Solid gel amplification method and apparatus for platform molecular diagnostics
09957559 ยท 2018-05-01
Assignee
Inventors
Cpc classification
B01L2200/0673
PERFORMING OPERATIONS; TRANSPORTING
C12M43/00
CHEMISTRY; METALLURGY
C12M21/18
CHEMISTRY; METALLURGY
B01L3/502707
PERFORMING OPERATIONS; TRANSPORTING
B01L3/50851
PERFORMING OPERATIONS; TRANSPORTING
C12P19/34
CHEMISTRY; METALLURGY
B01L7/52
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/12
PERFORMING OPERATIONS; TRANSPORTING
B01L9/065
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/069
PERFORMING OPERATIONS; TRANSPORTING
International classification
C12M1/40
CHEMISTRY; METALLURGY
B01L9/06
PERFORMING OPERATIONS; TRANSPORTING
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
B01L7/00
PERFORMING OPERATIONS; TRANSPORTING
C12M3/06
CHEMISTRY; METALLURGY
Abstract
The present invention provides for a novel system and method for amplification and detection of nucleic acids within a miniaturized device wherein sample administration occurs via capillary forces through a channel created by drying a hydrogel containing all components needed for a cell-free, enzymatic, nucleic-acid amplification system other than the template nucleic acid or precursor thereto, and wherein an aqueous sample is provided to the desiccated hydrogel, and the hydrogel is rehydrated, through capillary forces.
Claims
1. A cassette for performing interrogations for the presence of a nucleic acid within an aqueous sample comprising a pan containing within it solid wax with at least one trench on its surface; a multiplicity of capillaries with two opposing apertures; wherein said capillaries contain a desiccated hydrogel containing all components needed for a cell-free nucleic acid amplification other than the template nucleic acid, within the capillaries there exists a path described by the inner diameter of said capillary and said desiccated hydrogel which allows atmospheric communication between opposing apertures and through said capillaries, said capillaries are within said trench with the longitudinal axis of said capillary parallel to the longitudinal axis of said trench, said trench resists the motion of said capillaries through friction between the inner longitudinal surface of said trench and the longitudinal surface of said capillaries with at least one end of said capillary is capable of receiving an aqueous sample, said wax is optically transparent to at least two wavelengths of electromagnetic radiation wherein said at least two wavelengths are capable of differentiation by an optical detector, and said pan is capable of containing the wax when in a molten state.
2. The cassette of claim 1 wherein the wax is Paraffin wax.
3. The cassette of claim 1 wherein said capillaries are less than 2 mm in diameter.
4. The cassette of claim 3 wherein said capillaries have an inner diameter of 1.1 mm.
5. The cassette of claim 1 wherein said pan is thermally conductive.
6. The cassette of claim 5 wherein said pan is aluminum.
7. The cassette of claim 1 wherein said pan absorbs electromagnetic radiation of at least one of said at least two wavelengths.
8. The cassette of claim 1 wherein said desiccated hydrogel is polymerized acrylamide and bis-acrylamide.
9. The cassette of claim 8 wherein said desiccated hydrogel is 4% acrylamide and 0.4% bis-acrylamide.
10. The cassette of claim 1 wherein said components needed for a cell free nucleic acid amplification system comprises the enzymes, substrates and primers needed for a polymerase chain reaction.
11. The cassette of claim 10 wherein said components needed for a cell free nucleic acid amplifications system comprises tris-sulfate, (NH.sub.4).sub.2SO.sub.4, MgCl.sub.2, all four deoxyribonucleotides, Bovine Serum Albumin, at least two primers designed to hybridize with a target nucleotide sequence, a heat stable DNA polymerase, azobis, TEMED and water.
12. The cassette of claim 11 wherein said components needed for a cell free nucleic acid amplifications system includes LC Green.
13. A system for detecting the presence of a nucleic acid within an aqueous sample comprising a pan containing within it solid wax with at least one trench on its surface; a multiplicity of capillaries with two opposing apertures; means for controlling temperature in thermal communication with said pan; illumination source; and optical detector, wherein The amplification of a nucleic acid is detected through an increase in an optical signal received by said optical detector resulting from the interaction of an illumination wavelength provided by said illumination source, said capillaries contain a desiccated hydrogel containing all components needed for a cell-free nucleic acid amplification other than the template nucleic acid, within the capillaries there exists a path described by the inner diameter of said capillary and said desiccated hydrogel which allows atmospheric communication between opposing apertures and through said capillaries; said capillaries are within said trench with the longitudinal axis of said capillary parallel to the longitudinal axis of said trench, said trench resists the motion of said capillaries through friction between the inner longitudinal surface of said trench and the outer longitudinal surface of said capillaries with at least one end of said capillary is capable of receiving an aqueous sample, said wax is optically transparent to at least two wavelengths of electromagnetic radiation provided by said illumination source wherein said at least two wavelengths are capable of differentiation by an optical detector, and said pan is capable of containing the wax when in a molten state.
14. The system of claim 13 wherein the wax is Paraffin wax.
15. The system of claim 13 wherein said capillaries are less than 2 min in diameter.
16. The system of claim 15 wherein said capillaries have an inner diameter of 1.1 mm.
17. The system of claim 13 wherein said pan is thermally conductive.
18. The system of claim 17 wherein said pan is aluminum.
19. The system of claim 13 wherein said pan absorbs electromagnetic radiation of at least one of said at least two wavelengths.
20. The system of claim 13 wherein said desiccated hydrogel is polymerized acrylamide and bis-acrylamide.
21. The system of claim 20 wherein said desiccated hydrogel is 4% acrylamide and 0.4% bis-acrylamide.
22. The system of claim 13 wherein said components needed for a cell free nucleic acid amplification system comprises the enzymes, substrates and primers needed for a polymerase chain reaction.
