Method for using hexenol glycosyl transferase
09957539 ยท 2018-05-01
Assignee
Inventors
Cpc classification
C12P19/18
CHEMISTRY; METALLURGY
International classification
C12P19/18
CHEMISTRY; METALLURGY
Abstract
A method for producing a hexenol glycoside using a hexenol glycosyltransferase. A transformant transformed with a gene encoding a hexenol glycosyltransferase and a method for preparing such a transformant.
Claims
1. A method for producing a hexenol glycoside, comprising: contacting an isolated, purified or extracted protein with a UDP-sugar and a hexenol molecule to cause glycosylation of the hexenol molecule and to thereby produce a hexenol glycoside; wherein the isolated, purified or extracted protein has glycosylation activity on the hexenol molecule and is selected from the group consisting of: (a) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4; (b) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4, except that no more than 1 to 24 amino acids are deleted, substituted, inserted, and/or added; and (c) a protein comprising an amino acid sequence that has 95% or more sequence identity with the amino acid sequence of SEQ ID NO: 2 or 4.
2. The method according to claim 1, wherein the UDP-sugar is a UDP-hexose.
3. The method according to claim 2, wherein the hexose of the UDP-hexose is selected from the group consisting of glucose, mannose and galactose.
4. The method according to claim 1, further comprising purifying the hexenol glycoside.
5. A method for producing a hexenol glycoside, comprising: providing a cell comprising a polynucleotide encoding a protein, wherein said cell expresses said protein, and said cell is a microorganism or a transgenic plant cell, and contacting within or outside of the cell said protein with a UDP-sugar and a hexenol molecule to cause glycosylation of the hexenol molecule and to thereby produce a hexenol glycoside, wherein said polynucleotide comprises a nucleotide sequence encoding said protein and an expression control region that controls expression of said nucleotide sequence and wherein the nucleotide sequence encoding said protein and/or the expression control region is heterologous to said cell, wherein said protein has glycosylation activity on the hexenol molecule and is selected from the group consisting of: (a) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4; (b) a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4, except that no more than 1 to 24 amino acids are deleted, substituted, inserted, and/or added; and (c) a protein comprising an amino acid sequence that has 95% or more sequence identity with the amino acid sequence of SEQ ID NO: 2 or 4.
6. The method according to claim 5, wherein the UDP-sugar is a UDP-hexose.
7. The method according to claim 6, wherein the hexose of the UDP-hexose is selected from the group consisting of glucose, mannose and galactose.
8. The method according to claim 5, further comprising purifying the hexenol glycoside.
9. The method according to claim 5, wherein the transgenic plant cell is from a transformed whole plant, a transformed plant organ, a transformed plant tissue, transformed cultured plant cells, or from a progeny plant of a transgenic whole plant whose genome comprises the polynucleotide encoding the protein having glycosylation activity on the hexenol molecule.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
BEST MODES FOR CARRYING OUT THE INVENTION
(11) The present invention will be described in more detail below. The following embodiments are illustrated to describe the present invention, and it is not intended to limit the present invention only to these embodiments. The present invention can be implemented in various modes, without departing from the spirit of the present invention.
(12) It should be noted that all publications cited herein, including prior art documents, patent gazettes and other patent documents, are incorporated herein by reference. Moreover, this specification incorporates the contents disclosed in the specification and drawings of Japanese Patent Application No. 2013-161579 (filed on Aug. 2, 2013), based on which the present application claims priority.
(13) The inventors of the present invention have elucidated, ahead of others, that specific proteins have glycosylation activity on hexenol.
(14) The amino acid sequences of the proteins identified by the inventors of the present invention and the CDS sequences of genes encoding these proteins are as shown in Table 1 below.
(15) TABLE-US-00001 TABLE 1 Amino CDS Acid Sequence Sequence (SEQ ID (SEQ ID Species Enzyme NO:) NO:) Camellia sinensis Cs_UGT_C30 1 2 (Cs) Cs_UGT_85Like_C1 3 4 Humulus lupulus Hl_UGT119 5 6 (Hl) Hl_UGT127 7 8 Hl_UGT279 9 10 Hl_UGT251 11 12 Stevia rebaudiana Sr_UGT85C2 13 14 (Sr) Sr_UGT85A5 15 16 Sr_UGT85C1 17 18 Vitaceae vitis Vv_UGT020 19 20 (Vv) Vv_UGT734 21 22 Vv_UGT744 23 24 Ipomoea batatas Ib_UGT42 25 26 (Ib) Arabidopsis thaliana At_UGT85A1 27 28 (At) At_UGT85A3 29 30 Antirrhinum majus Am_UGT207 31 32 (Am)
(16) These polynucleotides and enzymes can be obtained by procedures as described later in the Example section, known genetic engineering procedures, known synthesis procedures, etc.
(17) 1. Method for Producing a Hexenol Glycoside
(18) The present invention provides a method for producing a hexenol glycoside, which comprises the step of reacting a protein having glycosylation activity on hexenol (hereinafter referred to as the protein of the present invention) with a UDP-sugar and a hexenol molecule to cause glycosylation of the hexenol molecule.
(19) Moreover, the present invention also provides the use of the protein of the present invention in the production of hexenol glycosides.
(20) Further, the present invention also provides the protein of the present invention for use in the production of hexenol glycosides.
(21) The protein of the present invention is more specifically any one selected from the group consisting of (a) to (c) shown below:
(22) (a) a protein which consists of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32;
(23) (b) a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which has glycosylation activity on hexenol; and
(c) a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which has glycosylation activity on hexenol.
(24) In the above proteins (a) to (c), the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 is intended in some embodiment to mean the amino acid sequence shown in SEQ ID NO: 2 or 4, the amino acid sequence shown in SEQ ID NO: 6, 8, 10 or 12, the amino acid sequence shown in SEQ ID NO: 14, 16 or 18, the amino acid sequence shown in SEQ ID NO: 20, 22 or 24, the amino acid sequence shown in SEQ ID NO: 26, the amino acid sequence shown in SEQ ID NO: 28 or 30 or the amino acid sequence shown in SEQ ID NO: 32.
(25) The above protein (b) or (c) is typically a mutant of the naturally occurring polypeptide shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, although other examples include those which may be artificially obtained by site-directed mutagenesis as described in Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001, Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997, Nuc. Acids. Res., 10, 6487 (1982), Proc. Natl. Acad. Sci. USA, 79, 6409 (1982), Gene, 34, 315 (1985), Nuc. Acids. Res., 13, 4431 (1985), Proc. Natl. Acad. Sci. USA, 82, 488 (1985), etc.
(26) As used herein, the expression protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which has glycosylation activity on hexenol is intended to include proteins which consist of an amino acid sequence with deletion, substitution, insertion and/or addition of, e.g., 1 to 40 amino acid residues, 1 to 39 amino acid residues, 1 to 38 amino acid residues, 1 to 37 amino acid residues, 1 to 36 amino acid residues, 1 to 35 amino acid residues, 1 to 34 amino acid residues, 1 to 33 amino acid residues, 1 to 32 amino acid residues, 1 to 31 amino acid residues, 1 to 30 amino acid residues, 1 to 29 amino acid residues, 1 to 28 amino acid residues, 1 to 27 amino acid residues, 1 to 26 amino acid residues, 1 to 25 amino acid residues, 1 to 24 amino acid residues, 1 to 23 amino acid residues, 1 to 22 amino acid residues, 1 to 21 amino acid residues, 1 to 20 amino acid residues, 1 to 19 amino acid residues, 1 to 18 amino acid residues, 1 to 17 amino acid residues, 1 to 16 amino acid residues, 1 to 15 amino acid residues, 1 to 14 amino acid residues, 1 to 13 amino acid residues, 1 to 12 amino acid residues, 1 to 11 amino acid residues, 1 to 10 amino acid residues, 1 to 9 amino acid residues (1 to several amino acid residues), 1 to 8 amino acid residues, 1 to 7 amino acid residues, 1 to 6 amino acid residues, 1 to 5 amino acid residues, 1 to 4 amino acid residues, 1 to 3 amino acid residues, 1 to 2 amino acid residues, or a single amino acid residue in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which have glycosylation activity on hexenol. In general, a smaller number is more preferred for the above deletion, substitution, insertion and/or addition of amino acid residues.
(27) Moreover, examples of such proteins include those which have an amino acid sequence sharing a sequence identity of 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which have glycosylation activity on hexenol. In general, a larger value is more preferred for the above sequence identity.
