RECOMBINANT SOLUBLE HUMAN TISSUE FACTOR, METHOD OF ITS PRODUCTION AND USES THEREOF
20180111977 · 2018-04-26
Assignee
Inventors
Cpc classification
C08L89/06
CHEMISTRY; METALLURGY
A61P7/04
HUMAN NECESSITIES
A61L24/108
HUMAN NECESSITIES
C12N2500/90
CHEMISTRY; METALLURGY
C08L89/06
CHEMISTRY; METALLURGY
A61K9/0014
HUMAN NECESSITIES
International classification
A61K9/00
HUMAN NECESSITIES
Abstract
The present invention relates to a novel recombinant soluble human Tissue Factor(RshTF), which is an extrinsic hemostasis factor, produced in human HEK-cells. The present invention also relates to a hitherto unknown method of producing the RshTF as well as specific uses of RshTF and protein compositions comprising RshTF.
Claims
1. A recombinant soluble human Tissue Factor (RshTF) comprising the SEQ ID NO: 2, wherein said recombinant soluble human Tissue Factor is produced in a human HEK293 cell.
2. The recombinant soluble human Tissue Factor according to claim 1, wherein the human HEK293 cell is selected from the group consisting human HEK293T cells, human HEK293TS cells and human HEK293E cells.
3. The recombinant soluble human Tissue Factor according to claim 1, wherein the recombinant soluble human Tissue Factor is essentially serum-free.
4. The recombinant soluble human Tissue Factor according to claim 1, wherein the recombinant soluble human Tissue Factor is glycosylated with one or more non-reducing disaccharides, preferably trehalose, and/or with one or more disaccharides consisting of sugar-alcohol combinations, preferably mannitol.
5. The recombinant soluble human Tissue Factor according to claim 1, wherein at least 90% of the recombinant soluble human Tissue Factor comprises a glycolysation pattern that results in an immunogenicity response substantially identical to that of the corresponding natural human Tissue Factor.
6. The recombinant soluble human Tissue Factor according to claim 1, wherein said recombinant soluble human Tissue Factor is part of a glue, a powder, a spray, a gel, a granulate, a gelatin, a paste, a fluid, a suture, a scaffold, a paste and/or a cream substance to which said Factor can be bound or mixed.
7. The recombinant soluble human Tissue Factor according to claim 6, wherein the powder is MPEG PLGA.
8. The recombinant soluble human Tissue Factor according to claim 6, wherein the scaffold is a haemostatic scaffold in the form of a gel, a foam, polyurethane foam, a gelatin-like substance, a collagen, a collagen-derived paste and/or a gelatin-derived paste.
9. The recombinant soluble human Tissue Factor according to claim 8, wherein the concentration of recombinant soluble human Tissue Factor on the scaffold range from 0.1 g-1000 ug per cm.sup.2 scaffold.
10. The recombinant soluble human Tissue Factor according to claim 1, wherein the recombinant soluble human Tissue Factor is in a solution in a concentration in the range from 0.1 g/ml-1000 g/ml.
11-27. (canceled)
28. Method of treating and/or preventing bleedings in humans comprising topical administration on the bleeding site in a human with a recombinant soluble human Tissue Factor according to claim 1.
29. A method of producing recombinant soluble human Tissue Factor (RshTF), said method comprising culturing in vitro a human host cell transfected with at least one exogenous nucleic acid sequence encoding said recombinant soluble human Tissue Factor, wherein the human host cell is a human HEK293 cell.
30. The method according to claim 29, wherein the human HEK293 cell is selected from the group consisting of human HEK293T cells, human HEK293E cells and human HEK293TS cells.
31. The method according to claim 29, wherein the in vitro culturing is carried out under essentially serum-free conditions.
32. The method according to claim 29, wherein the transfected human HEK cell is cultured to a cell density between 3-9 million cells/mL culture medium.
33. The method according to claim 29, wherein the recombinant soluble human Tissue Factor is essentially serum-free.
34. The method according to claim 29, wherein the exogenous nucleic acid sequence comprises SEQ ID NO: 1.
35. (canceled)
36. The method according to claim 29, wherein the human HEK293 cell is human HEK293TS cells.
37. The recombinant soluble human Tissue Factor according to claim 1, wherein the human HEK293 cell is HEK293TS cells.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025] The present invention will now be described in more detail in the following.
DETAILED DESCRIPTION OF THE INVENTION
[0026] Definitions
[0027] Prior to discussing the present invention in further details, the following terms, abbreviations and conventions will first be defined:
[0028] Injury Severity Score (ISS)
[0029] The RshTF will be tested for instance by the US Army on pigs, after a certain piglesion model, which imitates the Injury scale used among others by The US Army and by the US Armed Forces. The scale is as follows:
[0030] The Injury Severity Score (ISS) is an anatomical scoring system that provides an overall score for patients with multiple injuries. Each injury is assigned an Abbreviated Injury Scale (AIS) score and is allocated to one of six body regions (Head, Face, Chest, Abdomen, Extremities (including Pelvis), External). Only the highest AIS score in each body region is used. The 3 most severely injured body regions have their score squared and added together to produce the ISS score.
[0031] An example of the ISS calculation is shown below:
TABLE-US-00001 TABLE 1 Region Injury Description AIS Square Top Three Head & Neck Cerebral Contusion 3 9 Face No Injury 0 Chest Flail Chest 4 16 Abdomen Minor Contusion of Liver 2 25 Complex Rupture Spleen 5 Extremity Fractured femur 3 External No Injury 0 Injury Severity Score (ISS): 50
[0032] The ISS score takes values from 0 to 75. If an injury is assigned an AIS of 6 (unsurvivable injury), the ISS score is automatically assigned to 75. The ISS score is virtually the only anatomical scoring system in use and correlates linearly with mortality, morbidity, hospital stay and other measures of severity.
[0033] Thus, according to the internationally recognized ISS scoring system a bleeding having an ISS value above 15 (ISS>15) is categorized a severe bleeding.
[0034] It should be noted that embodiments and features described in the context of one of the aspects of the present invention also apply to the other aspects of the invention.
[0035] All patent and non-patent references cited in the present application, are hereby incorporated by reference in their entirety.
[0036] The Novel ProteinRshTF
[0037] The present invention relates to a novel recombinant soluble human Tissue Factor, RshTF, produced in a human cell.
[0038] In accordance to an embodiment of the present invention, RshTF, which is a human glycoprotein, is produced and glycosylated by the machinery of the human HEK-cell, preferably HEK293t host cell, without any protease or enzyme effect.
[0039] RshTF's Role in the Blood Clotting Cascade
[0040] Damage to blood vessel walls exposes Tissue Factor-containing cells from underlying cell layers to the bloodstream, but in the event of excessive bleeding, this brief exposure as well as in too small amount to connect in sufficient amount to Factor VII/VIIa to initiate a satisfactory hemostasis, and therefore, it is often not sufficient to cause the excessive bleeding to stop.
[0041] Therefore, the RshTF of the present invention is then able to bind, in the presence of calcium, to Factor VII (FVII), which circulates at low levels in the bloodstream; the calcium forms a bridge between the extrinsic RshTF of the present invention and Factor VII.
[0042] This sets off an extracellular cascade involving sequential serine protease activations: the extracellular domain of the RshTF of the present invention and FVII is activated by auto-cleavage to RshTF/FVIIa, which along with FVIIIa (cofactor) converts FIX to FIXa, which again converts FX to FXa (although TF/FVIIa can also directly convert FX to FXa), which along with FVa (cofactor) converts FII (prothrombin) to FIIa (thrombin), which converts fibrinogen to fibrin, leading to fibrin deposition and the activation of platelets to form blood clots (the activation of FXIII to FXIIIa stabilizes the fibrin clot by cross-linking it) (see
[0043] So, the RshTF of the present invention interacts with Factor VII/VIIa and the activation of zymogen (intrinsic factors) which converts to proteases and via the chain of protease, Factor II (prothrormbin) is converted to Factor Ha (thrombin), which convert Factor I (fibrinogen) to fibrin.
[0044] Thus, the RshTF of the present invention has proven to bind to Factor VII/VIIa to form RshTF:VII/VIIa complex that, again, has proven to be capable of activating FXa resulting in activating of Factor II (prothrombin) to Factor IIa, thrombin.
[0045] RshTF for Use in Treatment and/or Prevention of Bleedings (Hemostasis)
[0046] In addition, the present invention relates to RshTF and RshTF comprising protein composition for use in treatment and/or prevention of bleedings (hemostasis).
[0047] RshTF according to the present invention is capable of creating hemostasis, making it possible to be used for a wide range of bleedings. For instance first aid personnel may use the RshTF or RshTF comprising protein composition of the present invention impregnated on a scaffold in a Medipack and could be used by military personnel who cannot bring autolytic products such as thrombin with them because thrombin itself decays within hours to few days without being deep frozen, and is therefore unpractical for use of first aid personnel.
[0048] The RshTF or a RshTF comprising protein composition of the present invention can, by applying suitable carriers or support materials, such as haemostatic scaffolds, activate the intrinsic system during serious trauma cases with serious excessive bleedings, when applied locally to the bleeding area, on a carrier or scaffold that can be brought into close contact with the bleeding area.
[0049] In an embodiment it may be needed to co-administer Factor VIIa concurrently with the topical application on the bleeding site of the RshTF or a RshTF comprising protein composition of the present invention.
[0050] In another embodiment it might be desirable to topically administer the RshTF or a RshTF comprising protein composition of the present invention together with soluble fibrinogen as a co-administration.
[0051] In still another embodiment it might be desirable to topically administer the RshTF or a RshTF comprising protein composition of the present invention concomitantly with one or more systemic administration(s) of Factor VII and/or Factor VIIa.
[0052] In still another embodiment it might be desirable to topically administer the RshTF or a RshTF comprising protein composition of the present invention concomitantly with adding collagen to the bleeding site.
[0053] The RshTF or a RshTF comprising protein composition of the present invention can also be used during surgery in vascular areas of the body, where the RshTF or a RshTF comprising protein composition, with or without carrier or on scaffold, alternatively mixed with certain type of powder or PEG composites, can be brought to the bleeding zone, and induce hemostasis. The thromboelastrography experiments carried out in connection to the present invention indicates that the RshTF of the present invention can be used to stop bleedings during surgery, for instance during vascular surgery, cardiovascular surgery or even in treatment and/or prevention of haemophilia.