23. The system of claim 22 wherein said components needed for a cell free nucleic acid amplifications system comprises tris-sulfate, (NH.sub.4).sub.2SO.sub.4, MgCl.sub.2, all four deoxyribonucleotides, Bovine Serum Albumin, at least two primers designed to hybridize with a target nucleotide sequence, a heat stable DNA polymerase, azobis, TEMED and water.
24. The system of claim 23 wherein said components needed for a cell free nucleic acid amplifications system includes LC Green.
25. The system of claim 24 wherein said illumination means is a laser emitting light at a wavelength of 445 nm.
26. The system of claim 13 where said optical detection means is a CCD camera with a band-pass interference filter centered at 530 nm.
27. A cassette for performing interrogations for the presence of a nucleic acid within an aqueous sample comprising a pan containing within it solid wax with at least one trench on its surface; a multiplicity of capillaries with two opposing apertures; wherein said capillaries contain a desiccated hydrogel containing all components needed for a cell-free nucleic acid amplification other than the template nucleic acid, within the capillaries there exists a path described by the inner diameter of said capillary and said desiccated hydrogel which allows atmospheric communication between opposing apertures and through said capillaries; said capillaries are within said trench with the longitudinal axis of said capillary parallel to the longitudinal axis of said trench, and said trench resists the motion of said capillaries through friction between the inner longitudinal surface of said trench and the longitudinal surface of said capillaries with at least one end of said capillary is capable of receiving an aqueous sample.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
DETAILED DESCRIPTION OF THE PRESENT INVENTION
(21) The prior art has described hydrogel-based PCR systems incorporating multiparameter PCR on individual reaction units termed hydrogel posts, using mineral oil as the vapour barrier. While this proved to be a reliable strategy, the gel post chips described in the art are not readily manufacturable and the use of oil creates problems for handling of a packaged cassette. To provide a system that could be easily manufactured, the present invention provides for a cassette comprised of hydrogel in capillaries or contained in a trench defined by a supporting substrate; with each capillary or trench segment defining a hydrogel strip serving as an individual reaction unit with a specified primer set, and further desiccated as described herein or otherwise known in the art. A chosen complement of capillary reaction units with the required primer sets can be assembled in wax trenches; or the wax may be used as the supporting substrate to define a hydrogel strip as further described herein. The wax then confines capillaries in the trench, thereby enclosing them in a cassette, said cassette comprising the hydrogel strip or hydrogel within a capillary as appropriate, the wax and an enclosure with at least one side capable of providing optical communication. Capillaries or gel strips can also be assembled in trenches without the use of wax, by way of non-limiting example, through use of a viscous material to maintain the capillary or gel strip in position them in place as described herein, or in another embodiment by placing them snugly in the trench. When PCR cycling begins, the wax melts and creates a vapour barrier; said wax chosen in accordance with that described herein, specifically to be solid at expected transport temperatures, liquid at expected PCR temperatures and optically transparent to wavelengths used to monitor or detect the effects of the PCR. Advantageously when PCR is complete, the wax solidifies and allows safe disposal of used cassettes. Other ways of preventing evaporation during thermal cycling are also contemplated by the present invention, as would be known in the art. The cassette can be stored at ambient temperature and later rehydrated by raw sample. Desiccation enables rapid sample delivery, with the shrinkage of the hydrogel from the desiccation. As described herein, the drying was performed to create a channel within each capillary that allows raw sample to enter via capillary action. A given cassette can test multiple patient samples, multiple sample types, test for the presence of multiple targets, or combinations thereof; with no significant cross-contamination. Each cassette may include quality control verification through integrated positive and negative controls for each target. The desiccated reaction units are stable over time at ambient room temperature as well as at 4 C. and at 20 C., thus enabling on the shelf storage of assembled cassettes.
(22) Specifically, the novel method and apparatus described herein provides for the performance of PCR or other amplification or gene detection method in a hydrogel medium, that in one embodiment is less than 50 L in volume, in a preferred embodiment is between 10-25 L in volume and in an even more preferred embodiment is 13 L in volume, obtaining real-time data in situ by detecting the fluorescence of DNA in the presence of an intercalating dye or other means of product or amplicon detection, and further simplifying the process for administration of a sample for interrogation under PCR followed by, or concurrent with, detection methods such as MCA. By utilizing the techniques described herein, a single administration of sample for interrogation, or a number of simplified administrations, can be used for multiple interrogations; allowing a single administration step for performing concurrent sample interrogation with positive and negative controls, multiple redundant interrogations, or multiple disparate interrogations; all detecting the presence of certain nucleic acid templates within a sample.
(23) As used herein, hydrogel refers to hydrophilic polymers forming colloidal hydrogel matrixes which result in similar mobilities of the nucleic acids of sizes contemplated by the present invention as in the specifically described gels herein, by way of non-limiting example, polyacrylamide and polyvinylpyrrolidone (xPVP) cross-linked with PEG-diacrylate resulting from the photopolymerization of 3.3% vinylpyrrolidone with 0.7% Polyethyleneglycol-diacrylate.
(24) The system described herein is designed to facilitate performance of diagnostic tests in parallel on the same sample, or on multiple different samples, using different hydrogel filled reaction chambers, with a simplified sample administration process. A non-limiting example of the utility of this platform is testing of patients as they present in the clinic, or in near point of care settings as they are known in the art, rather than transport of patient samples to a distant or centralized laboratory. The ability to acquire real-time template amplification, in one embodiment by PCR, and MCA using the method and apparatus of the present invention expands the use of this technique to applications such as asymmetric PCR for mutation scanning and genotyping performed with unlabelled probes. The utility of the present invention is not confined to detection of nucleic acids within a healthcare or human health setting. It is contemplated that the present invention has utility with respect to environmental, veterinary and any other field where interrogation for the presence of nucleic acids within a sample containing water.