(28) In the context of the present invention, the expression glycosylation activity on hexenol is intended to mean the ability to add a sugar included in a UDP-sugar to a hydroxy group (OH group) in hexenol serving as an aglycon (i.e., glycosylation). There is no particular limitation on the position of the hydroxy group where sugar addition occurs.
(29) Glycosylation activity on hexenol can be confirmed by reacting the protein of the present invention with a UDP-sugar and a hexenol molecule to detect a hexenol glycoside.
(30) In this case, the reaction of the protein of the present invention with a UDP-sugar and a hexenol molecule may be conducted by incubation at a temperature of 20 C. to 40 C. in a system (preferably a neutral buffer of pH 6.0 to 8.0 (e.g., sodium phosphate buffer or potassium phosphate buffer)) which contains the protein of the present invention in an amount of 1 to 500 ng (preferably 50 to 200 ng, most preferably 100 ng), a UDP-sugar (e.g., UDP-glucose) at 1 to 1000 M (preferably 100 to 700 M, most preferably 500 M) and hexenol (e.g., cis-3-hexenol) at 1 to 500 M (preferably 100 to 500 M, most preferably 250 M). Glycosylation reaction is normally completed within about 1 minute to about 12 hours.
(31) Moreover, to detect a hexenol glycoside, the above hexenol may be purified and analyzed by known procedures such as LC-MS analysis (liquid chromatography-mass spectrometry), etc. Namely, if the purified hexenol shows a glycoside peak, it can be determined that hexenol was glycosylated by the activity of the protein of the present invention.
(32) In addition, the protein of the present invention, particularly those shown below have glycosylation activity not only on hexenol, but also on geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool (
(33) (v) a protein which consists of the amino acid sequence shown in SEQ ID NO: 2;
(34) (w) a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool; and
(x) a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool.
(35) The above proteins (w) and (x) are equivalent to proteins (b) and (c) shown below, respectively:
(36) (b) a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on hexenol; and
(37) (c) a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on hexenol.
(38) Thus, the present invention also provides a method for glycosylation of any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool.
(39) In the context of the present invention, the expression glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool is intended to mean the ability to add a sugar included in a UDP-sugar to a hydroxy group (OH group) in any one or more substrates selected from the group consisting of geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool (hereinafter referred to as the substrate of the present invention) being in an aglycon state (i.e., glycosylation). There is no particular limitation on the position of the hydroxy group where sugar addition occurs.
(40) Glycosylation activity of the present invention on its substrate can be confirmed by reacting the protein of the present invention with a UDP-sugar and the substrate molecule of the present invention and detecting a hexenol glycoside.
(41) In this case, the reaction of the protein of the present invention with a UDP-sugar and the substrate molecule of the present invention may be conducted by incubation at a temperature of 20 C. to 40 C. in a system (preferably a neutral buffer of pH 6.0 to 8.0 (e.g., sodium phosphate buffer or potassium phosphate buffer)) which contains the protein of the present invention in an amount of 1 to 500 ng (preferably 50 to 200 ng, most preferably 100 ng), a UDP-sugar (e.g., UDP-glucose) at 1 to 1000 PA (preferably 100 to 700 M, most preferably 500 M) and the substrate of the present invention at 1 to 500 M (preferably 100 to 500 M, most preferably 250 M). Glycosylation reaction is normally completed within about 1 minute to about 12 hours.
(42) Moreover, to detect a glycoside of the substrate of the present invention, the above substrate may be purified and analyzed by known procedures such as LC-MS analysis (liquid chromatography-mass spectrometry), etc. Namely, if the purified substrate of the present invention shows a glycoside peak, it can be determined that the substrate of the present invention was glycosylated by the activity of the protein of the present invention.
(43) Deletion, substitution, insertion and/or addition of one or several amino acid residues in the amino acid sequence of the protein of the present invention is intended to mean that deletion, substitution, insertion and/or addition of one or several amino acid residues occurs at any one or more positions in the same sequence, and two or more of deletion, substitution, insertion and addition may occur at the same time.
(44) Examples of interchangeable amino acid residues are shown below. Amino acid residues included in the same group are interchangeable with each other. Group A: leucine, isoleucine, norleucine, valine, norvaline, alanine, 2-aminobutanoic acid, methionine, o-methylserine, t-butylglycine, t-butylalanine, cyclohexylalanine; Group B: aspartic acid, glutamic acid, isoaspartic acid, isoglutamic acid, 2-aminoadipic acid, 2-aminosuberic acid; Group C: asparagine, glutamine; Group D: lysine, arginine, ornithine, 2,4-diaminobutanoic acid, 2,3-diaminopropionic acid; Group E: proline, 3-hydroxyproline, 4-hydroxyproline; Group F: serine, threonine, homoserine; Group G: phenylalanine, tyrosine.
(45) Although the protein of the present invention may be obtained by being expressed from a polynucleotide encoding it (see the polynucleotide of the present invention described later) in appropriate host cells, it may also be prepared by chemical synthesis methods such as Fmoc method (fluorenylmethyloxycarbonyl method) and tBoc method (t-butyloxycarbonyl method). Alternatively, the protein of the present invention may also be chemically synthesized with peptide synthesizers commercially available from Advanced Automation Peptide Protein Technologies, Perkin Elmer, Protein Technologies, PerSeptive, Applied Biosystems, SHIMADZU, etc.
(46) In the context of the present invention, the term hexenol refers to hexene substituted with one or more OH groups (molecular formula: C.sub.6H.sub.12O). In this case, the hexene skeleton may be in any form, i.e., linear, branched or cyclic, preferably linear. Moreover, hexenol may have a carbon-carbon double bond at any position, although it preferably has a double bond between the carbon at the 3-position and the carbon at the 4-position. The hexene skeleton may be in either cis- or trans-configuration. In hexenol, the number of OH groups is preferably 1. Moreover, the OH group is preferably attached to the terminal carbon atom of the linear or branched hexene skeleton, more preferably attached to the terminal carbon atom of the linear hexene skeleton. Specific examples of hexenol include, but are not limited to, cis-3-hexenol (cis-3-hexen-1-ol) and trans-2-hexenol (trans-2-hexen-1-ol).
(47) In the context of the present invention, the term hexenol is used interchangeably with leaf alcohol in some cases. Specific examples of leaf alcohol include cis-3-hexenol and trans-2-hexenol (trans-2-hexen-1-ol).
(48) In the context of the present invention, benzyl alcohol is also referred to as phenylmethanol.
(49) In the context of the present invention, the term 2-phenylethanol refers to a compound which is also referred to as phenethyl alcohol, benzyl carbinol, -hydroxyethylbenzene, -phenylethyl alcohol, phenethanol, phenylethyl alcohol, -phenethyl alcohol, -phenylethanol, -phenethanol, phenylethanol, 2-phenethanol or -phenethylol.
(50) In the context of the present invention, the term UDP-sugar refers to a uridine diphosphate (UDP)-conjugated sugar, preferably a UDP-conjugated hexose (UDP-hexose). Examples include, but are not limited to, UDP-glucose, UDP-mannose and UDP-galactose. A preferred UDP-sugar is UDP-glucose.
(51) The term hexenol glycoside is intended to mean hexenol having a sugar (derived from a UDP-sugar) added to at least one or more OH groups.
(52) For example, when cis-3-hexenol is reacted with UDP-glucose in the presence of the protein of the present invention, cis-3-hexenyl monoglucoside is generated as a hexenol glycoside (see the reaction scheme shown below).
(53) ##STR00001##
(54) The method of the present invention for producing a hexenol glycoside comprises the step of reacting the protein of the present invention with a UDP-sugar and hexenol to cause glycosylation of the hexenol. The method of the present invention may further comprise the step of purifying the hexenol glycoside generated in the above step.
(55) The hexenol glycoside can be purified by known techniques such as extraction with an appropriate solvent (an aqueous solvent such as water or an organic solvent such as alcohol, ether or acetone), a gradient between an organic solvent (e.g., ethyl acetate) and water, high performance liquid chromatography (HPLC), gas chromatography, time-of-flight mass spectrometry (TOF-MS), ultra (high) performance liquid chromatography (UPLC), etc.
(56) Likewise, a glycoside of the substrate of the present invention is intended to mean the substrate of the present invention having a sugar (derived from a UDP-sugar) added to at least one or more OH groups.
(57) A method for producing a glycoside of the substrate of the present invention comprises the step of reacting the protein of the present invention with a UDP-sugar and the substrate of the present invention to cause glycosylation of the hexenol (substrate?). The method of the present invention may further comprise the step of purifying the glycoside of the substrate of the present invention generated in the above step.
