another example, it can be desirable to inhibit degradative functions of certain endogenous gene products, e.g., glycohydrolases that remove glucose moieties from secondary metabolites or phosphatases as discussed herein. As another example, expression of membrane transporters involved in transport of steviol glycosides can be inhibited, such that secretion of glycosylated steviosides is inhibited. Such regulation can be beneficial in that secretion of steviol glycosides can be inhibited for a desired period of time during culture of the microorganism, thereby increasing the yield of glycoside product(s) at harvest. In such cases, a nucleic acid that inhibits expression of the polypeptide or gene product can be included in a recombinant construct that is transformed into the strain. Alternatively, mutagenesis can be used to generate mutants in genes for which it is desired to inhibit function.
(167) III. Hosts
(168) Microorganisms
(169) Recombinant hosts can be used to express polypeptides for the production of steviol glycosides, including mammalian, insect, and plant cells. A number of prokaryotes and eukaryotes are also suitable for use in constructing the recombinant microorganisms described herein, e.g., gram-negative bacteria, yeast and fungi. A species and strain selected for use as a steviol or steviol glycoside production strain is first analyzed to determine which production genes are endogenous to the strain and which genes are not present. Genes for which an endogenous counterpart is not present in the strain are assembled in one or more recombinant constructs, which are then transformed into the strain in order to supply the missing function(s).
(170) Exemplary prokaryotic and eukaryotic species are described in more detail below. However, it will be appreciated that other species can be suitable. For example, suitable species can be in a genus selected from the group consisting of Agaricus, Aspergillus, Bacillus, Candida, Corynebacterium, Eremothecium, Escherichia, Fusarium/Gibberella, Kluyveromyces, Laetiporus, Lentinus, Phaffia, Phanerochaete, Pichia, Physcomitrella, Rhodoturula, Saccharomyces, Schizosaccharomyces, Sphaceloma, Xanthophyllomyces and Yarrowia. Exemplary species from such genera include Lentinus tigrinus, Laetiporus sulphureus, Phanerochaete chtysosporium, Pichia pastoris, Cyberlindnera jadinfi, Physcomitrella patens, Rhodoturula glutinis 32, Rhodoturula mucilaginosa, Phaffia rhodozyma UBV-AX, Xanthophyllomyces dendrorhous, Fusarium fujikuroi/Gibberella fujikuroi, Candida utilis, Candida glabrata, Candida albicans, and Yarrowia lipolytica. In some embodiments, a microorganism can be an Ascomycete such as Gibberella fujikuroi, Kluyveromyces lactis, Schizosaccharomyces pombe, Aspergillus niger, Yarrowia lipolytica, Ashbya gossypii, or Saccharomyces cerevisiae. In some embodiments, a microorganism can be a prokaryote such as Escherichia coli, Rhodobacter sphaeroides, or Rhodobacter capsulatus. It will be appreciated that certain microorganisms can be used to screen and test genes of interest in a high throughput manner, while other microorganisms with desired productivity or growth characteristics can be used for large-scale production of steviol glycosides.
(171) Saccharomyces cerevisiae
(172) Saccharomyces cerevisiae is a widely used chassis organism in synthetic biology, and can be used as the recombinant microorganism platform. There are libraries of mutants, plasmids, detailed computer models of metabolism and other information available for S. cerevisiae, allowing for rational design of various modules to enhance product yield. Methods are known for making recombinant microorganisms.
(173) A steviol biosynthesis gene cluster can be expressed in yeast using any of a number of known promoters. Strains that overproduce terpenes are known and can be used to increase the amount of geranylgeranyl diphosphate available for steviol and steviol glycoside production.
(174) Aspergillus spp.
(175) Aspergillus species such as A. oryzae, A. niger and A. sojae are widely used microorganisms in food production, and can also be used as the recombinant microorganism platform. Nucleotide sequences are available for genomes of A. nidulans, A. fumigatus, A. oryzae, A. clavatus, A. flavus, A. niger, and A. terreus, allowing rational design and modification of endogenous pathways to enhance flux and increase product yield. Metabolic models have been developed for Aspergillus, as well as transcriptomic studies and proteomics studies. A. niger is cultured for the industrial production of a number of food ingredients such as citric acid and gluconic acid, and thus species such as A. niger are generally suitable for the production of food ingredients such as steviol and steviol glycosides.
(176) Escherichia coli
(177) Escherichia coli, another widely used platform organism in synthetic biology, can also be used as the recombinant microorganism platform. Similar to Saccharomyces, there are libraries of mutants, plasmids, detailed computer models of metabolism and other information available for E. coli, allowing for rational design of various modules to enhance product yield. Methods similar to those described above for Saccharomyces can be used to make recombinant E. coli microorganisms.
(178) Agaricus, Gibberella, and Phanerochaete spp.
(179) Agaricus, Gibberella, and Phanerochaete spp. can be useful because they are known to produce large amounts of gibberellin in culture. Thus, the terpene precursors for producing large amounts of steviol and steviol glycosides are already produced by endogenous genes. Thus, modules containing recombinant genes for steviol or steviol glycoside biosynthesis polypeptides can be introduced into species from such genera without the necessity of introducing mevalonate or MEP pathway genes.
(180) Arxula adeninivorans (Blastobotrys adeninivorans)
(181) Arxula adeninivorans is a dimorphic yeast (it grows as a budding yeast like the baker's yeast up to a temperature of 42? C., above this threshold it grows in a filamentous form) with unusual biochemical characteristics. It can grow on a wide range of substrates and can assimilate nitrate. It has successfully been applied to the generation of strains that can produce natural plastics or the development of a biosensor for estrogens in environmental samples.
(182) Yarrowia lipolytica
(183) Yarrowia lipolytica is a dimorphic yeast (see Arxula adeninivorans) that can grow on a wide range of substrates. It has a high potential for industrial applications but there are no recombinant products commercially available yet.
(184) Rhodobacter spp.
(185) Rhodobacter can be used as the recombinant microorganism platform. Similar to E. coli, there are libraries of mutants available as well as suitable plasmid vectors, allowing for rational design of various modules to enhance product yield. Isoprenoid pathways have been engineered in membraneous bacterial species of Rhodobacter for increased production of carotenoid and CoQ10. See, U.S. Patent Publication Nos. 20050003474 and 20040078846. Methods similar to those described above for E. coli can be used to make recombinant Rhodobacter microorganisms.
(186) Candida boidinii
(187) Candida boidinii is a methylotrophic yeast (it can grow on methanol). Like other methylotrophic species such as Hansenula polymorpha and Pichia pastoris, it provides an excellent platform for the production of heterologous proteins. Yields in a multigram range of a secreted foreign protein have been reported. A computational method, IPRO, recently predicted mutations that experimentally switched the cofactor specificity of Candida boidinii xylose reductase from NADPH to NADH.
(188) Hansenula polymorpha (Pichia angusta)
(189) Hansenula polymorpha is another methylotrophic yeast (see Candida boidinii). It can furthermore grow on a wide range of other substrates; it is thermo-tolerant and can assimilate nitrate (see also Kluyveromyces lactis). It has been applied to the production of hepatitis B vaccines, insulin and interferon alpha-2a for the treatment of hepatitis C, furthermore to a range of technical enzymes.
(190) Kluyveromyces lactis
(191) Kluyveromyces lactis is yeast regularly applied to the production of kefir. It can grow on several sugars, most importantly on lactose which is present in milk and whey. It has successfully been applied among others to the production of chymosin (an enzyme that is usually present in the stomach of calves) for the production of cheese. Production takes place in fermenters on a 40,000 L scale.
(192) Pichia pastoris
(193) Pichia pastoris is a methylotrophic yeast (see Candida boidinii and Hansenula polymorpha). It provides an efficient platform for the production of foreign proteins. Platform elements are available as a kit and it is worldwide used in academia for the production of proteins. Strains have been engineered that can produce complex human N-glycan (yeast glycans are similar but not identical to those found in humans).
(194) Physcomitrella spp.
(195) Physcomitrella mosses, when grown in suspension culture, have characteristics similar to yeast or other fungal cultures. This genera is becoming an important type of cell for production of plant secondary metabolites, which can be difficult to produce in other types of cells.
(196) IV. Methods of Producing Steviol Glycosides
(197) Recombinant hosts described herein can be used in methods to produce steviol glycosides such as Rebaudioside M. For example, if the recombinant host is a microorganism, the method can include growing the recombinant microorganism in a culture medium under conditions in which steviol and/or steviol glycoside biosynthesis genes are expressed. The recombinant microorganism can be grown in a fed batch or continuous process. Typically, the recombinant microorganism is grown in a fermentor at a defined temperature(s) for a desired period of time. In certain embodiments, microorganisms include, but are not limited to S. cerevisiae, A. niger, A. oryzae, E. coli, L. lactis and B. subtilis. The constructed and genetically engineered microorganisms provided by the invention can be cultivated using conventional fermentation processes, including, inter alia, chemostat, batch, fed-batch cultivations, continuous perfusion fermentation, and continuous perfusion cell culture.
(198) Depending on the particular microorganism used in the method, other recombinant genes such as isopentenyl biosynthesis genes and terpene synthase and cyclase genes can also be present and expressed. Levels of substrates and intermediates, e.g., isopentenyl diphosphate, dimethylallyl diphosphate, geranylgeranyl diphosphate, kaurene and kaurenoic acid, can be determined by extracting samples from culture media for analysis according to published methods.
(199) After the recombinant microorganism has been grown in culture for the desired period of time, steviol and/or one or more steviol glycosides can then be recovered from the culture using various techniques known in the art. In some embodiments, a permeabilizing agent can be added to aid the feedstock entering into the host and product getting out. If the recombinant host is a plant or plant cells, steviol or steviol glycosides can be extracted from the plant tissue using various techniques known in the art. For example, a crude lysate of the cultured microorganism or plant tissue can be centrifuged to obtain a supernatant. The resulting supernatant can then be applied to a chromatography column, e.g., a C18 column such as Aqua? C18 column from Phenomenex or a Synergi? Hydro RP 80 ? column, and washed with water to remove hydrophilic compounds, followed by elution of the compound(s) of interest with a solvent such as acetonitrile or methanol. The compound(s) can then be further purified by preparative HPLC. See also WO 2009/140394.
(200) The amount of steviol glycoside (e.g., Rebaudioside M) produced can be from about 1 mg/L to about 2800 mg/L, e.g., about 1 to about 10 mg/L, about 3 to about 10 mg/L, about 5 to about 20 mg/L, about 10 to about 50 mg/L, about 10 to about 100 mg/L, about 25 to about 500 mg/L, about 100 to about 1,500 mg/L, or about 200 to about 1,000 mg/L. In general, longer culture times will lead to greater amounts of product. Thus, the recombinant microorganism can be cultured for from 1 day to 7 days, from 1 day to 5 days, from 3 days to 5 days, about 3 days, about 4 days, or about 5 days.
