A NOVEL CD16+ NATURAL KILLER CELL AND A METHOD OF CULTURING CD16+ NATURAL KILLER CELL
20230036481 · 2023-02-02
Assignee
Inventors
- SAI-WEN TANG (San Mateo, CA, US)
- ZIH-FEI CHENG (New Taipei City, TW)
- CHIA-YUN LEE (New Taipei City, TW)
- HAO-KANG LI (New Taipei City, TW)
- HSIU-PING YANG (New Taipei City, TW)
- CHING-WEN HSIAO (Castro Valley, CA, US)
- SEN HEN YANG (Vallejo, CA, US)
- TAI-SHENG WU (New Taipei City, TW)
- YAN-LIANG LIN (New Taipei City, TW)
- YAN-DA LAI (New Taipei City, TW)
- SHIH-CHIA HSIAO (New Taipei City, TW)
Cpc classification
A61K35/17
HUMAN NECESSITIES
C07K16/283
CHEMISTRY; METALLURGY
C07K14/70535
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
C12N2501/599
CHEMISTRY; METALLURGY
International classification
A61K35/17
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C07K16/28
CHEMISTRY; METALLURGY
Abstract
The present invention provides a human CD16.sup.+ natural killer cell line and a CAR-expressing human CD16.sup.+ natural killer cell line. These human CD16.sup.+ natural killer cell line and a CAR-expressing human CD16.sup.+ natural killer cell line does not include synthetic, genetically modified or purposely deliberately delivered polynucleotide encoding the CD16 receptor and are non-tumorigenic cell lines. Therefore, this human CD16.sup.+ natural killer cell line and a CAR-expressing human CD16.sup.+ natural killer cell line might provide considerable long-term safety for disease treatment.
Claims
1-67. (canceled)
68. A composition comprising: at least a human cell with cytotoxic capability, wherein the human cell with cytotoxic capability has the following characteristics: i) carrying a phenotype of CD3.sup.−CD56.sup.+ and expressing a CD16 receptor; and ii) comprising at least an antigen-binding complex in the cell membrane, wherein the antigen-binding complex is a means for inducing the cytotoxic activity of the cell via being specifically bound by an antigen selected from cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, antigen peptide bound by major histocompatibility complex, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, MAGE, or other target antigen (marker) expressed by a target cell; wherein the cell is not genetically modified from the natural killer cell having the deposit number ATCC CRL-2407.
69. The composition according to claim 68, wherein the cell is non-tumorigenic in an immune compromised mouse; or wherein, after being irradiated with γ-ray, the cell is non-tumorigenic in an allogeneic subject.
70. The composition according to claim 68, wherein the cell is capable of mediating an antibody-dependent cell cytotoxicity (ADCC) response, and the cell is a male cell.
71. The composition according to claim 68, wherein the cell is a natural killer cell genetically modified to express the antigen-binding complex.
72. The composition according to claim 68, wherein the cell and the natural killer cell line NK3.3 are derived from different subjects.
73. The composition according to claim 68, wherein the cell is derived from a subject with a cancer.
74. The composition according to claim 68, wherein the cell is derived from a Caucasian male.
75. The composition according to claim 68, wherein the cell and the natural killer cell having the deposit number ATCC CRL-2407 are derived from the same subject.
76. The composition according to claim 68, wherein the cell retains its capability to proliferate after subculture for at least 1 month, 2 months, 3 months, 4 months, 5 months or 6 months.
77. The composition according to claim 68, wherein the antigen-binding complex is produced by the cell.
78. The composition according to claim 68, wherein the cell further exhibits IL-15 secretion capability, IL-18 secretion capability, IL-21 secretion capability, IL-2 secretion capability, or other proliferation-inducing cytokine secretion capability, or the combination thereof; or wherein the cell further carries a phenotype of CD2.sup.+; or wherein the cell further carries a phenotype of CD45.sup.+; or wherein the cell further carries a phenotype selected from CD4.sup.+, CD25.sup.+, NKp30.sup.+, NKG2D.sup.+, NKp44.sup.+, NKp46.sup.+, CD27.sup.+, OX40.sup.+, CD107a.sup.+, NKG2A.sup.+, PD-1.sup.+, SIRPα.sup.+, CD158.sup.+ or the combination thereof.
79. The composition according to claim 68, wherein the antigen-binding complex comprises CD3 zeta (CD3) subunit.
80. The composition according to claim 79, wherein the antigen-binding complex further comprises CD28 subunit, ICOS (CD278) subunit, 4-1BB (CD137) subunit, OX40 (CD134) subunit, CD27 subunit, CD40 subunit, CD40L subunit, TLRs subunit, or other costimulatory molecule expressed by at least one of effector cells, or the combination thereof.
81. The composition according to claim 68, wherein the cell further comprises a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding a target-binding single-chain variable fragment (scFv) against the antigen, and the target-binding single-chain variable fragment is at least a subunit of the antigen-binding complex.
82. The composition according to claim 68, wherein a chromosome DNA sequence of the cell is at least 90% or 95% similar to the corresponding chromosome DNA sequence of the natural killer cell deposited at NPMD having the deposit number NITE BP-03017.
83. The composition according to claim 68, wherein the cell does not include synthetic, genetically modified and/or deliberately delivered polynucleotide encoding the CD16 receptor.
84. The composition according to claim 68, wherein the number of the human cells in the composition is at least 5×10.sup.5 and the human cells are in an amount equal to or more than 5% by number, based on the total number of the cells in the composition as 100%.
85. A method of obtaining a composition substantially enriched in human cells according to claim 68; the method comprising: (a) obtaining a population of human CD16.sup.+ natural killer cells; and (b) delivering a polynucleotide encoding the antigen-binding complex comprising a target-binding single-chain variable fragment (scFv) against the antigen into the human CD16.sup.+ natural killer cells thereby obtaining the composition substantially enriched in human cells; wherein the human CD16.sup.+ natural killer cell has the following characteristics: i) a chromosome DNA sequence of the human CD16.sup.+ natural killer cells is at least 90% or 95% similar to the corresponding chromosome DNA sequence of the natural killer cell deposited at NPMD having the deposit number NITE BP-03017, and ii) not genetically modified from the natural killer cell having the deposit number ATCC CRL-2407.
86. The method according to claim 85, wherein the antigen-binding complex comprises a CD3 zeta (CD3ζ) peptide.
87. The method according to claim 86, wherein the antigen-binding complex further comprises CD28 peptide, ICOS (CD278) peptide, 4-1BB (CD137) peptide, OX40 (CD134) peptide, CD27 peptide, CD40 peptide, CD40L peptide, TLRs peptide, or other peptide of costimulatory molecule expressed by at least one of effector cells, or the combination thereof.
88. The method according to claim 86, the method further comprising a step: (c) in a container, contacting the human cells with a culture medium comprising 0.5-10 vol % human platelet lysate and 100-3000 IU/mL IL-2; and culturing the cells for multiple days.
89. A method of treating cancer, tumor, autoimmune disease, neuronal disease, human immunodeficiency virus (HIV) infection, hematopoietic cell-related diseases, metabolic syndrome, pathogenic disease, viral infection, or bacterial infection, comprising administering a composition comprising an effective amount of the cell selected form claim 68 to a subject in need thereof.
90. The method of claim 89, wherein the antigen is a cancer antigen.
91. The method according to claim 89, wherein the method is for treating cancer or tumor.
92. The method according to claim 89, wherein the method is for treating solid tumor or liquid tumor.
Description
BRIEF DESCRIPTION OF THE DRAWING
[0445]
[0446]
[0447]
[0448]
[0449]
[0450]
[0451]
[0452]
[0453]
[0454]
[0455]
[0456]
[0457]
[0458]
[0459]
[0460]
[0461]
[0462]
[0463]
[0464]
[0465]
[0466]
[0467]
[0468]
[0469]
[0470]
[0471]
[0472]
[0473]
[0474]
[0475]
[0476]
[0477]
[0478]
[0479]
[0480]
[0481]
[0482]
[0483]
[0484]
[0485]
[0486]
[0487]
DETAILED DESCRIPTION OF THE INVENTION
[0488] The following is a detailed description using the embodiments of the present invention as well as the techniques and features of the present invention, however, these embodiments are not intended to limit the invention, any changes and modifications made without departing from the spirit and scope of the invention by anyone who is familiar with this technology are intended to be included in the scope of the invention.
Embodiment 1: Obtaining CD16.SUP.+ Natural Killer Cell Line that does not Include Genetically Modified Polynucleotide Encoding the CD16 Receptor
[0489] Please refer to
[0490] Step S11: Obtaining a population of human peripheral blood natural killer cells derived from a cell population having the deposit number ATCC CRL-2407; Step S12: Contacting the population of human peripheral blood natural killer cells with an antibody specific for a CD16 receptor; Step S13: Separating cells that are specifically bound by the antibody thereby obtaining the CD16.sup.+ natural killer cell line that does not include genetically modified polynucleotide encoding the CD16 receptor.
[0491] Preferably, in Step S12, the CD16 receptor is a CD16a receptor.
[0492] Preferably, flow cytometry, bead, or any material with antibody-modified surface is used to separate the cells that are specifically bound by the antibody in Step S13.
[0493] Preferably, the term “CD16.sup.+ natural killer cell line that does not include genetically modified polynucleotide encoding the CD16 receptor” refers to non-genetically modified human CD16.sup.+ natural killer cell line and/or human CD16.sup.+ natural killer cell line without synthetic or exogenous polynucleotide sequence encoding the CD16 receptor.
[0494] Detailed description of preferred embodiment is elaborated below.
Embodiment 1.1 Label and Sorting of CD16.SUP.+ Natural Killer Cell Line that does not Include Genetically Modified Polynucleotide Encoding the CD16 Receptor
[0495] This embodiment consists of an experimental group and a control group. The population of human peripheral blood natural killer cells with the deposit number ATCC CRL-2407 was centrifuged at a speed of 100-1000×g for 3-5 minutes. The supernatant was removed, and the population of human peripheral blood natural killer cells was resuspended with a buffer. The population of human peripheral blood natural killer cells was evenly distributed into the cell culture dishes of the control group and the experimental group. The population of human peripheral blood natural killer cells of experimental group was cultured in said cell culture dishes containing cell culture medium (DMEM culture medium, alpha modification of Eagle's minimum essential medium, or XVIVO 10 culture medium), 0.5%-30% (Volume percent, vol %, v/v) Human platelet lysate, and 100-3000 IU/mL Interleukin 2 (IL-2), and then mixed with CD16 fluorescently labeled antibody (CD16-PE-Cy7, an antibody against CD16a receptor and CD16b receptor) to label the cells expressing CD16 receptor in the population of human peripheral blood natural killer cells; while the population of human peripheral blood natural killer cells of the control group was mixed with an equal volume of the buffer. The cells in the experimental group and control group were separately centrifuged, the supernatant was removed, and a sorting buffer was added to adjust the cell concentration to 1×10.sup.7 cells per mL. Finally, the cell population of the experimental and control groups were analyzed using a cell sorter.
[0496] Wherein, the buffer was Pre-Sort buffer, Flow cytometry sample preparation buffers, or Dulbecco's phosphate buffer saline (DPBS). The sorting buffer was Pre-Sort buffer, Flow cytometry sample preparation buffers, or Dulbecco's phosphate buffer saline (DPBS) supplemented with fetal bovine serum (FBS). The cell sorter was, for example, a flow cytometer of Becton Dickinson-FACSAria lllu model.
[0497] Preferably, the sorting buffer comprises 0.1˜10% (Volume percent, vol %, v/v) Fetal bovine serum (Fetal Bovine Serum, FBS).
[0498] Preferably, the sorting time is 1 hour, and the sorting speed is 50-70000 events/second.
[0499] After using the forward scatter (FSC) and side scatter (SSC) of the cell sorter to analyze 10,000 particles in the control group and the experimental group respectively, 6771 particles in the 10,000 particles in the control group were cells (that the amount of cells is 67.7% when the number of the total particles is 100%), and 6944 particles in the 10,000 particles in the experimental group were cells (when the number of the total particles is 100%, the amount of cells is 69.4%).
[0500] The results for fluorescent analysis of the control group cells are shown in
[0501] In
[0502] The results in
[0503] The results in
[0504] Cells expressing the CD16 receptor were sorted from the experimental group cells in order to obtain high-purity CD16.sup.+ cells (hereinafter referred to as “purified CD16.sup.+ cell population”, “isolated oNK”, or “isolated non-transgenic human CD16.sup.+ natural killer cell line”.)
[0505] Please refer to
[0506] The aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population are non-transgenic cells; all of the aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population have the feature of CD3.sup.−CD56.sup.+ after analysis, they can be continuously subcultured and are non-tumorigenic; therefore, aforesaid cell expressing CD16 receptor in the purified CD16.sup.+ cell population is a novel non-transgenic human CD16.sup.+ natural killer cell line.
Embodiment 2: Culturing Human CD16.SUP.+ Natural Killer Cells
[0507] Please refer to
[0508] Step S21: Obtaining human CD16.sup.+ natural killer cells;
[0509] Step S22: In the container, contacting the human CD16.sup.+ natural killer cells with a culture medium comprising human platelet lysate and IL-2; and
[0510] Step S23: Culturing the human CD16.sup.+ natural killer cells for multiple days to proliferate the human CD16.sup.+ natural killer cells.