(25) The novel hydrogel PCR system of the present invention can perform PCR, melt curve analysis and real time quantitative PCR, with an output that compares favourably with conventional systems. It is contemplated by the present invention that both processed, and unprocessed, aqueous or partially aqueous samples may be used with the present method and apparatus, including but not limited to, serum, plasma, whole blood, sputum, mucous, aspirates, debrided tissue, scrapings, lymphatic fluid, macerated plant tissue, suspensions of fecal matter, soil samples and environmental water samples. The present invention contemplates use of methods for detecting a gene or transcript other than PCR and one skilled in the art would be aware of the variations of PCR and other gene or transcript detection systems. By performing replicate PCRs in multiple hydrogel reaction chambers, statistical data to confirm a result can be obtained. The method of the present invention can be implemented for detection in the same sample of multiple nucleic acids, mutations/polymorphisms or other genetic changes in DNA, RNA or during RNA processing as known in the art, contained within a heterogeneous nucleic acid population, or multiple organisms, pathogens, bacteria or viruses within a single sample, or can accommodate testing of multiple samples, each for more than one target template.
(26) The present invention provides a method of performing real-time PCR in hydrogels with MCA in an array of cylindrical or other shaped hydrogel-filled or self-standing hydrogel reaction chambers (for example sub-milliliter volumes per reaction chamber, such as hydrogel posts, hydrogel filled cylinders, hydrogel strips). In a preferred embodiment the PCR and post-PCR analysis of the resulting amplified nucleic acid (if any) was performed in a range of microfluidic volumes (sub-one milliliter volumes).
(27) The present invention provides a method of performing real-time PCR and MCA in a hydrogel containing all PCR reagents, save for the template, which can be made in a variety of shapes or sizes and such hydrogels desiccated, thereby reducing its volume. When a hydrogel is polymerized and desiccated inside a constrained channel space, the reduction of the hydrogel volume results in an empty space that can be used for the sample delivery through capillary forces, which serves to rehydrate the hydrogel. The capillary forces therefore simplify the application of sample for interrogation through PCR within the hydrogel.
(28) The desiccation contemplated by the present invention is not limited to any one known generally in the art. One skilled in the art will recognize that although there is a multiplicity of desiccation methods and strategies that may be used, the exact method selected should be one that maintains the integrity of the hydrogel, is non-destructive to the PCR reagents within, and will allow successful PCR following rehydration and introduction of a template. One example of a methodology is presented in U.S. Pat. No. 6,313,102.
(29) The contained channel can be formed from any number of solid substrates, and in a preferred embodiment the substrate is wax or glass, plastic, such as Poly(methyl methacrylate (PMMA), Cyclo Olefin Polymer (COP), cyclic olefin copolymer (COC), Polycarbonate (PC), Polystyrene (PS), or other thermally conductive composite polymers, metal-plastic alloys, or ceramic, forming a trench within the substrate and may optionally be covered. The solid substrate may also be formed of metal shaped to include trenches, for example aluminum or injection moldable metals. In a preferred embodiment the covering is transparent to the wavelengths of light used to perform MCA, or other means of detection of the presence or absence of a PCR product of interest. In another embodiment, an underlying substrate is established in wax, plastic such as PMMA, COP, COC, or composite polymers, glass, metal such as aluminum, upon which is placed a capillary tube formed by glass or plastic containing a desiccated hydrogel, or a strip of hydrogel containing reagents, as contemplated by the present invention. It is contemplated by the present invention that the hydrogel may be attached to the substrate or the optional covering such as a glass coverslip or clear plastic, or may form a direct adhesion to the substrate and cover, respectively below and above the hydrogel reaction chamber and as further described herein. Wax may be used to anchor reaction chambers within the substrate. A wax covering also provides a vapour barrier when it melts, as heating cycle initiates for PCR. The hydrogel containing capillary is contemplated as being in various shapes (including, but not limited to, round, oblong, square, or rectangular) and can be made with different glass types and may optionally be surrounded by a plastic cladding. Hydrogel strips without a glass or other cladding can also be formed directly in the trenches. The wax or plastic trenches used to constrain clad hydrogels and/or directly form the hydrogels (herein referred to as hydrogel strips) can be in various shapes (including but not restricted to rectangular, square, semi-oblong, or semi-circular). Each capillary or hydrogel strip can be of various lengths and heights, though the dimensions are constrained by the ability to draw sufficient fluid into the hydrogel strip or capillary through capillary forces, and as such are a function of the viscosity of the fluid, air pressure, ambient humidity, and other factors known in the art to affect capillary forces. Therefore in a preferred embodiment of the present invention the trench or capillary containing a hydrogel describes a microfluidic volume so as to reduce environmental effects on capillary forces as well as ensure sufficient capillary forces to allow introduction of the fluid to the desiccated hydrogel, with an opening that allows administration of the sample and another opening to allow displaced air to escape, thereby enabling capillary flow through the channel.