(201) It will be appreciated that the various genes and modules discussed herein can be present in two or more recombinant microorganisms rather than a single microorganism. When a plurality of recombinant microorganisms is used, they can be grown in a mixed culture to produce steviol and/or steviol glycosides. For example, a first microorganism can comprise one or more biosynthesis genes for producing steviol while a second microorganism comprises steviol glycoside biosynthesis genes. Alternatively, the two or more microorganisms each can be grown in a separate culture medium and the product of the first culture medium, e.g., steviol, can be introduced into second culture medium to be converted into a subsequent intermediate, or into an end product such as Rebaudioside A. The product produced by the second, or final microorganism is then recovered. It will also be appreciated that in some embodiments, a recombinant microorganism is grown using nutrient sources other than a culture medium and utilizing a system other than a fermentor.
(202) Steviol glycosides do not necessarily have equivalent performance in different food systems. It is therefore desirable to have the ability to direct the synthesis to steviol glycoside compositions of choice. Recombinant hosts described herein can produce compositions that are selectively enriched for specific steviol glycosides (e.g., Rebaudioside M) and have a consistent taste profile. Thus, the recombinant microorganisms, plants, and plant cells described herein can facilitate the production of compositions that are tailored to meet the sweetening profile desired for a given food product and that have a proportion of each steviol glycoside that is consistent from batch to batch. Microorganisms described herein do not produce the undesired plant byproducts found in Stevia extracts. Thus, steviol glycoside compositions produced by the recombinant microorganisms described herein are distinguishable from compositions derived from Stevia plants.
(203) V. Food Products
(204) The steviol glycosides obtained by the methods disclosed herein can be used to make food and beverage products, dietary supplements and sweetener compositions. For example, substantially pure steviol glycoside such as Rebaudioside M can be included in food products such as ice cream, carbonated beverages, fruit juices, yogurts, baked goods, chewing gums, hard and soft candies, and sauces. Substantially pure steviol glycoside also can be included in non-food products such as pharmaceutical products, medicinal products, dietary supplements and nutritional supplements. Substantially pure steviol glycosides can also be included in animal feed products for both the agriculture industry and the companion animal industry. Alternatively, a mixture of steviol glycosides can be made by culturing recombinant microorganisms separately or growing different plants/plant cells, each producing a specific steviol or steviol glycoside, recovering the steviol or steviol glycoside in substantially pure form from each microorganism or plant/plant cells and then combining the compounds to obtain a mixture containing each compound in the desired proportion (e.g., Rebaudioside M with one or more other steviol glycosides). The recombinant microorganisms, plants, and plant cells described herein permit more precise and consistent mixtures to be obtained compared to current Stevia products. In another alternative, a substantially pure steviol glycoside can be incorporated into a food product along with other sweeteners, e.g. saccharin, dextrose, sucrose, fructose, erythritol, aspartame, sucralose, monatin, or acesulfame potassium. The weight ratio of steviol glycoside relative to other sweeteners can be varied as desired to achieve a satisfactory taste in the final food product. See, e.g., U.S. Patent Publication No. 2007/0128311. In some embodiments, the steviol glycoside can be provided with a flavor (e.g., citrus) as a flavor modulator.
(205) Compositions produced by a recombinant microorganism, plant, or plant cell described herein can be incorporated into food products. For example, a steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a food product in an amount ranging from about 20 mg steviol glycoside/kg food product to about 1800 mg steviol glycoside/kg food product on a dry weight basis, depending on the type of steviol glycoside and food product. For example, a steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a dessert, cold confectionary (e.g., ice cream), dairy product (e.g., yogurt), or beverage (e.g., a carbonated beverage) such that the food product has a maximum of 500 mg steviol glycoside/kg food on a dry weight basis. A steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a baked good (e.g., a biscuit) such that the food product has a maximum of 300 mg steviol glycoside/kg food on a dry weight basis. A steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a sauce (e.g., chocolate syrup) or vegetable product (e.g., pickles) such that the food product has a maximum of 1000 mg steviol glycoside/kg food on a dry weight basis. A steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into bread such that the food product has a maximum of 160 mg steviol glycoside/kg food on a dry weight basis. A steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a hard or soft candy such that the food product has a maximum of 1600 mg steviol glycoside/kg food on a dry weight basis. A steviol glycoside composition produced by a recombinant microorganism, plant, or plant cell can be incorporated into a processed fruit product (e.g., fruit juices, fruit filling, jams, and jellies) such that the food product has a maximum of 1000 mg steviol glycoside/kg food on a dry weight basis.
(206) In some embodiments, a substantially pure steviol or steviol glycoside is incorporated into a tabletop sweetener or cup-for-cup product. Such products typically are diluted to the appropriate sweetness level with one or more bulking agents, e.g., maltodextrins, known to those skilled in the art. Steviol glycoside compositions enriched for Rebaudioside M can be package in a sachet, for example, at from 10,000 to 30,000 mg steviol glycoside/kg product on a dry weight basis, for tabletop use.
(207) The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
(208) The Examples that follow are illustrative of specific embodiments of the invention and various uses thereof. They are set forth for explanatory purposes only and are not to be taken as limiting the invention.
Example 1: Strain Engineering and Fermentation of EFSC 3044
(209) Yeast strain EFSC 3044 was derived from a wild type Saccharomyces cerevisiae strain containing three auxotrophic modifications, namely the deletions of URA3, LEU2 and HIS3. The strain can be manipulated using standard genetic methods and can be used as a regular diploid or haploid yeast strain. The strain was converted to steviol glycosides-producing yeast by genomic-integration of five DNA constructs. Each construct contained multiple genes and was introduced into the yeast genome by homologous recombination. Furthermore, the first, second, and fifth construct were assembled by homologous recombination in yeast.
(210) The first construct contained eight genes and was inserted in the DPP1 locus and disrupted and partially deleted DPP1 (phosphatase). The DNA inserted contained: the Ashbya gossypii TEF1 promoter expressing the natMX gene (selectable marker) followed by the TEF1 terminator from A. gossypii; Gene Art codon optimized Ste via rebaudiana UGT85C2 (GenBank AAR06916.1; SEQ ID NO:3) expressed from the native yeast GPD1 promoter and followed by the native yeast CYC1 terminator; S. rebaudiana CPR-8 (SEQ ID NO:5) expressed using the native yeast TPI1 promoter followed by the native yeast TDH1 terminator; Arabidopsis thaliana kaurene synthase (SEQ ID NO:6, similar to GenBank AEE36246.1) expressed from the native yeast PDC1 promoter and followed by the native yeast FBA1 terminator; synthetic Synechococcus sp. GGPPS (SEQ ID NO: 22, GenBank ABC98596.1) expressed using the native yeast TEF2 promoter and followed by the native yeast PGI1 terminator; DNA2.0 codon-optimized S. rebaudiana KAHe1 (SEQ ID NO:8) expressed from the native yeast TEF1 promoter and followed by the native yeast ENO2 terminator; synthetic S. rebaudiana KO-1 (SEQ ID NO: 23, GenBank ABA42921.1) expressed using the native yeast FBA1 promoter and followed by the native yeast TDH2 terminator; and Zea mays truncated CDPS (SEQ ID NO:133) expressed using the native yeast PGK1 promoter and followed by the native yeast ADH2 terminator.
(211) The second construct was inserted at the YPRC?15 locus and contained: the TEF1 promoter from A. gossypii in front of the kanMX gene (selectable marker) followed by the TEF1 terminator from A. gossypii; the Gene Art codon optimized A. thaliana ATR2 (SEQ ID NO: 10) expressed from the native yeast PGK1 promoter followed by the native yeast ADH2 terminator; S. rebaudiana UGT74G1 (SEQ ID NO:135, GenBank AAR06920.1) expressed from the native yeast TPI1 promoter followed by the native yeast TDH1 terminator; Gene Art codon-optimized S. rebaudiana UGT76G1 (SEQ ID NO:14, encodes GenBank AAR06912) expressed from the native yeast TEF1 promoter followed by the native yeast ENO2 terminator; and GeneArt codon-optimized sequence encoding a S. rebaudiana UGT91D2e-b with the amino acid modifications L211M and V286A (SEQ ID NO:15 for UGT91D2e amino acid sequence for the wild type sequence; codon optimized nucleotide sequence is set forth in SEQ ID NO:90) and expressed from the native yeast GPD1 promoter and followed by the native yeast CYC1 terminator. UGT91D2e-b is disclosed herein as SEQ ID NO: 66 with mutations at methionine residue at residue 211 and an alanine residue at residue 286.
(212) The first and the second construct were combined in the same spore clone by mating and dissection. This yeast strain was subsequently transformed with construct three and four in two successive events.
(213) Construct three was integrated between genes PRP5 and YBR238C and contained the Kluyveromyces lactis leu2 promoter expressing the K. lactis leu2 gene followed by the leu2 terminator from K. lactis, the native yeast GPD1 promoter expressing the DNA2.0-optimized S. rebaudiana KAHe1 (SEQ ID NO:8) followed by the native yeast CYC1 terminator, and the native yeast TPI1 promoter expressing the Zea mays truncated CDPS (SEQ ID NO: 133) followed by the native yeast TPI1 terminator.
(214) Construct four was integrated in the genome between genes ECM3 and YOR093C with an expression cassette containing the TEF1 promoter from A. gossypii expressing the K. pneumoniae hphMX gene followed by the TEF1 terminator from A. gossypii, Synechococcus sp. GGPPS (SEQ ID NO: 22) expressed from the native yeast GPD1 promoter followed by the native yeast CYC1 terminator, and the native yeast TPI1 promoter expressing the A. thaliana KS (SEQ ID NO: 6) followed by the native yeast TPI1 terminator.
(215) The four introduced selectable markers natMX, kanMX, K. lactis LEU2 and K. pneumoniae hphMX and the promoters preceding and terminators succeeding the selectable marker genes were then removed by recombination.