[0511] The following describes a specific embodiment of culturing a non-transgenic human CD16.sup.+ natural killer cell line by the present invention, but the application of the invention is not limited thereto, which means the invention can also be used for culturing other human CD16.sup.+ natural killer cells. For example, primary CD16.sup.+ natural killer cell isolated from autologous or allogeneic blood, CD16-transgenic NK-92 cell line, or other human CD16.sup.+ natural killer cells.
Embodiment 2.1 Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0512] Step S21′: The purified CD16.sup.+ cell population (the proportion of cell expressing CD16 receptor was as high as 99%) sorted by Embodiment 1 was centrifuged and the supernatant was removed.
[0513] Step S22′: after resuspending the cells with 1 mL of cell culture medium, the cell suspension was placed in a first container to make the first container contain 6 54×10.sup.5 non-transgenic human CD16.sup.+ natural killer cell line in 40 mL cell culture medium; the cell culture medium comprises: 0.5%-30% (Volume percent, vol %, v/v) Human platelet lysate; 100-3000 IU/mL Interleukin 2 (IL-2); and DMEM culture medium (Dulbecco's Modified Eagle Medium), alpha modification of Eagle's minimum essential medium, or XVIVO 10 culture medium.
[0514] Step S23′: After multiple days of culture, a composition substantially enriched in human CD16.sup.+ natural killer cells was obtained, and in the composition substantially enriched in human CD16.sup.+ natural killer cells, the number of non-transgenic human CD16.sup.+ natural killer cell line is at lease 5×10.sup.5; the multiple days are, for example, 1 day to 3 years.
[0515] Preferably, the multiple days are 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, or 3 years.
[0516] Preferably, the cell culture medium comprises 0.5%, 1%, 1.5%, 1.6%, 2%, 2.5%, 2.6%, 3%, 3.5%, 3.6%, 4%, 4.5%, 4.6%, 5.0%, 5.1%, 5.5%, 5.6%, 6%, 6.1%, 6.5%, 6.6%, 7%, 7.1%, 7.5%, 7.6%, 8%, 8.1%, 8.5%, 8.6%, 9%, 9.1%, 9.5%, 9.6%, or 10% (Volume percent, vol %, v/v) human platelet lysate.
[0517] Preferably, the cell culture medium comprises 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, or 3000 IU/mL IL-2.
[0518] Preferably, Step S23′ further comprise substeps:
[0519] Step S231′: after multiple days of culture, the number of the cells in the cell culture medium reached the first cell number, and the first cell number was 1.25×10.sup.6˜5×10.sup.6;
[0520] Step S232′: The cell suspension was placed in a second container to make the number of cells in the second container be the first cell number; after multiple days of culture, the number of the cells reached the second cell number, and the second cell number was 5×10.sup.7˜1×10.sup.9; and
[0521] Step S233′: The cell suspension was placed in a third container to make the number of cells in the third container be the second cell number; after multiple days of culture, the number of the cells reached the third cell number in order to obtain a composition substantially enriched in human CD16.sup.+ natural killer cells; the third cell number was, for example, 5×10.sup.9, or 1×10.sup.40.
[0522] Wherein, the first container was, for example, a T25 cell culture flask (T25 flask), or G-Rex 6-well cell culture plate. The second and third containers comprised a gas permeable but water impermeable membrane, or, the second and third container can make concentration of the dissolved oxygen fully aerated or make the concentration of the dissolved glucose in the culture medium maintain in the 1500-5000 mg/L. Preferably, the second container was, for example, G-Rex 100M bottle (Product number 81100, WILSON WOLF, USA), the third container was, for example, G-Rex-500M (Product number 85500S, WILSON WOLF, USA). Please refer to the product manual of these containers for the instruction of using G-Rex 6M 6-well cell culture plate-, G-Rex 100M bottle, and G-Rex-500M.
[0523] In the steps S23′ and S231′˜S233′, 0.5%-30% (Volume percent, vol %, v/v) Human platelet lysate and 100-3000 IU/mL Interleukin 2 (IL-2) were added to a medium for culturing the cells. And the medium is for example, DMEM culture medium (Dulbecco's Modified Eagle Medium), alpha modification of Eagle's minimum essential medium, XVIVO 10 culture medium, or X-VIVO 10 Serum-free Hemapoietic Cell Medium.
[0524] In the steps S23′ and S231′˜S233′, the cells were incubated under the condition of 37° C. and 5% carbon dioxide.
Embodiment 2.2 Detecting Cell Viability of the Cultured Cells Obtained from Embodiment 2.1
[0525] Each sample of the cell suspensions, which were obtained by culturing for different days with the culture method disclosed in the embodiments 2.1, was mixed with an equal volume of Trypan blue, and the number of cells and the cell survival rate were observed.
[0526] The experimental results showed that after culturing for 7, 16, 21, 28, 37, 42, 49, 65, 92, 97, 103, 134, 166, 184, and 202 days, the number of cells respectively reached 1.61×10.sup.6, 1.01×10.sup.9, 2.53×10.sup.9, 5.06×10.sup.9, 1.01×10.sup.10, 1.62×10.sup.10, 3.24×10.sup.10, 1.13×10.sup.11, 1.81×10′.sup.5, 3.25×10.sup.16, 6.50×10.sup.17, 1.35×10.sup.22, 3.24×10.sup.27, 1.30×10.sup.33, and 1.04×10.sup.39. Please refer to
Embodiment 3: Detection of Cell Condition and Cell Surface Markers
Embodiment 3.1 Long-Term Culture of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line by the Culture Method of the Present Invention
[0527] There are two experimental trials in this embodiment. The first batch of the purified CD16.sup.+ cell population and the second batch of the purified CD16.sup.+ cell population (the proportions of cells expressing the CD16 receptor in both of the batches were as high as 99%) were sorted by the method of Embodiment 1.1, then the first batch of the purified CD16.sup.+ cell population and the second batch of the purified CD16.sup.+ cell population were cultured respectively by the culture method of Embodiment 2.1 to obtain the cell suspensions of the first experimental trial and the cell suspensions of the second experimental trial. The first batch of the purified CD16.sup.+ cell population was cultured for 35 days in total, while the second batch of the purified CD16.sup.+ cell population was cultured for at least a long period of time until day 202.
Embodiment 3.2 Detecting the Condition of the Cultured Cells
[0528] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mix with 1 μL of propidium iodide (PI). The cell sorter or flow cytometer was used to detect whether the cells were stained with propidium iodide to determine the percentage of cells that were undergoing apoptosis or have died.
Embodiment 3.3 Detection of CD56 CD3 and CD2 Surface Markers of the Cultured Cells
[0529] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD56 fluorescent labeled antibody (Cat. No. 318304, Biolegend, USA), 14, of CD3 fluorescent labeled antibody (Cat. No. 300410, Biolegend, USA), and 1 μL of CD2 fluorescent labeled antibody (Cat. No. 300222, Biolegend, USA) to simultaneously label cells expressing CD56 molecule, CD3 molecule, and/or CD2 molecule. Finally, the cell sorter or flow cytometer was used to analyze whether the cells exhibited CD56 molecules, CD3 molecules, and/or CD2 molecules, and the percentage of cells with various cell surface makers was calculated.
Embodiment 3.4 Detection of CD16 Surface Markers of the Cultured Cells
[0530] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 3.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD16 fluorescent labeled antibody (Cat. No. 302016, Biolegend, USA) to label cells expressing the CD16 receptor. Finally, the cell sorter was used to analyze whether the cells exhibited CD16 receptor, and the percentage of cells with CD16 receptor was calculated.
Embodiment 3.5 Detection of Cytotoxic Function of the Cultured Cells
[0531] xCELLigence Real Time Cell Analysis System (xCELLigence RTCA system, ACEA Biosciences Inc., USA) was used in this embodiment to detect the cytotoxic ability of the cultured cell toward target cells. This embodiment comprised a 96well xCELLigence E-Plate to carry out cytotoxicity test, and the wells in xCELLigence E-Plate were divided into control wells, experimental wells, and target cell maximum lysis control well. The effector cells used in this embodiment were the cell suspensions obtained by culturing at different time points in Embodiment 3.1, and the target cells were SK-OV-3 cell line (HTB-77, purchased from ATCC), which is an adherent ovarian cancer cell line. SK-OV-3 cells were seeded in control well, experimental well, and target cell maximum lysis control well, so that each well-contained 20000 SK-OV-3 cells, and then allowed it to sit 30 minutes.
[0532] A sample of the cell suspension obtained in Embodiment 3.1 was added to the experimental well, and the ratio of the number of effector cell to the number of SK-OV-3 cells (target cells) was 2, 5 and 10; added a tenth equal volume of lysis buffer to the sample of cell suspension into target cell maximum lysis control well; any sample or lysis buffer was not added to control well. The xCELLigence E-Plate was placed in the xCELLigence Real Time Cell Analysis System to detect real time change in the cell index (CI) under the condition of 37° C. and 5% carbon dioxide.
[0533] Wherein, the greater the number of target cells attached to the bottom of the xCELLigence E-Plate, the higher the cell index detected by the xCELLigence Real Time Cell Analysis System. Therefore, the cell index can be used to convert the percentage of target cells that are lysed in the experimental well. The formula used to convert the cell index to the percentage of target cells that are lysed in the experimental well is:
Percentage of lysed target cell (%)=1−[(cell index of experimental well−cell index of target cell maximum lysis control well)−(cell index of control well−cell index of target cell maximum lysis control well)]×100%
[0534] Please refer to Table 1 and Table 2. Table 1 shows the results of the cell suspensions obtained from the first experimental trial, and Table 2 shows the results of the cell suspension obtained from the second experimental trial.
[0535] In Table 1, the first column “day” indicates the number of culture days; the second column “PI” indicates the percentage of cells undergoing apoptosis or have died, based on the total number of the cells in the cell suspension as 100%; since natural killer cells, CD4.sup.+ T cells, and CD8.sup.+ T cells all exhibit CD56+(Pernick, N, 2018), so the third column “CD56.sup.+” indicates the percentage of the total number of natural killer cells, CD4.sup.+ T cells, and CD8.sup.+ T cells, based on the total number of the cells in the cell suspension as 100%; since T cells all exhibit CD3+(Pernick, N, 2018), the fourth column“CD3.sup.−” indicates the percentage of cells that are not T cells, based on the total number of the cells in the cell suspension as 100%; since natural killer cells, peripheral blood T cells, and most thymocytes all exhibit CD2.sup.+ (Pernick, N, 2018) and the cells to be bested in Embodiment 3 are derived from peripheral blood, so the fifth column “CD2.sup.+” indicates the percentage of the total number of natural killer cells and T cells, based on the total number of the cells in the cell suspension as 100%; the sixth column “CD56.sup.+CD3.sup.−” indicates the percentage of natural killer cells, based on the total number of the cells in the cell suspension as 100%; the seventh column “CD56.sup.+CD2.sup.+” indicates percentage of the total number of natural killer cells and T cells, based on the total number of the cells in the cell suspension as 100%; since natural killer cell and macrophage exhibit CD16.sup.+ (Pernick, N, 2018), and CD16 is involved in Antibody-dependent cell cytotoxicity (ADCC), the eighth column “CD16.sup.+” indicates the percentage of the total number of natural killer cells and macrophages with ADCC function, based on the total number of the cells in the cell suspension as 100%; the ninth column “CD56.sup.+CD16.sup.+” indicates the percentage of natural killer cells with ADCC function, based on the total number of natural killer cells (i.e., CD56.sup.+CD3.sup.− cells) as 100%.
[0536] The indication of the first to eighth columns in Table 2 is the same as in Table 1; when the ninth column “killing test” marks “✓” symbol, this indicates that the cytotoxic function of the cells in the cell suspension at certain time point was simultaneously tested and confirmed that the cells have cytotoxic function.
[0537] Table 1 shows that (1) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population (wherein the proportion of human CD16.sup.+ natural killer cell line is as high as 99%) was cultured for 7˜35 days, the percentage of cells undergoing apoptosis or have died is 5.65%˜7.34%, thus, the percentage of cell survival during culture is 92.66%−94.35%; (2) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell, CD4.sup.+T cell, and CD8.sup.+T cell is 99.08˜99.56%, based on the total number of the cells in the cell suspension as 100%; (3) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of cells that are not T cells is 99.88˜100%, based on the total number of the cells in the cell suspension as 100%; (4) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell and T cell is 98.08˜99.22%, based on the total number of the cells in the cell suspension as 100%; (5) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of natural killer cells is 98.21˜98.76%, based on the total number of the cells in the cell suspension as 100%; (6) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of total number of natural killer cell and T cell is 98.78˜99.33%, based on the total number of the cells in the cell suspension as 100%; (7) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of the total number of natural killer cells and macrophages with ADCC function is 90.17˜92.36%, based on the total number of the cells in the cell suspension as 100%; (8) in the cell suspension that was obtained after the first batch of the purified CD16.sup.+ cell population was cultured for 7˜35 days, the percentage of natural killer cell with ADCC function is 88.79˜92.11%, based on the total number of natural killer cell (i.e., CD56.sup.+CD3.sup.− cell) as 100%.