(58) The glycoside of the substrate of the present invention can be purified by known techniques such as extraction with an appropriate solvent (an aqueous solvent such as water or an organic solvent such as alcohol, ether or acetone), a gradient between an organic solvent (e.g., ethyl acetate) and water, high performance liquid chromatography (HPLC), gas chromatography, time-of-flight mass spectrometry (TOF-MS), ultra (high) performance liquid chromatography (UPLC), etc.
(59) 2. Non-Human Transformant Rich in Hexenol Glycosides
(60) Hexenol glycosides may also be produced using the protein of the present invention within cells such as those of bacteria (e.g., E. coli or yeast), plants, insects, non-human mammals, etc. In this case, a polynucleotide encoding the protein of the present invention (see the polynucleotide of the present invention described later) may be introduced into host cells derived from bacteria, plants, insects, non-human mammals or the like to cause expression of the protein of the present invention, followed by reacting the protein of the present invention with UDP-sugars and hexenol present within the above cells to produce hexenol glycosides. Namely, in this embodiment, the protein of the present invention is a recombinant protein generated by being expressed from a polynucleotide sequence encoding the protein in host cells.
(61) A non-human transformant obtained by introduction of a gene encoding the protein of the present invention is expected to be rich in hexenol glycosides when compared to the wild-type counterpart.
(62) The present invention therefore provides a non-human transformant transformed with a polynucleotide of any one selected from the group consisting of (a) to (e) shown below (hereinafter referred to as the polynucleotide of the present invention) (such a transformant is hereinafter referred to as the transformant of the present invention):
(63) (a) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31;
(64) (b) a polynucleotide encoding a protein which consists of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32;
(65) (c) a polynucleotide encoding a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which has glycosylation activity on hexenol;
(d) a polynucleotide encoding a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 and which has glycosylation activity on hexenol; and
(e) a polynucleotide which is hybridizable under high stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 and which encodes a protein having glycosylation activity on hexenol.
(66) In the above polynucleotides (a) and (e), the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 is intended in some embodiment to mean the nucleotide sequence shown in SEQ ID NO: 1 or 3, the nucleotide sequence shown in SEQ ID NO: 5, 7, 9 or 11, the nucleotide sequence shown in SEQ ID NO: 13, 15 or 17, the nucleotide sequence shown in SEQ ID NO: 19, 21 or 23, the nucleotide sequence shown in SEQ ID NO: 25, the nucleotide sequence shown in SEQ ID NO: 27 or 29 or the nucleotide sequence shown in SEQ ID NO: 31.
(67) In the above polynucleotides (b) to (d), the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 is intended in some embodiment to mean the amino acid sequence shown in SEQ ID NO: 2 or 4, the amino acid sequence shown in SEQ ID NO: 6, 8, 10 or 12, the amino acid sequence shown in SEQ ID NO: 14, 16 or 18, the amino acid sequence shown in SEQ ID NO: 20, 22 or 24, the amino acid sequence shown in SEQ ID NO: 26, the amino acid sequence shown in SEQ ID NO: 28 or 30 or the amino acid sequence shown in SEQ ID NO: 32.
(68) The polynucleotide of the present invention also includes polynucleotides shown below:
(69) (f) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1;
(70) (g) a polynucleotide encoding a protein which consists of the amino acid sequence shown in SEQ ID NO: 2;
(71) (h) a polynucleotide encoding a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool;
(i) a polynucleotide encoding a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool; and
(j) a polynucleotide which is hybridizable under high stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 and which encodes a protein having glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool.
(72) As used herein, the term polynucleotide is intended to mean DNA or RNA.
(73) As used herein, the expression polynucleotide which is hybridizable under high stringent conditions is intended to mean, for example, a polynucleotide that can be obtained by means of colony hybridization, plaque hybridization, Southern hybridization or other hybridization techniques using, as a probe, the whole or a part of a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 or of a polynucleotide consisting of a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32. For hybridization, it is possible to use techniques as described in, e.g., Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001 and Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997.
(74) As used herein, the term high stringent conditions refers to, for example, but is not limited to, conditions of (1) 5SSC, 5Denhardt's solution, 0.5% SDS, 50% formamide, 50 C., (2) 0.2SSC, 0.1% SDS, 60 C., (3) 0.2SSC, 0.1% SDS, 62 C., (4) 0.2SSC, 0.1% SDS, 65 C., or (5) 0.1SSC, 0.1% SDS, 65 C. Under these conditions, it can be expected that DNA having a higher sequence identity is efficiently obtained at a higher temperature. However, the stringency of hybridization would be affected by a plurality of factors, including temperature, probe concentration, probe length, ionic strength, reaction time, salt concentration and so on. Those skilled in the art would be able to achieve the same stringency by selecting these factors as appropriate.
(75) It should be noted that if a commercially available kit is used for hybridization, an Alkphos Direct Labelling and Detection System (GE Healthcare) may be used for this purpose, by way of example. In this case, hybridization may be accomplished in accordance with the protocol attached to the kit, i.e., a membrane may be incubated overnight with a labeled probe and then washed with a primary washing buffer containing 0.1% (w/v) SDS under conditions of 55 C. to 60 C. to detect the hybridized DNA. Alternatively, if a commercially available reagent (e.g., PCR labeling mix (Roche Diagnostics)) is used for digoxigenin (DIG) labeling of a probe during probe preparation based on the whole or a part of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 or of a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, a DIG nucleic acid detection kit (Roche Diagnostics) may be used for detection of hybridization.
(76) In addition to those listed above, other hybridizable polynucleotides include DNAs sharing a sequence identity of 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more with DNA consisting of the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 or with DNA encoding the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32, as calculated by homology search software such as FASTA or BLAST using default parameters.
(77) It should be noted that the sequence identity of amino acid sequences or nucleotide sequences can be determined by using FASTA (Science 227 (4693): 1435-1441, (1985)) or the algorithm of Karlin and Altschul, BLAST (Basic Local Alignment Search Tool) (Proc. Natl. Acad. Sci. USA 872264-2268, 1990; Proc Natl Acad Sci USA 90: 5873, 1993). Based on the algorithm of BLAST, programs called blastn, blastx, blastp, tblastn and tblastx have been developed (Altschul S F, et al.: J Mol Biol 215: 403, 1990). If blastn is used for nucleotide sequence analysis, parameters may be set to, for example, score=100 and wordlength=12. Likewise, if blastp is used for amino acid sequence analysis, parameters may be set to, for example, score=50 and wordlength=3. If BLAST and Gapped BLAST programs are used, default parameters in each program may be used.
(78) The above polynucleotides according to the present invention can be obtained by known genetic engineering procedures or known synthesis procedures.
(79) The polynucleotide of the present invention is preferably introduced into a host in a state of being inserted into an appropriate expression vector.
(80) An appropriate expression vector is generally configured to comprise:
(81) (i) a promoter transcribable in host cells;
(82) (ii) the polynucleotide of the present invention ligated to the promoter; and
(83) (iii) an expression cassette comprising, as constituent elements, signals that function in the host cells for transcription termination and polyadenylation of an RNA molecule.
(84) Such an expression vector may be prepared in any manner, for example, by techniques using plasmids, phages or cosmids, etc.
(85) The actual type of vector is not limited in any way, and any vector expressible in host cells may be selected as appropriate. Namely, a promoter sequence may be selected as appropriate for the type of host cells in order to ensure expression of the polynucleotide of the present invention, and this promoter and the polynucleotide of the present invention may then be integrated into various plasmids or the like for use as expression vectors.
(86) The expression vector of the present invention contains an expression control region(s) (e.g., a promoter, a terminator and/or a replication origin), depending on the type of host into which the expression vector is to be introduced. Promoters for use in bacterial expression vectors may be commonly used promoters (e.g., trc promoter, tac promoter, lac promoter). Likewise, promoters for use in yeast include, for example, glyceraldehyde triphosphate dehydrogenase promoter, PHO5 promoter and so on, while promoters for use in filamentous fungi include, for example, amylase, trpC and so on. In addition, examples of promoters used to express a desired gene in plant cells include cauliflower mosaic virus 35S RNA promoter, rd29A gene promoter, rbcS promoter, and mac-1 promoter that is configured to have the enhancer sequence of the above cauliflower mosaic virus 35S RNA promoter at the 5-side of Agrobacterium-derived mannopine synthase promoter sequence.
(87) The expression vector preferably comprises at least one selection marker. For this purpose, drug resistance markers (hygromycine, zeocin), geneticin resistance gene (G418r), herbicide resistance gene (SurB), copper resistance gene (CUP 1) (Marin et al., Proc. Natl. Acad. Sci. USA, vol. 81, p. 337, 1984), cerulenin resistance genes (fas2m, PDR4) (Junji Inokoshi et al., Biochemistry, vol. 64, p. 660, 1992; Hussain et al., Gene, vol. 101, p. 149, 1991) and so on are available for use.