(216) In this yeast strain, the fifth construct was inserted and assembled by yeast transformation and homologue recombination. The fifth construct contained seven genes and was inserted at the YORW?22 locus. The DNA inserted contained: the A. gossypii TEF1 promoter expressing the Schizosaccharomyces Pombe HIS5 gene (selectable marker) followed by the TEF1 terminator from A. gossypii; S. rebaudiana KO-1 (SEQ ID NO: 23, GenBank ABA42921.1) expressed from the native yeast GPD1 promoter and followed by the native yeast CYC1 terminator; S. rebaudiana CPR-8 (SEQ ID NO: 5) expressed using the native yeast TPI1 promoter followed by the native yeast TDH1 terminator; Arabidopsis thaliana kaurene synthase (SEQ ID NO: 6, similar to GenBank AEE36246.1) expressed from the native yeast PDC1 promoter and followed by the native yeast FBA1 terminator; a codon optimized version of the rice gene Os03g0702000 (SEQ ID NO:18, encoding EUGT11) expressed using the native yeast TEF2 promoter and followed by the native yeast PGI1 terminator; DNA2.0 codon-optimized S. rebaudiana KAHe1 (SEQ ID NO: 8) expressed from the native yeast TEF1 promoter and followed by the native yeast ENO2 terminator; and Zea mays truncated CDPS (SEQ ID NO:133) expressed using the native yeast PGK1 promoter and followed by the native yeast ADH2 terminator.
(217) The described yeast strain was made prototrophic by introduction of the two plasmids, EPSC2182 and EPSC2308. EPSC2182 was derived from a p415TEF CEN/ARS shuttle plasmid with a LEU2 marker and contains another copy of S. rebaudiana KAHe1 expressed from the native yeast TEF1 promoter and succeeded by the native yeast CYC1 terminator. EPSC2308 was a p416TEF-based CEN/ARS shuttle plasmid with the URA3 marker wherein the EUGT11 gene was cloned and expressed from the native yeast TEF1 promoter and succeeded by the native yeast CYC1 terminator. This yeast strain was then designated EFSC 3044.
(218) TABLE-US-00010 TABLE 11 List of Recombinant Genes in Strain EFSC 3044. Yeast Construct Gene Designation Location No. UGT85C2 Genomic 1 S. rebaudiana CPR-8 Genomic 1 A thaliana Kaurene synthase Genomic 1 Synechococcus sp. GGPPS Genomic 1 S. rebaudiana KAHe1 Genomic 1 S. rebaudiana KO-1 Genomic 1 Zea mays truncated CDPS Genomic 1 A. thaliana ATR2 Genomic 2 S. rebaudiana UGT74G1 Genomic 2 S. rebaudiana UGT76G1 Genomic 2 Stevia UGT91D2e-b altered Genomic 2 S. rebaudiana KAHe1 Genomic 3 Zea mays truncated CDPS Genomic 3 Synechococcus sp. GGPPS Genomic 4 A. thaliana Kaurene synthase Genomic 4 S. rebaudiana KO-1 Genomic 5 S. rebaudiana CPR-8 Genomic 5 A thaliana Kaurene synthase Genomic 5 Os03g0702000 (EUGT11) Genomic 5 S. rebaudiana KAHe1 Genomic 5 Zea mays truncated CDPS Genomic 5 S. rebaudiana KAHe1 Plasmid 6 EUGT11 Plasmid 7
(219) Fed-batch fermentation was carried out aerobically in 2 L (working volume) fermenters which included a ?16 hour growth phase in the base medium (Synthetic Complete media) followed by ?100 hours of feeding with glucose utilized as the carbon and energy source combined with trace metals, vitamins, salts, and Yeast Nitrogen Base (YNB) and/or amino acid supplementation. The pH was kept near pH 5, and the temperature setpoint was 30? C. The feed rate was controlled to prevent oxygen depletion and to minimize ethanol formation (glucose-limited conditions). Whole culture samples (without cell removal) were taken and boiled in an equal volume of DMSO for total glycosides levels.
(220) The following methodology was used to analyze steviol glycosides and steviol pathway intermediates, unless otherwise indicated. LC-MS analyses were performed using an UltiMate? 3000 UPLC system (Dionex, Sunnyvale, Calif.) fitted with an Acquity UPLC? BEH C18 column (100?2.1 mm, 1.7 ?m particles; Waters, Milford, Mass.) connected to a TSQ Quantum Access (ThermoFisher Scientific) triple quadropole mass spectrometer with a heated electrospray ion (HESI) source. Elution was carried out using a mobile phase of eluent B (MeCN with 0.1% Formic acid) and eluent A (water with 0.1% Formic acid) by increasing the gradient from 29->48% B from min 0.0 to 4.0, increasing 48->100% B in min 4.0 to 4.2, holding 100% B from min 4.2 to 6.2, and re-equilibrating with 29% eluent B. The flow rate was 0.4 ml/min and the column temperature was kept at 55? C. Steviol glycosides were detected using SIM (Single Ion Monitoring) in positive mode with the following m/z-traces in Table 12.
(221) TABLE-US-00011 TABLE 12 Summary of Analytical Compounds Detected by LC/MS. Exact m/z Compound Description Mass trace (typical t.sub.R in min) Steviol + [M + H].sup.+ 481.2 ? 0.5 19-SMG (4.15), 13-SMG 1 Glucose 481.2796 (4.38) [M + Na].sup.+ 503.1 ? 0.5 503.2615 Steviol + [M + Na].sup.+ .sup.665 ? 0.5 Rubusoside (3.04) 2 Glucose 665.3149 Steviol-1,2-bioside (3.48) Steviol-1,3-bioside (4.05) Steviol + [M + Na].sup.+ 827.4 ? 0.5 1,2-Stevioside (2.28) 3 Glucose 827.3677 1,3-Stevioside (2.82) Rebaudioside B (3.9) Steviol + [M + Na].sup.+ 989.4 ? 0.5 Rebaudioside A (2.23) 4 Glucose 989.4200 Steviol + [M + Na].sup.+ 1151.4 ? 0.5 Rebaudioside D (1.19) 5 Glucose 1151.4728 Steviol + [M + Na].sup.+ 1313.5 ? 0.5 Rebaudioside M (1.31) 6 Glucose 1313.5257
(222) The level of steviol glycosides were quantified by comparing with calibration curves obtained with authentic standards from LGC Standards. For example, standard solutions of 0.5 to 100 ?M Rebaudioside A (RebA) were typically utilized to construct a calibration curve.
(223) A modified LC-MS methodology (using a BEH RPshield C18 HPLC column (50?2.1 mm, 1.7 ?m particles; Waters, Milford, Mass.) was used to analyze compounds described in Example 5 and in vitro experiment to determine relative rates for UGT76G1. The elution was carried out using a mobile phase of eluent B (MeCN with 0.1% formic acid) and eluent A (water with 0.1% formic acid) by increasing the gradient from 25->47% B from min 0.0 to 4.0, increasing 47->100% B in min 4.0 to 5.0, holding 100% B from min 5.0 to 6.5, and finally re-equilibrating with 25% B. The flow rate was 0.4 ml/min and the column temperature was kept at 35? C. A modified LC-MS methodology resulted in shorter retention time for the compounds shown in Table 12. Typical retention times using the modified LC-MS methodology (t.sub.R in min) were: 3.34 for 19-SMG; 3.54 for 13-SMG; 2.55 for Rubusoside; 2.95 for Steviol-1,2-bioside; 3.31 for Steviol-1,3-bioside; 2.04 for 1,2-Stevioside; 2.42 for 1,3-Stevioside; 2.91 for Rebaudioside B; 2.03 for Rebaudioside A; 1.1 for Rebaudioside D; and 1.32 for Rebaudioside M.
Example 2: In Vitro Characterization of Reactions that Produce a Hexa-Glycosylated Steviol Glycoside
(224) As described in Example 1, a hexa-glucosyl steviol glycoside was observed when EUGT11 was expressed at high levels in steviol-glycoside producing yeast strains. To characterize the reactions that were occurring to produce this molecule, further in vitro work was done with individual UGTs.
(225) UGT76G1 (SEQ ID NO: 1) was cloned into the pET30a plasmid (EMD Millipore). The resulting vector was transformed into an appropriate DE3 E. coli strain and transformants were grown and induced according to manufacturer's protocols. The corresponding fusion protein (6? HIS-tagged) was purified by immobilized metal affinity chromatography using standard methods.
(226) Approximately 0.08 ?g of purified UGT76G1 per ?L of reaction was incubated with 100 ?M RebD, 300 ?M UDP-glucose, and 10 U/mL Alkaline Phosphatase (Fermentas/Thermo Fisher, Waltham, Mass.). The reactions were performed at 30? C. in 20 mM Hepes-NaOH, pH 7.6, for 24 hours. Prior to LC-MS analysis, one volume of 100% DMSO was added to each reaction and vortexed, and samples were centrifuged at 16,000?g for 1 minute.
(227) A new peak appeared during the reaction at a mass corresponding to steviol+6 glucose moieties, eluting at 1.31 min and corresponding to a trace of one of the hexaglucosyl steviol glycosides found upon the overexpression of EUGT11 in vivo. This result suggested that UGT76G1 can further glycosylate RebD, resulting in a hexaglycoside. It was hypothesized that UGT76G1, in addition to making a 1,3-glucose linkage with the primary glucose at C13 of the steviol backbone, has a secondary activity of adding a 1,3-bound glucose to the primary glucose at C19. It is likely that the only glycosylation site available in RebD available for UGT76G1 is the glucose at C19, which would result in the production of a hexaglycoside designated RebM. The hexaglycoside detected was isolated and determined to be Rebaudioside M, as shown in Examples 3 and 4.
Example 3: Isolation of the Hexa-Glycosylated Molecule
(228) The hexa-glucosyl steviol glycoside product was isolated from a fermentation similar to that described in Example 1 for structural analysis following the scheme outlined in
(229) After the fermentation, the culture broth was centrifuged for 30 min at 7000 rpm at 4? C. and the supernatant was purified as follows: A glass column was filled with 150 mL HP20 Diaion? resin (Supelco), and an aliquot of 300 mL supernatant was loaded on to the column and washed with 2?250 mL MilliQ water. The glycoside product was eluted by stepwise incremental increases in the methanol concentration in MilliQ water (in 250 mL portionsstarting with 0%.fwdarw.10%.fwdarw.40%.fwdarw.60%.fwdarw.80%.fwdarw.100% MeOH). The levels of steviol glycosides in each fraction were analyzed by LC-MS. The most promising fractions (60-80% MeOH) were combined and reduced to total of 10 mL using a vacuum evaporator. A glass column filled with 600 mL spherical C18 bonded flash silica gel (45-70 um, 70 ?/Supelco) was equilibrated with 5% aqueous acetonitrile (Acetronitrile: HPLC gradeWater: MilliQ). The concentrated residue from the HP20 purification was loaded on the column and eluted by stepwise increases in the acetonitrile contribution. The starting eluent was 5% acetonitrile in water. The level of acetonitrile was raised by 5% per step (each 400 mL). After reaching 50% acetonitrile 10% steps were made. All fractions were analyzed by LC-MS, pooled according to their steviol glycoside composition, and dried under vacuum. Table 13 contains a summary of the glycosides found in each of the fractions.