TABLE-US-00001 TABLE 1 the test result of cell condition and cell surface marker of the cell suspension obtained by culturing the first batch of the purified CD16.sup.+ cell population. PI.sup.+ CD56.sup.+ CD3.sup.− CD2.sup.+ CD56.sup.+CD3.sup.− CD56.sup.+CD2.sup.+ CD16.sup.+ CD56.sup.+/CD16.sup.+ (% of (% of (% of (% of (% of (% of (% of (% of total total total total total total total CD56.sup.+CD3.sup.− Day cells) cells) cells) cells) cells) cells) cells) cells) 7 6.54 99.45 100 98.08 98.76 99.01 90.17 — 16 5.65 99.08 99.96 98.86 98.21 98.78 90.35 — 21 7.34 99.56 99.9 98.75 98.71 99.33 90.67 — 23 — — — — — — — 88.79 26 — — — — — — — 90.51 28 7.18 99.33 99.88 99.22 98.29 99.15 92.36 — 30 — — — — — — — 92.11 35 — — — — — — — 91.37
[0538] Table 2 shows that (1) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population (wherein the proportion of human CD16.sup.+ natural killer cell line is as high as 99%) was cultured for 7-202 days, the percentage of cells undergoing apoptosis or have died is 2.7%-10.5%, thus, the percentage of cell survival during culture is 89.5%-97.3%; (2) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of total number of natural killer cell, CD4.sup.+ T cell, and CD8.sup.+ T cell is 98.85%-99.65%, based on the total number of the cells in the cell suspension as 100%; (3) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of cells that are not T cells is 99.82%-100%, based on the total number of the cells in the cell suspension as 100%; (4) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of total number of natural killer cell and T cell is 94.5%-99.68%, based on the total number of the cells in the cell suspension as 100%; (5) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of natural killer cells is 97.65%-99.05%, based on the total number of the cells in the cell suspension as 100%; (6) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of total number of natural killer cell and T cell is 97.83%-99.61%, based on the total number of the cells in the cell suspension as 100%; (7) in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days, the percentage of the total number of natural killer cells and macrophages with ADCC function is 83.88%-94.04%%, based on the total number of the cells in the cell suspension as 100%; (8) The cell in the cell suspension that was obtained after the second batch of the purified CD16.sup.+ cell population was cultured for 7-202 days was confirmed to have cytotoxic function.
[0539] The cell suspension obtained by culturing for 28 days with the culture method disclosed in the embodiment 2.1 has been deposited at NPMD with the deposit number NITE BP-03017. The results disclosed in this invention indicate that the oNK cell line could retain its capability to proliferate after subculture for at least 3 months and thus may comprised deregulated genes responsible for cell growth control (e.g. the oNK cell line may comprised an inactive tumor suppressor gene, or a mutated and highly expressed oncogene).
TABLE-US-00002 TABLE 2 the test results of cell condition, cell surface marker and cytotoxicity of the cell suspension obtained by culturing the second batch of the purified CD16.sup.+ cell population. PI.sup.+ CD56.sup.+ CD3.sup.− CD2.sup.+ CD56.sup.+CD3.sup.− CD56.sup.+CD2.sup.+ CD16.sup.+ (% of (% of (% of (% of (% of (% of (% of Total cell total total total total total total total Killing Day number cells) cells) cells) cells) cells) cells) cells) test 7 1.61 × 10.sup.6 5.97 99.45 100.00 98.08 98.76 99.01 90.17 16 1.01 × 10.sup.9 5.65 99.09 99.96 98.86 98.21 98.8 90.36 21 2.53 × 10.sup.9 6.2 99.56 99.91 98.75 98.72 99.33 90.7 28 5.06 × 10.sup.9 6.46 99.33 99.88 99.22 98.29 99.15 92.36 37 1.01 × 10.sup.10 10.5 98.85 99.99 98.48 97.65 98.66 91.96 42 1.62 × 10.sup.10 9.63 99.15 100.00 98.24 98.06 98.8 93.09 49 3.24 × 10.sup.10 6.31 98.99 100.00 94.5 97.71 97.83 94.04 65 1.13 × 10.sup.11 4.41 99.15 99.99 98.55 97.81 98.85 90.35 92 1.81 × 10.sup.15 2.7 99.62 99.99 99.43 98.58 99.42 85.99 ✓ 97 3.25 × 10.sup.16 7.91 99.23 99.90 99.58 98.3 99.05 86.98 ✓ 103 6.50 × 10.sup.17 3.17 99.65 99.82 99.5 98.71 99.45 83.88 ✓ 134 1.35 × 10.sup.22 3.09 99.62 99.99 99.68 98.75 99.42 86.18 ✓ 166 3.24 × 10.sup.27 4.74 99.17 100.00 99.06 99.05 99.61 89.93 ✓ 184 1.30 × 10.sup.33 7.87 99.61 99.99 98.23 98.77 99.37 92.38 ✓ 202 1.04 × 10.sup.39 5.36 99.59 99.96 97.52 98.94 99.33 93.02 ✓
Embodiment 3.6 Detection of Activation Markers, Inhibitory Markers, and Other NK Cell Markers of the Cultured Cells
[0540] Cell suspensions obtained by culturing for 93 days with the culture method disclosed in the embodiments 2.1 (refer to as 93-day cultured oNK suspension) were used in this embodiment. Cells in the Cell suspensions were evenly assigned into 19 groups. Cells in the first group were centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD56 fluorescent labeled antibody (Cat. No. 318304, Biolegend, USA), 1 L of CD3 fluorescent labeled antibody (Cat. No. 300410, Biolegend, USA), and 1 μL of CD2 fluorescent labeled antibody (Cat. No. 300222, Biolegend, USA) to simultaneously label cells expressing CD56 molecule, CD3 molecule, and/or CD2 molecule. Finally, the cell sorter or flow cytometer was used to analyze whether the cells exhibited CD56 molecules, CD3 molecules, and/or CD2 molecules, and the percentage of cells with various cell surface makers was calculated.
[0541] Cells in the other 18 groups were centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then respectively mixed with 1 μL of CD16 fluorescent labeled antibody (Cat. No. 302016, Biolegend, USA), CD45 fluorescent labeled antibody (Cat. No. 368512, Biolegend, USA), CD4 fluorescent labeled antibody (Cat. No. 300514, Biolegend, USA), CD8 fluorescent labeled antibody (Cat. No. 344706, Biolegend, USA), CD19 fluorescent labeled antibody (Cat. No. 302210, Biolegend, USA), CD25 fluorescent labeled antibody (Cat. No. 302614, Biolegend, USA), NKp30 fluorescent labeled antibody (Cat. No. 325214, Biolegend, USA), NKG2D fluorescent labeled antibody (Cat. No. 320812, Biolegend, USA), NKp44 fluorescent labeled antibody (Cat. No. 325116, Biolegend, USA), NKp46 fluorescent labeled antibody (Cat. No. 331916, Biolegend, USA), CD27 fluorescent labeled antibody (Cat. No. 47-0279-42, Invitrogen, USA), OX40 fluorescent labeled antibody (Cat. No. 350004, Biolegend, USA), CD107a fluorescent labeled antibody (Cat. No. 328630, Biolegend, USA), NKG2A fluorescent labeled antibody (Cat. No. FAB1059P, R&D Systems, USA), PD-1 fluorescent labeled antibody (Cat. No. 367406, Biolegend, USA), TIGIT fluorescent labeled antibody (Cat. No. 372704, Biolegend, USA), SIRPα fluorescent labeled antibody (Cat. No. 372104, Biolegend, USA), and CD158 fluorescent labeled antibody (Cat. No. FAB1848P, R&D Systems, USA).
[0542] Finally, the cell sorter was used to analyze whether the cells exhibited CD16 receptor, CD45 marker, CD4 marker, CD8 marker, CD19 marker, CD25 marker, NKp30 marker, NKG2D marker, NKp44 marker, NKp46 marker, CD27 marker, OX40 marker, CD107a marker, NKG2A marker, PD-1 marker, TIGIT marker, SIRPα marker, and CD158 marker.
[0543] Among these markers, CD16, CD25, NKp30, NKG2D, NKp44, NKp46, and CD107a are activation markers, whereas NKG2A, PD-1, TIGIT, SIRPα. CD27, OX40, and CD158 are inhibitory markers. Based on the knowledge of those skilled in the art, expression of activation markers potentiates anti-tumor activity of NK cells, whereas expression of inhibitory markers potentiates function inhibition of NK cells.
[0544] Please refer to Table 3. Table 3 shows the test result of the activation markers, inhibitory markers, and other NK cell markers of the cell suspensions obtained from embodiments 2.1.
[0545] Table 3 shows that the purified CD16.sup.+ populations express CD56 (98.0±0.2%), CD2 (99.5±0.2%), CD45 (99.7±0.1%), CD4 (0.8±0.3%), CD3 (0.0±0.0%), CD8 (0.0±0.0%), CD19 (0.0±0.0%), CD16 (85.7±7.0%), CD25 (42.3±13.1%), NKp30 (93.6±4.3%), NKG2D (46.1±17.4%), NKp44 (75.1±13.3%), NKp46 (46.4±16.9%), CD27 (0.62±0.08%), OX40 (0.11±0.03%), CD107a (96.1±4.3%), NKG2A (0.14±0.15%), PD-1 (27.0±19.4%), TIGIT (4.3±6.5%), SIRPα (3.2±3.0%), and CD158 (0.4±0.3%). All of the aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population have the feature of CD3.sup.−CD56.sup.+ after analysis. Preferably, the aforesaid cells expressing CD16 receptor in the purified CD16.sup.+ cell population is positive for CD2, CD45, and CD4 and negative for CD8 and CD19. The positiveness of CD4 is an unexpected result.
TABLE-US-00003 TABLE 3 the test result of the activation markers, inhibitory markers, and other NK cell markers of the cell suspensions obtained from embodiments 2.1. Marker CD56 CD2 CD45 CD4 CD3 CD8 CD19 % of positive 98.0 ± 0.2 99.5 ± 0.2 99.7 ± 0.1 0.8 ± 0.3 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 population Marker CD16 CD25 NKp30 NKG2D NKp44 NKp46 CD27 OX40 CD107a % of positive 85.7 ± 7.0 42.3 ± 13.1 93.6 ± 4.3 46.1 ± 17.4 75.1 ± 13.3 46.4 ± 16.9 0.62 ± 0.08 0.11 ± 0.03 96.1 ± 4.3 population Marker NKG2A PD-1 TIGIT SIRPα CD158 % of positive 0.14 ± 0.15 27.0 ± 19.4 4.3 ± 6.5 3.2 ± 3.0 0.4 ± 0.3 population
Embodiment 4: Non-Tumorigenicity of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0546] Six to eight-week-old female BALB/c nude mice (purchased from The Jackson Laboratory or BioLasco, Taiwan) were used in this Embodiment. 30 mice were randomly assigned into six groups, which were a SK-OV-3 group, Raji group, Daudi group, oNK group, γ-ray irradiated ACE-oNK group, and DPBS group.
[0547] A human ovarian cancer cell line “SK-OV-3” (Purchased from ATCC; The deposit number is ATCC HTB-77), human B lymphoblastoid cell lines “Raji” (Purchased from ATCC; The deposit number is ATCC CCL-86) and “Daudi” (Purchased from ATCC; The deposit number is ATCC CCL-213), a cell suspension that was obtained by culturing for 88 days with the culture method disclosed in the embodiments 2.1 (88-day cultured oNK suspension of the present invention, refer to as 88-day cultured oNK suspension), and a γ-ray irradiated ACE-oNK cell suspension were used in this Embodiment. The method for preparing γ-ray irradiated ACE-oNK cell suspension was described below.
[0548] γ-ray irradiated ACE-oNK cell suspension: the cell suspension that was obtained by culturing for 84 days with the culture method disclosed in the embodiments 2.1 (84-day cultured oNK suspension of the present invention, refer to as 84-day cultured oNK suspension) were gamma irradiated at dose 10 Gy. After binding Trastuzumab to cells in the γ-ray irradiated 84-day cultured oNK suspension using a cell linker and a Trastuzumab linker which are complementary, the γ-ray irradiated ACE-oNK cell suspension were obtained.
[0549] The procedure of binding Trastuzumab to cells (e.g., natural killer cells, cells in the 60-day cultured oNK suspension, cells in the γ-ray irradiated 60-day cultured oNK suspension) was as follows: (A) The step of preparing cell linker and binding the cell linker to the cell in order to prepare a cell-ssDNA conjugate; (B) The step of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab in order to prepare the Trastuzumab-ssDNA conjugate; (C) Mixing cell-ssDNA conjugate and Trastuzumab-ssDNA conjugate to combine cell-ssDNA conjugate and Trastuzumab-ssDNA conjugate through the cell linker and its complementary sequence on the Trastuzumab linker in order to prepare Trastuzumab-conjugated cells.
[0550] Wherein the step (A) of preparing cell linker and binding the cell linker to the cell comprises the following steps (a1)˜(a4):
[0551] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0552] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0553] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0554] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 cells and incubated for 1-60 minutes to obtain cell-ssDNA conjugate.