(88) Although the transformant of the present invention may be prepared (produced) in any manner, an expression vector comprising the polynucleotide of the present invention may be introduced into a host to transform the host, by way of example. Host cells used for this purpose may be of any type, and conventionally known various types of cells can be used preferably. Specific examples include bacteria such as E. coli, yeast (budding yeast Saccharomyces cerevisiae, fission yeast Schizosaccharomyces pombe) and plant cells, etc.
(89) Culture media and conditions appropriate for the above host cells are well known in the art. Moreover, the organism to be transformed may be of any type, and examples include various types of microorganisms or plants as listed above for host cells.
(90) For transformation of host cells, commonly used known techniques can be used. For example, transformation may be accomplished by, but is not limited to, electroporation (Mackenxie, D. A. et al., Appl. Environ. Microbiol., vol. 66, p. 4655-4661, 2000), particle delivery method (described in JP 2005-287403 A entitled Breeding Method of Lipid Producing Fungi), spheroplast method (Proc. Natl. Acad. Sci. USA, vol. 75, p. 1929, 1978), lithium acetate method (J. Bacteriology, vol. 153, p. 163, 1983), and other methods as described in Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual.
(91) In addition, as for standard molecular biological procedures, reference may be made to Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor Laboratory Press 2001, Methods in Yeast Genetics, A laboratory manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), etc.
(92) In one embodiment of the present invention, the transformant may be a plant transformant. The plant transformant according to this embodiment may be obtained by introducing a recombinant vector comprising the polynucleotide of the present invention into a plant such that a polypeptide encoded by this polynucleotide can be expressed.
(93) In cases where a recombinant expression vector is used, any recombinant expression vector may be used for transformation of a whole plant as long as it is a vector allowing the polynucleotide of the present invention to be expressed within the plant. Examples of such a vector include those having a promoter which drives constitutive expression of a desired polynucleotide within plant cells or those having a promoter whose activation is induced by external stimulation.
(94) Examples of a promoter which drives constitutive expression of a desired polynucleotide within plant cells include cauliflower mosaic virus 35S RNA promoter, rd29A gene promoter, rbcS promoter, mac-1 promoter, etc.
(95) Examples of a promoter whose activation is induced by external stimulation include mouse mammary tumor virus (MMTV) promoter, tetracycline-responsive promoter, metallothionein promoter and heat shock protein promoter, etc. In particular, to drive inducible expression of a desired polynucleotide within plant cells upon external stimulation, it is possible to use a stress-inducible promoter, a high temperature- or low temperature-inducible promoter, etc. Moreover, to drive expression of a desired polynucleotide specifically in a certain organ of the whole plant, it is possible to use a promoter for a gene specifically expressed in the intended organ.
(96) The plant to be transformed in the present invention is intended to mean any of a whole plant, a plant organ (e.g., leaf, petal, stem, root, seed), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, vascular bundle, palisade tissue, spongy parenchyma) or a plant cultured cell, or alternatively, various forms of plant cells (e.g., suspension cultured cells), a protoplast, a leaf section, a callus and so on. The plant used for transformation may be of any type, belonging to either monocotyledons or dicotyledons.
(97) For gene transfer into plants, transformation techniques known to those skilled in the art may be used (e.g., Agrobacterium-mediated method, gene gun method, PEG-mediated method, electroporation). For example, Agrobacterium-mediated method and direct gene transfer into plant cells are well known. In the case of using the Agrobacterium-mediated method, the constructed plant expression vector may be introduced into an appropriate Agrobacterium strain (e.g., Agrobacterium tumefaciens) and this strain may then be infected into a leaf section cultured under sterile conditions, e.g., in accordance with the leaf disk method (Hirofumi Miyauchi, Manuals for Plant Genetic Engineering (1990) pages 27-31, Kodansha Scientific Ltd., Tokyo) to thereby obtain a transgenic plant. Alternatively, it is possible to use the method of Nagel et al. (Micribiol. Lett., 67: 325 (1990)). In this method, for example, an expression vector is first introduced into Agrobacterium, and the transformed Agrobacterium is then introduced into plant cells or plant tissues as described in Plant Molecular Biology Manual (Gelvin, S. B. et al., Academic Press Publishers). As used herein, the term plant tissue also includes a callus obtainable by culturing plant cells. In cases where the Agrobacterium-mediated method is used for transformation, a binary vector (e.g., pBI121 or pPZP202) may be used.
(98) Likewise, techniques known for direct gene transfer into plant cells or plant tissues are electroporation and particle gun method. In the case of using a particle gun, a whole plant, a plant organ or a plant tissue may be used directly, or sections may be prepared therefrom before use, or protoplasts may be prepared and used. The thus prepared samples may be treated using a gene transfer device (e.g., PDS-1000 (BIO-RAD)). Although treatment conditions will vary depending on the type of plant or sample, the treatment is generally conducted at a pressure of about 450 to 2000 psi and at a distance of about 4 to 12 cm.
(99) The transformed cells or plant tissues are first selected by drug resistance such as hygromycin resistance, and then regenerated into whole plants in a standard manner. Regeneration from transformed cells into whole plants may be accomplished by techniques known to those skilled in the art as appropriate for the type of plant cells.
(100) In cases where cultured plant cells are used as a host, transformation may be accomplished by introducing a recombinant vector into the cultured cells with a gene gun or by electroporation, etc. Calli, shoots, hairy roots and the like obtained as a result of transformation may be used directly for cell culture, tissue culture or organ culture, and may also be regenerated into whole plants using conventionally known procedures for plant tissue culture, e.g., by being administered with an appropriate concentration of a plant hormone (e.g., auxin, cytokinin, gibberellin, abscisic acid, ethylene, brassinolide).
(101) Confirmation of whether or not the polynucleotide of the present invention has been introduced into a plant may be accomplished by PCR, Southern hybridization, Northern hybridization, etc. For example, DNA is prepared from a transgenic plant and DNA specific primers are designed for PCR. PCR may be performed under the same conditions as used for preparation of the above plasmid. Then, amplification products may be subjected to, e.g., agarose gel electrophoresis, polyacrylamide gel electrophoresis or capillary electrophoresis, followed by staining with ethidium bromide, SYBR Green solution, etc. If the amplification products are detected as a single band, it can be confirmed that the plant has been transformed. Alternatively, primers which have been labeled with a fluorescent dye or the like may be used in PCR to thereby detect amplification products. Further, it is also possible to use techniques in which amplification products are bound onto a solid phase (e.g., a microplate) and confirmed by fluorescence or enzymatic reaction, etc.
(102) Once a transgenic whole plant whose genome carries the polynucleotide of the present invention has been obtained, progeny plants may be obtained by sexual or asexual reproduction of the whole plant. Moreover, from such a whole plant or progeny plants thereof or clones thereof, for example, seeds, fruits, cuttings, tubers, root tubers, rootstocks, calli, protoplasts or the like may be obtained and used to achieve mass production of the whole plant. Thus, the present invention also encompasses a whole plant into which the polynucleotide of the present invention has been introduced in an expressible form, or progeny plants of the whole plant which have the same properties as the whole plant, or tissues derived from the whole plant and progeny plants thereof.