(230) TABLE-US-00012 TABLE 13 Summary of Fractionation of Steviol Glycosides. mg Fraction Description 321.1 2-11 RebD and some 6X glycosylated steviol glycoside 138.3 12-20 RebD and some 6X glycosylated steviol glycoside 357.4 21-27 Bulk of 6X glycosylated steviol glycoside 98.9 28-30 RebA 68.4 31-36 Rubusoside, steviol-1,2-bioside 14.8 34-45 Mostly 13-SMG 852.8 Wash Acetonitrile wash
Example 4: NMR Confirmation of Structure
(231) To produce a pure sample for NMR, approximately 50 mg of the hexa-glycosylated enriched residue obtained in Example 3 were further purified on a semi-preparative HPLC system. The system was equipped with an Aqua? C18 column (Phenomenex: Dimension 250?21.2 mm, 5 micron). Elution was carried out using a mobile phase of eluent B (MeCN with 0.1% trifluoroacetic acid) and eluent A (water with 0.1% triflouroacidic acid) by increasing the gradient from 1%.fwdarw.50% B from min 0.0 to 21, 50->100% min 21.0 to 27.0 and finally washing with 100% B and re-equilibration. The flow rate was 14 mL/min at room temperature. The fractions were collected by time and analyzed by LC-QTOF-MS for the presence of steviol glycosides. The system used was a UPLC (Waters) coupled to a MicrOTOFII Mass Spectrometer (Bruker). The column used was Acquity UPLC? BEH C18, 100?2.1 mm, 1.7 ?m (Waters). Mobile phases were A: 0.1% Formic Acid in water and B: 0.1% Formic Acid in Acetonitrile. The gradient applied was from 1% B to 50% B in 12 minutes and then to 100% B in 3 minutes. The flow rate was 0.4 ml/min.
(232) Fraction 93 was utilized for NMR analysis. All NMR experiments were performed in DMSO-d6 at 25 C using a Bruker Avance III 600 MHz NMR spectrometer equipped with a 1.7 mm cryogenic TCI probe.
(233) The structures were solved by means of standard homo- and heteronuclear multipulse NMR experiments, namely .sup.1H,.sup.1HCOSY, .sup.1H,.sup.13CHSQC and .sup.1H,.sup.13CHMBC experiments. The NMR data obtained was as follows:
(234) 1H NMR (600 MHz, DMSO-d6) ? ppm 0.78 (br. s., 1H) 0.83 (s, 3H) 0.92 (d, J=7.39 Hz, 2H) 0.97-1.04 (m, 1H) 1.17 (s, 3H) 1.30-1.54 (m, 6H) 1.67 (d, J=10.40 Hz, 1H) 1.72-1.86 (m, 4H) 1.92 (d, J=6.49 Hz, 1H) 1.96-2.05 (m, 2H) 2.08 (d, J=10.82 Hz, 1H) 2.32 (d, J=12.71 Hz, 1H) 2.91 (t, J=8.82 Hz, 1H) 2.95-3.01 (m, 1H) 3.02-3.27 (m, 14H) 3.31-3.55 (m, 10H) 3.57-3.86 (m, 10H) 4.47 (d, J=7.86 Hz, 1H) 4.51 (d, J=8.00 Hz, 1H) 4.53 (d, J=7.62 Hz, 1H) 4.66 (d, J=7.81 Hz, 1H) 4.73 (br. s., 1H) 4.80 (d, J=7.86 Hz, 1H) 5.11 (br. s., 1H) 5.53 (d, J=8.19 Hz, 1H)
(235) 13C NMR (150.91 MHz, DMSO-d6) ? ppm 16.4, 19.4, 19.9, 21.8, 28.3, 36.7, 37.2, 39.3, 40.3, 41.5, 41.6, 43.2, 43.7, 47.0, 47.2, 53.2, 57.0, 60.7, 61.2, 61.4, 61.8, 62.0, 62.1, 68.5, 68.9, 70.4 (3C), 71.2, 71.6, 74.1-74.3 (4C), 74.8, 75.8, 76.9-77.1 (6C), 77.6, 79.6, 85.8, 86.8, 87.1, 92.1, 96.2, 102.1, 102.8, 103.2, 103.3, 104.5, 153.1, 175.1
(236) The confirmed structure of RebM (systematic name: 13-[?-D-glucopyranosyl-(1->3)-?-D-glucopyranosyl-(1->2)-??-D-glucopyranosyl-1-oxy] kaur-16-en-18-oic acid, 18-M-D-glucopyranosyl-(1->3)-U3-D-glucopyranosyl-(1->2) [3-D-glucopyranosyl-1-ester]) is shown in
Example 5: Isolation and Determination of Additional Fermentation Products of EFSC 3044
(237) In addition to RebM, fermentation of EFSC 3044 resulted in formation of a di-glycosylated steviol glycoside (13-hydroxy kaur-16-en-18-oic acid, [2-O-?-D-glucopyranosyl-13-D-glucopyranosyl] ester) with a retention time of 2.31 (
(238) These compounds were isolated according to the following method. After the fermentation, the culture broth was centrifuged for 10 min at 5000 rpm at 4? C. and the supernatant was purified as follows: A glass column was filled with 300 mL HP20 Diaion? resin (Supelco), and an aliquot of 1700 mL supernatant was loaded on to the column and washed with 3.5 Liters of ddH2O. The compounds were eluted by using 2 L MeOH and fractions of 500 mL each collected. After LC-MS analysis, the fractions containing the majority of the target compounds were pooled and evaporated on a rotary evaporation system (Rotavap, B?chi, Switzerland) yielding 1.85 grams of dark grey material. The crude extract was re-dissolved in 3.5 mL of DMSO and injected in aliquots of 0.7 mL in a semi-preparative LC-MS for further purification. The column used was a XBridge C18, 19?250 mm, 5 um (Waters Corporation). Mobile phases were A: 0.1% TFA in water and B: 0.1% TFA in Acetonitrile. Elution was done by a linear gradient from 1% B to 60% B in 44 min. Fractions of 2.1 mL were continuously collected during the run. Fractions collected were analysed by LC-MS in order to evaluate the presence and purity of target analytes. Fractions containing compounds identified as Peak 8 and Peak 9 were neutralized by adding 0.8 mL of NH3 (aq.), pooled and dried by Genevac centrifugal evaporation system.
(239) Structures of these compounds were determined by NMR with the method of Example 4.
(240) The NMR data obtained for the di-glycosylated steviol glycoside are as follows:
(241) 1H NMR (600 MHz, DMSO-d.sub.6) ? ppm 0.72-0.79 (m, 1H) 0.81 (s, 3H) 0.93 (d, J=8.07 Hz, 1H) 0.98-1.05 (m, 1H) 1.17 (s, 3H) 1.20 (d, J=11.37 Hz, 1H) 1.36 (d, J=4.03 Hz, 2H) 1.40-1.52 (m, 1H) 1.55-1.70 (m, 1H) 1.77 (d, J=9.54 Hz, 3H) 1.84-1.90 (m, 1H) 2.03 (d, J=8.07 Hz, 1H) 2.31-2.41 (m, 1H) 2.79-2.87 (m, 1H) 2.89-2.96 (m, 1H) 3.08 (s, 2H) 3.12-3.18 (m, 3H) 3.19-3.24 (m, 1H) 3.34 (d, J=4.77 Hz, 2H) 3.41-3.45 (m, 2H) 3.46-3.55 (m, 1H) 3.65 (d, J=11.37 Hz, 1H) 3.73 (dd, J=15.41, 8.44 Hz, 4H) 4.26-4.40 (m, 1H) 4.48 (d, J=7.70 Hz, 1H) 4.52-4.62 (m, 1H) 4.69 (br.s., 1H) 4.81 (d, J=7.70 Hz, 1H) 4.88 (br.s., 1H) 4.91-5.03 (m, 1H) 5.05-5.26 (m, 2H) 5.51 (d, J=7.70 Hz, 1H) 5.55 (br.s., 1H; the formula is C32H50O13; formula weight is 642.7316).
(242) The NMR data obtained for the tri-glycosylated steviol glycoside are as follows:
(243) 1H NMR (600 MHz, DMSO-d.sub.6) ? ppm 0.73-0.79 (m, 1H) 0.81 (s, 3H) 0.89-0.97 (m, 2H) 0.99-1.05 (m, 1H) 1.17 (s, 3H) 1.19 (d, J=11.37 Hz, 1H) 1.24 (s, 2H) 1.31-1.40 (m, 4H) 1.40-1.51 (m, 3H) 1.55-1.63 (m, 1H) 1.67 (dd, J=14.12, 5.32 Hz, 1H) 1.71-1.82 (m, 5H) 1.88 (d, J=11.00 Hz, 1H) 1.98-2.08 (m, 2H) 2.23-2.30 (m, 1H) 2.94 (t, J=8.44 Hz, 1H) 3.01-3.11 (m, 3H) 3.12-3.17 (m, 1H) 3.19-3.28 (m, 3H) 3.44-3.52 (m, 5H) 3.54-3.60 (m, 1H) 3.61-3.71 (m, 3H) 4.36 (br. s., 1H) 4.49 (br. s., 1H) 4.55 (d, J=7.70 Hz, 1H) 4.69 (s, 1H) 4.73 (br. s., 1H) 4.88 (br. s., 1H) 4.91-5.05 (m, 2H) 5.17 (br.s., 1H) 5.31 (br.s., 1H) 5.44 (d, J=8.07 Hz, 1H) 5.55 (br. s., 1H; the formula is C38H60O18; formula weight is 804.8722).
(244) The di-glycosylated steviol glycoside ester was determined to be an analog of steviol-1,2-bioside (
Example 6: Engineering and Fermentation of EFSC 3261
(245) The wild type Saccharomyces strain utilized in Example 1 was modified to contain the heterologous genes in Table 14 involved in steviol glycoside production. The genes were all integrated into the chromosome of the host strain using similar methods described in Example 1.