[0555] The step (B) of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab comprises the following steps (b1)˜(b4):
[0556] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0557] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain a Trastuzumab linker stock. The Trastuzumab linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0558] Step (b3) 10-500 μL Trastuzumab linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0559] Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL Trastuzumab stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain Trastuzumab-ssDNA conjugate.
[0560] The cell-ssDNA conjugate and the Trastuzumab-ssDNA conjugate were mixed to obtain Trastuzumab-conjugated cell such as cells in the γ-ray irradiated ACE-oNK cell suspension.
[0561] 1×10.sup.7 SK-OV-3 cells, 1×10.sup.7 Raji cells, 1×10.sup.7 Daudi cells, 1×10.sup.7 cells in the 60-day cultured oNK suspension, and 1×10.sup.7 cells in γ-ray irradiated ACE-oNK cell suspension were suspended respectively in 100 μL, of Dulbecco's Phosphate-Buffered Saline (DPBS) to obtain different cell suspensions. The cell suspensions and 100 μL, of DPBS were subcutaneously implanted in female BALB/c nude mice in SK-OV-3 group, Raji group, Daudi group, oNK group, γ-ray irradiated ACE-oNK group, and DPBS group on Day 0 respectively. Tumor growth in each mouse was observed on Day 14, Day 21, Day 24, Day 42, and Day 59, and the mice were euthanized on Day 59.
[0562] Please refer to Table 4. Table 4 shows the results of tumor formation in nude mice xenografted with different cell lines.
[0563] Table 4 shows that there was no tumor formation in the mice of DPBS groups (negative control group) throughout the study period (0/5, 0%), while all five mice in SK-OV-3 group (positive control group) developed tumors (5/5, 100%). For mice xenografted with lymphoma cell line Daudi, 4 out of 5 mice in Daudi group developed tumors (4/5, 80%) that lasted until end of study (Day 59). For mice xenografted with lymphoma cell line Raji, 1 out of 5 (1/5) mice harbored detectable tumor before Day 42, but then returned to unmeasurable size by end of study.
[0564] For mice xenografted with oNK cells or γ-ray irradiated ACE-oNK cells of the present invention, there was no tumor formation in mice in oNK group and γ-ray irradiated ACE-oNK group throughout the study period (0/5, 0%). These study results provide evidence that non-irradiated oNK cells and the Trastuzumab-conjugated irradiated ACE-oNK cells are non-tumorigenic and safe for future clinical application and disease treatment.
TABLE-US-00004 TABLE 4 the results of tumor formation in nude mice xenografted with different cell lines. Tumor incidence Cell type Day 14 Day 21 Day 24 Day 42 Day 59 SK-OV-3 suspension 5/5 5/5 5/5 5/5 5/5 Raji suspension 1/5 1/5 1/5 0/5 0/5 Daudi suspension 0/5 3/5 4/5 4/5 4/5 Non-irradiated oNK 0/5 0/5 0/5 0/5 0/5 suspension ACE-oNK-HER2 0/5 0/5 0/5 0/5 0/5 suspension DPBS 0/5 0/5 0/5 0/5 0/5
Embodiment 5: Cytotoxicity of the Cultured Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line Against Different Cancer Cells
[0565] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is the cell suspension that was obtained by culturing for 104 days with the culture method disclosed in the embodiments 2.1 (104-day cultured oNK suspension of the present invention, refer to as 104-day cultured oNK suspension wherein the proportion of human CD16.sup.+ natural killer cell line is 82.51%), (2) the target cells used in this embodiment are SK-OV-3 (a human ovarian cancer cell line), SK-BR-3 (a human breast cancer cell line), OVCAR-3 (a human ovarian cancer cell line), MCF-7 (a human breast cancer cell line), A549 (a human lung carcinoma cell line), and T24 (a human bladder carcinoma cell line); and (3) the ratio of the number of effector cells to the number of target cells is 1:1, 2:1 and 5:1 (ET1, ET2 and ET5).
[0566] Please refer to
[0567] These study results provide evidence that the cultured non-transgenic CD16.sup.+ natural killer cell line kill 4.33±3.43% to 92.98±1.06% of SK-OV-3, 12.23±0.09% to 87.88±0.01% of SK-BR-3, 47.78±0.09% to 81.30±0.52% of OVCAR-3, 27.02±5.05% to 85.15±0.01% of MCF-7, 31.68±3.00% to 90.74±0.22% of A549 and 27.77±1.57% to 37.09±2.21% of T24 at the ratio of the number of effector cells to the number of target cells being 1:1 to 5:1 (ET1 to ET5). Thus, the cultured non-transgenic CD16+ natural killer cell line harbors effective cytotoxicity against diverse types of cancer cells.
Embodiment 6: The Comparison of the Cytotoxic Activity Between the Cultured Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line and NK-92 Cell Line
[0568] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} the cell suspension that was obtained by culturing for 33 days with the culture method disclosed in the embodiments 2.1 (33-day cultured oNK suspension of the present invention, refer to as 33-day cultured oNK suspension wherein the proportion of human CD16.sup.+ natural killer cell line is 91.74%), or {circle around (2)} the population of human peripheral blood natural killer cells having the deposit number ATCC CRL-2407 (refer to as NK-92 suspension wherein the proportion of NK-92 cell line is at least 98% as shown in
[0569] Please refer to
[0570] Thus, the result shows that: as compare with NK-92 cells (NK-92 is a CD16.sup.− natural killer cell line and thus unable to destroy cancer cells through ADCC process), oNK cells that were not activated to induce ADCC reaction could cause about 21-fold increase of cytotoxicity (49.68÷2.4=21). This is an unexpected result.
[0571] Moreover, based on this result, applicant believe that after isolating human CD16.sup.+ natural killer cell line from the 33-day cultured oNK suspension (cultured oNK) and isolating CD16.sup.− natural killer cell line (NK-92) from the NK-92 suspension, similar unexpected result could be observed.
Embodiment 7: The Comparison of the Cytotoxic Activity Between Different Amount of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0572] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} the cell suspension that was obtained by culturing for X days with the culture method disclosed in the embodiments 2.1 (X-day cultured oNK suspension of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 8.91%, refer to as suspension with small number of oNK cells), {circle around (2)} the cell suspension that was obtained by culturing for Y days with the culture method disclosed in the embodiments 2.1 (Y-day cultured oNK of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 64.15%, refer to as suspension with medium number of oNK cells), {circle around (3)} the cell suspension that was obtained by culturing for Z days with the culture method disclosed in the embodiments 2.1 (Z-day cultured oNK of the present invention wherein the proportion of human CD16.sup.+ natural killer cell line is 91.74%, refer to as suspension with large number of oNK cells), {circle around (4)} the population of human peripheral blood natural killer cells with the deposit number ATCC CRL-2407 (refer to as NK-92 suspension wherein the proportion of NK-92 cell line is at least 98% as shown in
[0573] The method for preparing the suspension with small number of ACE-oNK-HER2 cells, the suspension with medium number of ACE-oNK-HER2 cells, and the suspension with large number of ACE-oNK-HER2 cells were described below.
[0574] The suspension with small number of ACE-oNK-HER2 cells: the total cells in “the suspension with small number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with small number of ACE-oNK-HER2 cells were obtained wherein the proportion of ACE-oNK-HER2 cells is about 8.91%.
[0575] The suspension with medium number of ACE-oNK-HER2 cells: the total cells in “the suspension with medium number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with medium number of ACE-oNK-HER2 cells was obtained wherein the proportion of ACE-oNK-HER2 cells is about 64.15%.
[0576] The suspension with large number of ACE-oNK-HER2 cells: the total cells in “the suspension with large number of oNK cells” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary, and therefore the suspension with large number of ACE-oNK-HER2 cells was obtained wherein the proportion of ACE-oNK-HER2 cells is about 91.74%.
[0577] The procedure of binding Trastuzumab to cells (cells in the suspension with small number of oNK cells, the suspension with medium number of oNK cells, or the suspension with large number of oNK cells) is same as that of Embodiment 4.
[0578] Please refer to
[0579]
[0580] Thus, the result shows that: as compare with NK-92 cells (NK-92 is a CD16.sup.− natural killer cell line and thus unable to destroy cancer cells through ADCC process), the suspension with small number of oNK cells (wherein the proportion of human CD16.sup.+ natural killer cell line is 8.91%) is enough to cause about 10-fold increase of cytotoxicity (25±2.4=10). This is an unexpected result. Therefore, it indicated that human CD16.sup.+ natural killer cell line in an amount equal to or more than 5% by number is enough to kill cancer cells, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar unexpected result could be observed in clinical trials.
[0581] The result also shows that the suspension with medium or large number of oNK cells (wherein the proportion of human CD16.sup.+ natural killer cell line is 64.15% or 91.74%) could cause about 20-21 fold increase of cytotoxicity (47.60±2.4=20; 49.68±2.4=21). Therefore, it indicates that the more the human CD16.sup.+ natural killer cell line, the more the cancer cells are killed and then reach a plateau as the human CD16.sup.+ natural killer cell line in an amount equal to about 60%-65% by number, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar result could be observed in clinical trials.
[0582]
[0583] Thus, the result shows that: when the non-transgenic human CD16.sup.+ natural killer cell line obtained by the culture of the present invention was linked with antibodies targeting the tumor-associated antigens (such as Trastuzumab) by using a cell linker and an antibody linker (such as Trastuzumab linker) which are complementary and thus could be activated to induce ADCC reaction, the cytotoxic effect was significantly increased by 14.4%-38.7% (62.00%−47.60%=14.4%; 63.70%−25.00%=38.7%).
[0584] The result also shows that exogeneous targeting unit complexed-oNK cell (such as anti-HER2 antibody-conjugated oNK cells) in an amount equal to or more than 5% by number is enough to kill cancer cells through ADCC process; it also indicates that the more the exogeneous targeting unit complexed-oNK cell, the more the cancer cells are killed through ADCC process and reach a first plateau as the exogeneous targeting unit complexed-oNK cell in an amount equal to about 5%-10% by number, based on the total number of the cells in the composition as 100%. Based on this result, applicant believes that similar result could be observed in clinical trials.
Embodiment 8: The Comparison of the Cytotoxic Activity Between the Anti-HER2 Antibody-Conjugated Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line and the Anti-HER2 Antibody Co-Cultured Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0585] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is {circle around (1)} cell suspensions obtained by culturing for 55 days with the culture method disclosed in the embodiments 2.1 (refer to as 55-day cultured oNK suspension), or {circle around (2)} cell suspension with ACE-oNK-HER2 cells (the total cells in “55-day cultured oNK suspension” were linked with Trastuzumab by using a cell linker and a Trastuzumab linker that are complementary as described in Embodiment 4); (2) the ratio of the number of effector cells (the total cells in the 55-day cultured oNK suspension or the total cells in the cell suspension with ACE-oNK-HER2 cells) to the number of SK-OV-3 cells (target cells) is 1:1 (ET1), 2:1 (ET2), or 5:1 (ET5); and (3) In the experimental wells for the 55-day cultured oNK suspension, equivalent amount of Trastuzumab as the total amount of the Trastuzumab linked to the cells in the cell suspension with ACE-oNK-HER2 cells at E:T ratio of 1 (0.55 ng), 2 (1.10 ng) and 5 (2.75 ng) was added. The detail procedure was described below.
[0586] The wells in xCELLigence E-Plate were divided into control wells, ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, ACE-oNK-HER2 ET5 experimental well, oNK and Herceptin ET1 experimental well, oNK and Herceptin ET2 experimental well, oNK and Herceptin ET5 experimental well, and target cell maximum lysis control well. SK-OV-3 cells were seeded in control well, ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, ACE-oNK-HER2 ET5 experimental well, oNK and Herceptin ET1 experimental well, oNK and Herceptin ET2 experimental well, oNK and Herceptin ET5 experimental well, and target cell maximum lysis control well, so that each well-contained 20000 SK-OV-3 cells, and then allowed it to sit 30 minutes.
[0587] 20000, 40000, or 100000 cells in the cell suspension with ACE-oNK-HER2 cells was added to the ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, and ACE-oNK-HER2 ET5 experimental well respectively; hence, the ratio of the number of effector cell (the total cells in the cell suspension with ACE-oNK-HER2 cells) to the number of SKOV-3 cells (target cells) was 1, 2 and 5.
[0588] Both of 20000, 40000, or 100000 cells in the 55-day cultured oNK suspension and 0.55, 1.10, or 2.75 ng of Trastuzumab (an antibody against HER2 protein with product name as Herceptin was purchased from Roche Swiss) were added to the “oNK and Herceptin ET1 experimental well”, “oNK and Herceptin ET2 experimental well”, and “oNK and Herceptin ET5 experimental well” respectively. Therefore, the ratio of the number of effector cell (the total cells in the 55-day cultured oNK suspension) to the number of SK-OV-3 cells (target cells) was 1, 2 and 5; the amount of Trastuzumab in the “oNK and Herceptin ET1 experimental well”, “oNK and Herceptin ET2 experimental well”, or “oNK and Herceptin ET5 experimental well” was respectively same as the total amount of the Trastuzumab linked to the cells in the ACE-oNK-HER2 ET1 experimental well, ACE-oNK-HER2 ET2 experimental well, and ACE-oNK-HER2 ET5 experimental well.