(103) In addition, transformation techniques for various plants have already been reported. Transgenic plants according to the present invention include plants of the family Solanaceae (e.g., eggplant, tomato, hot pepper, potato, tobacco, stramonium, Chinese lantern plant, petunia, calibrachoa, nierembergia), plants of the family Leguminosae (e.g., soybean, adzuki bean, peanut, kidney bean, broad bean, Bird's foot trefoil), plants of the family Rosaceae (e.g., strawberry, Japanese apricot, cherry tree, rose, blueberry, blackberry, bilberry, cassis, raspberry), plants of the family Caryophyllaceae (e.g., carnation, gypsophila), plants of the family Asteraceae (e.g., chrysanthemum, stevia, gerbera, sunflower, daisy), plants of the family Orchidaceae (e.g., orchid), plants of the family Primulaceae (e.g., cyclamen), plants of the family Gentianaceae (e.g., showy prairie gentian, gentian), plants of the family Iridaceae (e.g., freesia, iris, gladiolus), plants of the family Scrophulariaceae (e.g., snapdragon, torenia), stone crop (kalanchoe), plants of the family Liliaceae (e.g., lily, tulip), plants of the family Convolvulaceae (e.g., morning glory, ivy-leaved morning glory, moonflower, sweet potato, cypress vine, evolvulus), plants of the family Hydrangeaceae (e.g., hydrangea, deutzia), plants of the family Cucurbitaceae (e.g., bottle gourd), plants of the family Geraniaceae (e.g., pelargonium, geranium), plants of the family Oleaceae (e.g., weeping forsythia), plants of the family Vitaceae (e.g., grape), plants of the family Theaceae (e.g., Camellia sinensis, camellia, tea plant), plants of the family Gramineae (e.g., rice, barley, wheat, oat, rye, maize, foxtail millet, Japanese barnyard millet, kaoliang, sugar cane, bamboo, wild oat, finger millet, sorghum, Manchurian wild rice, job's tears, pasture grass), plants of the family Moraceae (e.g., mulberry, hop, paper mulberry, rubber tree, cannabis), plants of the family Rubiaceae (e.g., coffee tree, gardenia), plants of the family Fagaceae (e.g., oak, beech, Japanese emperor oak), plants of the family Pedaliaceae (e.g., sesame), plants of the family Rutaceae (e.g., bitter orange, Citrus junos, satsuma mandarin, Japanese pepper tree), plants of the family Brassicaceae (e.g., red cabbage, flowering cabbage, Japanese radish, Arabidopsis thaliana, Chinese colza, cabbage, broccoli, cauliflower), and plants of the family Lamiacea (e.g., salvia, perilla, lavender, skullcap).
(104) Examples of preferred plants include Camellia sinensis, hop (Humulus lupulus), sweet potato (Ipomoea batatas), snapdragon (Antirrhinum majus), stevia (Stevia rebaudiana), Arabidopsis thaliana, grape (Vitaceae vitis) and so on.
(105) The whole plant transformed with the polynucleotide of the present invention (hereinafter referred to as the plant of the present invention or the whole plant of the present invention) is rich in hexenol glycosides when compared to the wild-type counterpart.
(106) Moreover, the plant of the present invention or the whole plant of the present invention is rich in glycosides of the substrate of the present invention when compared to the wild-type counterpart.
(107) The plant of the present invention can be easily obtained as a perfect whole plant by being grown from a seed, a cuttage, a bulb or the like of the plant of the present invention.
(108) Thus, the plant of the present invention encompasses a whole plant, a plant organ (e.g., leaf, petal, stem, root, seed, bulb), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, vascular bundle, palisade tissue, spongy parenchyma) or a cultured plant cell, or alternatively, various forms of plant cells (e.g., suspension cultured cells), a protoplast, a leaf section, a callus and so on.
(109) 3. Extract of Transformant and Use Thereof
(110) In another embodiment, the present invention also provides an extract of the above transformant. Since the transformant of the present invention is rich in hexenol glycosides when compared to the wild-type counterpart, an extract of the transformant is considered to contain hexenol glycosides at high concentrations.
(111) Likewise, the transformant of the present invention is rich in glycosides of the substrate of the present invention when compared to the wild-type counterpart, and hence an extract of the transformant is considered to contain glycosides of the substrate of the present invention at high concentrations.
(112) Such an extract of the transformant of the present invention can be obtained as follows: the transformant is homogenized with, e.g., glass beads, a homogenizer or a sonicator and the resulting homogenate is centrifuged to collect the supernatant. In addition, a further extraction step may also be provided in accordance with extraction procedures for hexenol glycosides as mentioned above.
(113) The extract of the transformant of the present invention can be provided for use in, e.g., production of aromatics and/or industrial raw materials according to standard practice.
(114) In another embodiment, the present invention also provides a food, a beverage, an aromatic, a pharmaceutical preparation, an industrial raw material, and/or an aromatic cosmetic product, each containing hexenol glycosides produced by the method of the present invention. Such a food, an aromatic, a pharmaceutical preparation and/or an industrial raw material, each containing the extract of the transformant of the present invention, may be prepared in a routine manner. In this way, such a food, an aromatic, a pharmaceutical preparation and/or an industrial raw material, each containing the extract of the transformant of the present invention, contains hexenol glycosides produced by using the method of the present invention.
(115) 4. Plant Modified to Suppress the Expression of Hexenol Glycosyltransferase
(116) As to green leaf volatiles accumulated in glycosylated form within plant cells, glycosylation is inhibited when suppressing the expression of a protein endogenously occurring in plants and having glycosylation activity on hexenol. As a result, the thus modified plants will contain more volatile hexenol in non-glycosylated form and can be expected to release a stronger green aroma.
(117) The present invention therefore provides a plant modified to suppress the expression of a protein having glycosylation activity on hexenol.
(118) More specifically, such a protein having glycosylation activity on hexenol (hereinafter referred to as hexenol glycosyltransferase) is encoded by a polynucleotide of any one selected from the group consisting of (a) to (e) shown below:
(119) (a) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31;
(120) (b) a polynucleotide encoding a protein which consists of the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32;
(121) (c) a polynucleotide encoding a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 and which has glycosylation activity on hexenol;
(d) a polynucleotide encoding a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 and which has glycosylation activity on hexenol; and
(e) a polynucleotide which is hybridizable under high stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 and which encodes a protein having glycosylation activity on hexenol.
(122) The polynucleotides (a) to (e) are as defined above in the section 2. Non-human transformant rich in hexenol glycosides.
(123) In the above polynucleotides (a) and (e), the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29 or 31 is intended in some embodiment to mean the nucleotide sequence shown in SEQ ID NO: 1 or 3, the nucleotide sequence shown in SEQ ID NO: 5, 7, 9 or 11, the nucleotide sequence shown in SEQ ID NO: 13, 15 or 17, the nucleotide sequence shown in SEQ ID NO: 19, 21 or 23, the nucleotide sequence shown in SEQ ID NO: 25, the nucleotide sequence shown in SEQ ID NO: 27 or 29 or the nucleotide sequence shown in SEQ ID NO: 31.
(124) In the above polynucleotides (b) to (d), the amino acid sequence shown in SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30 or 32 is intended in some embodiment to mean the amino acid sequence shown in SEQ ID NO: 2 or 4, the amino acid sequence shown in SEQ ID NO: 6, 8, 10 or 12, the amino acid sequence shown in SEQ ID NO: 14, 16 or 18, the amino acid sequence shown in SEQ ID NO: 20, 22 or 24, the amino acid sequence shown in SEQ ID NO: 26, the amino acid sequence shown in SEQ ID NO: 28 or 30 or the amino acid sequence shown in SEQ ID NO: 32.
(125) Specific examples of means to suppress the expression of hexenol glycosyltransferase include substances capable of reducing the expression level of messenger RNA (mRNA) for this enzyme, as exemplified by low molecular compounds, hormones, proteins and nucleic acids. In one embodiment, such a substance may be a nucleic acid capable of suppressing the functions or expression of a gene encoding the above enzyme. Examples of such a nucleic acid include hairpin-shaped shRNAs (short hairpin RNAs) or double-stranded RNAs (dsRNAs) which produce siRNAs (small interfering RNAs) for RNA interference (RNAi), as well as antisense nucleic acids, decoy nucleic acids, or aptamers, etc. These inhibitory nucleic acids are able to suppress the expression of the above gene. The target gene to be inhibited which encodes hexenol glycosyltransferase consists of any one of the above polynucleotides (a) to (e), and sequence information can be obtained for each polynucleotide. In the present invention, it is possible to use, as a target region to be inhibited, not only a coding region, but also a non-coding region of the gene encoding hexenol glycosyltransferase.
(126) RNA interference (RNAi) is a multi-step process proceeding through a number of stages. First of all, dsRNA or shRNA expressed from an RNAi expression vector is recognized by Dicer and cleaved into siRNAs of 21 to 23 nucleotides. These siRNAs are then integrated into an RNAi targeting complex, which is called the RNA-induced silencing complex (RISC), and the complexes between RISC and siRNAs bind to target mRNA containing sequences complementary to the siRNA sequences and thereby cleave the mRNA. The target mRNA is cleaved in the center of its region complementary to the siRNA, finally leading to rapid degradation of the target mRNA and reduced protein expression levels. The most potent siRNA duplexes are known to be sequences of 21 nucleotides in length, each comprising a 19 bp duplex with an overhang of two uridine residues at the 3-terminal end (Elbashir S. M. et al., Genes and Dev, 15, 188-200 (2001)).
(127) In general, a target sequence on mRNA may be selected from the cDNA sequence corresponding to the mRNA sequence. However, the present invention is not limited to this region.