(30) With respect to the gaps established between adjacent capillaries, one skilled in the art will recognize that the extent of gap necessary to isolate adjacent capillaries, with respect to fluid communication of a hydrating sample between adjacent capillaries; or alternatively to allow fluid communication of a hydrating sample between adjacent capillaries; is a function of the ambient air pressure, viscosity of the hydrating sample, and humidity of the atmosphere surrounding the capillaries. Though a failure of hydrating sample to successfully communicate through adjacent capillaries is easily addressed by administering sample to the non-hydrating channel, reproducibility and ease of sample administration to a multiplicity of adjacent capillaries (enabling fluid communication therein) is enhanced by maintaining a separation of less than 1.5 mm, and in a preferred embodiment, no more than 1 mm with respect to a 1.1 mm diameter capillary tube. Air gaps of greater than 1.5 mm, and in a preferred embodiment greater than 3 mm, are recommended in order to isolate adjacent capillaries and prevent fluid communication. Capillaries of greater than 1.1 mm are contemplated by the present invention; though larger hydrogels require extended periods for desiccation; the only constraint is creation of a sufficient space for delivery of sample via capillary forces of a sufficient volume to rehydrate the desiccated hydrogel.
(31) The present invention contemplates an assembly of, for example, hydrogel strips or hydrogel containing capillaries to produce a diagnostic cassette (or chip) with the hydrogel strips or hydrogel containing capillaries embedded in a wax, plastic, metal, glass, ceramic, metal/wax, plastic/wax, glass/wax or plastic/metal/wax substrate and desiccated, wherein the diagnostic cassette can be stored and be ready for accepting samples and in combination with an internal or external heating and visualization system, and be capable of performing an interrogation upon a clinical sample or samples in a clinical, or other, settings. The layout of the hydrogel strips or capillaries in wax, other solid material, or wax in combination with other solid supporting substrates can be in various forms including but not limited to those resembling the petals of a flower, alignment in a row, and parallel arrangements; so long as there is a space for introduction of the sample for interrogation and a path for movement of displaced air resulting from the drawing and rehydration of the hydrogel by capillary forces. Such a path can be provided by openings at both ends of a capillary or gel strip reaction unit. It is contemplated by the present invention that rehydration of the desiccated hydrogel can be controlled through the size and air pressure of said path for displaced air resulting from the rehydration of the hydrogel. Advantageously, the chip containing, for example, the hydrogel strips or hydrogel capillaries in a wax, plastic, metal, glass, ceramic, wax/plastic, wax/plastic, or wax/plastic/metal media are capable of being manufactured using automated processes and the materials used in the manufacture are relatively inexpensive. The channels or trenches contemplated herein may be formed using hot embossing, stamps that can be made of materials such as polydimethylsiloxane (PDMS), or other methods to form metal or plastic or other materials as solid supporting substrates.
(32) Wax housing embedded or attached hydrogel strips or hydrogel capillaries can be placed in a solid supporting substrate such as an aluminum or plastic pan. A seal, for example PDMS, is used as a stamp to indent the melted wax in the pan to form impressions for placing hydrogel capillaries or forming hydrogel strips in various arrangements. Hydrogel capillaries or hydrogel strips are placed at the bottom of the solid supporting substrate such that no wax is directly touching the liquid sample above the hydrogel. This prevents the reaction chambers (e.g. hydrogel capillaries or hydrogel strips) from floating on a thin layer of wax when the wax melts. Reaction units can also be anchored to the bottom surface of the support using, for example, 40% trehalose or other sugar or a drop of monomeric PDMS, for example Sylgard 184 silicon elastomer base, Dow Corning Corporation, Midland, USA. In another embodiment, wax on both sides of the trench walls are compressed around the capillaries to anchor them after they have been placed in the trench. The fixed position of a reaction chamber enhances thermal communication with the heating element and enables precise PCR cycling and accurate imaging of fluorescence during PCR and MCA. The indentation of the wax for placing different shapes of capillaries must precisely match the width of the capillary, such that there is no extra gap between/through which the sample could otherwise flow; this prevents the fluid sample from spreading outside the immediate confines of the reaction chambers where any unabsorbed sample could facilitate components of one hydrogel moving into another. A close fit between the trench and the hydrogel reaction chambers facilitates the absorption of the entire introduced sample volume by the desiccated hydrogel with no excess fluid remaining, thereby preventing any possibility of cross contamination between reaction chambers. Among possible configurations of reaction chambers, each chamber may incorporate different primers, allowing multiple reaction chambers in close proximity to each other within a given chip or cassette assembly. Thus fluid contact between them is disadvantageous, and the presence of molten wax upon heating for the PCR, as contemplated by the repent invention, advantageously inhibiting fluid communication between reaction chambers. When multiple samples are tested on a single substrate chip or cassette holding multiple different reaction vessels, it is important to ensure that no sample mixing occurs, again emphasizing the disadvantage of having unabsorbed free fluid on/in the substrate of the chip or cassette.
(33) The hydrogel strips are made in the solid supporting substrate containing trenches which act as a mold for polymerized hydrogels, while hydrogel capillaries can be polymerized and desiccated within the trenches present in the solid supporting substrate or prepared elsewhere and later placed within the trenches. Reagent-containing hydrogels can be polymerized in wax, plastic, metal or other material used to form a mold. For hydrogel capillaries prepared elsewhere and later placed into the trenches, the hydrogel capillaries can be attached to the bottom of the trench by polymerized or dried acrylamide solution, monomeric PDMS, or dried sugar solution such as trehalose. In another embodiment, wax can be added atop the hydrogel capillaries in the trench or the wax walls can be compressed to fix them into position and to provide a vapour barrier when melted.