[0589] Please refer to
[0590] Thus, the result shows that: as compare with oNK cells that were co-cultured with IgG antibodies targeting the tumor-associated antigens, ACE-oNK-HER2 cells that were linked (conjugated) with IgG antibodies targeting the tumor-associated antigens could cause 9-∞ fold increase of cytotoxicity at lower doses (ET1 with 0.55 ng Trastuzumab, or ET2 with 1.10 ng Trastuzumab; 65.60÷7.30=9; 31.40÷0.00=∞; ∞ is a symbol that represents an infinitely large number). That is, “linking CD16.sup.+ natural killer cells with anti-tumor antigen antibody” (e.g. linking cultured oNK with Trastuzumab) makes an unexpected result, and linking CD16.sup.+ natural killer cells with anti-tumor antigen antibody” make effective and safer therapy based on lower dose treatment could be achieved.
[0591] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 55-day cultured oNK suspension (cultured oNK) and isolating Trastuzumab-linked CD16.sup.+ natural killer cells (ACE-oNK-HER2 cells) from the cell suspension with ACE-oNK-HER2 cells, similar unexpected result could be observed.
Embodiment 9: Detection of Genomic DNA of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
Embodiment 9.1 Detection of DNA Sequence Encoding CD16 Receptor by Droplet Digital PCR (ddPCR)
[0592] Droplet Digital PCR (ddPCR) was used in this embodiment to detect DNA sequence encoding CD16 receptor of cultured non-transgenic human CD16.sup.+ natural killer cell line in the present invention (oNK) or CD16-transgenic NK-92 cell line (yNK).
[0593] Cell suspensions obtained by culturing for M days with the culture method disclosed in the embodiments 2.1 (refer to as M-day cultured oNK suspension) and CD16-transgenic NK-92 cell line (Purchased from ATCC with the deposit number is ATCC PTA-6967; refer to as yNK) were used in this embodiment. Genomic DNA of yNK and cells in the M-day cultured oNK suspension were isolated by Blood & Cell Culture DNA Mini Kit (Purchased from Qiagen).
[0594] yNK sample or oNK sample: 50 ng genomic DNA isolated from yNK or M-day cultured oNK suspension was mixed with 10 μL ddPCR™ Supermix for Probes (2×) (Catalog number #1863026; Purchased from Bio-Rad), 1 μL BstXI restriction enzyme (Product name BstXI; Catalog number R0113S; Purchased form BioLabs), and 1 μL Mixture of CD16 F176F hydrolysis probe and CD16 F176V hydrolysis probe (Assay ID: C_25815666_10; Purchased form ThermoFisher; The Context Sequence
TABLE-US-00005 [VIC/FAM]: TCTGAAGACACATTTTTACTCCCAA[C/A]AAGCCCCCTGCAGAAGTAGG AGCCG;
https://www.thermofisher.com/order/genome-database/details/genotyping/C_25815666_10?CID=&ICID=&subtype=), and the final volume is 20 μL.
[0595] No-template control sample: water, 10 μL ddPCR™ Supermix for Probes (2×), 1 μL BstXI restriction enzyme, and 1 μL Mixture of CD16 F176F hydrolysis probe and CD16 F176V hydrolysis probe were mixed, and the final volume is 20 μL.
[0596] ddPCR experiments were performed using the QX100/QX200 Droplet Digital PCR (ddPCR) system (Purchased from Bio-Rad). First, samples are placed into a QX100 or QX200 Droplet Generator (a machine in the QX100/QX200 Droplet Digital PCR system) to partition each sample into 15000-20000 droplets (nanoliter-sized droplet).
[0597] Second, the wells in the 96 well plate (Product name: DG8 cartridge; Purchased from Bio-Rad) were divided into no-template control well, yNK well, and oNK well, and these wells are for no-template control group (NTC group), yNK group, and oNK group respectively. Nanolized no-template control sample, yNK sample, and oNK sample were respectively transferred into the no-template control well, yNK well, and oNK well.
[0598] Third, for the PCR amplification process, thermocycling conditions were 95° C. for 10 min, 45 cycles of 95° C. for 15 s, and 60° C. for 1 min, followed by 98° C. for 10 min then hold at 4° C. The ramp rate for each step was set to 2° C./s.
[0599] CD16 F176F hydrolysis probe is a probe labeled with FAM reporter fluorophore, and CD16 F176V hydrolysis probe is a probe labeled with VIC reporter fluorophore. The main steps in the PCR amplification process are denaturation, annealing, and extension. During annealing, the hydrolysis probe (such as CD16 F176F hydrolysis probe or CD16 F176V hydrolysis probe) binds to the target sequence; then during extension, the reporter labeled at the 5′ end of the probe is cleaved and free reporter fluoresces. The sequence of CD16 F176F hydrolysis probe is SEQ ID NO:11 and thus is expected to be able to detect DNA sequence encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3; the sequence of CD16 F176V hydrolysis probe is SEQ ID NO:12 and is expected to be able to detect the synthetic DNA sequence in yNK.
[0600] Please note that the DNA sequence encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3 in oNK would be transcribed to CD16 F176F mRNA then translated to CD16 F176F protein, wherein the sequence of the DNA encoding CD16 receptor located on q arm of chromosome 1 at position 1q23.3 in oNK comprises SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:19; the sequence of CD16 F176F mRNA comprises SEQ ID NO:13; the sequence of CD16 F176F protein comprises SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:14, or SEQ ID NO:20. The synthetic DNA sequence encoding CD16 receptor in yNK would be transcribed to CD16 F176V mRNA then translated to CD16 F176V protein, and the sequence of CD16 F176V mRNA is SEQ ID NO:15; the sequence of CD16 F176V protein is SEQ ID NO:16.
[0601] Forth, for droplet reading process, droplets were read using a QX100/QX200 Droplet Reader (a machine in the QX100/QX200 Droplet Digital PCR system), in which droplets were spaced out individually for fluorescence reading and therefore each droplet was analyzed individually using a two-color detection system (set to detect FAM and VIC). Positive droplets, which contain at least one copy of the target DNA molecule (such as CD16 F176F hydrolysis probe detected DNA molecule or CD16 F176V hydrolysis probe detected DNA molecule), exhibit increased fluorescence compared with negative droplets.
[0602] Please refer to
[0603] In NTC group, there were only 1 positive droplet containing CD16 F176F hydrolysis probe-detectable DNA molecule and 4 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecules in total 14568 collected droplets (events). In yNK group, there were 6737 positive droplets containing CD16 F176F hydrolysis probe-detectable DNA molecules and 8152 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecules in total 14230 collected droplets (events). In oNK group, there were 7637 positive droplets containing CD16 F176F hydrolysis probe-detectable DNA molecules and 5333 positive droplets containing CD16 F176V hydrolysis probe-detectable DNA molecule in total 14230 collected droplets (events).
[0604] Thus, the result shows that using ddPCR system to analyze the genomic DNA of yNK cells, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was 0.83 (6737÷8152=0.83), whereas using ddPCR system to analyze the genomic DNA of oNK cells, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was 1.43 (7637÷5333=1.43).
[0605] That is, by using ddPCR system to analyze the genomic DNA of human CD16.sup.+ natural killer cell line (oNK) in the present invention, the ratio of CD16 F176F hydrolysis probe-detectable DNA molecule to CD16 F176V hydrolysis probe-detectable DNA molecule was equal to or higher than 1 (the number of CD16 F176F probe detectable DNA molecule÷the number of CD16 F176V probe detectable DNA molecule≥1).
[0606] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the M-day cultured oNK suspension (cultured oNK), similar result could be observed.
[0607] Based on applicant's experience, another hydrolysis probes with sequence SEQ ID NO:17 or SEQ ID NO:18 could detect DNA sequence encoding CD16 receptor in other CD16-transgenic NK cells.
Embodiment 9.2 Detection of DNA Sequence Encoding CD16 Receptor by Fluorescence In Situ Hybridization (FISH)
[0608] Two-color fluorescence in situ hybridization (FISH) was used in this embodiment to detect transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD16a receptor in human natural killer cells.
[0609] The cultured non-transgenic human CD16.sup.+ natural killer cell line in the present invention (oNK) is used as an example to show the result of the human cell with no transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD16 receptor, whereas the CD16-transgenic NK-92 cell line (yNK) is used as an example to show the result of the human cell with transgenic, synthetic, genetically modified, or deliberately delivered DNA sequence encoding the CD16 receptor.
[0610] For the detail, the isolated CD16.sup.+ NK cells (oNK cells) from the cell suspensions obtained by culturing for N days with the culture method disclosed in the embodiments 2.1 (refer to as N-day cultured oNK suspension) and CD16-transgenic NK-92 cell line (Purchased from ATCC with the deposit number is ATCC PTA-6967; refer to as yNK) were used in this embodiment.
[0611] Kallioniemi disclosed the details of the two-color fluorescence in situ hybridization (FISH) method in 1996, and a short extract is presented below.
[0612] First, nuclei from 1×10.sup.7 yNK cells or oNK cells (CD16.sup.+ NK cells) isolated form the N-day cultured oNK suspension are prepared according to protocols used in DNA flow cytometry (Kallioniemi et al., 1996; Vindelov et al., 1983). For the detail, the cell pellet is incubated in a hypotonic detergent solution and brief trypsin digestion.
[0613] Second, nuclei are dropped on microscope slides, air-dried, and fixed in methanol acetic acid.
[0614] Third, prior to hybridization, the target nuclei are treated with proteinase K or other proteolytic enzymes to improve probe penetration.
[0615] Forth, denaturation of target nuclei is usually accomplished by immersing slides in a denaturation solution (70% formamide, 2×SSC) for 2-4 min at 70° C., followed by ethanol fixation and dehydration. Denaturation time and temperature have to be optimized according to the characteristics of the target cells.
[0616] Fifth, Prior to hybridization, 20-60 ng of the first fluorescent dye-labeled FCGR3A FISH Probe (a test probe that could detect all of the human DNA sequence encoding CD16a receptor; Purchased from Empire Genomics), 20-60 ng of the second fluorescent dye-labeled Chromosome 1 Control Probe (a reference probe; Purchased from Empire Genomics), and blocking DNA (unlabeled Cot-1 or placental DNA) are added to a formamide-based hybridization buffer. It is necessary to use the blocking DNA when the probe contains repetitive sequences that will hybridize to multiple locations in the genome. Hybridization mixture is heated to 70° C. for 5 min to denature the probe fragments then applied on the target slide; a cover slip is applied and sealed with rubber cement. Hybridization is performed overnight at 37° C. in a moist chamber.
[0617] Sixth, unbound probes are washed.
[0618] Seventh, Target nuclei are counterstained with a DNA stain, typically propidium iodide or DAPI.
[0619] The hybridizations are evaluated with a regular high-quality epifluorescence microscope. Almost any recent microscope model from the major manufacturers (Zeiss, Leitz, Olympus, and Nikon) is suitable for gene-specific FISH analysis; the 60× Plan Apos or other objectives in which chromatic aberrations are carefully corrected are preferred. The number of test and reference probe signals is evaluated from a minimum of 100 randomly chosen nuclei throughout the slide. Only morphologically intact and nonoverlapping nuclei are counted. Because the nuclei are three-dimensional, it is necessary to move the focus throughout the depth of the nuclei to obtain the correct signal count.
[0620] Several formats are typically used for reporting the results of gene-specific FISH, for example: (1) the number of test probe signals per cell; (2) the number of signals per cell from the test probe divided by those from the reference probe; or (3) the percentage of cells where the test probe signal number is present at a higher or lower copy number than the reference probe.
[0621] Please refer to
[0622] Based on applicant's experience, the number of FCGR3A FISH Probe (a test probe which could detect all of the human DNA sequence encoding CD16a receptor) signals per oNK cell would be 2 (the actual gene copy number per cell), and two-color FISH pattern of oNK would look like
Embodiment 10: Effect of Freezing and Thawing on the Survival Rate of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0623] The purified CD16.sup.+ cell population (the proportion of cells expressing CD16 receptor was as high as 99%) was sorted by the method of Embodiment 1.1, and then the purified CD16.sup.+ cell population was cultured for 21 days by the culture method of Embodiment 2.1 (purified CD16.sup.+ cell population was subcultured for 8 times). The sample of the cell solution was mixed with an equal volume of Trypan blue, then subjected to cell count and learned that the cell survival rate is 95%. Take a sufficient amount of the cell solution that contained 2×10.sup.7 viable cells, then perform the following freezing and thawing procedures.
[0624] Freezing procedure: centrifuged the cell solution containing 2×10.sup.7 viable cells, and removed the supernatant then resuspend the cell using 1 mL of frozen medium (CryoStor® CS10 Freeze Media, containing 10 vol % DMSO, BioLife Solutions, USA). The cell suspension was placed in a cryotube, and the cryotube was placed in the CoolCell Cell freezing container (Corning USA), then stored the CoolCell Cell freezing container in a −80° C. refrigerator overnight (which decreased 1° C. per minute). The cryotube was transferred and stored in liquid nitrogen for 17 days.