[0054] Method of Producing RshTF
[0055] RshTF of the present invention constitutes as an important part of the Tissue Factor, the extracellular domain of the Tissue Factor, which is not an enzyme but a relatively stable glycoprotein with three glycosylation areas, which means that it is of great importance in what cell system the coding region for this part of the Tissue Factor together with its expression vector is used.
[0056] Because the transfected host cell decides what glycosylation the translated glycoprotein will show, and especially in cases where there is more than one glycosylation, Tissue Factor is extremely dependent on which host cell system is used. When the resulting protein, such as RshTF, is for use in humans, the most optimal host cells for producing said protein would of course be human cells, the machinery of which will result in human glycosylation, important for its biological function in humans as well as the important to evade any immune reaction against the glycosylated part of the recombinant protein, such as RshTF.
[0057] Thus, the RshTF of the present invention is produced by transfection into human cell lines, such as HEKcells, preferably HEK293t cell lines, and expressed in considerable amount easy to purify.
[0058] Due to the fact that the RshTF of the present invention is a glycoprotein and not an enzyme or a protease it is already known to be significantly more stable than any of the other intrinsic factors such as for instance thrombin which is an unstable serine protease that converts soluble fibrinogen to insoluble fibrin.
[0059] In light of this, the inventors constructed an expression vector and linearized it to transfect HEK293T cells. After the transfection, stable cell lines which were growing in the presence of zeocin (a broad-spectrum antibiotic that is effective against most bacteria) were selected. The stable cell lines were adapted to grow in serum-free and suspension culture, and produced 30-40 mg/L RshTF of the present invention.
[0060] Because of the stability of the RshTF of the present invention when dried either as lyophilized or in an air dried, meaning with a minimum of solvent for instance a buffer and/or water at a low ppm, meaning minor humidity, or as a solvent, the RshTF can be buffer processed to a phosphate buffered saline (PBS) at a pH range for instance between pH 7.2-7.5 using Ultra 15 (MWCO 10 kDa, Millipore) according to the manufacturer's manual and sterilized through a 0.2 um filter. Its concentration can be measured by Agilent 8543 UV/vis spectrophotometer.
[0061] The RshTF produced by the method of the present invention may be less heterogenic, but on the contrary, more homogenous, enabling a better consistency in the final protein product, more reproducible from lot to lot, functionally more active and less immunogenic due to the lesser difference in the sugar molecules, which otherwise may be obtained in cells such as insect cells or CHO-cells. At the same time, the final product will also be virus free and free of pathologic prions.
[0062] The host cells, i.e. human HEK-cells, used in the method according to the present invention allows for a stable and high yield expression of RshTF. Said cells may be grown in suspension under serum-free conditions to high densities in different types of bioreactors.
[0063] Mammalian cells, such as human HEK-cells, are generally cultured in commercially available serum-containing or serum-free media. Selection of a medium appropriate for the particular cell line used is within the level of ordinary skill in the art.
[0064] Serum-free culture medium for HEK-cell cultures or cells lines and their suitable growth and expression media may be used to further improve protein production yields.
[0065] In an embodiment of the present invention the human host cell may be cultured to a cell density of above 10.sup.3 cells per ml. Traditionally used HEK-cells may grow to cell densities of at the most 10.sup.3 cells per ml. It is therefore indeed surprising that the subtypes of HEK 293 cells may grow to densities as high as 10.sup.9 in suspension under serum-free conditions.
[0066] Thus, in an embodiment of the present invention the human host cell may be cultured to a cell density of above 10.sup.3 cells per ml, such as above 10.sup.4 cells per ml, e.g. above 10.sup.5 cells per ml, such as above 10.sup.6 cells per ml, e.g. above 10.sup.7 cells per ml, such as above 10.sup.8 cells per ml, e.g. above 10.sup.9 cells per ml, e.g. above 10.sup.9 cells per ml, the cell count of which may be further improved, and thereby have a pronounced influence on the yield of protein produced.
[0067] The method of purifying the resulting RshTF may be selected from the group consisting of affinity chromatography, ion-exchange chromatography, gel chromatography and any combination thereof. The chromatography may be 2-step chromatography.
[0068] In an embodiment of the present invention substantially no synthetic protease inhibitor(s) may need to be added according to the method of the present invention. If synthetic protease inhibitor(s) are added, this is in very small amounts, and to the crude harvested medium comprising the coagulation factor.
[0069] Method of Producing RshTFThe Importance of a Correct Glycosylation Pattern
[0070] In general, the glycosylation of recombinant proteins produced in transfected cells is inherently derived from the cells in which the recombinant protein is produced. Most proteins undergo post-translational modification (PTM), which can alter their physical and chemical properties, e.g., MW, pI, folding, stability, and biological activity. Glycosylation is the most widely found PTM, with estimations that 80% of all plasma proteins are glycosylated.
[0071] Glycosylation is not under direct genetic control, but is dependent on the availability and activity of the various glycosyltransferases, monosaccharides and precursors. Glycosylation of recombinant proteins is dependent on the machinery of the cell line in which they are made.
[0072] Thus, the RshTF of the present invention is an extracellular transmembrane glycoprotein which is produced in transfected human cell cultures, i.e. human HEK-cells, Thus, the RshTF of the present invention is also adapting the humanized glycosylation of the RshTF which optimizes its use in humans without causing allergic reactions due to the content of xenogeneic material or xenogeneic glycosylation, which often leads to allergic reaction, for instance when instead of human cells, transfected animal cells are such as Chinese Hamster Ovarian (CHO) or Baby Hamster Kidney cells).
[0073] Thus, there are considerable advantages of using the method of the invention when producing RshTF, and especially when producing RshTF from the extracellular domain (SEQ ID NO: 2) as shown in
[0074] The RshTF of the present invention is generally produced by transfecting a vector (plasmid) containing at least one cDNA sequence expressing the recombinant Tissue Factor, into host cell, preferably HEK-cells.
[0075] These HEK-cells may be sublines of HEK cells such as HEK 293, HEK293T, HEK293E, HEK293 EBNA or PER-C6 cells.
[0076] The RshTF-encoding nucleotide sequence (when cloned into a suitable vector) can advantageously be transfected into any of the above-mentioned HEK-cell lines.
[0077] Producing RshTF according to the present invention in human HEK-cell lines is particularly advantageous when compared to the conventional techniques of using transfected non-human cell line, such as animal derived cell lines, such as those that have been used for years, such as BHK- and CHO-cells or even less useable in regards to this invention are Human Recombinant Tissue Factor produced in E. Coli.
[0078] Because of the heavy glycosylated protein that the RshTF according to the present invention contains in its extracellular domain, it is an advantage that the transfected cell and expression vector system results in the correct human glycosylation both for the sake of the biological behaviour, but also to avoid immune reaction against a foreign, non-human glycosylation pattern when used in man.
[0079] Posttranslational modification performed in human cells, influence several physical properties and chemical properties such as glycosylation, phosphorylation, carbocylation, palmitoylation, and neuraminoglycosilation, etc. are of significant importance for the properties of the coagulation factor.
[0080] In one embodiment, the RshTF of the present invention is glycosylated with one or more non-reducing disaccharides, preferably trehalose, and/or with one or more disaccharides consisting of sugar-alcohol combinations, preferably mannitol.
[0081] In another embodiment, the RshTF of the present invention comprises a glycosylation patterns which is substantially identical to that of the corresponding natural human Tissue Factor.
[0082] In still another embodiment, at least 90% of the RshTF of the present invention comprises a glycolysation pattern that results in an immunogenicity response substantially identical to that of the corresponding natural human Tissue Factor.
[0083] In still other embodiments, at least 90% of the RshTF of the present invention comprises a glycolysation pattern that results in an immunogenicity response substantially identical to that of the corresponding natural human Tissue Factor, such as at least 91%, at least 92%, least 93%, at least 94%, least 95%, at least 96%, least 97%, at least 98%, least 99%, or 100%, e.g. in the range from 90-100%, such as in the range from 92-99%, such as in the range from 93-98%, such as in the range from 94-97%, such as in the range from 95-96%.
[0084] RshTF Formulationse.g. RshTF Impregnated and/or Coated on Scaffolds
[0085] The concentration of RshTF or RshTF comprising protein composition of the present invention for instance impregnated and/or coated on scaffolds is based on results that the inventors found capable of causing blood-clotting effect in a reproducible manner.
[0086] When present on a scaffold according to the present invention the concentration of RshTF or RshTF comprising protein composition is in the range from: 0.1 g-1000 ug per cm.sup.2 scaffold, preferably 0.2 g-500 ug per cm.sup.2 scaffold, more preferably 0.3 g-250 ug per cm.sup.2 scaffold, still more preferably 0.4 g-100 ug per cm.sup.2 scaffold, still more preferably 0.5 g-50 ug per cm.sup.2 scaffold, most preferably 1 g-25 ug per cm.sup.2 scaffold.
[0087] When present as a solution, the concentration of RshTF or RshTF comprising protein composition is in the range from: 0.1 g/ml-1000 g/ml, preferably 0.2 g/ml-500 g/ml, more preferably 0.3 g/ml-250 g/ml 0.1 g/ml-1000 g/ml most preferably 2.5 g/ml-25 g/ml.
[0088] In a particularly preferred embodiment the concentration of RshTF in solution is in the range from: 2.5 g/ml.
[0089] The concentrations of RshTF or RshTF comprising protein composition on the scaffold depend on the type of scaffold used and whether it will be coated for instance by electro-spraying to scaffolds such as non-resorbable Biatain (Coloplast) or on resorbable gelatin-like scaffolds, or collagen scaffolds, which in this last scaffold in itself can produce some mechanical or physical hemostasis.
[0090] Kit-of-Parts: RshTF or RshTF-Containing Protein Compositions used on e.g. a Haemostatic Scaffold
[0091] The RshTF of the present invention constitutes as an important part of the Tissue Factor, namely the extracellular domain of the Tissue Factor, which is not an enzyme but a relatively stable glycoprotein with three glycosylation areas.