(34) It is contemplated by the present invention that each hydrogel capillary or hydrogel strip within a solid supporting substrate, or diagnostic chip, may have different primers for amplifying different segments of a nucleic acid which may, or may not be present within a sample for interrogation, thereby allowing detection of the presence of nucleic acids which are known to correlate to disease states, congenital or otherwise, as well as infections, or generally conditions that correlate with the presence of a given nucleic acid marker. A single diagnostic cassette can contain different hydrogel strips or hydrogel capillaries with different primers for analysing a single patient sample, multiple samples from a single patient, or multiple samples from multiple patients. Each hydrogel capillary or strip can have different primer sets for assembly in an array of reaction chambers (a chip or cassette) that together carry out simultaneous testing in parallel for multiple targets, each in a different reaction chamber but all on the same substrate. For a given chip or cassette that includes multiple trenches or their equivalent, an assembled substrate can include positive and negative controls that are simultaneously tested in parallel with the test capillaries. For example, a given set of trenches might each contain a series of test capillaries aligned next to each other or angled beside each other, as well as positive and negative controls, such that a different patient sample can be applied to each trench, or many different targets and their respective controls can be tested for a single patient sample. Sample delivery can be performed to a single hydrogel capillary at a time or to a multiplicity of hydrogel capillaries in fluid communication with a single source of fluid sample. Multiple hydrogel capillaries or hydrogel strips within a solid supporting substrate or diagnostic chip may have different primers to detect the presence of certain nucleic acids using PCR from one patient sample, or multiple alignments or arrangements to diagnose several or many patients. Positive and negative controls can be included in the same solid supporting substrate or diagnostic chip through selection of primers or PCR components present within the hydrogel strip or hydrogel capillary, as is generally known in the art.
(35) Advantageously, during the PCR hydrogel strips or hydrogel capillaries are housed within wax selected for a melting point lower than the lowest temperature used within PCR cycling and selected for optical transparency of the relevant wavelengths used for MCA; the melted wax closes the open ends of the hydrogel strips or hydrogel capillaries or enters the ends of the hydrogel capillaries establishing them as individual reaction chambers. The wax thereby acts as a barrier to stop cross contamination of among different primer sets and/or different samples analysed on the same chip as well as preventing hydrogel drying during the PCR or MCA. If housing the hydrogel strips or hydrogel capillaries in a plastic or metal or metal/plastic substrate, it may have a wax cap placed over the hydrogel strips or hydrogel capillaries such that wax, once melted, can enclose them. Microfluidic channels can be incorporated into plastic or metal substrate to hydrate multiple strips with the sample by dispensing it from one opening.
(36) When a desiccated hydrogel in a capillary is hydrated by a sample, the fluid fills around the dried gel, thereby hydrating the gel. For a sample that contains biological substances or particulates that are opaque or illumination-opaque or transmission-opaque with respect to fluorescence or illumination wavelength; by way of non-limiting example, red blood cells or other components in, for example, the blood or particulates in for example fecal suspensions or plant material; these cannot be absorbed into the hydrogel as those substances are retained in the perimeter of the inside of the capillary. These substances then act as light blockers preventing excitation light reaching the hydrogel or the fluorescent light exiting from the hydrogel resulting in low light intensities measured by the detector. Advantageously this phenomenon can be prevented through attachment of the hydrogel to the inside capillary surface during the polymerization and desiccation. With respect to the hydrogel strips of the present invention, the desiccated hydrogel is attached to the glass from the top side, allowing the sample to flow beneath as it hydrates the gel, thereby restricting optically opaque materials to the bottom of the chamber and allowing fluorescence measurements to be made on the top side. Advantageously, if the sample contains opaque substances, those substances are trapped at the bottom of the hydrogel strip or other configuration, leaving the top side of the hydrogel strip attached to the optically clear glass or other substrate. In such case, the excitation light can reach the hydrogel and the fluorescence light generated in the hydrogel can exit the hydrogel through the top side of the strip without any obstruction allowing the collection of accurate signals during the DNA amplification or the melting curve analysis.
(37) The solid supporting substrate housing the hydrogel strips or hydrogel capillaries may have channels indented into the substrate forming the hydrogel strips within the channels or the hydrogel capillaries may be placed within the channels. Walls of these channels can reduce the light bleeding from one strongly fluorescing capillary to the others proximal to it during the laser induced fluorescence, or other optically based measurements, as long as at least one optically-transparent region is present to allow transmission of illumination or fluorescence emissions to a collector. Such a solid supporting substrate can contain a higher density of hydrogel strips or hydrogel capillaries thereby allowing more reactions within a diagnostic chip. Opaque barriers may be placed between the hydrogel capillaries or hydrogel strips lanes to reduce optical bleed. Coloured wax or plastic can also be used to reduce optical bleeding between hydrogel capillaries.
(38) In one embodiment, the present invention provides for a ready-made cassette containing short glass capillaries holding desiccated acrylamide gels containing all reagents required for undertaking a PCR reaction, save for the DNA template. The cassettes are arranged in wax trenches created within metal pan, or structure capable of containing the wax and cassettes when said wax is in a molten state. Positive and negative controls are included as part of the cassette. In one non-limiting embodiment described herein, the capillaries within the cassette contain reagents for detecting four sexually transmitted infections using unprocessed aqueous specimens from a human. To increase the stability during storage of the cassettes, the hydrogel mixture inside capillaries is desiccated prior to cassette assembly and the final cassette is stored under vacuum, such as within a vacuum-packed plastic enclosure known in the art. When testing occurs, the cassette is removed from the enclosure and sample containing the templates is introduced to the desiccated hydrogel mixture by capillary action to rehydrate the capillaries.