(246) TABLE-US-00013 TABLE 14 List of Recombinant Genes and Promoters Used in Strain EFSC 3261. Number Heterologous pathway gene of copies Promoter(s) used GGPPS7 (Synechococcus sp) 2 TEF2, GPD1 synthetic gene CDPS (truncated, Zea mays) 3 PGK1 (X2), TPI1 native gene KS5 (A. thaliana) native gene 3 TPI1, PDC1 (X2) KO (S. rebaudiana KO1) 2 FBA1, GPD1 synthetic gene ATR2 synthetic gene 1 PGK1 KAH (S. rebaudiana KAHe1) 3 GPD1, TEF1 (X2) synthetic gene S. rebaudiana CPR 8 native 2 TPI1 (X2) gene 85C2 (S. rebaudiana) 1 GPD1 synthetic 74G1 native (S. rebaudiana) 1 TPI1 76G1 synthetic (S. rebaudiana) 1 TEF1 91d2e-b 2X mutant from 1 GPD1 S. rebaudiana EUGT11 synthetic 1 TEF2 (Oryza sativa)
(247) Fed-batch fermentation was carried out aerobically in 2 L (working volume) fermenters which included a ?16 hour growth phase in the base medium (minimal medium containing glucose, ammonium sulfate, trace metals, vitamins, salts, and buffer) followed by ?100 hours of feeding with a glucose-containing defined feed medium. Glucose was utilized as the carbon and energy source and combined with trace metals, vitamins, and salts. The pH was kept near pH 5 and the temperature setpoint was 30? C. The feed rate was controlled to prevent oxygen depletion and to minimize ethanol formation (glucose-limited conditions). Whole culture samples (without cell removal) were taken and boiled in an equal volume of DMSO for total glycosides levels.
(248)
Example 7: Strain Engineering and Fermentation of EFSC 3297 for Increased Production of RebD and RebM
(249) The same wild type Saccharomyces strain utilized in Example 1 was modified to contain the heterologous genes in Table 15 involved in steviol glycoside production. The genes were all integrated into the chromosome of the host strain using similar methods described in Example 1. Although the genes used are identical to those in Example 1, increased copy numbers of bottleneck enzymes in the steviol pathway allowed for increased production of RebD and RebM. Fermentation of strain 3297 was carried out in a manner similar to that described above for strain 3261.
(250) TABLE-US-00014 TABLE 15 List of Recombinant Genes and Promoters Used in Strain EFSC 3297. Number Heterologous pathway gene of copies Promoter(s) used GGPPS7 (Synechococcus sp) 3 TEF2 (X2), GPD1 synthetic gene CDPS (truncated, Zea mays) 4 PGK1 (X3), TPI1 native gene KS5 (A. thaliana) native gene 4 TPI1, PDC1 (X3) KO (S. rebaudiana KO1) 2 FBA1, GPD1 synthetic gene ATR2 synthetic gene 1 PGK1 KAH (S. rebaudiana KAHe1) 4 GPD1 (X2), TEF1 (X2) synthetic gene S. rebaudiana CPR 8 native 3 TPI1 (X3) gene 85C2 (S. rebaudiana) 1 GPD1 synthetic 74G1 native (S. rebaudiana) 1 TPI1 76G1 synthetic (S. rebaudiana) 1 TEF1 91d2e-b 2X mutant from 1 GPD1 S. rebaudiana EUGT11 synthetic 2 TEF2 (X2) (Oryza sativa)
(251) Production of RebD and RebM by EFSC 3297 is shown in
Example 8: Strain Engineering and Fermentation of EFSC 3841 with Two Copies of the UGT76G1 Gene
(252) The wild type Saccharomyces strain utilized in Example 1 was modified to contain the heterologous genes in Table 16 involved in steviol glycoside production. The genes were all integrated into the chromosome of the host strain using similar methods described in Example 1. Fermentation conditions for 3841 were similar to those described above for strain 3261.
(253) TABLE-US-00015 TABLE 16 List of Recombinant Genes and Promoters Used in Strain EFSC 3841. Number Heterologous pathway gene of copies Promoter(s) used GGPPS7 (Synechococcus sp) 3 TEF2 (X3) synthetic gene CDPS (truncated, Zea mays) 4 PGK1 (X4) native gene KS5 (A. thaliana) native gene 4 PDC1 (X4) KO (S. rebaudiana KO1) 3 FBA1, GPD1, TPI1 synthetic gene ATR2 synthetic gene 2 PGK1 (X2) KAH (S. rebaudiana KAHe1) 4 GPD1, TEF1 (X3) synthetic gene S. rebaudiana CPR 8 native 3 TPI1 (X3) gene 85C2 (S. rebaudiana) 2 GPD1 (X2) synthetic 74G1 native (S. rebaudiana) 2 TPI1 (X2) 76G1 synthetic (S. rebaudiana) 2 TEF1 (X2) 91d2e-b 2X mutant from 2 GPD1 (X2) S. rebaudiana EUGT11 synthetic 2 TEF2, TEF1 (Oryza sativa)
(254) Production of RebD, RebM, and RebA by EFSC 3841 is shown in
Example 9: Knockdown of One UGT76G1 Gene from EFSC 3841 and Decreased Production of RebD and RebM
(255) An auxotrophic (leu2, ura3) version of strain EFSC 3841 described above, designated EFSC 3643, was further modified to delete one of the wild type 76G1 UGT genes. The performance of 3 colonies containing one copy of UGT 76G1 was tested versus 4 colonies of the unmodified strain which contains 2 copies of UGT 76G1. PCR was used to verify that the new strain only harbored one copy of the 76G1. Briefly, the disruption of one copy of UGT76G1 was verified by two PCR reactions amplifying a region upstream of the insertion site with part of the integration cassette and a region downstream of the insertion site with part of the integration cassette used for disruption. PCR primers designed for the wildtype 76G1 confirmed that wildtype 76G1 was still intact and present in the strain. The colonies were grown in 96 deep-well plates for 96 hours at 30? C. and 400 RPM. The total amounts of RebD and RebM were determined by LC/MS analysis.
(256) From
Example 10: Determination of Relative Rates of RebD and RebM Production
(257) p416GPD containing WT-76G1 was expressed in the protease deficient yeast strain DSY6 for 48 h in SC-ura media. 100 ?L of cells were then reinoculated in 3 mL of SC-ura media for 16 h. The cells were lysed with 200 ?L CelLytic? Y according to manufacturer's description. 6 ?L of the lysate were added to 24 ?L of the reaction mixture consisting of 20 mM Tris-buffer (pH 8.0), 0.3 ?MUDPG, and 0.1 ?M Reb D or Reb E. The reactions were incubated at 30? C. and stopped at 0, 1, 2, and 18 h by transferring 25 ?L of the 30 ?L reaction mixture to 25 ?L DMSO. Amounts of RebD, RebE, and RebM were analyzed by LC-MS and assessed by peak integration during data processing as area under the curve.
(258)
Example 11: Prediction of Amino Acids Involved in RebM and RebD Binding in UGT76G1
(259) As a means for identifying UGT76G1 variants with increased activity and regioselectivity towards RebM or RebD, homology modeling and docking studies were performed. Three homology models were generated using standard setting in the SybylX program with a combination of the following PDB-files 2PQ6 (% ID=31), 2C1X (% ID=28), 3HBF (% ID=28), 2VCE (% ID=35) as templates. The ligands present in PDB2VCE were used during the generation of main- and side-chains but removed prior to energy minimization. To yield the highest quality structures, models were energy minimized using an AMBER FF99 forcefield with either the standard settings or a gradient termination with a threshold of 0.1 kJ, a cutoff radius of 10 ?, and a maximum iteration of 5000 cycles. Statistics for the models are shown in Table 17, and variance between the models can be found in
(260) TABLE-US-00016 TABLE 17 Summary of UGT76G1 homology models. Statistic Model 1 Model 2 Model 3 Goal Clashscore, .sup.1.1 0.42 3.38 all atoms (99.sup.th (99.sup.th (97.sup.th percentile) percentile) percentile) Poor rotamers 16 6 8 <1% (4.47%) (1.52%) (2.02%) Ramachandran 5 12 6 <0.05%.sup. outliers (1.26%) (2.70%) (1.35%) Ramachandran 354 375 404 >98% favored (88.94%) (84.27%) (90.79%) MolProbity score 1.89 1.46 1.89 (81.sup.st (96.sup.th (81.sup.st percentile) percentile) percentile) C? deviations > 0.25 3 1 5 0 ? (0.80%) (0.24%) (1.20%) Bad backbone bonds 0/1599 0/1780 0/1780 0% (0%) (0%) (0%) Bad backbone 0/1996 1/2224 0/2224 <0.1% angles (0%) (0.04%) (0%)
(261) After model generation, substrates were docked into the active site of the enzyme using the Surflex Dock suite in SybylX to predict the amino acids forming the binding pocket. The UDPG portion of the UGT76G1 binding groove was located by aligning the 76G1 models with PDB2VCE and importing the ligand, UDPF2G, directly from the template. To dock the acceptor substrates, a protocol was generated using standard values covering the remaining part of the binding site. The dockings were performed using the GeomX settings on a ligand library containing steviol glycosides allowed with protein flexibility (model 1) or no flexibility (model 2). The docking results were analyzed using a combination of the scoring functions in SybyIX using top 3 docking results in base mode and top 1 docking result with protein flexibility.
(262) All UGT76G1 amino acids are shown in Table 18 below. The sites for the saturation library were determined by selecting all residues found to be within 5 ? of RebD and RebM in the docking analysis on two or more models (shown as bold x). Furthermore, all residues found to be within 5 ? of the RebM and RebD 19-O-glucose moiety, which were positioned in the binding site for the RebD.fwdarw.RebM reaction, were selected. Residues completely conserved between similar enzymes, which are shown in bold and with a !, were omitted from the screen.