[0092] Instead of using the unstable thrombin as the clotting agent during bleedings, the much more stable RshTF of the present invention, being a novel and reproducible inducer of blood clotting, which is extremely temperature tolerant due to the fact that extracellular part RshTF is very stable, can advantageously be used to quickly and efficiently to treat bleedings in for example a bleeding soldier or patient.
[0093] In particular, because of RshTF's binding with an intrinsic factor such as Factor VII/Factor VIIa to form the RshTF:FVII and/or RshTF:FVIIa complexes, which in turn enables this complex/combination to activate Factor X (and Factor X via Factor I X), it would be desirable to impregnate and/or coat for example a haemostatic scaffold with RshTF or protein compositions comprising for example RshTF:FVII and/or RshTF:FVIIa complexes.
[0094] Thus, as the RshTF of the present invention is produced as a stable recombinant human glycoprotein, it withstands temperatures significantly better than unstable (labile) intrinsic factors complying much more to what is needed in for example the (battle) field where a clotting protein shall withstand wide range of temperatures.
[0095] It is extremely difficult to handle traditional blood clotting products, e.g. in a battlefield where such products typically are carried on/by individuals (such as soldiers in combat, emergency vehicles of any kind).
[0096] Thus, in order to provide an easy, quick and safe way of stopping bleedings in for example a bleeding victim or patient, it would be of great importance if for example RshTF or RshTF:FVII and/or RshTF:FVIIa complexes is/are already coated, impregnated or otherwise on the hemostatic carrier (scaffold or alike).
[0097] Such products shall for instance when soldiers are in combat be carried in Medipacks and shall be able to withstand harsh conditions and tolerate ambient temperatures, preferably from zero often up to 37 C. without losing its activity.
[0098] RshTF or RshTF comprising protein composition of the present invention can be readily coated and/or impregnated onto many types of scaffolds in milligram amounts and carried in for example sealed aluminum foil, easy to tear open and bring in contact with the bleeding with moderate pressure, where it, when applied to the bleeding under pressure will by its binding capacity to intrinsic factors such as Factor VIIa to form RshTF:Factor VIIa start the clotting effect or hemostasis within 7 (seven) minutes.
[0099] Thus, because of the stability of the RshTF of the present invention and/or protein composition based thereon when dried, after having been coated onto a scaffold, it can be carried with medical personnel as for instance first aid personnel and can be carried as a scaffold in a medipack and could be used by military personnel who can not bring autolytic products such as thrombin with them because thrombin itself decays within hours to few days without being deep frozen, and is therefore unpractical for use of first aid personnel.
[0100] The RshTF or RshTF comprising protein composition of the present invention can be applied alone or together with various carriers and/or stabilisators to a bleeding area, and may bind to zymogen or intrinsic Factor VIIa to form a soluble RshTF:Factor VIIa.
[0101] Since the product is essentially serum free it is possible to carry the products in a e.g. a medipack.
[0102] A kit-of-parts could contain both RshTF or RshTF comprising protein composition of the present invention, which can be mixed after having been titrated and will most probably be in the area of micrograms to mg/cm.sup.2 scaffold, e.g. after being dissolved with highly purified recombinant prothrombin or recombinant preprothrombin at an amount of 140 IU/cm scaffold (or recombinant prethrombin).
[0103] In addition, in said kit-of-parts RshTF or RshTF comprising protein composition of the present invention either alone or in combination with recombinant prothrombin, recombinant preprothrombin or recombinant prothrombin can be added to a carrier as for instance biatain (Coloplast) or MPEG PLGA (Coloplast).
[0104] In another embodiment, in the case of MPEG-PLGA scaffolds, such a scaffold could be mixed with a paste that can be applied a cream applied directly on bleedings known in the art as sieving of blood from e.g. a surgical area.
[0105] Unlike thrombin the RshTF or RshTF comprising protein composition of the present invention have several month of stability especially if the recombinant proteins are dried after being coated to the synthetic membrane or other membranes and can be stored most probably up to between 0.5 to 1 year, e.g. when packed as a kit.
[0106] The scaffold comprising RshTF or RshTF comprising protein composition of the present invention can be applied to the bleeding area, by adding some pressure to facilitate hemostasis. The hemostasis is effected by the mixing of RshTF or RshTF comprising protein with endogenous clotting factors such as Factor VII/VIIa, which through Factor IX activates Factor X to Factor Xa.
[0107] In an embodiment, the RshTF or RshTF comprising protein composition of the present invention may be in form of a powder (such as but not limited to MPEG PLGA+CaCl.sub.2), a gel or present in a scaffold.
[0108] In a further embodiment, such a scaffold may e.g. be Biatain, which is polyurethane foam, or alternative as collagen or gelatin derived paste, that can be applied in using various application methods including via a syringe system or spray system.
[0109] An embodiment of the invention pertains to a kit-of-parts comprising: [0110] (i) A scaffold which may e.g. be Biatain, which is polyurethane foam, or alternative as collagen or gelatin derived paste, that can be applied in using various application methods including via a syringe system or spray system, comprising the RshTF or RshTF comprising protein composition of the present invention.
[0111] Another embodiment pertains to a kit-of-parts comprising: [0112] (i) A gel or granulate or a gelatin, or a paste comprising the RshTF or RshTF comprising protein composition of the present invention.
[0113] Another embodiment pertains to a kit-of-parts comprising: [0114] (i) a scaffold comprising the RshTF or RshTF comprising protein composition of the present invention and [0115] (ii) recombinant prothrombin (or preprothrombin)
[0116] Another embodiment pertains to a kit-of-parts comprising: [0117] (i) a gel or granulate or a gelatin comprising RshTF or RshTF comprising protein composition of the present invention and [0118] (ii) recombinant prothrombin (preprothrombin)
[0119] Also envisaged is a IA RshTF Kit prepared as a prophylactic kit, capable of securing hemostasis, after the surgeon has completed the surgery, but is unsure of, whether post operative bleeding may occur. This is also be envisioned to happen, when a dentist or a dental surgeon needs postoperative security for bleeding.
[0120] This so-called Prophylactic hemostasis Kit will ensure that the bleedings or sieving of bleedings, that relatively often happens in the postoperative phase, can be treated by applying a prophylactic combination of RshTF or RshTF comprising protein composition of the present invention for instance in a paste, added to another area, where the surgeon may anticipate a postoperative bleeding, so instead of using application of kits combining thrombin and fibrinogen (such as Baxter's Tiseel glue), where one could have a spray or a paste to apply to an area, that may be expected to be capable of causing post operative bleedings.
[0121] For instance during orthopaedic surgery in bone structures, where it is extremely difficult to apply suturing, a paste or a spray containing RshTF or RshTF comprising protein composition of the present invention can be applied, when the surgeon is closing the operated area, and has to rely on the fact that everything has been done to avoid postoperative bleedings. Likewise, neurosurgeons and dentists are often in need of such products.
[0122] The same is true for cardiovascular surgeons. In such cases, it is not sufficient at all to apply thrombin in such prophylactic kit; and there is often no need to use combinations of thrombin and fibrinogen mix, such as Tiseel glue, etc. where one instead can apply a glycoprotein such as RshTF in a carrier such as paste, foam, or may be even thin layers of membrane's coated with RshTF or RshTF comprising protein composition of the present invention.
[0123] In another aspect of the invention, it is anticipated that RshTF or RshTF comprising protein composition of the present invention can be mixed with either prothrombin and/or thrombin (of the type of thrombin that HumaCell (Soon Jeong, HumanCell, Naperville, Ill., USA) as this may improve the stability when compared to all other types of recombinant human thrombin.
[0124] One or more of these improved recombinant intrinsic factors, which is proprietary to HumanCell, could accelerate the clotting or hemostasis effect to in the area of seconds (e.g., 12-200 seconds), where it is anticipated that even though when RshTF is applied in vivo in animals or humans (topical application), the clotting time may shortenalso when using a scaffold such as special types of collagen, membranes, or paste, in which RshTF or RshTF comprising protein composition of the present invention can be mixed from the factory, and distributed for instance with minimal humidity or even when filled into a sealed bag, using N.sub.2 gas during filling to obtain as low humidity as possible, or even by adding humidity absorbing salts.
[0125] The ideal matrix for hemostatic treatment has to be capable of adhering to any mammal tissue surfaces including bleeding surfaces to prevent bleeding during e.g. surgery and to conserve the patient's own blood volume, or at least minimize the necessity for the usage of natural blood products on the patient. RshTF or RshTF comprising protein composition of the present invention in a kit with or without added recombinant prothrombin or prothrombin, added to a bleeding surface will form a clot and work as a hemostatic.
[0126] In an embodiment, the scaffold may be selected from the group consisting of a dressing, a patch, a sponge, such as Tacosil, Hema-Seal, Biatain, MPEG-PLGA , Aseed, Spongostan and Surgifoamm Surgiflo, other gelatin like products or collagen type products, from for example of porcine origin.
[0127] In a further embodiment, the scaffold matrix can also constitute a paste, which can be distributed over a blood sieving area, in which it is difficult or impossible to place sutures, then the paste can be covering the area, where the surgeon has performed his surgery on the patient, and then work as a haemostat product after surgery has been completed, and in this manner the surgeon can ensure him/her self, that if sieve bleeding should occur after he/she has closed the layers over the surgical field. The past containing RshTF or RshTF comprising protein composition of the present invention will just stay there most probably for some time (minutes to hours) before resorption, and if bleeding should start after the fact that the surgeon has closed the area and found that it is not bleeding, any bleeding occurring afterwards, for instance in relative close connection to the postoperative period (minutes to hours), the RshTF or RshTF comprising protein composition of the present invention will do nothing before, the patient might start bleeding again postoperatively, and the intrinsic factors via Factor VII /VIIa will then form activation of Factor IX and/or Factor X, and thrombin conversion will occur and clotting be the result.
[0128] This prophylactic treatment makes use of RshTF or RshTF comprising protein composition of the present invention embedded in a carrier placed on the operation area, which will not be activated post operatively before, a possible bleeding should occur, after the wound has been closed or the operation area has been closed.