(128) siRNA molecules may be designed on the basis of the criteria well known in the art. For example, as a target segment in target mRNA, it is possible to select a segment covering 15 to 30 contiguous bases, preferably 19 to 25 contiguous bases, preferably starting with AA, TA, GA or CA. siRNA molecules have a GC ratio of 30% to 70%, preferably 35% to 55%. Alternatively, a target sequence for RNAi may be selected as appropriate as described in Ui-Tei K. et al. ((2004) Nucleic Acids Res. 32, 936-948).
(129) For introduction of siRNA into cells, it is possible to use, e.g., procedures in which synthesized siRNA is ligated to plasmid DNA and then introduced into cells, or procedures in which double-stranded RNA is annealed.
(130) In the present invention, shRNA may also be used for providing RNAi effect. shRNA is an RNA molecule called short hairpin RNA, which has a stem-loop structure because some single-stranded regions form complementary strands with other regions.
(131) shRNA may be designed to form a stem-loop structure as a part thereof. For example, assuming that a sequence covering a certain region is designated as sequence A, and a strand complementary to the sequence A is designated as sequence B, shRNA is designed to comprise the sequence A, a spacer and the sequence B linked in this order on a single RNA strand and to have an overall length of 45 to 60 bases. The spacer may also have any length.
(132) Although the sequence A is a sequence covering a partial region of the target gene encoding hexenol glycosyltransferase, there is no particular limitation on the target region and any region may be selected as a candidate for the target region. In addition, the sequence A has a length of 19 to 25 bases, preferably 19 to 21 bases.
(133) Further, in the present invention, microRNA may be used to inhibit the expression of hexenol glycosyltransferase. microRNA (miRNA) is an intracellular single-stranded RNA molecule having a length of about 20 to 25 bases and is a kind of ncRNA (non-coding RNA) which is considered to have the function of regulating the expression of other genes. miRNA is generated through processing upon transcription into RNA and is present as a nucleic acid capable of forming a hairpin structure which suppresses the expression of a target sequence.
(134) Since miRNA is also an inhibitory nucleic acid based on RNAi, miRNA may also be designed and synthesized in the same manner as in the case of shRNA or siRNA.
(135) Expression vectors for RNAi may be readily prepared with a commercially available DNA/RNA synthesizer (e.g., Applied Biosystems model 394) on the basis of pMuniH1 plasmid, pSINsi vector (Takara Bio Inc., Japan), pSIF1-H1 (System Biosciences, Inc.), etc. Examples of expression vectors for RNAi include, but are not limited to, pSPB1876 (WO2004/071467). Expression vectors for RNAi may be prepared by entrusting their preparation to third parties such as Cosmo Bio Co., Ltd. (Japan), Takara Bio Inc. (Japan), Invitrogen, Promega, etc.
(136) A method for producing a plant modified to suppress the expression of hexenol glycosyltransferase may comprise the following steps.
(137) (1) Step of Introducing an Expression Vector for RNAi (e.g., siRNA Expression Vector or miRNA Expression Vector) Against Hexenol Glycosyltransferase into a Host Plant or a Portion Thereof
(138) Introduction of an expression vector for RNAi into a host plant may be accomplished in the same manner as described above in the section 2. Non-human transformant rich in hexenol glycosides. The host plant may be any of a whole plant or a portion thereof, i.e., a plant organ (e.g., leaf, petal, stem, root, seed), a plant tissue (e.g., epidermis, phloem, parenchyma, xylem, vascular bundle, palisade tissue, spongy parenchyma) or a cultured plant cell, or alternatively, various forms of plant cells (e.g., suspension cultured cells), a protoplast, a leaf section, a callus and so on. The type of plant is also as described above in the section 2. Non-human transformant rich in hexenol glycosides.
(139) (2) Step of Growing the Transgenic Plant Obtained in the Above Step (1)
(140) If the host plant used in the above step (1) is a portion of a whole plant, such as a plant organ, a plant tissue, a plant cell, a protoplast, a leaf section or a callus, the resulting transformant may be grown in an appropriate environment until a perfect whole plant is formed. With respect to techniques for growing a portion of a whole plant into a perfect whole plant, reference may be made to the descriptions in the following document: Biochemistry Experiments Vol. 41, An Introduction to Plant Cell Technology, Japan Scientific Societies Press, ISBN 4-7622-1899-5.
(141) Upon cultivation of the thus obtained plant which is modified to suppress the expression of a gene for hexenol glycosyltransferase, the hexenol aglycon can be produced efficiently.
(142) In the same manner, RNA interference may be performed on polynucleotides (f) to (j) shown below to thereby prepare a whole plant rich in the substrate of the present invention in non-glycosylated form:
(143) (f) a polynucleotide containing the nucleotide sequence shown in SEQ ID NO: 1;
(144) (g) a polynucleotide encoding a protein which consists of the amino acid sequence shown in SEQ ID NO: 2;
(145) (h) a polynucleotide encoding a protein which consists of an amino acid sequence with deletion, substitution, insertion and/or addition of 1 to 40 amino acids in the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool;
(i) a polynucleotide encoding a protein which has an amino acid sequence sharing a sequence identity of 90% or more with the amino acid sequence shown in SEQ ID NO: 2 and which has glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool; and
(j) a polynucleotide which is hybridizable under high stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 1 and which encodes a protein having glycosylation activity on any one or more substrates selected from the group consisting of hexenol, geraniol, eugenol, benzyl alcohol, 2-phenylethanol and linalool.
(146) Upon cultivation of the thus obtained plant which is modified to suppress the expression of a gene for glycosyltransferase acting on the substrate of the present invention, the aglycon of the substrate of the present invention can be produced efficiently.
(147) 5. Processed Product of a Plant Modified to Suppress the Expression of a Gene for Hexenol Glycosyltransferase
(148) Today, not only natural flowers (e.g., soil-grown plants, potted plants, cut flowers), but also processed products of natural flowers are sold as products for plant appreciation. Due to their strong green aroma, plants modified to suppress the expression of a gene for hexenol glycosyltransferase or for glycosyltransferase acting on the substrate of the present invention are also very useful as materials for such processed products of natural flowers. Thus, another embodiment of the present invention is a processed product of a plant (e.g., natural flower, cut flower) modified to suppress the expression of a gene for hexenol glycosyltransferase or a portion of the plant (e.g., leaf, petal, stem, root, seed, bulb). Examples of such a processed product include, but are not limited to, pressed flowers, dried flowers, preserved flowers, material flowers, resin-embedded products, etc.
(149) 6. Extract of a Plant Modified to Suppress the Expression of Hexenol Glycosyltransferase and Use Thereof
(150) In another embodiment, the present invention also provides an extract of the above plant modified to suppress the expression of a gene for hexenol glycosyltransferase or for glycosyltransferase acting on the substrate of the present invention. Since the plant modified to suppress the expression of a gene for hexenol glycosyltransferase or for glycosyltransferase acting on the substrate of the present invention is rich in hexenol aglycon or in the aglycon of the substrate of the present invention when compared to the wild-type counterpart, an extract of the modified plant is considered to contain hexenol aglycon or the aglycon of the substrate of the present invention at high concentration.
(151) The above extract can be extracted in the same manner as described above for the extract of the transformant of the present invention.
(152) The thus obtained extract can be provided for use in, e.g., production of aromatics and/or industrial raw materials according to standard practice.
(153) In another embodiment, the present invention also provides an aromatic and/or an industrial raw material, each containing the above extract. Such an aromatic and/or an industrial raw material, each containing the above extract, may be prepared in a routine manner. In this way, such an aromatic and/or an industrial raw material, each containing the extract of the plant modified to suppress the expression of a gene for hexenol glycosyltransferase or for glycosyltransferase acting on the substrate of the present invention, contains hexenol aglycon or the aglycon of the substrate of the present invention generated by using the plant modified to suppress the expression of hexenol glycosyltransferase or glycosyltransferase acting on the substrate of the present invention.
(154) The aromatic and industrial raw material of the present invention are of the same type and composition as described above in the section 3. Extract of transformant and use thereof..fwdarw.Since the relevant detailed descriptions in Section 3. have been deleted, this sentence should also be deleted.
(155) 7. Screening Method for a Plant Rich in Hexenol Glycosides or a Plant Rich in Hexenol Aglycon
(156) The present invention provides a screening method for a plant rich in hexenol aglycon. More specifically, the above method comprises steps (1) to (3) shown below:
(157) (1) the step of extracting mRNA from a test plant;
(158) (2) the step of allowing hybridization between the above mRNA or cDNA prepared from the above mRNA and a polynucleotide which is hybridizable under high stringent conditions with a polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide of the present invention; and
(3) the step of detecting the above hybridization.