(263) TABLE-US-00017 TABLE 18 Prediction of amino acids involved in RebM and RebD binding in UGT76G1. Enzyme UGT76G1 Top3 Top3 Top1 Top1 Top1 (base) (Base) (PF) (PF) (Base) Model no. Model 2 1 1 1 1 1 + 2 Unique Substrate: minus 5 ?: Unique Total RebM RebD cons. RebM RebD screened RebM RebM RebM 19Glcs 19Glcs AAs: 19Glc: 19Glcs: residues: Residue ?: 5 5 5 5 5 5 5 5 5 No. of res 73 58 42 15 11 23 12 3 38 in group: VAL 20 20 20 20 X x PRO 21! 21 21 21 21 21 PHE 22 22 22 22 22 22 X x GLN 23 23 23 23 23 x x GLY 24 24 24 24 24 X x HIS 25! 25 25 25 ILE 26 26 26 26 x x ASN 27 27 27 THR 48 48 ASN 49 49 49 49 49 x x PHE 50 50 50 50 50 x x ASN 51 51 51 51 51 x x PRO 53 53 53 53 x x LYS 54 54 54 54 54 x x THR 55 55 55 55 55 x x SER 56 56 56 56 56 x x PRO 80 80 THR 81 81 HIS 82 82 GLY 83 83 PRO 84 84 LEU 85 85 85 X x MET 88 88 ARG 89 89 ILE 92 92 GLU 95 95 95 HIS 96 96 96 ASP 99 99 99 ARG 103 103 103 THR 123 123 ASP 124! 124 124 ALA 125 125 LEU 126 126 126 126 X x TRP 127 127 127 127 X x TYR 128 128 128 X x VAL 143 143 LEU 144 144 MET 145 145 145 X x THR 146 146 146 146 X x SER 147 147 147 147 X x SER 148 148 PHE 150 150 ASN 151 151 151 151 X x PHE 152 152 ALA 154 154 HIS 155 155 155 155 X x VAL 156 156 SER 157 157 LEU 158 158 PRO 159 159 GLN 160 160 PHE 161 161 ASP 162 162 GLU 163 163 GLY 165 165 TYR 166 166 LEU 167 167 ASP 168 168 ASP 189 189 ILE 190 190 LYS 191 191 191 191 X x SER 192 192 ALA 193 193 TYR 194 194 SER 195 195 195 195 X x ASN 196 196 TRP 197 197 GLN 198 198 198 198 X x ILE 199 199 199 X x LEU 200 200 200 200 X x LYS 201 201 GLU 202 202 ILE 203 203 203 203 X x LEU 204 204 204 204 X x GLY 205 205 LYS 206 206 MET 207 207 207 ILE 208 208 LYS 209 209 SER 253 253 253 253 253 x x LEU 257 257 257 257 x x PHE 281! 281 GLY 282! 282 282 282 SER 283 283 283 283 283 x x THR 284 284 284 284 284 X x SER 285 285 285 285 x x GLU 286 286 VAL 309 309 ARG 311! 311 PHE 314 314 314 314 314 x x LYS 337 337 337 x x TRP 338! 338 338 338 338 HIS 356! 356 GLY 358! 358 TRP 359! 359 359 ASN 360! 360 PHE 377 377 GLY 378 378 378 X x LEU 379 379 379 379 X x ASP 380 380 380 380 X x GLN 381! 381 381 381 PRO 382 382 LEU 383 383 ASN 384 384 Bold indicates complete conservation in amino acid. Bold ! indicates amino acid residues that are completely conserved between similar enzymes and were omitted from the screen.
Example 12: UGT76G1 Site Saturation Library Prescreen
(264) Prior to performing the UGT76G1 site saturation library screening as described herein, culture growth and production of RebM and RebD were monitored in 96 and 4?24 deep-well plates. Using the standard lithium acetate protocol, the EFSC 3385 strain was transformed with p416GPD containing WT-76G1, and the transformants were plated on SC-URA plates. EFSC 3385 is a strain that is deficient in UGT76G1 and thus will make RebE until transformed with a plasmid containing an active UGT76G1. The strain contained a disruption in the UGT76G1 coding region, which was replaced with the spHIS5 marker, and also contained integrated copies of the UGT91D2e-2? mutant, UGT74G1, ATR2, UGT85C2, S. rebaudiana CPR8 (2 copies), A. thaliana KS5 (2 copies), Synechococcus GGPPS7, codon optimized S. rebaudiana KAHe1 (2 copies), S. rebaudiana KO (two copies), the truncated Zea mays CDPS5 (2 copies), and EUGT11.
(265) For the 96 deep-well plate condition, 96 colonies were transferred to a plate containing 1 mL SC-URA, and the plate was incubated at 30? C. and 400 RPM for 96 h. For the 4?24 deep-well plate condition, 96 colonies were transferred to a plate containing 3 mL SC-URA. The plate was incubated at 30? C. and 320 RPM for 96 h, and 200 ?L were then transferred from each well to a 96 deep-well plate.
(266) 50 ?L of the cultures from each plate were transferred to 96 well polymerase chain reaction (PCR) plates and diluted 1:1 with 100% dimethyl sulfoxide (DMSO). The plates were heat sealed, incubated at 80? C. for 10 min, and subsequently cooled to 25? C. The plates were spun at 4000 RPM for 10 min, and 50 ?L of the culture mixtures were transferred to a new plate for LC-MS analysis.
(267) Results of the UGT76G1 site saturation library prescreen can be found in
Example 13: UGT76G1 Site Saturation Library Screen
(268) Through the company, Baseclear, UGT76G1 was subcloned from EPSC2060 (p423GPD) to EPSB492 (p416GPD) using the SpeI and XhoI restriction sites, and the site saturation libraries were created using degenerate NNS-primers. Using the standard lithium acetate protocol, the EFSC3385 strain was transformed with the library or with control plasmid containing WT-76G1, and the transformants were plated on SC-URA plates.
(269) 1 mL of SC-URA media was added to 96 deep-well plates, and colonies from each of the 38 site saturation library residues identified in Example 9 were picked and incubated in the 96 deep-well plates at 30? C. and 400 RPM for 96 h. 50 ?L of each culture samples were then transferred to 96 well PCR plates containing 50 ?L 100% DMSO. The plates were then heat sealed, incubated at 80? C. for 10 min, subsequently cooled to 12? C., and spun at 4000 RPM for 10 min. 70 ?L of each supernatant were transferred to a new plate for LC-MS analysis.
(270)
(271) TABLE-US-00018 TABLE 19 Numbering for UGT76G1 site saturation library variants. Number Residue 1 VAL 20 2 PHE 22 3 GLN 23 4 GLY 24 5 ILE 26 6 ASN 49 7 PHE 50 8 ASN 51 9 PRO 53 10 LYS 54 11 THR 55 12 SER 56 13 LEU 85 14 LEU 126 15 TRP 127 16 TYR 128 17 MET 145 18 THR 146 19 SER 147 20 ASN 151 21 HIS 155 22 LYS 191 23 SER 195 24 GLN 198 25 ILE 199 26 LEU 200 27 GLU 202 28 ILE 203 29 SER 253 30 LEU 257 31 SER 283 32 THR 284 33 SER 285 34 PHE 314 35 LYS 337 36 GLY 378 37 LEU 379 38 ASP 380
(272) Table 20 and
(273) TABLE-US-00019 TABLE 20 Top RebM- and RebD-producing colonies. RebM RebD Colony (?M) (?M) A1 16.28 23.35 A2 4.83 24.12 A3 2.92 25.13 A4 34.07 12.24 A5 5.66 23.72 A6 11.08 23.50 A7 5.33 24.35 A8 38.36 11.90 A9 42.18 13.76 A10 33.80 8.95 A11 34.66 10.13 A12 40.44 9.30 B1 36.86 13.64 B2 34.88 9.05 B3 38.61 6.64 B4 20.84 24.42 B5 22.70 23.28 B6 35.49 9.63 B7 34.55 8.71 B8 35.47 11.31 B9 35.62 9.17 B10 37.59 7.80 B11 36.76 12.41 B12 2.31 26.75 C1 2.21 23.66 C2 9.24 24.56 C3 1.93 23.18 C4 10.47 24.70 C5 4.91 23.09 C6 2.38 27.11 C7 11.06 28.32 C8 13.77 23.07 C9 35.58 9.92 C10 33.51 5.02 C11 33.87 4.24 C12 6.04 30.20 D1 33.51 4.93 D2 43.18 12.50 D3 34.04 8.06 D4 35.92 12.38 D5 37.11 7.14 D6 44.66 11.19 D7 33.61 13.36 D8 36.19 8.68 D9 36.88 16.12 D10 11.25 30.00 D11 11.68 31.55 E1 56.60 7.58 E2 12.18 30.41 E3 13.75 33.16 E4 8.79 27.90 E5 8.69 25.33 E6 11.78 28.56 E7 8.31 23.67 E8 9.19 25.35 E9 7.77 27.41 E10 8.96 24.06 E11 11.25 31.88 E12 10.18 24.20 F1 9.94 23.65 F2 38.36 12.57 F3 37.37 15.35 F4 8.89 25.59 F5 10.78 23.51 F6 11.41 27.57 F7 10.96 26.18 F8 35.86 14.67 F9 5.69 29.07 F10 13.84 32.85 F11 2.81 27.27 F12 39.86 10.64 G1 37.94 8.80 G2 9.56 23.64 G3 33.80 9.62 G4 3.01 25.15 G5 9.81 25.41 G6 42.71 9.96 G7 1.65 24.20 G8 9.63 24.28 G9 33.65 22.69 G10 34.87 9.69 G11 33.66 11.49 G12 3.58 24.04 H1 33.94 9.84 H2 10.39 23.59 H3 43.64 9.40 H4 33.50 8.73 H5 36.32 9.39 H6 34.61 7.69 H7 36.73 9.20 H8 35.49 4.09 H9 34.25 4.82 H10 35.36 4.10 H11 19.87 25.19
Example 14: UGT76G1 Site Saturation Library Rescreen and Variant Sequencing
(274) A rescreen of the 47 UGT76G1 variant colonies producing either the highest amounts of RebD or RebM was done in triplicate and showed the same trends as the initial screen (
(275) TABLE-US-00020 GPDseq_fwdprimerseq: CGGTAGGTATTGATTGTAATT (SEQIDNO:87) CYC1seq_revprimerseq: CTTTTCGGTTAGAGCGGATGT (SEQIDNO:88)
(276) Tables 21-23 show the amounts and rankings of RebD, RebM, and RebD/RebM produced by the indicated variants, and Table 24 summarizes the mutations that selectively increase either RebD or RebM production. Amounts of RebM, RebD, RebA, Rubusoside, and RebB produced by wild type and UGT76G1 variant colonies are shown in Table 25.