(39) The present invention contemplates using an increase in an optical signal as an indication of the amplification of a target nucleotide sequence as a result of an amplification reaction resulting from the binding of primers selected to amplify only a target sequence. One skilled in the art will recognize that there are a multitude of technologies available to provide said optical signal, and the present invention is not intended to be limited to those described herein. In a preferred embodiment, the present invention utilizes a construct that provides an optical signal when interacting with double stranded DNA, which is absent or attenuated when said DNA is single stranded. This provides the ability to monitor the transition of DNA from double- to single-stranded and allows MCA as contemplated herein. As such, LC Green, an intercalating dye which provides an optical signal due to increased fluorescence when intercalated with dsDNA, provides such a result, though the present invention contemplates the use of any dye or marker construct, such as quantum dots; such constructs or dyes selected according to the transparency of the wax described herein to the resulting optical signal. Care must also be paid to the transparency of the wax to the wavelength of light or other electromagnetic radiation utilized to provide said optical signal. As used herein illumination means may be any source of energy or electromagnetic wave that is utilized to provide an input energy which is then transformed, attenuated, or modified by the dye or construct to provide the optical signal. Examples of illumination means include, but are not limited to, lasers, light emitting diodes, bulbs and energetic chemical bonds.
Example 1: Sample Delivery
(40) A channel with dimensions such that it contains microfluidic volumes (i.e. sub-1 mL volumes) or a microfluidic channel, can be made in wax, plastic, glass, wax/glass or wax/plastic (
(41) A PCR/hydrogel mix can be supplied to a wax channel or other type of trench as an enclosure (
Example 2: Chip or Cassette Containing Hydrogel Strips or Capillaries
(42) A diagnostic cassette can be made by indenting wax with a PDMS stamp to produce trenches for making hydrogel strips (
(43) The shape of the hydrogel strip may be controlled by altering the shape of the PDMS stamp, as the stamp produces the reverse shape within the trench. The shape of the PDMS stamp should match the shape of the capillaries such that the capillary lies snugly in the created wax or plastic trench. A plastic or metal diagnostic chip, with or without coloring to block any optical bleeding, can be made with techniques such as injection molding, heat embossing, milling or other known methods, so as to produce trenches for hydrogel strip formation or for placement of hydrogel capillaries. Different hydrogel capillaries or hydrogel strips can have different primers for testing different diseases or conditions. The glass coverslip or a clear plastic strip (
(44) Specifically, the manufacture of hydrogel strips in accordance with the present invention is as follows. As shown in
(45) As shown in
Example 3: Different Configurations of the Chip Containing Hydrogel Capillaries or Hydrogel Strips
(46) Hydrogel strips (
(47) When utilizing wax trenches to receive capillaries, as otherwise disclosed herein, the wax on opposing sides of the trench enclosing the capillary may be indented towards each other using a thin piece of metal or plastic, so as to better hold the capillary and stabilize it against motion during storage or transportation. The metal or plastic may optionally be heated so as to partially melt the wax around the capillary. In the alternative, or in addition to, application of a small amount of trehalose, linear polymer acrylamide or PDMS monomer between the capillary and the supporting surface of wax can assist in the stabilizing of the capillary reaction unit following its polymerization and drying.
(48)
(49) As an example of an alternate geometry, the cassette in
(50) Samples may further be delivered to multiple lanes within a cassette by administration of a hydrating sample to a single port. As shown in
Example 4: Separating Capillaries to Individual Amplification Chambers
(51) Once the wax is melted during the first denaturation step within the PCR process, the fluid wax enters the openings of the hydrogel strips or hydrogel capillaries, thereby separating them into individual reaction chambers and inhibiting cross-contamination between hydrogel strips or hydrogel capillaries which may contain different primers, negative and positive controls, and/or different samples (
Example 5: Preparation of Glass Capillary Tubes and Placement in Cassette
(52) Glass hemotocrit tubes (Plain, Blue TipFisher Scientific, Fair Lawn, N.J.) were cut to 6 or 7 mm in length. The inner diameter of the capillary is 1.1 mm while the outer diameter is 1.5 mm. Capillaries were heated overnight in an oven at 550 C. to remove any prior coating or treatment. In the presence of these commercial treatments to capillaries, the noodle shape of the hydrogel is not properly formed upon desiccation, or alternatively it may spoil or otherwise inhibit the PCR reaction. Therefore, it is vital to remove these coatings or treatments provided in commercially available capillaries.
(53) The steps for the preparation of hydrogel capillaries for PCR are shown in
(54) The polymerised capillaries were placed in a vacuum oven to desiccate the hydrogel, as is generally known in the art for dehydration of biologically active samples. After desiccation, capillaries hold dried hydrogel in the shape of a noodle as shown in
(55) Paraffin wax (Surgipath Paraplast X-tra, Leica Microsystems) was used to make trenches and to hold reaction units securely in place. To remove background fluorescence, melted wax was filtered at 65 C. through a glass funnel filled with Silica hydrogel 60 (Merck Millipore). One volume of Silica hydrogel filters 4-5 volumes of wax.
(56) An aluminum pan (23.5 mm32 mm) was used as the base of the cassette to contain wax and capillaries (
(57) A polymer cassette with trenches can also be used to hold capillary reaction units. In the present example, nine parallel trenches 1.6 mm in width with rounded bottoms were milled in a sheet of thermally conductive polymer (Cool Polymers Inc., North Kingstown, R.I., USA) with dimensions of 29 mm25 mm3 mm. The thickness of the polymer at the bottom of the trench is 0.4 mm. Each trench was filled with 80 L of wax prior to arranging the capillaries.
(58) Capillaries can be placed in the pan with different arrangements as shown in
Example 6: Demonstration of Nucleic Acid Detection Using Clinical Samples
(59) To demonstrate performance, raw genital swabs and urine were introduced to the same cassette to simultaneously detect four sexually transmitted infections. Herpes Simplex Viruses (HSV-1 and HSV-2) were detected from raw genital swabs. Ureaplasmd Urealyticum (UU) and Mycoplasma Homonis (MH) were detected from raw urine.