(159) The above step (1) may be accomplished by extracting mRNA from a test plant. Although mRNA may be extracted from any site of the test plant, preferred are petals. Once mRNA has been extracted, cDNA may be prepared from the mRNA through reverse transcription.
(160) The above step (2) may be accomplished as follows: a polynucleotide or oligonucleotide consisting of a nucleotide sequence complementary to the polynucleotide of the present invention is used as a probe or primer and allowed to hybridize with the mRNA extracted above under high stringent conditions. High stringent conditions are as already described above. Such a polynucleotide or oligonucleotide has a length of preferably 5 to 500 bp, more preferably 10 to 200 bp, and even more preferably 10 to 100 bp. The polynucleotide or oligonucleotide may be readily synthesized with various automatic synthesizers (e.g., AKTA oligopilot plus 10/100 (GE Healthcare)), or alternatively, its synthesis may be entrusted to a third party (e.g., Promega or Takara), etc.
(161) When the polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide of the present invention is used as a probe in the step (2), the step (3) may be accomplished by commonly used techniques for detection of hybridization, such as Southern blotting, Northern blotting (Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual 2nd Edition (1989), Cold Spring Harbor Laboratory Press), microarrays (Affymetrix; see U.S. Pat. Nos. 6,045,996, 5,925,525 and 5,858,659), TaqMan PCR (Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual 2nd Edition (1989), Cold Spring Harbor Laboratory Press), or fluorescent in situ hybridization (FISH) (Sieben V. J. et al., (2007-06). IET Nanobiotechnology 1 (3): 27-35). On the other hand, when the polynucleotide consisting of a nucleotide sequence complementary to the polynucleotide of the present invention is used as a primer in the step (2), the step (3) may be accomplished by PCR amplification and the subsequent analysis of the resulting amplification products by electrophoresis or sequencing (Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual 2nd Edition (1989), Cold Spring Harbor Laboratory Press), etc., to detect hybridization.
(162) A whole plant in which hybridization was more often detected can be regarded as expressing higher levels of a protein having glycosylation activity on hexenol compounds than other whole plants, and hence such a whole plant is predicted to be rich in hexenol glycosides.
(163) On the other hand, a whole plant in which hybridization was less often detected shows lower expression of a protein having glycosylation activity on hexenol compounds than other whole plants, and hence such a whole plant is predicted to be rich in hexenol aglycon and to release a strong green aroma.
(164) 8. Composition for Producing a Hexenol Glycoside
(165) The present invention provides a composition for producing a hexenol glycoside, which comprises the protein of the present invention and a solvent (hereinafter referred to as the composition of the present invention).
(166) The composition of the present invention may further comprise a UDP-sugar.
(167) The protein of the present invention, a hexenol glycoside and a UDP-sugar are as described above.
(168) The solvent used for this purpose is not limited in any way, but preferred is a neutral buffer of pH 6.0 to 8.0 (e.g., sodium phosphate buffer or potassium phosphate buffer).
(169) When the composition of the present invention is mixed and reacted with hexenol (and a UDP-sugar), a hexenol glycoside can be easily produced.
(170) The reaction of the protein of the present invention with a UDP-sugar and a hexenol molecule is as described above.
EXAMPLES
(171) The present invention will now be described in more detail by way of the following examples, which are not intended to limit the scope of the present invention.
Example 1 Search for Camellia sinensis-Derived Candidate Genes
(172) The molecular biological procedures used in this example are as described in Molecular Cloning (Sambrook et al., Cold Spring Harbour Laboratory Press, 2001), unless otherwise specified in detail.
(173) Since tea is known to contain glycosides of green leaf volatiles, phages (about 300,000 pfu) from the cDNA library of Camellia sinensis (cultivar Yabukita) (Non-patent Document 4) were used for comprehensive screening of glycosyltransferase genes using Arabidopsis thaliana glycosyltransferase. Fragments amplified with the Arabidopsis thaliana UGT85A3 gene specific primer set (SEQ ID NOs: 33 and 34) and UGT85A1 gene specific primer set (SEQ ID NOs: 35 and 36) were used as screening probes to conduct plaque hybridization screening.
(174) CACC-NdeI-UGT85A3-Fw (the underlined nucleotides represent an NdeI recognition site):
(175) TABLE-US-00002 (SEQIDNO:33) 5-CACCCATATGGGATCCCGTTTTGTTTC-3
XhoI-stop-UGT85A3-Rv (the underlined nucleotides represent an XhoI recognition site):
(176) TABLE-US-00003 (SEQIDNO:34) 5-CTCGAGTTACGTGTTAGGGATCTTTC-3
NdeI-AtUGT85A1-Fw (the underlined nucleotides represent an NdeI recognition site):
(177) TABLE-US-00004 (SEQIDNO:35) CACCCATATGGGATCTCAGATCATTCATAAC
BamHI-AtUGT85A1-Rv (the underlined nucleotides represent a BamHI recognition site):
(178) TABLE-US-00005 (SEQIDNO:36) GGATCCTTAATCCTGTGATTTTTGTCCCAAAAG
(179) The probes were each labeled by PCR using a non-radioisotope DIG-nucleic acid detection system (Roche Diagnostics) under the conditions recommended by the manufacturer. A PCR reaction solution used for this purpose was prepared to contain 1 l of template DNA (total cDNA from Arabidopsis thaliana), 1Taq buffer (TakaRa Bio), 0.2 mM dNTPs, primers (0.2 pmol/l each) and rTaq polymerase (1.25 U). This PCR reaction solution was reacted at 94 C. for 5 minutes, followed by 30 cycles of reaction at 94 C. for 1 minute, at 52 C. for 1 minute and at 72 C. for 2 minutes, and final treatment at 72 C. for 5 minutes. This PCR product was applied to a Mini Quick Spin column (Roche) to remove the primers and unreacted dNTPs, and the resulting product was used as a screening probe.
(180) Library screening and positive clone detection were accomplished by using a non-radioisotope DIG-nucleic acid detection system (Roche Diagnostics) in accordance with the method recommend by the manufacturer. Hybridization was conducted overnight at 37 C. in 5SSC containing 30% formamide, and the membranes were washed with 5SSC and 1% SDS at 55 C. for 20 minutes. Approximately 500,000 plaques were screened. After secondary screening, the resulting positive clones were analyzed with a DNA Sequencer model 3100 (Applied Biosystems) by primer walking with synthetic oligonucleotide primers, thus obtaining cDNA sequences. The resulting cDNA sequences were analyzed for homology using the Blastx program (blast.ncbi.nlm.nih.gov/Blast.cgi) to thereby obtain Camellia sinensis UGT genes (Cs_UGT) including Cs_UGT_C30 and Cs_UGT85like_C1.
Example 2 Expression of Camellia sinensis-Derived Candidate Genes in E. coli Cells
(181) Primers specific to these UGTs were designed and Camellia sinensis cDNA was used as a template to amplify the genes by PCR. These amplification products were each subcloned into pENTR-TOPO Directional vector (Invitrogen) in accordance with the method recommend by the manufacturer. The clones were analyzed with a DNA Sequencer model 3100 (Applied Biosystems) by primer walking with synthetic oligonucleotide primers, thus confirming that there was no PCR-induced mutation in the inserted fragments.
(182) Each Cs_UGT fragment of approximately 1.4 kb was excised by means of the NdeI and XhoI or SalI or BamHI restriction enzyme sites added to the primers, and then ligated to the NdeI and XhoI or BamHI sites of an E. coli expression vector, pET15b (Novagen), to thereby obtain an E. coli expression vector for each enzyme gene. Each vector was designed to carry the open reading frame of the Cs_UGT gene in frame with a His tag located upstream of the NdeI site so as to express a chimeric protein having the His tag fused to the N-terminal end of Cs_UGT.
Example 3 Enzyme Expression and Purification
(183) To clarify the biochemical functions of these enzymes, these enzymes were allowed to be expressed in E. coli cells. The Cs_UGT E. coli expression plasmids obtained above were each used to transform E. coli strain BL21(DE3) in a standard manner. The resulting transformants were each cultured overnight at 37 C. under shaking conditions in 4 ml of a 50 g/ml ampicillin-containing LB medium (10 g/l typtone pepton, 5 g/l yeast extract, 1 g/l NaCl). After reaching the resting phase, each cultured solution (4 ml) was inoculated into a medium of the same composition (80 ml) and cultured at 37 C. under shaking conditions. At the time point where the cell turbidity (OD600) reached about 0.5, IPTG was added at a final concentration of 0.5 mM, followed by culturing at 18 C. for 20 hours under shaking conditions.