(277) TABLE-US-00021 TABLE 21 Identities of top RebD-producing UGT76G1 variants. Rescreen Screen Sample 1 Sample 2 Sample 3 Average RebD RebD RebD RebD RebD Colony (?M) Rank (?M) Rank (?M) Rank (?M) Rank (?M) RANK Mutation E2 25.33 21 17.00 21 18.99 7 19.35 3 20.17 13 L257A E5 33.16 1 17.51 15 15.34 29 18.49 8 21.13 13 L257G F9 29.07 8 21.05 3 17.23 15 13.89 28 20.31 14 L257T G5 25.15 23 21.53 2 19.07 4 14.50 25 20.06 14 S283G E3 28.56 9 16.42 22 18.28 10 21.09 14 L257W C7 27.11 15 18.64 8 14.64 32 18.97 4 19.84 15 T146A F6 25.59 18 18.17 11 15.55 25 18.87 5 19.55 15 L257R, (S389F) C5 28.32 10 16.03 20 22.18 15 T146A D11 30.00 7 15.58 24 22.79 16 L257R A5 23.72 35 18.52 10 16.76 19 18.66 6 19.42 18 I26F F1 24.06 33 19.91 4 16.90 17 20.29 18 L257G B12 24.56 26 18.11 12 17.29 14 15.98 21 18.99 18 T146G E4 30.41 5 16.30 23 17.46 11 12.88 34 19.26 18 L257P E10 23.65 38 19.31 3 17.12 15 20.03 19 L257G F4 12.57 55 19.36 5 17.43 13 18.55 7 16.98 20 L257E E9 24.20 31 17.49 16 16.93 16 19.54 21 L257G E7 23.67 36 19.24 6 15.51 26 16.74 17 18.79 21 L257G H2 23.59 40 15.85 26 17.95 8 17.63 12 18.75 22 S285R G7 24.20 30 16.34 21 17.22 14 19.26 22 S283N C12 30.20 6 14.50 33 14.36 27 19.68 22 H155R C1 26.75 16 15.32 27 16.30 22 14.43 26 18.20 23 T146G A6 23.50 42 14.96 29 19.59 2 16.25 19 18.57 23 I26W C4 24.70 25 15.94 22 20.32 24 T146P
(278) TABLE-US-00022 TABLE 22 Identities of the top RebM-producing UGT76G1 variants. Rescreen Screen Sample 1 Sample 2 Sample 3 Average RebD RebD RebD RebD RebD Colony (?M) Rank (?M) Rank (?M) Rank (?M) Rank (?M) RANK Mutation G1 37.94 12 26.68 7 26.77 6 30.46 8 T284G H7 36.73 19 29.81 1 25.11 12 30.55 11 K337P B1 36.86 17 27.82 5 32.34 11 T55K D2 43.18 4 21.39 30 27.28 4 30.62 13 Q198R H3 43.64 3 23.32 21 24.67 14 22.03 23 28.42 15 S285T C11 33.87 39 28.92 3 26.07 8 24.21 14 28.27 16 H155L A10 33.80 41 25.52 10 23.48 15 29.50 1 28.08 17 S56A B11 36.76 18 25.28 12 20.88 28 24.69 13 26.90 18 Y128S H04 33.50 47 25.34 11 24.98 13 28.71 3 28.13 19 K337E B02 34.88 30 28.40 4 20.65 27 27.98 20 T55E D09 56.60 1 21.14 32 20.84 29 32.86 21 S253G D01 33.51 45 23.48 20 25.27 11 25.33 10 26.89 22 H155L H09 34.25 35 21.90 21 25.28 11 27.14 22 L379V G11 33.65 43 22.95 22 27.77 3 28.12 23 T284R B8 35.47 28 25.66 9 21.01 26 20.13 28 25.57 23 Y128E F2 11.41 58 31.01 1 21.06 25 26.62 7 22.53 23 S253W C10 33.51 46 22.04 28 25.54 10 25.42 8 26.63 23 H155L
(279) TABLE-US-00023 TABLE 23 Identities of the top RebD/M-producing UGT76G1 variants. Rank Average Average Average Average RebD + RebD Rank RebM Rank Rank Colony (?M) RebD (?M) RebM (96-M) Mutation G7 19.26 22 1.51 84 34 S283N F9 20.31 14 5.27 71 38 L257T C1 18.20 23 1.90 79 40 T146G B12 18.99 18 3.74 74 41 T146G A5 19.42 18 6.76 68 46 I26F F6 19.55 15 8.23 63 48 L257R + S389F C6 17.74 29 2.59 77 48 T146G F1 20.29 18 7.98 65 49 L257G E2 20.17 13 8.64 60 49 L257A C7 19.84 15 7.52 61 50 T146A C3 16.30 37 1.74 83 50 T146G E11 17.80 25 6.48 69 52 L257G A2 15.34 32 4.48 76 52 Q23H E5 21.13 13 9.32 57 52 L257G E4 19.26 18 8.00 61 54 L257P G5 20.06 14 8.79 56 54 S283G D11 22.79 16 9.75 58 54 L257R C5 22.18 15 10.81 57 54 T146A E9 19.54 21 8.21 62 55 L257G E7 18.79 21 8.00 62 55 L257G C2 18.29 26 6.95 67 55 T146A A3 15.25 35 3.19 76 56 Q23G E12 17.28 25 7.26 65 56 L257W E10 20.03 19 10.10 57 57 L257G
(280) TABLE-US-00024 TABLE 24 Summary of UGT76G1 variants for RebD production and RebM production. RebD Q23G, Q23H, I26F, I26W, T146A, T146G, T146P, H155R, L257P, L257W, L257T, L257G, L257A, L257R, L257E, S283G and S283N RebM T55K, T55E, S56A, Y128S, Y128E, H155L, H155R, Q198R, S285R, S285T, S253W, S253G, T284R, T284G, S285G, K337E, K337P and L379V
(281) TABLE-US-00025 TABLE 25 Production of steviol glycosides by UGT76G1 variants. Total RebM RebD RebA Rubu RebB RebA-->RebM Mutation AVG (?M) SUM WT 22.35 4.98 7.03 0.65 2.54 34.37 WT 24.01 5.14 5.68 0.77 2.43 34.83 RebD-optimizing mutations L257W 9.35 18.46 4.70 2.03 32.52 L257A 8.62 18.45 4.75 1.97 31.82 L257E 8.72 18.44 3.70 1.54 30.87 L257G 7.49 18.40 4.44 0.18 1.80 30.34 S283G 10.71 18.37 3.77 1.58 32.85 L257G 10.18 18.22 4.47 0.20 1.87 32.86 I26F 7.13 17.98 3.81 1.64 28.92 Q23H 4.30 17.88 3.04 1.38 25.22 L257R, S389F 8.01 17.53 4.21 1.92 29.75 T146A 9.24 17.41 4.16 0.18 1.72 30.82 L257T 5.13 17.39 2.73 0.25 1.29 25.24 L257W 11.40 17.35 4.28 1.94 33.04 L257G 7.23 17.21 4.19 0.45 1.81 28.62 L257G 7.90 17.16 4.16 1.73 29.22 S285R 8.66 17.14 3.44 1.70 29.25 T146G 1.91 17.13 1.69 0.74 20.73 L257G 7.84 17.12 3.93 1.80 28.88 I26W 11.51 16.93 5.22 1.93 33.67 S283N 1.45 16.78 1.48 0.67 19.70 T146A 10.57 16.03 4.07 1.86 30.68 T146G 1.82 15.95 1.75 0.22 0.72 19.52 T146P 10.12 15.94 4.05 1.96 30.11 T146A 9.31 15.60 4.34 1.91 29.25 L257R 8.26 15.58 3.60 0.17 1.88 27.44 L257P 6.61 15.55 3.62 0.15 1.59 25.78 T146G 1.76 15.35 1.81 0.24 0.68 18.92 H155R 10.49 14.43 4.46 0.25 1.78 29.38 L257G 5.12 14.03 3.63 0.95 22.78 T146G 1.64 12.86 1.65 0.21 0.67 16.14 Q23G 3.33 11.96 1.71 0.16 0.80 17.00 RebM-optimizing mutations T55K 27.82 7.96 6.28 0.40 2.31 42.06 K337P 27.46 8.14 5.83 0.41 2.18 41.43 T284G 26.72 7.29 7.27 0.34 2.72 41.28 H155L 26.40 3.70 6.79 0.30 2.50 36.89 K337E 26.34 7.14 6.35 0.39 2.66 39.83 S253W 26.23 6.83 5.82 0.37 2.26 38.89 S56A 26.17 6.50 6.94 0.66 2.46 39.61 T284R 25.36 7.99 6.24 0.24 2.56 39.58 H155L 24.69 3.65 7.38 0.39 2.66 35.72 T55E 24.52 6.73 5.84 0.46 2.09 37.09 Q198R 24.33 6.61 6.37 0.60 2.33 37.32 H155L 24.33 4.00 7.43 0.29 2.53 35.76 Y128S 23.62 6.20 6.48 0.43 2.29 36.29 L379V 23.59 4.01 7.09 0.28 2.72 34.69 S285T 23.34 5.90 5.73 0.44 2.30 34.97 Y128E 22.27 5.04 5.78 0.41 2.17 33.09 S253G 20.99 7.26 5.78 0.27 2.42 34.04
Example 15: Determination of Relative Rates of UGT76G1 Glycosylation Reactions
(282) UGT76G1 was only known in the literature to catalyze the 1,3-glycosylation of 1,2-stevioside to convert it into RebA and converting 1,2-bioside to RebB. The inventors have newly discovered that the reactions shown in Table 26 are catalyzed by UGT76G1.
(283) TABLE-US-00026 TABLE 26 Newly discovered UGT76G1 reactions. Substrate Product Rebaudioside D Rebaudioside M Rubusoside Rebaudioside Q (1,3-O-glycoside linkages on both the 13- and 19-O-glucose position) Steviol 1,2 bioside Rebaudioside B isomer (19-O) isomer (19-O)
(284) Similar to Example 9, p416GPD containing WT-76G1 was expressed in the protease deficient yeast strain DSY6 for 48 h in SC-ura media. 100 ?L of cells were then reinoculated in 3 mL of SC-ura media for 16 h. The cells were lysed with 200 ?L CelLytic? Y according to manufacturer's description. 6 ?L of the lysate were added to 24 ?L of the reaction mixture consisting of 20 mM Tris-buffer (pH 8.0), 0.3 pMUDPG, and either 0.1 ?M rubusoside, 0.2 ?M 1,2-bioside, 0.2 ?M 1,2-stevioside, 0.2 ?M RebA, or 0.1 ?M RebE. The reactions were incubated at 30? C. and stopped at 0, 1, 2, and 18 h by transferring 25 ?L of the 30 ?L reaction mixture to 25 ?L DMSO. Amounts of steviol glycosides were analyzed by LC-MS and assessed by peak integration during data processing as area under the curve.
(285) In
(286) Furthermore, using either 1,2-stevioside or RebA as a substrate, a peak eluting at 1.96 min on the steviol+5 glucose chromatogram appeared (
(287) These results collectively indicated that UGT76G1 preferentially catalyzed glycosylation of steviol glycoside substrates that are 1,2-di-glycosylated on the 13-O-position, followed by steviol glycoside substrates that are mono-glycosylated at the 13-O-position. There appeared to be little preference arising from the glycosylation state of the 19-O-position. FIG. 1 summarizes steviol glycoside glycosylation reactions and the enzymes by which they are known to be catalyzed.
Example 16: Production of Steviol Glycosides by UGT76G1 Variants
(288) Quantitative standards are not commercially available for each steviol glycoside, which prevented some concentration measurements. Therefore, production of additional steviol glycosides by the enzyme variants, as compared to the wild type enzyme, was assessed by peak integration during data processing. The area under the curve data for each variant was normalized to the wild type UGT76G1 and is shown in Table 27. These data were in agreement with previous examples but also showed that some of the variants did not produce 1,3-stevioside (RebG), rubusoside, Reb Q, and/or a steviol-tetraglycoside eluting at 1.43 min, as the wild type controls did. Increases in RebM and RebD production can be explained by this observation.