[0129] The amount of the RshTF or RshTF comprising protein composition of the present invention may vary depending on the intended use of the product, the more severe bleeding, the higher a concentration of the one or more coagulation factor is needed. Suitably, the amount of the RshTF or RshTF comprising protein composition of the present invention in microgram up to mg/cm.sup.2 and recombinant prothrombin (or preprothrombin) is in the range from 70 -1000 to 5000 U/cm.sup.2 or a comparable measured amount taking into account the measurement cm.sup.2. It is envisaged that an amount of 10-1000 U/cm.sup.2 may be suitable in a device for stopping severe bleedings.
[0130] When applying the RshTF or RshTF comprising protein composition of the present invention, there can be difference in time to hemostasis, and some products such as porcine collagen derived products may add to the hemostasis, i.e. besides the classical hemostasis that is normally caused by activation of the intrinsic zymogens to activated enzymes, ending with activated thrombin that again will convert soluble fibrinogen to insoluble fibrin. The clotting efficacy also include the solidity of a clotting that can be accelerated of factors already present in the blood such as for instance platelets.
[0131] Therefore, two (2) variations of this Hemostatic kit may be envisaged, namely a kit comprising of RshTF (the extra cellular part) or RshTF comprising protein composition of the present invention.
[0132] In cases where a bleeding patient may suffer from bleedings and be low in prothrombin, another Hemostatic kit for these types of patients will contain both RshTF (the extra cellular part) or RshTF comprising protein at an amount of 2.5gor even 1 g/mL or e.g., 2.5 g or even 1 g/cm.sup.2 scaffold, together with 70 to 150 units of prothrombin, corresponding to 10-40 g/cm.sup.2. The recombinant human prothrombin or preprothrombin, which will be the most useable protein to be mixed together with the RshTF (the extra cellular part) or RshTF comprising protein (whereas thrombin (Factor IIa) will not be capable of being used for this purpose).
[0133] Enhanced Stability of the RshTF by Using Dissacharides and/or Polysarcharides
[0134] The stability of RshTF glycoprotein can be enhanced by dissacharides, such as for instance isomalt or mannitol. Isomalt or mannitol is/are a sugar substitute, a type of sugar alcohol, used primarily for its sugar-like physical properties. Isomalt or mannitol will, when added to a glycoprotein such as RshTF in the same amount (weight to weight) as the amount of RshTF, stabilize the RshTF. Isomalt or mannitol is an equimolar mixture of two disaccharides, each composed of two sugars: glucose and mannitol (-D-glucopyranosido-1,6-mannitol), also glucose and sorbitol (-D-glucopyranosido-1,6-sorbitol).
[0135] In this manner one can add a certain amount of non-reducing types of sugar components such as non-reducing disaccharides, which could be any non-reducing disaccharides such as e.g. trehalose, or disaccharides consisting of sugar-alcohol combinations such as e.g. isomalt or mannitol. Furthermore, larger molecule such as dextran could be used, because it is also a no-reducing sugar combination.
[0136] Complete hydrolysis of isomalt or mannitol yields glucose (50%), sorbitol (25%), and mannitol (25%).
[0137] Other disaccharides could be used instead of isomalt or mannitol, but mannitol is the preferred dissacharide that can be used as stabilisator. The common sugar alcohols, maltitol, erythritol, and hydrogenated starch hydrolysates, are manufactured from cornstarch. Xylitol, another common sugar alcohol, is manufactured from such sources as corncobs, sugar cane bagasse (stalk residue remaining after sugar extraction), or birch wood waste. Isomalt or mannitol and lactitol are becoming more common and are manufactured from sucrose and whey, respectively.
[0138] Lyophilization of RshTF
[0139] When lyophilizing RshTF, maltose and Tween are added in order to obtain an easily soluble freeze-dried powder to avoid a freeze-dried product not easily resolved in solvents, which often would be PBS at pH 6.5 to 7.5. The RshTF is freeze-dried in adequate portions, easy for the user to re-dissolve and apply to a carrier or to create a spray form of RshTF. Instead of the combination of maltose and Tween, one can use mannitol together with Tween.
[0140] RshTF's Dependency on the Intrinsic Factor VII/VIIa by in Order to Induce and Accelerate Hemostasis
[0141] For a more detailed description of the blood cascade reactions starting, see
[0142] Thus, as depicted in
[0143] During bleeding the source of Tissue Factor is released from endothelial cells which are damaged or torn apart because of damage to blood vessels. The released endogenous Tissue Factor (Factor III) are then responsible for binding to Factor VII/Factor VIIa, to form TF:VIIa. The amount of Tissue Factor binding to Factor VIIa to form TF:Factor VIIa is most probably not sufficient to prevent larger bleeding.
[0144] Under those circumstances, when Factor VII/VIIa (such as Novo Nordisk NovoSeven) is given parenterally, there may not be sufficient amount of Tissue Factor to form sufficient amount of Factor VIIa (NovoSeven) to activate the cascade (see
[0145] In this context, RshTF or RshTF comprising protein composition of the present invention has proven to activate prothrombin to thrombin as evidenced by PPP (platelet-poor plasma) Thrombography (see e.g. example 10) thus providing evidence of the fact that the RshTF of the present invention (produced by using transfected human HEK-cells to produce the extracellular part (SEQ ID NO: 2) of the Tissue Factor) and capable of reacting through binding of RshTF to Factor VII/VIIa to form RshTF:FVIIa (RgsTF:FVIIa) by exposing platelet poor plasma by solely exposing the platelet poor plasma to the RshTF.
[0146] One of the reasons why Factor VII/Factor VIIa has been able to cause induction and acceleration of activation of thrombin to convert soluble fibrinogen to insoluble fibrin in the blood coagulation cascade, is partly caused by insufficient endogenous presence of Tissue Factor or soluble Tissue Factor capable of binding to the injected Factor VII/Factor VIIa to form sufficient amount of TF:FVIIa complex to induce Factor Xa (or via Factor IXa to induce Factor Xa), which in turn produces sufficient amount of thrombin to be converted into fibrinogen. This is one of the reasons claimed to be the cause of the effect by administering systemic Factor VIIa alone (such as NovoSeven).
[0147] By combining RshTF or RshTF comprising protein composition of the present invention topically to the bleeding area, at the same time as systemically administering Factor VII/VIIa (such as NovoSeven) into the patient, the topically applied RshTF or RshTF comprising protein composition of the present invention will together with the Factor VII/FVIIa be capable of more efficiently stop the bleeding at the bleeding site.
[0148] Should the amount of prothrombin in the bleeding area be too small, recombinant prothrombin may be administered together with the topical application of RshTF or RshTF comprising protein composition of the present invention to provide sufficient supply of prothrombin to be converted to thrombin and thereby adding to the hemostasis effect.
[0149] In case where applied Factor VII/VIIa is given to trauma patients with severe bleedings, Factor VIIa may not be able to connect with sufficient amount of Tissue Factor to activate Factor Xa. Therefore the addition of RshTF or RshTF comprising protein composition of the present invention (applied topically) to the bleeding area, may utilize the systemically injected recombinant Factor VIIa to induce activation of Factor Xa and activate prothrombin to produce activated Factor Ha (thrombin), to create sufficient hemostasis within the limited time period, where the patient has not yet reached a phase, where the bleeding has been too large to prevent using this approach.
[0150] Protein Composition Comprising RshTF in Combination with e.g. One or More Addition Haemostatic Agent(s)
[0151] If it should appear that a severe bleeding would be stopped faster, by adding a surplus of other factors, one intrinsic factor that might be added systemically would be recombinant Factor VII/ VIIa which would be bound to RshTF or RshTF comprising protein composition of the present invention to form RshTF:FVIIa or RshTF:VII/VIIa to further activate the zymogens Factor X to Xa and ending up activating zymogen Factor II, prothrombin to activated Factor II, thrombin which would convert soluble fibrinogen to insoluble fibrin, and together with released platelets among others, would form a solid clot.
[0152] The ideal product for stopping excessive bleedings may be Tissue Factor or rather RshTF or RshTF comprising protein composition of the present invention, which as the extrinsic factor would act together with Factor VII (Factor VIIa would form TF:FVIIa, etc.). As described above, one could also ensure an accelerated hemostasis by adding prothombin or a thrombin (e.g. from HumanCell, Naperville, Ill.).
[0153] Preprothrombin is defined as a two chain, disulphide-bonded, glycosylated polypeptide that when activated to thrombin cleaves specific bonds in fibrinogen to produce fibrin monomers that self-assemble to form a fibrin clot, when activated to thrombin.
[0154] When mixing preprothrombin, activated, with RshTF or RshTF comprising protein composition of the present invention, to thrombin together with fibrinogen, the final stage of the natural fibrin clotting cascade takes place. In addition to providing hemostasis, this fibrin sealant also provides ideal environment for fibroblastic proliferation as well as proliferation of other mesenchymal cells.
[0155] In an embodiment of the invention, the recombinant human prothrombin to be combined with RshTF or RshTF comprising protein composition of the present invention is a preprothombin.
[0156] The RshTF or RshTF comprising protein composition of the present invention administered topically as for instance on a carrier or scaffold that again will activate Factor X to Factor Xa. Then Factor Xa will activate either endogenous prothrombin present in the bleeding area, or applied preprothrombin (for instance as a freeze-dried mix of recombinant Tissue Factor and preprothrombin supplied on a carrier or scaffold and kept in a sealed package, and opened at the time of the bleeding being treated).
[0157] In this manner the resulting activated thrombin will either be activated from endogenous prothrombin or from exogenous preprothrombin. This activation of thrombin will start converting fibrinogen to fibrin and thereby, efficient and fast clotting is obtained.
[0158] Modes of Co-Administration
[0159] In an embodiment of the invention, the RshTF is for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered together with soluble fibrinogen as a co-administration. When the RshTF is administered topically via e.g. a scaffold, the soluble fibrinogen can be administered intravenously (IV) or topically, e.g. admixed in the scaffold together with the RshTF
[0160] This co-administration accelerate conversion of soluble made available either by systemic application by intravenous or other routes for the organism to have sufficient amount of fibrinogen in his/her blood to enable conversion of sufficient amount of soluble fibrinogen to insoluble fibrin.