(60) Samples
(61) Genital swab samples (HSV-1 positive, HSV-2 positive, and negative controlsbased on testing using culture methods) were obtained from a clinic for sexually transmitted diseases. Genital swabs from patients were placed in universal transport media (UTM; Copan Diagnostics Inc., Murrieta, Calif., USA) at the clinic and transported to the laboratory where they were frozen at 20 C. until use. For all experiments, unprocessed genital swab samples in UTM were used directly without DNA purification. Thirty anonymized urine samples were obtained from the sexually transmitted disease clinic. Unprocessed urine samples were also used without DNA purification.
(62) Reagents
(63) Separate reaction mixes were prepared with (positive controls) or without template for HSV-1, HSV-2, MH, and UU and used to fill capillaries. The primer sets for detecting HSV-1, HSV-2, UU and MH are shown in Table 1. Each 100 pit reaction mix consisted of 20 L of 5PCR buffer (333 mM tris-sulfate, pH 8.6, 83 mM (NH.sub.4).sub.2SO.sub.4 (Sigma, St. Louis, Mo.); and 40% sucrose (Sigma)), 30 L of 40% sugar, 4 L of 50 mM MgCl.sub.2 (Fluka, Buchs), 2 L of 10 mM [dNTP] (Sigma), 2 L of 1% BSA (Sigma), 4 L of 10 M primer solution (Integrated DNA technologies, San Diego, Calif.) for each of the two primers, 10 L of 10LC Green Plus (Idaho Technology Inc., Salt Lake City, Utah) and 4 L of Taq polymerase (20 units/L), 10 L of a 40% acrylamide (Sigma) 4.4% bis-acrylamide aqueous solution (N,N-methylene bisacrylamide, BioRad, Hercules, Calif.), 2 L of 3% azobis (Wako, Richmond), 1 L of 10% TEMED (N,N,N,N tetramethylethylenediamine, Sigma) and water. For the positive controls, 4 L of sample collected from patients known to be infected was added, replacing water. The mixes were vortexed, centrifuged, and loaded into the capillaries as described below.
(64) TABLE-US-00001 TABLE1 PrimersusedforamplificationofHSV-1,HSV-2,UU andMHtargets. PrimerName Sequence(5 to3) Identifier HSV-1Forward GGGCCATTTTACGAGGAGGA SEQIDNO1 HSV-1Reverse GGAACGCACCACACAAAAGA SEQIDNO2 HSV-2Forward GTTTGGCGTGTGTCTCTGAA SEQIDNO3 HSV-2Reverse CTTTTATCCCCGGCACACAG SEQIDNO4 UUForward GGAATGACACACGATAAACCCT SEQIDNO5 UUReverse TGACAATCGCGCTTCTGTATAA SEQIDNO6 MHForward AACGTAGGTTGTACTCCGTAGA SEQIDNO7 MHReverse AAGTCGGTTTGCTAACCTCG SEQIDNO8
SampleDelivery
(65) The sample is delivered to a single capillary or a line of capillaries that are placed next to each other in the trench by dispensing the sample at one end of the trench such that the sample flows through by capillary forces and rehydrates the gels as shown in
(66) PCR and Melting Curve Analysis
(67) The instrument used for PCR and MCA is shown in
(68) The 30 anonymized urine samples were also screened by conventional PCR to identify those with UU and MH infections. The reaction mix is as above except that 2.5 L of urine was added to the 25 L reaction mix. Thermocycling conditions were similar to conventional PCR for HSVs.
(69) After the sample was introduced into the cassette, the rehydrated cassette was then placed on the peltier element of the GelCycler for thermal cycling (
(70) For testing on cassettes, the CCD images acquired during PCR and MCA were analyzed to visualize the amplification status and to detect the products in each capillary. Images taken at the extension step of each PCR cycle (35 or 40) were analyzed with ImageJ software (National Institutes of Health, U.S.) using the MicroArray Rectangular Plug-in (Dr. Robert Dougherty, OptiNav Inc., Redmond, Wash.) to plot the cycle number versus the fluorescence intensity in each capillary. Using the software, rectangles were placed around the image of each capillary in the first image, followed by automated analysis of the sequential image series to measure the fluorescence intensity of each capillary during PCR and MCA. The image recognition software acquires this data without human intervention.
(71) Melting curves were created from CCD images taken at 0.2 C. degree interval during the heating of the cassette from 70 C. to 95 C. and were analyzed to measure the melting temperature for amplicons in each capillary, as previously described (Atrazhev, A. et al Analytical Chemistry, 2010, 82, 8079; Manage, D. et al Lab on a Chip, 2012, 12, 1664). A plot of the negative derivative of this fluorescence with respect to the temperature determines the melting temperature (T.sub.m) of the PCR products.
(72) High Sensitivity Detection of HSV in Genital Swabs
(73) In order to test the sensitivity of the cassette system, PCR was performed with a dilution series of genital swabs positive for HSV-1 or HSV-2. Serial dilutions of the swab samples were made at dilution factors of 10.sup., 10.sup.2, 10.sup.3, and 10.sup.4 which were then used to hydrate the hydrogel capillaries. The cassette was arranged as shown in
(74) The absolute number of HSV copies from a genital swab is not reported routinely, and is generally not clinically meaningful.