(289) TABLE-US-00027 TABLE 27 Area under the curve data as a measure of the production of steviol glycosides by UGT76G1 variants relative to wildtype UGT76G1 production. 0.95 min 1,3 at 13 Stv4Glc and Reb Reb 1,2 1,3 (suspect 1.43 min 19Pos Variant M D RebA Stev Stev RebB Rubu 1,2-Bios 1,3-Bios 19-SMG 13-SMG Stev RebE) Stv4Glc Reb Q Q23H 0.2 2.6 0.4 2.5 0.5 1.0 3.7 0.5 Q23G 0.2 2.5 0.3 2.0 0.3 0.3 0.6 2.8 0.4 I26F 0.3 3.8 0.6 2.2 0.7 1.1 3.0 0.5 I26W 0.5 3.6 0.9 1.8 0.8 0.8 2.5 0.4 S56A 1.2 1.4 1.2 1.2 0.7 1.0 1.0 1.2 1.4 0.3 0.7 T55K 1.3 1.7 1.0 1.0 1.0 0.6 1.0 1.1 0.9 T55E 1.2 1.4 1.0 1.3 0.8 0.9 0.7 0.9 1.7 0.3 0.9 Y128E 1.1 1.1 1.0 1.1 0.9 0.6 1.0 1.0 0.7 0.4 Y128S 1.1 1.3 1.1 1.2 0.6 1.0 0.7 1.0 1.3 1.0 0.6 T146G 0.1 3.6 0.3 3.7 0.3 1.0 7.6 0.9 T146G 0.1 3.3 0.3 4.0 0.3 0.4 1.4 7.3 1.0 T146A 0.4 3.3 0.7 2.1 0.8 0.9 3.2 0.5 T146G 0.1 2.7 0.3 3.8 0.3 0.3 1.2 6.2 0.9 T146P 0.5 3.4 0.7 2.2 0.8 0.9 3.0 0.5 T146A 0.5 3.4 0.7 2.2 0.8 0.8 3.3 0.5 T146G 0.1 3.4 0.3 3.7 0.3 0.3 1.2 6.6 0.9 T146A 0.4 3.7 0.7 2.2 0.7 0.3 1.1 3.8 0.5 H155L 1.2 0.8 1.2 1.0 1.1 0.4 1.0 0.6 0.4 H155L 1.3 0.8 1.1 0.8 1.1 0.5 1.0 0.5 0.3 H155R 0.5 3.1 0.7 2.2 0.8 0.4 0.9 2.8 0.6 H155L 1.2 0.8 1.2 1.0 1.1 0.6 1.1 0.8 0.5 0.5 Q198R 1.2 1.4 1.1 1.3 0.8 1.0 0.9 1.1 1.6 0.6 S253G 1.0 1.5 1.0 1.1 1.0 0.4 1.2 1.2 0.2 L257R 0.4 3.3 0.6 2.4 0.8 0.3 1.1 2.8 0.6 L257A 0.4 3.9 0.8 2.8 0.8 1.3 4.3 0.7 L257W 0.5 3.7 0.7 2.5 0.8 0.9 3.8 0.6 L257P 0.3 3.3 0.6 2.3 0.7 0.2 0.9 3.1 0.5 L257G 0.4 3.6 0.7 2.4 0.8 1.2 3.3 0.5 L257G 0.4 3.6 0.7 2.4 0.7 1.2 3.6 0.6 L257G 0.3 3.6 0.7 3.7 0.8 0.7 1.2 7.9 0.9 L257G 0.5 3.9 0.7 2.6 0.8 0.3 1.1 3.2 0.7 L257G 0.2 3.0 0.6 2.2 0.4 1.0 3.0 0.5 L257W 0.3 2.9 1.8 4.1 1.8 0.8 1.3 4.0 0.5 L257G 0.4 3.9 0.7 2.6 0.8 0.3 1.4 4.1 0.7 S253W 1.3 1.4 1.0 1.3 1.0 0.6 0.9 1.4 0.7 0.4 L257E 0.4 3.9 0.6 2.4 0.7 0.9 3.9 0.6 L257R, 0.4 3.7 0.7 2.5 0.8 1.1 3.5 0.5 S389F L257T 0.2 3.7 0.5 2.6 0.5 0.4 0.8 4.0 0.6 T284G 1.3 1.5 1.2 1.3 1.2 0.5 1.1 2.2 0.7 S283G 0.5 3.9 0.6 1.9 0.7 1.1 3.5 0.4 S283N 0.1 3.6 0.2 3.9 0.3 1.1 6.8 1.0 T284R 1.2 1.7 1.0 1.4 1.1 0.4 1.0 2.2 0.4 S285R 0.4 3.6 0.6 2.6 0.7 1.3 4.4 0.6 S285T 1.1 1.3 1.0 1.0 1.0 0.7 1.0 1.2 0.9 0.3 K337E 1.3 1.5 1.1 1.1 1.1 0.6 1.2 1.2 0.7 K337P 1.3 1.7 1.0 1.3 0.9 0.6 1.1 1.6 1.1 0.4 L379V 1.1 0.9 1.2 1.2 1.2 0.4 1.1 1.1 0.4
(290) Table 28 summarizes trends in steviol glycoside production through RebD-optimizing and RebM-optimizing mutations, compared to the normalized production of wild type controls. The variants with increased RebD production appeared to primarily be the result of inhibiting the RebD.fwdarw.RebM reaction. Additional RebD production can stem from inhibition of the Rubu.fwdarw.RebG.fwdarw.RebQ steviol glycosylation branch as well as a reduction in RebB and of a tetraglucoside eluting at 1.43 min. The four-fold increase in 1,2-Stevioside and seven-fold increase in RebE were unexpected, but the RebE increase could be a seven-fold increase in a very small amount of sideproduct found in the wild type controls. Nevertheless, this finding indicated that the Stevioside.fwdarw.RebA reaction had also been partially inhibited by the RebD-optimizing mutations, which was seen as a reduction in RebA intermediate.
(291) TABLE-US-00028 TABLE 28 Steviol glycoside production by the UGT76G1 wild type or RebD and RebM-optimizing mutations. 1.43 1,3 at 13 0.95 min min and 19 1,2 1,3 1,2 1,3 19- 13- Stv4Glc Stv4Glc Pos RebM RebD RebA Stev Stev RebB Rubu Bios Bios SMG SMG Stev (RebE) (UNK) (RebQ) RebD 0.1-0.5x 2.5-3.9x 0.3-0.8x 1.8-4.0x 0.0x 0.3-0.8x 0.0-0.4x 0.9-1.3x 3.0-7.0x 0.4-0.9x 0.0x RebM 1.0-1.3x 0.8-1.7x 1.0-1.2x 0.8-1.3x 0.0-0.8x 0.9-1.1x 0.4-1.0x 0.9-1.2x 0.5-2.0x 0.0-0.9x 0.0-0.8x WT 23.2 ?M 5.1 ?M 6.4 ?M AUC AUC 2.5 ?M 0.7 ?M AUC AUC AUC AUC
(292) The mutation resulting in the highest RebD levels, L257G, produced nearly four-fold the RebD of the wild type and was found in six colonies sequenced. Other L257 mutations demonstrated nearly the same productivity. Mutants 126W and S283G showed the highest RebD/stevioside ratio, indicating that these mutations lead to the greatest inhibition of the RebD.fwdarw.M reaction without mitigating the Stev.fwdarw.RebA reaction. These two mutations also completely abolished the Rubu.fwdarw.RebG.fwdarw.RebQ pathway and reduced the amount of the tetraglucoside eluting at 1.43 min while minimally affecting RebB production. The best RebD/RebM ratios were found with T146G and S283N mutants, which showed a 40-50-fold increase over the wild type. The S389Fmutation found with L257R demonstrated higher RebD production than L257R alone.
(293) Generally, increases in RebM also resulted in increases in RebD, while decreasing or completely blocking the Rubu.fwdarw.RebG.fwdarw.RebQ glycosylation pathway and the tetraglucoside eluting at 1.43 min. Yet, the remaining steviol glycosides studied appeared unaffected. The top RebM producers, T55K and K337P, each increased RebM by 1.3-fold and decreased rubusoside by 0.6-fold, compared to the wild type. Since rubusoside was only present at 0.7 ?M in the wild type, this observed decrease was insufficient to explain the increase in RebM. The Rubu.fwdarw.RebG.fwdarw.RebQ pathway was almost removed, with no 1,3-stevioside (RebG) produced by these mutants. As well, the variant with the K337P mutation produced 0.6-fold the levels of RebQ with the wild type. The mutations H155L and L379V each produced more RebM to RebD, with the wild type UGT76G1 producing approximately 4.58 RebM per RebD, and H155L and L379 producing approximately 6.66 and 5.88 RebM per RebD, respectively. Through the data uncovered by this study, UGT76G1 enzymes can be screened to identify species having improved kinetics towards RebD and RebM and that minimize side products, thereby increasing the flux towards the desired steviol glycosides.
(294) Having described the invention in detail and by reference to specific embodiments thereof, it will be apparent that modifications and variations are possible without departing from the scope of the invention defined in the appended claims. More specifically, although some aspects of the present invention are identified herein as particularly advantageous, it is contemplated that the present invention is not necessarily limited to these particular aspects of the invention.
REFERENCES
(295) 1. Critical Reviews in Food Science and Nutrition, 52:11, 988-998, DOI:10.1080/10408398.2010.519447. 2. J Nat Prod. 2013 Jun. 28; 76(6):1201-28. doi: 10.1021/np400203b. Epub 2013 May 28. 3. Plant Physiology and Biochemistry 63 (2013) 245e253. 4. Praveen Guleria and Sudesh Kumar Yadav, 2013. Insights into Steviol Glycoside Biosynthesis Pathway Enzymes Through Structural Homology Modelling. American Journal of Biochemistry and Molecular Biology, 3: 1-19. 5. The Plant Journal (2005) 41, 56-67 doi: 10.1111/j.1365-313X.2004.02275. 6. Madhav et al., Functional and structural variation of uridine diphosphate glycosyltransferase (UGT) gene of Stevia rebaudianaeUGTSr involved in the synthesis of rebaudioside A Plant Physiology and Biochemistry 63 (2013) 245e253. 7. Jewett M C, et al., Molecular Systems Biology, Vol. 4, article 220 (2008). 8. Masada S et al., FEBS Letters, Vol. 581, 2562-2566 (2007).