[0161] Outline of Subsequent Experimental Tests
[0162] After production and purification of the RshTF, thrombography experiments were performed to determine the functional activity of RshTF (performed at the Hematology Laboratory at Washington University Medical School in St. Louis (Mo., USA)).
[0163] In addition, the inventors performed two functional activity assays with fresh human blood: thrombin generation in platelet poor plasma (PPP) and clot formation in whole blood. Both assays proved that RshTF alone triggered thrombin generation in PPP without exogenous phospholipids and formed a clot in whole blood in a shorter time. These encouraging findings justify homeostatic validation in animal models and clinical testing as a kit containing a carrier on to which RshTF of the present invention is coated, impregnated or otherwise applied.
[0164] Thus, in the above-context, an object of the present invention relates to the provision of a stable blood clotting agent which tolerates ambient temperatures without losing activity, is easy to produce, can be produced in high yields and having low antigenicity when used to treat and/or prevent bleedings in humans.
[0165] In particular, it is an object of the present invention to provide a RshTF comprising the SEQ ID NO: 2, wherein the RshTF is produced in a human cell, that solves the above mentioned problems of the prior art in relation to traditionally used blood clotting agents.
[0166] Thus, one aspect of the invention relates to a RshTF comprising the SEQ ID NO: 2, wherein said recombinant soluble human Tissue Factor is produced in a human cell.
[0167] Another aspect of the present invention relates to a protein composition comprising RshTF in combination with one or more intrinsic factor, such as e.g. Factor VII/VIIa, participating in blood clotting or hemostasis.
[0168] Yet another aspect of the present invention is to provide a kit-of parts comprising an essentially air- and humidity-tight receptacle comprising a scaffold impregnated and/or coated with RshTF or a protein composition comprising RshTF, and optionally a humidity absorbing material.
[0169] Still another aspect of the present invention is to provide a method of producing recombinant soluble human Tissue Factor, said method comprising culturing in vitro a human host cell transfected with at least one exogenous nucleic acid sequence encoding said recombinant soluble human Tissue Factor, wherein the human host cell is a human HEK cell.
[0170] Items
[0171] Item 1: A recombinant soluble human Tissue Factor (RshTF) comprising the SEQ ID NO: 2, wherein said recombinant soluble human Tissue Factor is produced in a human cell.
[0172] Item 2: The recombinant soluble human Tissue Factor according to item 1, wherein the human cell is a human HEK cell selected from the group consisting of human HEK 293 cells, human HEK293T cells, human HEK293E cells or human HEK293 cells.
[0173] Item 3: The recombinant soluble human Tissue Factor according to any of items 1-2, wherein the recombinant soluble human Tissue Factor is essentially serum-free.
[0174] Item 4: The recombinant soluble human Tissue Factor according to any of items 1-3, wherein the recombinant soluble human Tissue Factor is glycosylated with one or more non-reducing disaccharides, preferably trehalose, and/or with one or more disaccharides consisting of sugar-alcohol combinations, preferably mannitol.
[0175] Item 5: The recombinant soluble human Tissue Factor according to any of items 1-4, wherein at least 90% of the recombinant soluble human Tissue Factor comprises a glycolysation pattern that results in an immunogenicity response substantially identical to that of the corresponding natural human Tissue Factor.
[0176] Item 6: The recombinant soluble human Tissue Factor according to any of items 1-5, wherein said recombinant soluble human Tissue Factor is part of a glue, a powder, a spray, a gel, a granulate, a gelatin, a paste, a fluid, a suture, a scaffold, a paste and/or a cream substance to which said Factor can be bound or mixed.
[0177] Item 7: The recombinant soluble human Tissue Factor according to item 6, wherein the powder is MPEG PLGA.
[0178] Item 8: The recombinant soluble human Tissue Factor according to item 6, wherein the scaffold is a haemostatic scaffold in the form of a gel, a foam, polyurethane foam, a gelatin-like substance, a collagen, a collagen-derived paste and/or a gelatin-derived paste.
[0179] Item 9: The recombinant soluble human Tissue Factor according to item 8, wherein the concentration of recombinant soluble human Tissue Factor on the scaffold range from 0.1 g-1000 ug per cm.sup.2 scaffold.
[0180] Item 10: The recombinant soluble human Tissue Factor according to any of items 1-5, wherein the recombinant soluble human Tissue Factor is in a solution in a concentration in the range from 0.1 g/ml-1000 g/ml.
[0181] Item 11: The recombinant soluble human Tissue Factor according to any of items 1-10, for use in topical treatment and/or prevention of bleedings.
[0182] Item 12: The recombinant soluble human Tissue Factor according to any of items 1-10, for topical use as a tissue sealant and/or to facilitate tissue adherence.
[0183] Item 13: The recombinant soluble human Tissue Factor according to any of items 1-10, for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered together with soluble fibrinogen as a co-administration.
[0184] Item 14: The recombinant soluble human Tissue Factor according to any of items 1-10, for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered concomitantly with one or more systemic administration(s) of Factor VII and/or Factor VIIa.
[0185] Item 15: The recombinant soluble human Tissue Factor according to any of items 1-10, for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered concomitantly with adding collagen to the bleeding site.
[0186] Item 16: A protein composition comprising recombinant soluble human Tissue Factor according to any of items 1-5, in combination with one or more agents selected from the group consisting of: fibrinogen (Factor I), prothrombin (Factor II), any other composition of prothrombin such as for instance preprothrombin and prethrombin, thrombin, Tissue Factor (Factor III), Labile Factor (Factor V), proconvertin (Factor VII), Factor VII/VIIa (NovoSeven), Antihaemophilic Factor (Factor VIII), Christmas Factor (Factor IX), Stuart-Prower Factor (Factor X), Plasma thromboplastic (Factor XI), Hageman Factor (Factor XII), Factor XIII, Fibrin-stabilizing Factor (transamidase or Factor XIIIa), von Willebrand Factor, Prekallikrein (Fletcher Factor) high-molecular-weight kininogen (HMWK), fibronectin or any intrinsic Factor participating in blood clotting or hemostasis.
[0187] Item 17: The protein composition according to item 16, wherein said protein composition is part of a glue, a powder, a spray, a gel, a granulate, a gelatin, a paste, a fluid, a suture, a scaffold, a paste and/or a cream substance to which said Factor can be bound or mixed.
[0188] Item 18: The protein composition according to item 17, wherein the powder is MPEG PLGA.
[0189] Item 19: The protein composition according to item 17, wherein the scaffold is a haemostatic scaffold in the form of a gel, a foam, polyurethane foam, a gelatin-like substance, a collagen, a collagen-derived paste and/or a gelatin-derived paste.
[0190] Item 20: The protein composition according to item 19, wherein the concentration of protein composition on the scaffold range from 0.1 g-1000 ug per cm.sup.2 scaffold.
[0191] Item 21: The protein composition according to item 16, wherein the protein composition is in a solution in a concentration in the range from 0.1 g/ml-1000 g/ml.
[0192] Item 22: The protein composition according to any of items 16-21, for use in topical treatment and/or prevention of bleedings.
[0193] Item 23: The protein composition according to any of items 16-21, for topical use as a tissue sealant and/or to facilitate tissue adherence.
[0194] Item 24: The protein composition according to any of items 16-21, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered together with soluble fibrinogen as a co-administration.
[0195] Item 25: The protein composition according to any of items 16-21, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered concomitantly with one or more systemic administration(s) of Factor VII and/or Factor VIIa.
[0196] Item 26: The protein composition according to any of items 16-21, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered concomitantly with adding collagen to the bleeding site.
[0197] Item 27: A kit-of parts comprising an essentially air- and humidity-tight receptacle comprising a scaffold impregnated and/or coated with recombinant soluble human Tissue Factor according to any of items 1-5, 8-9 or a protein composition according to any of items 16, 19-20, and optionally a humidity absorbing material.
[0198] Item 28: Method of treating and/or preventing bleedings in humans comprising topical administration on the bleeding site in a human with a recombinant soluble human Tissue Factor according to any of items 1-10 and/or one or more of the protein compositions according to any of items 16-21.
[0199] Item 29: A method of producing recombinant soluble human Tissue Factor (RshTF), said method comprising culturing in vitro a human host cell transfected with at least one exogenous nucleic acid sequence encoding said recombinant soluble human Tissue Factor, wherein the human host cell is a human HEK cell.
[0200] Item 30: The method according to item 29, wherein the human HEK cell is selected from the group consisting of human HEK 293 cells, human HEK293T cells , human HEK293E cells or human HEK293 cells.
[0201] Item 31: The method according to any of items 29-30, wherein the in vitro culturing is carried out under essentially serum-free conditions.
[0202] Item 32: The method according to any of items 29-31, wherein the transfected human HEK cell is cultured to a cell density between 3-9 million cells/mL culture medium.
[0203] Item 33: The method according to any of items 29-32, wherein the recombinant soluble human Tissue Factor is essentially serum-free.
[0204] Item 34: The method according to any of items 29-33, wherein the exogenous nucleic acid sequence comprises SEQ ID NO: 1.
[0205] Item 35: A recombinant soluble human Tissue Factor obtainable by a method according to any of items 29-34.
[0206] Item 36: The recombinant soluble human Tissue Factor according to item 35, wherein the recombinant soluble human Tissue Factor is glycosylated with one or more non-reducing disaccharides, preferably trehalose, and/or with one or more disaccharides consisting of sugar-alcohol combinations, preferably mannitol.
[0207] Item 37: The recombinant soluble human Tissue Factor according to item 36, wherein at least 90% of the recombinant soluble human Tissue Factor comprises a glycolysation pattern that results in an immunogenicity response substantially identical to that of the corresponding natural human Tissue Factor.
[0208] Item 38: The recombinant soluble human Tissue Factor according to any of items 35-37, wherein said recombinant soluble human Tissue Factor is part of a glue, a powder, a spray, a gel, a granulate, a gelatin, a paste, a fluid, a suture, a scaffold, a paste and/or a cream substance to which said Factor can be bound or mixed.