[0625] Thawing procedure: place the cryotube in a 37° C. water bath to quickly thaw the cell suspension, and mix 1 mL of cell suspension with 9 mL of cell culture medium in Embodiment 2.1. After mixing a sample of the cell mixture with an equal volume of Trypan blue, the cell number and cell viability were observed.
[0626] The experimental results showed that 1.95×10.sup.7 cell survived after thawing, and the Recovery rate was as high as 97.5% [(1.95×10.sup.7)÷(2×10.sup.7)×100%=97.5%], and the cell survival rate was 96% that had no significant difference from viability (95%) before freezing.
Embodiment 11: Cytotoxic Activity of Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line
[0627] The experimental method of this embodiment is almost the same as that of Embodiment 3.5, except that (1) the effector cell used in this embodiment is Ctrl oNK cells, Ctrl yNK cells, ACE-oNK cells, or ACE-yNK cells; and (2) the ratio of the number of effector cells to the number of SKOV-3 cells (target cells) is 2:1 (ET2) or 5:1 (ET5).
[0628] Ctrl oNK cell: Ctrl oNK cells are the cultured cell population after the purified CD16.sup.+ cell populations (wherein the proportion of non-transgenic human CD16.sup.+ natural killer cell line is as high as 99%) were cultured for 26 days by using the method of Embodiment 2.1.
[0629] Ctrl yNK cell: Ctrl yNK cells are CD16-transgenic NK-92 cell line (Purchased from ATCC; The deposit number is ATCC PTA-6967);
[0630] ACE-oNK cell: ACE-oNK cells are cells obtained by binding Trastuzumab (an antibody against HER2 protein, product name as Herceptin, purchased from Roche Swiss) to Ctrl oNK cells using a cell linker and a Trastuzumab linker that are complementary.
[0631] ACE-yNK cell: ACE-yNK cells are cells obtained by binding Trastuzumab (an antibody against HER2 protein, product name as Herceptin, purchased from Roche Swiss) to Ctrl yNK cells using a cell linker and a Trastuzumab linker that are complementary.
[0632] The procedure of binding Trastuzumab to natural killer cells (e.g., Ctrl oNK cells or Ctrl yNK cells) are as follows: (A) The step of preparing cell linker and binding the cell linker to the natural killer cell in order to prepare an NK-ssDNA conjugate; (B) The step of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab in order to prepare the Trastuzumab-ssDNA conjugate; (C) Mixing NK-ssDNA conjugate and Trastuzumab-ssDNA conjugate to combine NK-ssDNA conjugate and Trastuzumab-ssDNA conjugate through the cell linker and its complementary sequence on the Trastuzumab linker in order to prepare Trastuzumab-conjugated natural killer cells (e.g., ACE-oNK cells or ACE-yNK cells).
[0633] Wherein the step (A) of preparing cell linker and binding the cell linker to the natural killer cell comprises the following steps (a1)˜(a4):
[0634] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0635] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0636] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1— 60 minute(s).
[0637] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 natural killer cells and incubated for 1-60 minutes to obtain NK-ssDNA conjugate.
[0638] the step (B) of preparing Trastuzumab linker and binding the Trastuzumab linker to Trastuzumab comprises the following steps (b1)˜(b4):
[0639] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0640] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain the Trastuzumab linker stock. The Trastuzumab linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0641] Step (b3) 10-500 μL Trastuzumab linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0642] Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL Trastuzumab stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain Trastuzumab-ssDNA conjugate.
[0643] Please refer to
[0644] Please refer to
[0645] The results of
[0646] The results in
Embodiment 12: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line with Different Concentration of Human Platelet Lysate
[0647] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; and (2) the cell culture medium comprises 500 IU/mL IL-2 and {circle around (1)} 2.5% human platelet lysate, {circle around (2)} 5.0% human platelet lysate, {circle around (3)} 10.0% human platelet lysate, or {circle around (4)} 5.0% human serum (comprising no human platelet lysate).
[0648] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0649] Please refer to
[0650]
[0651]
[0652]
[0653] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar result could be observed.
Embodiment 13: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line with Different Concentration of IL-2
[0654] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; and (2) the cell culture medium comprises 5.0% human platelet lysate and {circle around (1)} 100 IU/mL IL-2, {circle around (2)} 200 IU/mL IL-2, {circle around (3)} 500 IU/mL IL-2, {circle around (4)} 750 IU/mL IL-2, or {circle around (5)} 1000 IU/mL IL-2.
[0655] Please note that both of IL-2 and human platelet lysate were required for expansion human CD16.sup.+ natural killer cells. In this embodiment, 1.8×10.sup.7 IU/mL IL-2 was equal to 1.1 mg/mL IL-2. Therefore, 100 IU/mL IL-2 was equal to 0.0612 μg/mL IL-2; 200 IU/mL IL-2 was equal to 0.1224 μg/mL IL-2; 500 IU/mL IL-2 was equal to 0.306 μg/mL IL-2; 750 IU/mL IL-2 was equal to 0.459 μg/mL IL-2; and 1000 IU/mL IL-2 was equal to 0.612 μg/mL IL-2.
[0656] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0657] Please refer to
[0658]
[0659]
[0660]
[0661] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar results could be observed.
Embodiment 14: Culturing Non-Transgenic Human CD16.SUP.+ Natural Killer Cell Line in Different Container
[0662] The experimental method of this embodiment is almost the same as that of Embodiment 2.1, except that (1) in Step S22′, all of the cells in the cell suspensions obtained by culturing for 9 days with the culture method disclosed in the embodiments 2.1 (refer to as 9-day cultured oNK suspension) were cultured in this embodiment and the number of cells in the first container in Step S22′ was 5×10.sup.6; (2) the cell culture medium comprises 500 IU/mL IL-2 and 5.0% human platelet lysate; and (3) the containers used in this embodiment are {circle around (1)} air-permeable container such as G-Rex 6-well culture plate or {circle around (2)} non air-permeable container such as T25 cell culture flask.
[0663] The experimental method of detecting cell number, cell viability, and CD16 surface marker of the cultured cells in this embodiment is the same as that of Embodiment 2.2 and 3.4.
[0664] Please refer to
[0665]
[0666]
[0667]
[0668] Moreover, based on this result, applicant believes that after isolating human CD16.sup.+ natural killer cell line from the 9-day cultured oNK suspension (cultured oNK), similar result could be observed.
Embodiment 15: Prepare Exogenous Targeting Unit Complexed-oNK Cells
[0669] In this embodiment, applicant prepares an exogenous targeting unit complexed-oNK cell to which at least an exogenous targeting unit complexed. The exogenous targeting unit comprises an targeting moiety which exhibits specific binding to a biological marker on a target cell, and the targeting moiety could bind to a biological marker selected from cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, MAGE, or other target antigen (marker) expressed by a target cell. The targeting moiety is not a nucleic acid and is not produced by the exogenous targeting unit complexed-oNK cell.
[0670] The procedure of binding a targeting moiety (such as Trastuzumab which is against HER2 protein) to oNK cells are as follows: (A) The step of preparing cell linker and binding the cell linker to the natural killer cell in order to prepare an NK-ssDNA conjugate; (B) The step of preparing targeting moiety linker (such as Trastuzumab linker) and binding the targeting moiety linker to the targeting moiety in order to prepare the targeting moiety-ssDNA conjugate; (C) Mixing NK-ssDNA conjugate and targeting moiety-ssDNA conjugate to combine NK-ssDNA conjugate and targeting moiety-ssDNA conjugate through the cell linker and its complementary sequence on the targeting moiety linker in order to prepare exogenous targeting unit complexed-conjugated natural killer cells (e.g., ACE-oNK cells or ACE-yNK cells).
[0671] Wherein the step (A) of preparing cell linker and binding the cell linker to the natural killer cell comprises the following steps (a1)˜(a4):
[0672] Step (a1) A first single strand DNA was obtained, wherein the sequence of the first single strand DNA was SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7.
[0673] Step (a2) The 5′ end of the first single strand DNA was modified as 5′ end thiol-modified first single strand DNA to obtain the cell linker stock. The cell linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0674] Step (a3) 10-500 μL cell linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s).
[0675] Step (a4) The mixture obtained from Step (a3) were mixed with 1×10.sup.6-1×10.sup.8 natural killer cells and incubated for 1-60 minutes to obtain NK-ssDNA conjugate.
[0676] The step (B) of preparing targeting moiety linker and binding the targeting moiety linker to targeting moiety comprises the following steps (b1)−(b4):
[0677] Step (b1) A second single strand DNA was obtained, wherein the sequence of the second single strand DNA was SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, and the sequence of the second single strand DNA is the complementary strand to the first single strand DNA.
[0678] Step (b2) The 5′ end of the second single strand DNA was modified as 5′ end thiol-modified second single strand DNA to obtain the targeting moiety linker stock. The targeting moiety linker stock is also commercially available from Integrated DNA Technologies. Actual methods of modification are known, or will be apparent, to those skilled in the art (Zimmermann, J, 2010).
[0679] Step (b3) 10-500 L, targeting moiety linker stock and 0.1-10 μL NHS-Maleimide (commercially available from Fisher Scientific) were mixed and incubated for 1-60 minute(s). Step (b4) The mixture obtained from Step (b3) were mixed with 10-100 μL targeting moiety stock (commercially available from Roche) and incubated for 10 minutes to 3 hours to obtain targeting moiety-ssDNA conjugate.
[0680] The targeting moiety could be a peptide, protein, or aptamer, wherein the protein could be an antibody against a cancer antigen selected from HER2/neu (ERBB2), HER3 (ERBB3), EGFR, VEGF, VEGFR2, GD2, CTLA4, CD19, CD20, CD22, CD30, CD33 (Siglec-3), CD52 (CAMPATH-1 antigen), CD326 (EpCAM), CA-125 (MUC16), MMP9, DLL3, CD274 (PD-L1), CEA, MSLN (mesothelin), CA19-9, CD73, CD205 (DEC205), CD51, c-MET, TRAIL-R2, IGF-1R, CD3, MIF, folate receptor alpha (FOLR1), CSF1, OX-40, CD137, TfR, MUC1, CD25 (IL-2R), CD115 (CSF1R), IL1B, CD105 (Endoglin), KIR, CD47, CEA, IL-17A, DLL4, CD51, angiopoietin 2, neuropilin-1, CD37, CD223 (LAG-3), CD40, LIV-1 (SLC39A6), CD27 (TNFRSF7), CD276 (B7-H3), Trop2, Claudin1 (CLDN1), PSMA, TIM-1 (HAVcr-1), CEACAM5, CD70, LY6E, BCMA, CD135 (FLT3), APRIL, TF(F3), nectin-4, FAP, GPC3, FGFR3, a killer-cell immunoglobulin-like receptors (KIRs), a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, and combinations thereof.
[0681] Preferably, the targeting moiety is an antigen-binding unit or an antibody such as Trastuzumab (an antibody against HER2 protein with product name as Herceptin was purchased from Roche, Swiss).
[0682] According to the disclosures shown in the embodiments 7, 8, 11, and 15 as well as
Embodiment 15.1 Cytotoxicity of Exogenous Targeting Unit Complexed-oNK Cells Against Solid Tumor
[0683] Luciferase-expressing human ovary cancer cell line SKOV3 (SKOV3-Luc, which is a Her2.sup.+ cell lines; catalog number AKR-232, purchased from CELL BIOLABS Inc) were intraperitoneal injection into each of the 15 female NOG mice (Jackson Laboratory) on Day 0. Five mice of each group were treated with oNK (cells in cell suspensions obtained by culturing with the culture method disclosed in the embodiments 2.1), the ACE-oNK-HER2 cells disclosed in the embodiments 7 (exogenous targeting unit complexed-oNK cells), or Vehicle (cell medium only, such as fresh growth media described in Embodiment 16.1) on Day 0, 3, 5, 11, and 18. Luminescence was detected by AMI HTX (Spectral Imaging) in the end of the experiment.
[0684] The inventors of the present invention expect that exogenous targeting unit complexed-oNK cells exerts superior potency against solid ovarian tumor, and as compare with oNK cells, exogenous targeting unit complexed-oNK cells could cause higher cytotoxicity and extend life.
Embodiment 16: Prepare “Antigen-Binding Complex”-Expressing oNK Cells
[0685] The method for preparing oNK cells comprising a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding an antigen-binding complex comprising a target-binding single-chain variable fragment (scFv) against target antigen is disclosed in this embodiment, wherein the target antigen is selected from CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8, CD11a (ITGAL), CD11b (ITGAM), CD11c (ITGAX), CD11d (ITGAD), CD 18 (ITGB2), CD 19 (B4), CD27 (TNFRSF7), CD28, CD29 (ITGB1), CD30 (TNFRSF8), CD40 (TNFRSF5), CD48 (SLAMF2), CD49a (ITGA1), CD49d (ITGA4), CD49f (ITGA6), CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B-cell antigen receptor complex-associated alpha chain), CD79B (B-cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2DL1), CD158B1 (KIR2DL2), CD158B2 (KIR2DL3), CD158C (KIR3DP1), CD158D (KIRDL4), CD158F1 (KIR2DL5A), CD158F2 (KIR2DL5B), CD158K (KIR3DL2), CD160 (BY55), CD162 (SELPLG), CD226 (DNAM1), CD229 (SLAMF3), CD244 (SLAMF4), CD247 (CD3-zeta), CD258 (LIGHT), CD268 (BAFFR), CD270 (TNFSF14), CD272 (BTLA), CD276 (B7-H3), CD279 (PD-1), CD314 (NKG2D), CD319 (SLAMF7), CD335 (NK-p46), CD336 (NK-p44), CD337 (NK-p30), CD352 (SLAMF6), CD353 (SLAMF8), CD355 (CRTAM), CD357 (TNFRSF18), inducible T cell co-stimulator (ICOS), LFA-1 (CD11a/CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1/CBP, a CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, a Toll-like receptor, HER2, BCMA, PD-L1, VEGFR2, TCR b-chain, and combinations thereof.