(184) The following manipulations were all performed at 4 C. Each cultured transformant was collected by centrifugation (5,000g, 10 min) and then added to and suspended in Buffer S [20 mM HEPES buffer (pH 7.5), 20 mM imidazole, 14 mM -mercaptoethanol] at 1 ml/g cell. Subsequently, the suspension was homogenized by ultrasonication (15 sec, repeated 8 times) and then centrifuged (15,000g, 15 min). The resulting supernatant was collected as a crude enzyme solution. The crude enzyme solution was loaded onto a His SpinTrap column (GE Healthcare) which had been equilibrated with Buffer S, followed by centrifugation (70g, 30 sec). After washing with the buffer, proteins bound to the column were eluted stepwise with 5 ml each of Buffer S containing 100 mM and 500 mM imidazole. Each elution fraction was subjected to buffer replacement with 20 mM HEPES buffer (pH 7.5), 14 mM -mercaptoethanol through a Microcon YM-30 unit (Amicon) (magnification of dialysis: 1000).
(185) As a result of SDS-PAGE separation and the subsequent CBB staining or Western blotting analysis with anti-HisTag antibody, in the fraction eluted with 200 mM imidazole, a protein was confirmed at approximately 56.7 kDa, which is the putative molecular weight for the HisTag-fused Cs_UGT chimeric protein. This fraction was used for enzyme reaction.
Example 4 Enzyme Reaction and Reaction Product Analysis
(186) Standard enzyme reaction conditions are as follows. A reaction solution (2 mM UDP-glucose, 1.5 mM sugar acceptor substrate, 100 mM potassium phosphate buffer (pH 7.5), 25 l purified Cs_UGT enzyme solution) was prepared in a volume of 50 l with distilled water and reacted at 30 C. for 1 hour.
(187) The enzyme reaction solution (5 l) was analyzed by LC-MS under the following conditions.
(188) LC Conditions
(189) Column: CAPCELL PAK C18-UG120 (2.0 mm I.D.150 mm) Mobile phase: A: MilliQ water (containing 0.05% formic acid), B: acetonitrile Gradient: linear concentration gradient of B from 15% to 90% over 15 minutes Flow rate: 0.2 ml per minute Column oven: 40 C. Injection volume: 5 l
MS Conditions ESI (negative mode) SIM mode: (m/z 261, 297, 307)
(190) As a result of analysis, a product was detected around a retention time of 6 minutes in the reactions with Cs_UGT85like_C1 and Cs_UGT_C30. The same monoglucoside as the reference standard was detected (
Example 5 Analysis of Homolog Enzymes in Plant Lines Other than Camellia sinensis
(191) Since green leaf volatiles are found in a wide range of land plants, a search was conducted for UGTs causing glycosylation of green leaf volatiles derived from other plant lines on the basis of homology with the sequence of Camellia sinensis Cs_UGT_C30. Activity screening was conducted in the same manner as shown in the above Examples, indicating that the following UGTs were found to have similar activity to generate cis-3-hexenyl monoglucoside (
(192) TABLE-US-00006 TABLE 2 Source species Gene name Data Humulus lupulus Hl_UGT119 FIG. 2A: Sample 4 Hl_UGT127 FIG. 2B: Sample 5 Hl_UGT279 FIG. 2C: Sample 6 Hl_UGT251 FIG. 3A: Sample 7 Ipomoea batatas Ib_UGT42 FIG. 3B: Sample 8 Antirrhinum majus Am_UGT207 FIG. 3C: Sample 9 Stevia rebaudiana Sr_UGT85C2 FIG. 4A: Sample 10 Sr_UGT85A5 FIG. 4B: Sample 11 Sr_UGT85C1 FIG. 4C: Sample 12 Arabidopsis thaliana At_UGT85A1 FIG. 5A: Sample 13 At_UGT85A3 FIG. 5B: Sample 14 Vitaceae vitis Vv_UGT020 FIG. 6A: Sample 16 Vv_UGT734 FIG. 6B: Sample 17 Arabidopsis thaliana Vv_UGT744 FIG. 6C: Sample 18
(193) These results indicate that glycosyltransferases on green leaf volatiles have a certain correlation between their sequence and functions, and are present in a wide range of land plants.
Example 6 Analysis of Specificity for Sugar Acceptors
(194) As shown above, CsUGTC30 isolated from Camellia sinensis was found to have the ability to cause glucosylation of green leaf volatiles (GLV) typified by cis-3-hexen-1-ol (hexenol).
(195) Leaves of Camellia sinensis are known to contain not only glycosides of green leaf volatiles, but also monoterpene-based aroma components (e.g., geraniol, linalool) and aromatic-based aroma components in the form of glycosides (Non-patent Document: Wang et al., J. Agric. Food Chem. 2000, 48, 5411-5418).
(196) Next, to clarify the substrate specificity of CsUGTC30, geraniol, linalool, eugenol, benzyl alcohol, 2-phenylethanol, quercetin and cyanidin were each used as a substrate to determine the relative activity of transglucosylation with the above enzyme and under the above enzyme reaction conditions. The reaction time was set to 30 minutes at 30 C.
(197) As a result, CsUGTC30 showed the highest activity on geraniol and showed the second highest activity on eugenol and benzyl alcohol at the same level as on hexenol.
(198) CsUGTC30 was also found to have transglycosylation activity on 2-phenylethanol and linalool. In contrast, CsUGTC30 showed no transglycosylation activity on the flavonoids quercetin (flavonol) and cyanidin (anthocyanidin), which are non-aroma components (
(199) These results indicate that CsUGTC30 has the ability to cause glycosylation not only of green leaf volatiles, but also of monoterpene alcohol-based and aromatic-based aroma components.
Example 7 Analysis of Specificity for Sugar Acceptors
(200) Next, CsUGTC30 was studied for its specificity for sugar donors. For details of procedures, reference was made to the previously reported procedures (Non-patent Document 2: Noguchi et al. (2009) Plant Cell, 21: 1556-1572). Using geraniol as a sugar acceptor, 4 types of UDP-sugars, i.e., UDP-glucose, UDP-xylose, UDP-galactose and UDP-glucuronic acid were used for enzyme reaction. The reaction time was set to 30 minutes at 30 C. As a result, CsUGTC30 showed high specificity for UDP-glucose, and its specificity for UDP-galactose was 15% of that for UDP-glucose (
Example 8 Analysis of Specificity for Sugar Acceptors
(201) To clarify the expression region of CsUGTC30 responsible for glucosylation of aroma components, quantitative RT-PCR analysis was conducted in various organs. In the manner described above, total RNAs were extracted from old leaves, mature leaves, young leaves, young leaves (treated in the dark), stems, roots and flowers of Camellia sinensis (cultivar Yabukita), followed by quantitative RT-PCR in the same manner as previously reported (Non-patent Document 3: Ono et al. (2010) Plant Cell, 22: 2856-2871). For treatment in the dark, the light was shielded for 24 hours with aluminum. The specific primers for CsUGTC30 (SEQ ID NOs: 37 and 38) and the specific primers for internal standard 18S rRNA (SEQ ID NOs: 39 and 40) used here are as shown below.
(202) TABLE-US-00007 SpecificprimerforCsUGTC30(forward): qRT-Cs-30-FW2 (SEQIDNO:37) 5-TGTCCAAAGAGGCATTTTCC-3 SpecificprimerforCsUGTC30(Reverse): qRT-Cs-30-RV2 (SEQIDNO:38) 5-AAGGATGGCATGTCCTTGAG-3 Specificprimerfor18SrRNA(forward): Cs18srRNA-FW (SEQIDNO:39) 5-CAACTTTCGATGGTAGGATAGTG-3 Specificprimerfor18SrRNA(Reverse): Cs18srRNA-RV (SEQIDNO:40) 5-GGCTATAGACTCGTTGAATACATC-3
(203) As a result, CsUGTC30 was confirmed to be expressed at the highest level in young leaves (
INDUSTRIAL APPLICABILITY
(204) In food products containing various plant extracts including Camellia sinensis which is a source material for green tea, oolong tea, black tea and others, green leaf volatiles are important components determining the quality of the food products. For this reason, there is a demand for techniques to control green leaf volatiles. From a plurality of plant lines, the inventors of the present invention have now found several types of glycosyltransferases having glycosylation activity on green leaf volatiles. When using or controlling these enzymes, a green aroma can be enhanced or reduced. The present invention provides food products with modified aroma or an important tool for development of aromatics.
(205) Sequence Listing Free Text
(206) SEQ ID NOs: 33 to 40: synthetic DNAs
(207) Sequence Listing