[0209] Item 39: The recombinant soluble human Tissue Factor according to item 38, wherein the powder is MPEG PLGA.
[0210] Item 40: The recombinant soluble human Tissue Factor according to item 38, wherein the scaffold is a haemostatic scaffold in the form of a gel, a foam, polyurethane foam, a gelatin-like substance, a collagen, a collagen-derived paste and/or a gelatin-derived paste.
[0211] Item 41: The recombinant soluble human Tissue Factor according to item 40, wherein the concentration of recombinant soluble human Tissue Factor on the scaffold range from 0.1 g-1000 ug per cm.sup.2 scaffold.
[0212] Item 42: The recombinant soluble human Tissue Factor according to item 35-37, wherein the recombinant soluble human Tissue Factor is in a solution in a concentration in the range from 0.1 g/ml-1000 g/ml.
[0213] Item 43: The recombinant soluble human Tissue Factor according to any of items 35-42, for use in topical treatment and/or prevention of bleedings.
[0214] Item 44: The recombinant soluble human Tissue Factor according to any of items 35-42, for topical use as a tissue sealant and/or to facilitate tissue adherence.
[0215] Item 45: The recombinant soluble human Tissue Factor according to any of items 35-42, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered together with soluble fibrinogen as a co-administration.
[0216] Item 46: The recombinant soluble human Tissue Factor according to any of items 35-42, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered concomitantly with one or more systemic administration(s) of Factor VII and/or Factor VIIa.
[0217] Item 47: The recombinant soluble human Tissue Factor according to any of items 35-42, for use in topical treatment and/or prevention of bleedings wherein said protein composition is administered concomitantly with adding collagen to the bleeding site.
[0218] Item 48: The recombinant soluble human Tissue Factor according to any of items 35-42, for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered together with soluble fibrinogen as a co-administration.
[0219] Item 49: A protein composition comprising recombinant soluble human Tissue Factor obtainable by a method according to any of items 29-34, in combination with one or more agents selected from the group consisting of: fibrinogen (Factor I), prothrombin (Factor II), any other composition of prothrombin such as for instance preprothrombin and prethrombin, thrombin, Tissue Factor (Factor III), Labile Factor (Factor V), proconvertin (Factor VII), Factor VII/VIIa (NovoSeven), Antihaemophilic Factor (Factor VIII), Christmas Factor (Factor IX), Stuart-Prower Factor (Factor X), Plasma thromboplastic (Factor XI), Hageman Factor (Factor XII), Factor XIII, Fibrin-stabilizing Factor (transamidase or Factor XIIIa), von Willebrand Factor, Prekallikrein (Fletcher Factor) high-molecular-weight kininogen (HMWK), fibronectin or any intrinsic Factor participating in blood clotting or hemostasis.
[0220] Item 50: The protein composition according to item 49, wherein said protein composition is part of a glue, a powder, a spray, a gel, a granulate, a gelatin, a paste, a fluid, a suture, a scaffold, a paste and/or a cream substance to which said Factor can be bound or mixed.
[0221] Item 51: The protein composition according to item 50, wherein the powder is MPEG PLGA.
[0222] Item 52: The protein composition according to item 50, wherein the scaffold is a haemostatic scaffold in the form of a gel, a foam, polyurethane foam, a gelatin-like substance, a collagen, a collagen-derived paste and/or a gelatin-derived paste.
[0223] Item 53: The protein composition according to item 52, wherein the concentration of protein composition on the scaffold range from 0.1 g-1000 ug per cm.sup.2 scaffold.
[0224] Item 54: The protein composition according to item 49, wherein the protein composition is in a solution in a concentration in the range from 0.1 g/ml-1000 g/ml.
[0225] Item 55: The protein composition according to any of items 49-54, for use in topical treatment and/or prevention of bleedings.
[0226] Item 56: The protein composition according to any of items 49-54, for topical use as a tissue sealant and/or to facilitate tissue adherence.
[0227] Item 57: The protein composition according to any of items 49-54, for use in topical treatment and/or prevention of bleedings wherein said recombinant soluble human Tissue Factor is administered together with soluble fibrinogen as a co-administration.
[0228] Item 58: A kit-of parts comprising an essentially air- and humidity-tight receptacle comprising a scaffold impregnated and/or coated with recombinant soluble human Tissue Factor obtainable by a method according to any of items 29-34 or a scaffold according to item 40-41, and a protein composition according to any of items 49-54, and optionally a humidity absorbing material.
[0229] Item 59: Method of treating and/or preventing bleedings comprising topical administration on the bleeding site in a human with a recombinant soluble human Tissue Factor obtainable by a method according to any of items 29-34 or recombinant soluble human Tissue Factor according to any of items 35-42 and/or one or more of the protein compositions according to any of items 49-54.
[0230] The invention will now be described in further details in the following non-limiting examples.
EXAMPLES
[0231] In the below examples the following tools, media, apparatus etc. have been applied (table 2).
TABLE-US-00002 TABLE 2 Description Supplier Cat No. DMEM LifeTecnologies 11960 L-Glutamine, 200 mM LifeTecnologies 25030 1M HEPES LifeTecnologies 15630 MEM NEAA 100X LifeTecnologies 11140 PBS LifeTecnologies 10010 TrypLE LifeTecnologies 12605 CD293 LifeTecnologies 11913 Zeocin LifeTecnologies R250-05 NuPAGE (SDS-PAGE) LifeTecnologies NP0322BOX 100 mm Petri Dish MIdSci TP93100 125 mL Erlenmeyer flask VWR 89095-258 250 mL Erlenmeyer flask VWR 89095-268 2 L Erlenmeyer flask VWR 10126-438 HiTrap ANX FF GE Life Sciences 17-5163-01 HiTrap Heparin HP GE Life Sciences 17-0407-03 HiTrap Q FF GE Life Sciences 17-5156-01 Thrombin calibrator Stago 86192 FluCa Kit Stago 86197
Example 1
[0232] Method of Producing RshTFOverview (Table 3)
TABLE-US-00003 TABLE 3 Culture medium & Liquid CD 293: Invitrogen (#11913) supplements 200 mM L-glutamine: Invitrogen (#25030) 1M HEPES: Invitrogen (#15630) Zeocin (100 mg/mL): Invitrogen (#R250) Suspension culture medium: CD 293 (1 L) + 4 mM L-glutamine + 25 mM HEPES at final concentrations Zecoin medium: Suspension culture medium + 50 ug/mL zeocin at final concentration (CAN BE OMITTED for large scale production) Thaw & Seeding 1. Thaw 1 vial of each cell line in 37 C. water bath 2. After mixing by pipetting 3-4 times the cells to be transferred into 10 ml of suspension culture medium in 125 mL Erlenmeyer flask with vent cap (VWR, #30180-036) 3. Suspension culture the cells at 125 rpm overnight Growing
1. On day 2 count the viable cell density (VCD) and adjust VCD to one million cells/mL with 50 ug/mL zeocin supplied suspension medium 2. On day 3 and/or day 4 count VCD and adjust to 1M/mL until reach 50 mL culture 3. Once reach 50 mL culture with NLT 90% viability adjust VCD to 0.5M/mL with the fresh zeocin medium 4. Grow the cells for 7 days in the zeocin medium Scale-up process
1. At day 7 count VCD and adjust to 0.5M/mL with the fresh zeocin medium: 125 mL flask (VWR, #30180-036, up to 50 mL culture), 250 mL flask (VWR, #30180-044, up to 100 mL culture), or 2 L flask (VWR, #83014-018, up to 800 mL culture) 2. Grow for 7 days between the passages 3. Once culture volume reaches 800 mL culture next larger scale requires spinner or bioreactor. Each passage yields four times larger volume culture. Cell harvest Cells for passage to be harvested by centrifugation at 200 g for 5 min. Spent medium Recombinant protein spent medium to be harvest harvested by centrifugation 10,000 g for 20 min and stored at 20 C. until performing purification All centrifuge tubes/bottles to be pyrogen free and autoclaved. Spent medium must be handled in a bio-safety cabinet to avoid introducing endotoxin
[0233] HEK293TS cell line, a serum-free and suspension adapted cell line, was generated from HEK293T (original HEK293T cell line used for transfection of the gene for extracellular soluble human Tissue Factor is from HumanCell Inc., Naperville, Ill. 60540, purchased from GenHunter (TN, USA)). Cell culture media, supplements, and zeocin were purchased from LifeTechnologies (CA, USA). Bovine calf serum was purchased from HyClone (UT, USA). Plastic culture dishes were from MidSci (MO, USA), and Erlenmeyer culture flasks from VWR (PA, USA). Protein purification prepacked columns were from GE Lifesciences (NJ, USA). Thrombin generation assay reagents were from Diagnostica Stago (NJ, USA). Detailed provider information is in Table 2.
[0234] The production of RshTF was split up into 3 steps, where step 1 consists of obtaining the cDNA of hTF (BC011029) and construct the expression plasmid encoding the Tissue Factor protein, 1-219 amino acid residues. Then the coding sequence was confirmed to be authentic. The construct was transfected into HEK 293T cells and expression was confirmed.
[0235] Step 2 consisted of selecting the cell lines that appeared to be stably transfected. The transfected HEK293T cell line was adapted to suspension culture and further adapted to serum- free media culturing. The transfected HEK293T cell culture in suspension was then expanded in a one (1) litre with a cell density of approximately 3-3.5 million cells/mL. The third (3rd) step consisted of purification by column chromatography as shown in the following table 4.