[0686] Preferably, the antigen-binding complex is a chimeric antigen receptor (CAR) designed similar with a chimeric antigen receptor in a chimeric antigen receptor-T cell (CAR-T cell).
[0687] In naturally present antigen-specific T cell's membrane, there are both of (1) T cell receptors that are responsible for specifically recognizing antigen's fragments presented by HLA and (2) costimulatory molecules. Both of antigen binding signal and sufficient costimulatory signals are required for full activation of the antigen-specific T cells; wherein the costimulatory signals are induced via the costimulatory molecules being bound by their ligands that are usually shown in the target cell's membrane (Weinkove et al., 2019).
[0688] Example of costimulatory molecules expressed by T cells include CD28 subunit, ICOS (CD278) subunit, 4-1BB (CD137) subunit, OX40 (CD134) subunit, CD27 subunit, CD40 subunit, CD40L subunit, TLRs subunit, or other costimulatory molecules (Weinkove et al., 2019).
[0689] The synthetic chimeric antigen receptor (CAR) combines variable regions of an antibody with intracellular signaling components derived from the T cell receptor complex, and thus allows redirection of T cell cytotoxicity against an antigen on any HLA background (antigen processing and presentation by HLA are not required) (Weinkove et al., 2019).
[0690] The first-generation CARs incorporate only intracellular CD3 (such as CD3 zeta, also known as CD3c). The second-generation CARs further incorporate one intracellular signaling domain of costimulatory molecule (such as CD28), and the third-generation CARs incorporate more than one intracellular signaling domains of costimulatory molecules (such as combining CD28 and 4-1BB) (Weinkove et al., 2019).
[0691] Take CD19 as an example to explain the method of preparing oNK comprising a synthetic, genetically modified and/or deliberately delivered polynucleotide encoding a chimeric antigen receptor (CAR) comprising a target-binding single-chain variable fragment (scFv) against CD19 as below.
[0692]
[0693]
[0694] Step S31: Generating the transfection-, electroporation- or lentivirus-based CAR constructs;
[0695] Step S32: Transfecting, electroporating, or infecting oNK cells with CAR construct;
[0696] Step S33: Enriching the CAR-expressing oNK cells with an antibody specific to the tag or the antigen.
Embodiment 16.1: Prepare Chimeric Antigen Receptor (CAR)-Expressing oNK Cells
[0697] The following describes a specific embodiment of establishing a CAR-expressing human CD16.sup.+ natural killer cell line against CD19 that does not include genetically modified polynucleotide encoding the CD16 receptor (such as anti-CD 19 CAR-expressing oNK cells) by the present invention, but the application of the invention is not limited thereto, which means the invention can also be used for establishing CAR-expressing human CD16.sup.+ natural killer cell lines against other CAR-target antigens that does not include genetically modified polynucleotide encoding the CD16 receptor. For example, the invention can also be used for establishing CAR-expressing human CD16.sup.+ natural killer cell line against CD70, GPC3, or PD-L1 that does not include genetically modified polynucleotide encoding the CD16 receptor. In the present invention, inventors expect that the higher the binding capacity of the CAR-expressing human CD16.sup.+ natural killer cell line against a CAR-target antigen (such as anti-CD 19 CAR-expressing oNK cells against CD19 recombinant protein), the higher the cytotoxicity of CAR-expressing human CD16.sup.+ natural killer cell line against the target cells that express CAR-target antigen.
[0698] In the step S31, anti-CD19 CAR nucleotide sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, or SEQ ID NO:47 is chemically synthesized by Synbio Technologies. A polymerase chain reaction (PCR) Kit (M05305, New England Biolabs) is used to amplify said synthesized anti-CD19 CAR nucleotide to a large enough amount. Restriction enzyme (such as HinDIII, EcoRI, or BamHI) is used to cut the synthesized anti-CD19 CAR nucleotide and a vector such as linearized pBudCE vector, (ThermoFisher Scientific), pMAXCloning vector (Lonza), pCD810A-1 or pCD510B-1 (System Biosciences). A ligase (such as Taq DNA ligase) is mixed with the restricted enzyme digested synthesized anti-CD19 CAR nucleotide and the restricted enzyme digested vector to promote ligation reactions and “anti-CD19 CAR plasmid comprising Myc gene (or anti-CD19 CAR plasmid comprising tag)” formation. Actual methods of preparing transfection-, electroporation- or lentivirus-based CAR constructs (such as anti-CD19 CAR plasmid or anti-CD19 CAR plasmid comprising Myc gene or anti-CD19 CAR plasmid comprising tag) are known, or will be apparent, to those skilled in the art (U.S. Pat. No. 7,446,179; WO 2015157252; U.S. Pat. No. 7,446,179).
[0699] In the step S32, the anti-CD19 CAR plasmids comprising Myc gene (or anti-CD19 CAR plasmid comprising tag) are transfected, electroporated or transduced into oNK to obtain anti-CD19 CAR-expressing oNK.
[0700] For example, cell suspensions obtained by culturing with the culture method disclosed in the embodiments 2.1 (refer to as cultured oNK suspension) were harvested (please refer to
Embodiment 16.2: Enrich Chimeric Antigen Receptor (CAR)-Expressing oNK Cells
[0701] In the step S33, to enrich the CAR-expressing oNK cells, the cells obtained from step S32 were stained with tagged CD19 recombinant protein (Cat No. 11880-H08H from Sino Biological, or FITC-conjugated CD 19 recombinant protein with Cat No. CD9-HF2H2 from ACROBiosystem, or APC-conjugated CD19 recombinant protein with Cat No. CD19-3309HA from Creative BioMart) and fluorescence-conjugated anti-Myc Antibody (Novus Biologicals) (please refer to
[0702] The results for fluorescent analysis of the cultured oNK cell suspension without the transuded anti-CD19 CAR construct are shown in
[0703] The results in
[0704] The results in
[0705] Please refer to
[0706] Preferably, anti-CD19 CAR nucleotide sequence comprises a sequence of SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, or other anti-CD19 CAR nucleotide sequence.
[0707] The method of preparing CAR plasmids and lentiviral particles comprising CAR plasmids are known, or will be apparent, to those skilled in the art.
[0708] In addition, CAR plasmids and lentiviral particles comprising CAR plasmids are commercially available. For example, lentiviral particles comprising anti-CD19 CAR plasmid could be purchased from Creative Biolabs (this anti-CD19 CAR construct comprises CD19 scFv domain, CD28 domain, and CD3 zeta domain; Cat No. VP-CAR-LC61); lentiviral particles comprising anti-BCMA CAR plasmid could be purchased from Creative Biolabs (Cat No. VP-CAR-LC534); lentiviral particles comprising anti-HER2 CAR plasmid could be purchased from Creative Biolabs (Cat No. VP-CAR-LC834); lentiviral particles comprising anti-PD-L1 CAR plasmid could be purchased from Creative Biolabs (Cat No. CAR-ZP1471); lentiviral particles comprising anti-VEGFR2 CAR plasmid could be purchased from Creative Biolabs (Cat No. VP-CAR-LC616); lentiviral particles comprising anti-TCR b-chain CAR plasmid could be purchased from Creative Biolabs (Cat No. VP-TCR-YC160); lentiviral particles comprising anti-ICAM-1 CAR plasmid could be purchased from Creative Biolabs (Cat No. CAR-ZP7800); lentiviral particles comprising anti-PD-1 CAR plasmid could be purchased from Creative Biolabs (Cat No. VP-CAR-LC412).
[0709] The cell suspensions obtained by culturing with the culture method disclosed in the embodiments 2.1 (refer to as cultured oNK suspension) could be transfected (such as Lipofectamine 2000, Lipofectamine 3000, ThermoFisher Scientific), electroporated (such as P3 Primary Cell Nucleofector Kit, SF Cell line Nucleofector Kit, Lonza) or transduced (such as lentivirus, retrovirus) with each of these CAR plasmids or lentiviral particles comprising CAR plasmids to obtain the CAR-expressing oNK cells against CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8, CD11a (ITGAL), CD11b (ITGAM), CD11c (ITGAX), CD11d (ITGAD), CD 18 (ITGB2), CD 19 (B4), CD27 (TNFRSF7), CD28, CD29 (ITGB1), CD30 (TNFRSF8), CD40 (TNFRSF5), CD48 (SLAMF2), CD49a (ITGA1), CD49d (ITGA4), CD49f (ITGA6), CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B-cell antigen receptor complex-associated alpha chain), CD79B (B-cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2DL1), CD158B1 (KIR2DL2), CD158B2 (KIR2DL3), CD158C (KIR3DP1), CD158D (KIRDL4), CD158F1 (KIR2DL5A), CD158F2 (KIR2DL5B), CD158K (KIR3DL2), CD160 (BY55), CD162 (SELPLG), CD226 (DNAM1), CD229 (SLAMF3), CD244 (SLAMF4), CD247 (CD3-zeta), CD258 (LIGHT), CD268 (BAFFR), CD270 (TNFSF14), CD272 (BTLA), CD276 (B7-H3), CD279 (PD-1), CD314 (NKG2D), CD319 (SLAMF7), CD335 (NK-p46), CD336 (NK-p44), CD337 (NK-p30), CD352 (SLAMF6), CD353 (SLAMF8), CD355 (CRTAM), CD357 (TNFRSF18), inducible T cell co-stimulator (ICOS), LFA-1 (CD11a/CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1/CBP, a CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, a Toll-like receptor, HER2, BCMA, PD-L1, VEGFR2, TCR b-chain, or combinations thereof.
Embodiment 17: Non-Tumorigenicity of CAR-Expressing oNK Cells
[0710] Six to eight-week-old female BALB/c nude mice (purchased from The Jackson Laboratory or BioLasco, Taiwan) were used in this Embodiment. 25 mice were randomly assigned into five groups, which were a SK-OV-3 group, Daudi group, oNK group, CAR19-oNK group, and DPBS group.
[0711] A human ovarian cancer cell line “SK-OV-3” (Purchased from ATCC; The deposit number is ATCC HTB-77), human B lymphoblastoid cell lines “Daudi” (Purchased from ATCC; The deposit number is ATCC CCL-213), a cell suspension that was obtained by culturing for 101 days with the culture method disclosed in the embodiments 2.1 (101-day cultured oNKsuspension of the present invention, refer to as 101-day cultured oNK suspension), and an anti-CD19 CAR-expressing oNK cell suspension (a cell suspension that was obtained by culturing oNK cells for 25 days with the culture method disclosed in the embodiments 2.1 and then performing the transduction process and CAR-expressing cell isolation process as disclosed in the embodiments 16.1 and 16.2, refer to as 25-day cultured CAR19-oNK cell suspension) were used in this Embodiment.
[0712] 1×10.sup.7 SK-OV-3 cells, 1×10.sup.7 Daudi cells, 1×10.sup.7 cells in the 101-day cultured oNK suspension, and 1×10.sup.7 cells in 25-day cultured CAR19-oNK cell suspension were suspended respectively in 100 L of Dulbecco's Phosphate-Buffered Saline (DPBS) to obtain different cell suspensions. The cell suspensions and 100 μL of DPBS were subcutaneously implanted in female BALB/crude mice in SK-OV-3 group, Daudi group, oNK group, CAR19-oNK group, and DPBS group on Day 0 respectively. Tumor growth in each mouse was observed on Day 21, Day 24, Day 42, and Day 59, and the mice were euthanized on Day 59.
[0713] Please refer to Table 5. Table 5 shows the results of tumor formation in nude mice xenografted with different cell lines.
[0714] Table 5 shows that there was no tumor formation in the mice of DPBS groups (negative control group) throughout the study period (0/5, 0%), while all five mice in SK-OV-3 group (positive control group) developed tumors (5/5, 100%). For mice xenografted with lymphoma cell line Daudi, 4 out of 5 mice in Daudi group developed tumors (4/5, 80%) that lasted until end of study (Day 59).
[0715] For mice xenografted with oNK cells or anti-CD19 CAR-expressing oNK cells of the present invention, there was no tumor formation in mice in oNK group and CAR19-oNK group throughout the study period (0/5, 0%). These study results provide evidence that non-irradiated oNK cells and the CAR-expressed oNK cells are non-tumorigenic and safe for future clinical application and disease treatment.