(75) Simultaneous Testing for UU, MH, HSV-1 and HSV-2 on the Same Cassette
(76) HSV-1, HSV-2, UU and MH targets were amplified on the same cassette with genital swabs tested for HSVs and urine samples tested for mycoplasma targets (UV and MH). The capillary arrangement for a four target STI panel is shown in
(77)
Example 7: Demonstration of Long-Term Stability of Cassettes
(78) Capillaries are readily filled with hydrogel mixture and are flexible in terms of using different primer sets in assembled cassettes, with no cross-contamination as shown above and in later sections. However, for use in a clinical setting, pre-made cassettes should have a prolonged shelf life, with unprocessed samples introduced at the time of testing. The use of freshly polymerized gels is incompatible with these requirements as sample cannot be added to a capillary after polymerization. After filling capillaries with hydrogel reaction mixture, the hydrogel inside the capillaries was desiccated. Desiccated hydrogel accounts for about 15-18% of the whole capillary volume and holds a shape of a noodle inside the gel thereby creating a channel, which is essential for delivery of the sample to the capillary which rehydrates the hydrogel at the time of testing.
(79) In order to study the stability of the reagents at room temperature for long term storage, separate sets of stored cassettes were then tested after 1 week, 1.5 months, and 3 months.
(80) A set of experiments was designed to confirm that PCR reagents in desiccated capillary reaction units could still support PCR and were stable at room temperature for at least 3 months. As shown in
(81) MCA data from
(82) Based upon these observations, cassettes were pre-made and stored in vacuum-sealed bags at room temperature for at least several days before use. Air-tight sealing during storage was essential to prevent any further loss of moisture that can compromise enzyme activity. The wax pan with desiccated hydrogel capillaries placed in the trenches in different arrangements was stored in a vacuum-sealed bag as shown in
Example 8: Absence of Cross Contamination in Cassette PCR
(83) Capillaries with desiccated hydrogel noodles each containing a primer set for a different pathogen can be arranged in wax trenches such that the sample can be delivered from one end to the all of the capillaries in a given trench as shown in
(84) Cassettes having 4 trenches with four 6 mm capillaries per trench were arranged with alternate HSV-1 and HSV-2 capillaries physically adjacent to each other within the trench along which sample flows. This is shown in
(85) Experiments to evaluate cross contamination are shown in
(86)
(87) These results also confirm primer specificity and highlight the importance of MCA for the correct interpretation of fluorescence data. The amplified products from the hydrogel were extracted from capillaries and sequenced to confirm their identity. Any primer-dimers or incorrect amplification will contribute to overall fluorescence and hence influence the amplification curve, giving an incorrect C.sub.p value. For this reason, MCA is essential to confirm product identity by observing a defined melt peak at the correct T.sub.m for the expected amplicon.
Example 9: Multi-Target Screening of Samples from Multiple Patients
(88) A cassette with capillaries arranged in an aluminium pan to simultaneously detect 2 STIs in multiple patients (HSV-1 and HSV-2) is shown in
(89) The CCD image at 30th cycle of PCR is shown in
(90) A cassette with a black polymer pan is capable of testing 16 HSV raw genital swab samples is shown in
(91) Shown in
Example 10: Genomic DNA Amplification in Hydrogel Capillaries
(92) The device and system described herein, in particular in Example 6, was used to perform amplification of DNA obtained from buccal swabs of humans to detect two Single Nucleotide Polymorphisms (SNPs), rs1219648 and rs2981582, with allele specific PCR. The primers utilized are shown in Table 2. The buccal swab was dissolved in a commercial pre-treatment solution by moving it in the solution for about 10 s, the swab was then removed, and was heated at two different temperatures for total of 8 min according to the manufacturer's instructions. It was then diluted 10 and added to the capillaries.
(93) TABLE-US-00002 TABLE2 Primersusedforamplificationofrs1219648andrs2981582SNPsfrom humangenome. PrimerName Sequence(5 to3) Identifier rs1219648-Wildtype CATGGCCATCCTTGAAGACT SEQIDNO9 Reverse(rs121-WT) rs1219648-MutantReverse CATGGCCATCCTTGAAGACC SEQIDNO10 (rs121-MT) rs1219648-common ATGGCGCAGAATTACTTACA SEQIDNO11 Forward(rs121-F) rs2981582-Wildtype ATCGCCACTTAATGAACCTGTTT SEQIDNO12 Forward(rs298-WT-F) CC rs2981582-Wildtype CTCCTTCCTAAACTGTCCTGA SEQIDNO13 Reverse(rs298-WT-R) rs2981582-Mutant CGCCACTTAATGAACCTGTTTCT SEQIDNO14 Forward(rs298-MT-F) rs2981582-MutantReverse TCCTTCCTAAACTGTCCTGA SEQIDNO15 (rs298-MT-R)
(94) As shown in
Example 11: Instrument and System for Receiving Cassettes and Performing PCR and MCA
(95)
(96) In order to perform PCR and MCA in a pan with hydrogel capillaries, the prototype instrument shown in
Example 12: Comparison of Oil and Wax as a Vapour Barrier
(97) A comparison of oil and wax as vapour barriers for gel-filled capillaries was performed using HSV-1 or HSV-2 in raw genital swabs and amplified on cassettes in wax or covered in mineral oil. Template DNA was polymerized into the hydrogel along with the other reagents, using freshly filled and polymerized hydrogel in capillaries. The DNA in these capillaries was polymerized into the hydrogel while the negative controls lacked DNA template. Real-time PCR data and MCA data are shown in
(98) While particular embodiments of the present invention have been described in the foregoing, it is to be understood that other embodiments are possible within the scope of the invention and are intended to be included herein. It will be clear to any person skilled in the art that modifications of and adjustments to this invention, not shown, are possible without departing from the spirit of the invention as demonstrated through the exemplary embodiments. The invention is therefore to be considered limited solely by the scope of the appended claims.