TABLE-US-00004 TABLE 4 Activities Duration Step 1: 4-5 weeks a) Obtain cDNA of hTF (BC011029) and construct expression plasmid encoding the protein of 1-219 amino acid residues (2-3 weeks) b) Confirm that coding sequence is authentic (1 week) c) Transfect HEK cells and confirm expression (1 week) Step 2: 6 weeks a) Select cell lines that are stably transfected (2 weeks) b) Adapt to suspension culture (up to 1 week) c) Adapt to Serum-free media (up to 1 week) Step 3: 4-5 weeks a) Scale up protein production to 1 L (2 weeks) b) Purify shTF to homogeneity, demonstrated by SDS gel (1 week)
Example 2
[0236] In this example the cloning of human soluble Tissue Factor is described in more details. Step 1: Cloning human soluble Tissue Factor (219aa) into an expression vector, transfection and expression of the protein
[0237] Gene source of human Tissue Factor (BC011029) was purchased from GE Lifesciences. Coding region of extracellular domain (soluble Tissue Factor; residues 1-219) was cloned into pST2 expression vector (Human Cell Co.) at Sill site to construct pST2-HF3 (
[0238] Human embryonic kidney (HEK) cell handling was performed in a Laminar Hood (Nuaire NU-425-300). On day 1, 20 million suspension HEK293TS cells in CD293.sup.+ were plated on a 100 mm Petri dish in DMEM.sup.+ and grown to confluency in 24 hours. The next day the cells were passed to 5 dishes for transfection. After 24 hours growing, cells on one dish with 90% confluency were transfected with a mixture of linearized pST2-HF3 vector (10 g), 500 l DMEM medium without any supplement, and 30 l polyethyleneimine, and grown in a water-jacketed humidified incubator (VWR 2310) with 5% CO.sub.2 at 37 C.
Example 3
[0239] Step 2: Cell Line Selection and Serum-Free and Suspension Adaptation
[0240] Two days culture after transfection, the cells were passed into three 100 mm Petri dishes with DMEM completed medium with 400 g/mL zeocin (DMEM.sup.+ Z400) for selection. After one-week selection, survived cells from three dishes were pooled and transferred to a new plate and grown another week to confluency on the plate. The selected cells were then passed to 2 new plates with DMEM.sup.+ Z400. After 4 days when the cells reached confluency one plate was washed with 2 mL of PBS and treated with 1 mL of TrypLE for 5 minutes in the humidified incubator. After the incubation the cells were detached, collected by pipetting, and mixed with 1 mL of CD293 supplemented with 25 mM HEPES, 4 mM L-Gln, and 50 g/mL zeocin (CD293.sup.+ Z50). The cell suspension was centrifuged at 200g for 5 minutes and the supernatant was removed. The cell pellet was re-suspended in 10 mL CD293.sup.+ Z50 in a 125 mL plastic Erlenmeyer flask with a vent cap. The flask was moved onto a shaker (MAXQ2000, Thermo Scientific) rotating at 125 rpm in a dry CO.sub.2 incubator with 5% CO.sub.2 at 37 C. (Shel Lab 2428, Sheldon Manufacturing). Every 2-3 days the cell number was counted until the cells adapted to the serum-free chemically defined medium and culture. HEK293T cell morphologies in monolayer culture and in suspension culture are shown in
Example 4
[0241] Over a 2 weeks period, the cells were adapted to the serum-free suspension culture and the soluble Tissue Factor band was identified on a SDS-PAGE gel (
Example 5
[0242] Large scale production in 1 Litre batch was done in a pilot size Wave Bioreactor at a temperature of 37 C., starting as 100 mL culture with 0.5 million HEK 293T cells in suspension in serum-free medium, added during the week to 1000 ml as explained below.
[0243] Initial serum-free suspension adaptation of the selected cells showed 2-3 mg/L expression level of RshTF. While the protein purification protocol was developed, the cells were continuously cultured at 7 days batch culture mode in 100 mL culture with 0.5 million/mL seeding density in CD293.sup.+ Z50 for 4 more weeks.
[0244] After the extended culture, protein expression level was visibly improved, and the cells at the stage were cryobanked and set up for 1 L culture. From 2 days culture RshTF band was clearly visible on SDS-PAGE (
[0245] At day 9, the conditioned medium was harvested by centrifugation at 2,000g for 10 minutes.
Example 6
[0246] Currently known purification methods in the literature (see e.g. Broze, Jr. G J et al. (1985) J. Biol. Chem 260:10917-10920 or Guha A. et al. (1986) Proc. Natl. Acad. Sci. USA 83:299-302) are employing a Tissue Factor antibody or Tissue Factor VII affinity absorbent which are not applicable to large scale purification.
[0247] Therefore the inventors have developed a new protocol employing only conventional chromatography resins that are cheap and scalable with simple buffers.
[0248] Purification protocol was developed with AKTA FPLC, Unicorn software, pre-packed ion exchange and affinity columns (GE Lifesciences): On day 8 of 1 L culture, the cells were removed by centrifugation at 2,000g for 10 minutes and the conditioned medium was harvested.
[0249] The conditioned medium was applied on 0.2 m filter membrane to remove particles before loading onto the chromatography columns. As a virus inactivation process, Triton X-100 was added into the filtered medium at 1% final concentration. After 30 minutes incubation at room temperature, 2 volumes of WFI grade water was added to the medium and mixed to low the salt concentration to 50 mM ('5 mS/cm).
[0250] The low salt medium was loaded onto a HiTrap ANX FF column equilibrated with 10 mM Tris-HCl, pH 7.4. After the loading the column was washed with 2 column volumes of the equilibration buffer to get the baseline. Soluble Tissue Factor fraction was then eluted with 10 mM Tris-HCl, pH 7.4, 150 mM NaCl until the peak came down to the baseline. The column was stripped with 10 mM Tris-HCl, pH 7.4, 1 M NaCl.
Example 7
[0251] The eluted soluble Tissue Factor fraction was mixed with 2 volumes of 10 mM Tris-HCl, pH 7.4 to low the salt concentration to 50 mM (5 mS/cm). Then the mixed fraction was loaded on HiTrap Heparin HP column equilibrated with 10 mM Tris-HCl, pH 7.4. The soluble Tissue Factor was in the flow through fraction. After the loading the column was washed with the equilibration buffer until the peak comes down to the baseline. The column was stripped with 10 mM Tris-HCl, pH 7.4, 1M NaCl (
Example 8
[0252] The soluble Tissue Factor fraction was then loaded onto HiTrap Q FF column equilibrated with 10 mM Tris-HCl, pH 7.4. After the loading the column was washed with 2 column volumes of the equilibration buffer to get the baseline. Soluble Tissue Factor fraction was then eluted with 10 mM Tris-HCl, pH 7.4, 300 mM NaCl until the peak came down to the baseline. The column was stripped with 10 mM Tris-HCl, pH 7.4, 1 M NaCl.
Example 9
[0253] Purified soluble Tissue Factor fraction (210 mL) was processed buffer exchange to phosphate buffered saline (PBS) using Ultra 15 (MWCO 10 kDa, Millipore) according to the manufacturer's manual and 0.2 m filter sterilized. Its concentration was measured by Agilent 8543 UV/vis spectrometer (
Example 10
[0254] Functional assays with fresh human blood.
[0255] Recombinant human Tissue Factor has been used as a key component in hemostasis in a number of prior art studies. The Tissue Factors currently used in the studies are produced in bacteria cells, and composed of extracellular domain and transmembrane domain.
[0256] However, the bacterial Tissue Factors are lacking of posttranslational modification (PTM) including glycosylation and disulphide bond due to the limitation of the expression system. Under such conditions exogenous phospholipid is also needed for proper function of the Tissue Factor.
[0257] The purpose of the functional assay was to test the functionality of RshTF produced with proper PTM from human cells in the human blood coagulation cascade without exogenous phospholipids supplied. A common outcome of the coagulation cascade between extrinsic and intrinsic pathways is producing active thrombin from prothrombin which is triggered by the exposed Tissue Factors at wound site. Calibrated Automated Thrombogram with Fluoroscan Ascent (Thermo Scientific) is a widely used instrument in research labs to monitor thrombin generation (said experiments were carried out at Washington University in St. Louis).
[0258] Each day a healthy donor donated 40 mL of blood with a nurse's help and calcium was chelated in the blood by sodium citrate added as an anticoagulant. The donated blood was transferred into 3.2% Citrate tubes and mixed by several gentle inversions.
[0259] The citrate mixed blood was centrifuged at 2,500g for 15 minutes at 24 C. without break. After the centrifugation platelet-poor plasma (PPP) was gently collected using a polypropylene Pasteur's pipet. First day, we tested hematological function of rshTF in thrombin generation: 80 l PPP was delivered into the designated wells in a 96 well plate and various concentrations of RshTF was added to the wells in 20 l in duplicate.
[0260] Stock solution of RshTF is 2.5 mg/mL or 0.1 mM based on polypeptide molecular mass (24.8 kDa). Control well was added 20 l of phosphate-buffered saline (PBS). To calculate thrombin generated, a known concentration of thrombin standard (Thrombin Calibrator, Stago) was set in triplicate: 80 l PPP and 20 l Thrombin Calibrator. After the PPP and RshTF were mixed in the plate, Fluka substrate solution (Stago), a thrombin substrate with fluorescent label, was automatically discharged 20 l with calcium to the wells by the instrument and started thrombin generation reading.
[0261] At 10 nM RshTF concentration, thrombin generation started at 7 minutes and reached highest thrombin concentration (44 nM) at 19 minutes. At 1 nM and 0.1 nM, thrombin generation started at 15 and 33 minutes respectively. Interestingly, control with PBS showed thrombin generation at 1 hour albeit a significantly less amount (
Example 11
[0262] On day two (continuing from example 10), instead of repeating the same experiment under a non-physiological condition, the inventors conducted a clot formation assay with whole blood. In each 100 l of whole blood in a 1.5 mL Eppendorf tube, calcium was compensated at 10 mM. Clot formation was then triggered by adding a certain amount of RshTF, and mixing in the blood by shaking.
[0263] Then the inventors measured the time taken to form a clot. The result showed that RshTF triggered clot formation in the whole blood and did faster than PBS control: RshTF at 0.025 ug/mL formed a clot at 13 min whereas PBS control at 21 min (
[0264] The conclusion the two experiments (examples 10-11) was that we RshTF alone triggered thrombin generation in PPP without exogenous phospholipids supplied and that RshTF in whole blood shortened the clot formation time in a dose-dependent manner. Additionally, the manner in which the RshTF cause the clot formation through its binding to Factor VII/VIIa to form RshTF:FVII/FVIIa. These encouraging findings justify homeostatic validation in animal models and in clinical trials.
TABLE-US-00005 Sequencelisting SEQIDNO:1(nucleotidesequenceencodingthesolublehumanTissueFactor (extracellulardomain),HF3-663nt): tcaggcactacaaatactgtggcagcatataatttaacttggaaatcaactaatttcaag 60 acaattttggagtgggaacccaaacccgtcaatcaagtctacactgttcaaataagcact 120 aagtcaggagattggaaaagcaaatgcttttacacaacagacacagagtgtgacctcacc 180 gacgagattgtgaaggatgtgaagcagacgtacttggcacgggtcttctcctacccggca 240 gggaatgtggagagcaccggttctgctggggagcctctgtatgagaactccccagagttc 300 acaccttacctggagacaaacctcggacagccaacaattcagagttttgaacaggtggga 360 acaaaagtgaatgtgaccgtagaagatgaacggactttagtcagaaggaacaacactttc 420 ctaagcctccgggatgtttttggcaaggacttaatttatacactttattattggaaatct 480 tcaagttcaggaaagaaaacagccaaaacaaacactaatgagtttttgattgatgtggat 540 aaaggagaaaactactgtttcagtgttcaagcagtgattccctcccgaacagttaaccgg 600 aagagtacagacagcccggtagagtgtatgggccaggagaaaggggaattcagagaatga 660 taa 663 SEQIDNO:2(theaminoacidsequenceofthesolublehumanTissueFactor (extracellulardomain(219aa:Ser33-Glu251)): SerGlyThrThrAsnThrValAlaAlaTyrAsnLeuThrTrpLysSer 151015 ThrAsnPheLysThrIleLeuGluTrpGluProLysProValAsnGln 202530 ValTyrThrValGlnIleSerThrLysSerGlyAspTrpLysSerLys 354045 CysPheTyrThrThrAspThrGluCysAspLeuThrAspGluIleVal 505560 LysAspValLysGlnThrTyrLeuAlaArgValPheSerTyrProAla 65707580 GlyAsnValGluSerThrGlySerAlaGlyGluProLeuTyrGluAsn 859095 SerProGluPheThrProTyrLeuGluThrAsnLeuGlyGlnProThr 100105110 IleGlnSerPheGluGlnValGlyThrLysValAsnValThrValGlu 115120125 AspGluArgThrLeuValArgArgAsnAsnThrPheLeuSerLeuArg 130135140 AspValPheGlyLysAspLeuIleTyrThrLeuTyrTyrTrpLysSer 145150155160 SerSerSerGlyLysLysThrAlaLysThrAsnThrAsnGluPheLeu 165170175 IleAspValAspLysGlyGluAsnTyrCysPheSerValGlnAlaVal 180185190 IleProSerArgThrValAsnArgLysSerThrAspSerProValGlu 195200205 CysMetGlyGlnGluLysGlyGluPheArgGlu 210215 SEQIDNO:3(nucleotidesequence(fullsequence)ofHumanTissueFactor(169-1056): atggagacccctgcctggccccgggtcccgcgccccgagaccgccgtcgctcggacgctc 60 ctgctcggctgggtcttcgcccaggtggccggcgcttcaggcactacaaatactgtggca 120 gcatataatttaacttggaaatcaactaatttcaagacaattttggagtgggaacccaaa 180 cccgtcaatcaagtctacactgttcaaataagcactaagtcaggagattggaaaagcaaa 240 tgcttttacacaacagacacagagtgtgacctcaccgacgagattgtgaaggatgtgaag 300 cagacgtacttggcacgggtcttctcctacccggcagggaatgtggagagcaccggttct 360 gctggggagcctctgtatgagaactccccagagttcacaccttacctggagacaaacctc 420 ggacagccaacaattcagagttttgaacaggtgggaacaaaagtgaatgtgaccgtagaa 480 gatgaacggactttagtcagaaggaacaacactttcctaagcctccgggatgtttttggc 540 aaggacttaatttatacactttattattggaaatcttcaagttcaggaaagaaaacagcc 600 aaaacaaacactaatgagtttttgattgatgtggataaaggagaaaactactgtttcagt 660 gttcaagcagtgattccctcccgaacagttaaccggaagagtacagacagcccggtagag 720 tgtatgggccaggagaaaggggaattcagagaaatattctacatcattggagctgtggta 780 tttgtggtcatcatccttgtcatcatcctggctatatctctacacaagtgtagaaaggca 840 ggagtggggcagagctggaaggagaactccccactgaatgtttcataa 888 SEQIDNO:4(aminoacidsequenceofHumanTissueFactorfullsequence(295amino acids)): MetGluThrProAlaTrpProArgValProArgProGluThrAlaVal 151015 AlaArgThrLeuLeuLeuGlyTrpValPheAlaGlnValAlaGlyAla 202530 SerGlyThrThrAsnThrValAlaAlaTyrAsnLeuThrTrpLysSer 354045 ThrAsnPheLysThrIleLeuGluTrpGluProLysProValAsnGln 505560 ValTyrThrValGlnIleSerThrLysSerGlyAspTrpLysSerLys 65707580 CysPheTyrThrThrAspThrGluCysAspLeuThrAspGluIleVal 859095 LysAspValLysGlnThrTyrLeuAlaArgValPheSerTyrProAla 100105110 GlyAsnValGluSerThrGlySerAlaGlyGluProLeuTyrGluAsn 115120125 SerProGluPheThrProTyrLeuGluThrAsnLeuGlyGlnProThr 130135140 IleGlnSerPheGluGlnValGlyThrLysValAsnValThrValGlu 145150155160 AspGluArgThrLeuValArgArgAsnAsnThrPheLeuSerLeuArg 165170175 AspValPheGlyLysAspLeuIleTyrThrLeuTyrTyrTrpLysSer 180185190 SerSerSerGlyLysLysThrAlaLysThrAsnThrAsnGluPheLeu 195200205 IleAspValAspLysGlyGluAsnTyrCysPheSerValGlnAlaVal 210215220 IleProSerArgThrValAsnArgLysSerThrAspSerProValGlu 225230235240 CysMetGlyGlnGluLysGlyGluPheArgGluIlePheTyrIleIle 245250255 GlyAlaValValPheValValIleIleLeuValIleIleLeuAlaIle 260265270 SerLeuHisLysCysArgLysAlaGlyValGlyGlnSerTrpLysGlu 275280285 AsnSerProLeuAsnValSer 290295 SEQIDNO:5(nucleotidesequenceofvector/plasmidpST2HF3(sTFgeneregion(974- 1636).ThevectorplasmidwaslinearizedwithBglIIandPciIrestrictionenzymes)). gacggatcgggagatctcccgatcccctatggtcgactctcagtacaatctgctctgatg 60 cgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcgc 120 gagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgct 180 tagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacattg 240 attattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatat 300 ggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgaccc 360 ccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcca 420 ttgacgtcaatgggtggactatttacggtaaactgcccacttggcagtacatcaagtgta 480 tcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcatta 540 tgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcat 600 cgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttga 660 ctcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacca 720 aaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcgg 780 taggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaacccac 840 tgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcc 900 accatggagacagacacactcctgctatgggtactgctgctctgggttccaggttccact 960 ggtgacgcgcccgggccggccaggcgcgcgcgccgtacgtacgaagcttggtaccgagct 1020 cggatccactccagtgtggtggaattctgcagatatccagcacagtggcggccgctcgag 1080 gagggcccgaacaaaaactcatctcagaagaggatctgaatagcgccgtcgaccatcatc 1140 atcatcatcattgagtttaaacccgctgatcagcctcgactgtgccttctagttgccagc 1200 catctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactg 1260 tcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattc 1320 tggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatg 1380 ctggggatgcggtgggctctatggcttctgaggcggaaagaaccagctggggctctaggg 1440 ggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgca 1500 gcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcct 1560 ttctcgccacgttcgccggctttccccgtcaagctctaaatcggggcatccctttagggt 1620 tccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcac 1680 gtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttct 1740 ttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattctt 1800 ttgatttataagggattttggggatttcggcctattggttaaaaaatgagctgatttaac 1860 aaaaatttaacgcgaattaattctgtggaatgtgtgtcagttagggtgtggaaagtcccc 1920 aggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtg 1980 tggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtc 2040 agcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgc 2100 ccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctc 2160 tgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaa 2220 aaagctcccgggagcttgtatatccattttcggatctgatcagcacgtgttgacaattaa 2280 tcatcggcatagtatatcggcatagtataatacgacaaggtgaggaactaaaccatggcc 2340 aagttgaccagtgccgttccggtgctcaccgcgcgcgacgtcgccggagcggtcgagttc 2400 tggaccgaccggctcgggttctcccgggacttcgtggaggacgacttcgccggtgtggtc 2460 cgggacgacgtgaccctgttcatcagcgcggtccaggaccaggtggtgccggacaacacc 2520 ctggcctgggtgtgggtgcgcggcctggacgagctgtacgccgagtggtcggaggtcgtg 2580 tccacgaacttccgggacgcctccgggccggccatgaccgagatcggcgagcagccgtgg 2640 gggcgggagttcgccctgcgcgacccggccggcaactgcgtgcacttcgtggccgaggag 2700 caggactgacacgtgctacgagatttcgattccaccgccgccttctatgaaaggttgggc 2760 ttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctg 2820 gagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaat 2880 agcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtcc 2940 aaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagctagagcttggcg 3000 taatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaac 3060 atacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcaca 3120 ttaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcat 3180 taatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcc 3240 tcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactca 3300 aaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagca 3360 aaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccatagg 3420 ctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccg 3480 acaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgtt 3540 ccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctt 3600 tctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggc 3660 tgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtctt 3720 gagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggatt 3780 agcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggc 3840 tacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaa 3900 agagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtt 3960 tgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttct 4020 acggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagatta 4080 tcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaa 4140 agtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatc 4200 tcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataact 4260 acgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgc 4320 tcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagt 4380 ggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagta 4440 agtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtg 4500 tcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagtt 4560 acatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtc 4620 agaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctctt 4680 actgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattc 4740 tgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataatacc 4800 gcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaa 4860 ctctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaac 4920 tgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaa 4980 aatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctt 5040 tttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaa 5100 tgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacct 5160 gacgtc 5166