TABLE-US-00006 TABLE 5 the results of tumor formation in nude mice xenografted with different cell lines. Tumor incidence Cell type Day 21 Day 24 Day 42 Day 59 SK-OV-3 suspension 5/5 5/5 5/5 5/5 Daudi suspension 4/5 4/5 4/5 4/5 Non-irradiated oNK 0/5 0/5 0/5 0/5 suspension Non-irradiated CAR19-NK 0/5 0/5 0/5 0/5 suspension DPBS 0/5 0/5 0/5 0/5
Embodiment 18: Analyze Cytotoxicity of CAR-Expressing oNK Cells Against Target Cells In Vitro
Embodiment 18.1 CD19 Binding Activity of CAR19-oNK Cells
[0716] Effector oNK (cell suspensions obtained by culturing for 70 days with the culture method disclosed in the embodiments 2.1; also refer to as 70-day cultured oNK suspension) and CAR19-oNK (70-day cultured CAR19-oNK cell suspension obtained by culturing oNK cells for 70 days with the culture method disclosed in the embodiments 2.1 and then performing the transduction process and CAR-expressing cell isolation process as disclosed in the embodiments 16.1 and 16.2; wherein the transduction process was based on the anti-CD19 CAR-expressing pseudo lentiviral particles that were prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0717] The results for CD19 binding activity of the oNK and CAR19-oNK are shown in
[0718] The results in
Embodiment 18.2 Cytotoxicity of CAR19-oNK Cells Against CD19.SUP.+ B-Cell Lymphoma
[0719] Effector oNK (cell suspensions obtained by culturing for 70 days with the culture method disclosed in the embodiments 2.1; also refer to as 70-day cultured oNK suspension) and CAR19-oNK (70-day cultured CAR19-oNK cell suspension obtained by culturing oNK cells for 70 days with the culture method disclosed in the embodiments 2.1 and then performing the transduction process and CAR-expressing cell isolation process as disclosed in the embodiments 16.1 and 16.2; wherein the transduction process was based on the anti-CD19 CAR-expressing pseudo lentiviral particles that were prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0720] Please refer to 19B.
[0721] Moreover, the result shows that: as compare with oNK cells, CAR19-oNK cells could cause about ∞-fold increase of cytotoxicity (13.1÷0=∞). This is an unexpected result.
Embodiment 18.3 CAR19-oNK Cell has No Off-Target Cytotoxicity
[0722] Effector oNK (cell suspensions obtained by culturing for 69 days with the culture method disclosed in the embodiments 2.1; also refer to as 69-day cultured oNK suspension) and CAR19-oNK (69-day cultured CAR19-oNK cell suspension obtained by culturing oNK cells for 69 days with the culture method disclosed in the embodiments 2.1 and then performing the transduction process and CAR-expressing cell isolation process as disclosed in the embodiments 16.1 and 16.2; wherein the transduction process was based on the anti-CD19 CAR-expressing pseudo lentiviral particles that were prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0723] Please refer to
[0724]
Embodiment 19: Analyze Cytotoxicity of CAR-Expressing oNK Cells Against Target Cells In Vivo
Embodiment 19.1 Cytotoxicity of CAR-Expressing oNK Cells Against Liquid Tumor
[0725] 1×10.sup.5 luciferase-expressing target cell Raji (Raji-Luc, which is a CD19.sup.+ B cell lymphoma cell lines; CCL-86, ATCC) were intravenously injected into each of the 15 female immune compromised NSG mice (Jackson Laboratory) on Day 0. Five mice of each group were treated with 5×10.sup.6 oNK (cells in cell suspensions obtained by culturing for 117 days with the culture method disclosed in the embodiments 2.1; also refer to as 117-day cultured oNK suspension), CAR19-oNK (117-day cultured CAR19-oNK cell suspension obtained by culturing oNK cells for 117 days with the culture method disclosed in the embodiments 2.1 and then performing the transduction process and CAR-expressing cell isolation process as disclosed in the embodiments 16.1 and 16.2; wherein the transduction process was based on the anti-CD19 CAR-expressing pseudo lentiviral particles that were prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0726]
[0727]
[0728]
[0729]
Embodiment 19.2 Cytotoxicity of CAR-Expressing oNK Cells Against Solid Tumor
[0730] Luciferase-expressing human ovary cancer cell line SKOV3 (SKOV3-Luc, which is a HER2.sup.+ cell lines; catalog number AKR-232, purchased from CELL BIOLABS Inc) were intraperitoneal injection into each of the 15 female NSG mice (Jackson Laboratory) on Day 0. Five mice of each group were treated with oNK (cells in cell suspensions obtained by culturing with the culture method disclosed in the embodiments 2.1), CARHER2-oNK (CARHER2-oNK cell suspension obtained by culturing oNK cells with the culture method disclosed in the embodiments 2.1 and then performing the transduction process with the anti-HER2 CAR-expressing pseudo lentiviral particles), or Vehicle (cell medium only, such as fresh growth media described in Embodiment 16.1) on Day 0, 4, 7, 10, 14, and 17. Luminescence was detected by AMI HTX (Spectral Imaging) weekly and in the end of the experiment.
[0731] The inventors of the present invention expect that CARHER2-oNK exerts superior potency against solid ovarian tumor, and as compare with oNK cells, CARHER2-oNK cells could cause higher cytotoxicity and extend life.
Embodiment 20: Monitor Long Term Cell Viability, Cell Proliferation, CD19 Binding Activity and Cell Surface Markers of CAR19-oNK
Embodiment 20.1 Cell Viability and Cell Proliferation of CAR19-oNK
[0732] CAR19-oNK (cell suspensions obtained by culturing for 4-day to 83-day CAR-oNK suspension generated by the transduction of cultured oNK with anti-CD19 CAR-expressing pseudo lentiviral particles prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0733] Step S41: Obtaining CAR19-oNK;
[0734] Step S42: In the container, contacting the CAR19-oNK with a culture medium comprising human platelet lysate on Day 0; and
[0735] Step S43: Culturing the CAR19-oNK for multiple days to proliferate the CAR19-oNK.
[0736] The detail condition could be found in embodiment 2.1, embodiment 11, and embodiment 13, and could further found in embodiment 12.
[0737] Each sample of the cell suspensions, which were obtained by culturing CAR19-oNK for different days, was mixed with an equal volume of Trypan blue, and the viability and cell number were observed. The viability was determined by dividing viable cell number by total cell number.
Embodiment 20.2 Detecting of CD56, CD3, and CD2 Surface Markers of the Cultured CAR19-oNK
[0738] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 20.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD56 fluorescent labeled antibody (Cat. No. 318304, Biolegend, USA), 1 μL of CD3 fluorescent labeled antibody (Cat. No. 300410, Biolegend, USA), and 1 μL of CD2 fluorescent labeled antibody (Cat. No. 300222, Biolegend, USA) to simultaneously label cells expressing CD56 molecule, CD3 molecule, and/or CD2 molecule. Finally, the cell sorter or flow cytometer was used to analyze whether the cells exhibited CD56 molecules, CD3 molecules, and/or CD2 molecules, and the percentage of cells with various cell surface makers was calculated.
Embodiment 20.3 Detection of CD16 Expression of the Cultured CAR19-oNK
[0739] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 20.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with 1 μL of CD16 fluorescent labeled antibody (Cat. No. 302016, Biolegend, USA) to label cells expressing CD16. Finally, the cell sorter or flow cytometer was used to analyze whether the cells exhibited CD16, and the percentage of cells with CD16 was calculated.
Embodiment 20.4 Detection of Binding Capacity of the Cultured CAR19-oNK to CD19 Recombinant Protein
[0740] Each sample of the cell suspensions, which were obtained at different time points in Embodiment 20.1, was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with tagged CD19 recombinant protein (Cat No. 11880-H08H from Sino Biological, or FITC-conjugated CD 19 recombinant protein with Cat No. CD9-HF2H2 from ACROBiosystem, or APC-conjugated CD19 recombinant protein with Cat No. CD19-3309HA from Creative BioMart). Finally, the cell sorter or flow cytometer was used to analyze whether the cells binding to the CD19 recombinant protein, and the percentage of cells binding to the CD19 recombinant protein was calculated.
[0741]
[0742]
[0743] The cells carrying a phenotype of CD3.sup.−CD56.sup.+CD16.sup.+ with CD19 recombinant protein binding activity are CAR19-oNK of the present invention. These CAR19-oNK cells could be isolated by cell sorter (BD Bioscience).
Embodiment 21 Detection of Cytokine Secretion of CAR19-oNK
[0744] CAR19-oNK cell suspensions (cell suspensions obtained by culturing for 50-day CAR-oNK suspension generated by the transduction of cultured oNK with anti-CD19 CAR-expressing pseudo lentiviral particles prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs comprising IL-15 expression domain as shown in
[0745]
[0746] For oNK cells being transduced with the CD19 CAR construct comprises IL-18 expression domain, IL-21 expression domain, IL-2 expression domain, or other proliferation inducing cytokine expression domain, these transduced oNK cells are capable of secreting IL-18, IL-21, IL-2, or other proliferation inducing cytokine.
Embodiment 22: Analyze Independence of Supplemented Cytokine in CAR19-oNK Culture
[0747] One million of CAR19-oNK (cell suspensions obtained by culturing for 56-day CAR-oNK suspension generated by the transduction of cultured oNK with anti-CD19 CAR-expressing pseudo lentiviral particles prepared from pCD810A-1 and lentivirus-based CD19 CAR constructs as shown in
[0748]
Embodiment 23: Detection of Binding Capacity of the CAR-Expressing oNK Cells to their Specific Recombinant Protein
[0749] CAR-expressing oNK cells comprising a target-binding single-chain variable fragment (scFv) against a target antigen (such as BCMA) was centrifuged; the supernatant was removed, the cells were resuspended in the buffer, then mixed with tagged target antigen recombinant protein (such as tagged BCMA recombinant protein). Finally, the cell sorter or flow cytometer was used to analyze whether the cells binding to the target antigen recombinant protein (such as BCMA), and the percentage of cells binding to the target antigen recombinant protein (such as BCMA) was calculated.
[0750] If the cells have the target antigen recombinant protein (such as BCMA) binding activity, the CAR-expressing oNK cells against the target antigen are successfully developed.
[0751] Based on the results shown in the embodiments 18 and 19, the inventors of the present invention believe that oNK cells being transduced with the CAR construct against CD19 or against any of the target antigens disclosed in the invention could elicit enhanced cytotoxicity against cancer cells, liquid tumor, and solid tumor expressing the target antigen without off-target cytotoxicity.
[0752] Preferably, the target antigen is CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8, CD11a (ITGAL), CD11b (ITGAM), CD11c (ITGAX), CD11d (ITGAD), CD 18 (ITGB2), CD 19 (B4), CD27 (TNFRSF7), CD28, CD29 (ITGB1), CD30 (TNFRSF8), CD40 (TNFRSF5), CD48 (SLAMF2), CD49a (ITGA1), CD49d (ITGA4), CD49f (ITGA6), CD66a (CEACAM1), CD66b (CEACAM8), CD66c (CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B-cell antigen receptor complex-associated alpha chain), CD79B (B-cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (OX40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2DL1), CD158B1 (KIR2DL2), CD158B2 (KIR2DL3), CD158C (KIR3DP1), CD158D (KIRDL4), CD158F1 (KIR2DL5A), CD158F2 (KIR2DL5B), CD158K (KIR3DL2), CD160 (BY55), CD162 (SELPLG), CD226 (DNAM1), CD229 (SLAMF3), CD244 (SLAMF4), CD247 (CD3-zeta), CD258 (LIGHT), CD268 (BAFFR), CD270 (TNFSF14), CD272 (BTLA), CD276 (B7-H3), CD279 (PD-1), CD314 (NKG2D), CD319 (SLAMF7), CD335 (NK-p46), CD336 (NK-p44), CD337 (NK-p30), CD352 (SLAMF6), CD353 (SLAMF8), CD355 (CRTAM), CD357 (TNFRSF18), inducible T cell co-stimulator (ICOS), LFA-1 (CD11a/CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1/CBP, a CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, a Toll-like receptor, HER2, BCMA, PD-L1, VEGFR2, TCR b-chain, and combinations thereof.
[0753] Preferably, CAR-expressing oNK cells comprising at least an antigen-binding complex in the cell membrane, wherein the antigen-binding complex is a means for inducing the cytotoxic activity of the cell via being specifically bound by a target antigen selected from cancer antigen, glycolipid, glycoprotein, cluster of differentiation antigen present on cells of a hematopoietic lineage, antigen peptide bound by major histocompatibility complex, gamma-glutamyltranspeptidase, adhesion protein, hormone, growth factor, cytokine, ligand receptor, ion channel, membrane-bound form of an immunoglobulin μ. chain, alfa-fetoprotein, C-reactive protein, chromogranin A, epithelial mucin antigen, human epithelium specific antigen, Lewis(a) antigen, multidrug resistance related protein, Neu oncogene protein, neuron specific enolase, P-glycoprotein, multidrug-resistance-related antigen, p170, multidrug-resistance-related antigen, prostate specific antigen, NCAM, ganglioside molecule, MART-1, heat shock protein, sialylTn, tyrosinase, MUC-1, HER-2/neu, KSA, PSMA, p53, RAS, EGF-R, VEGF, MAGE, or other target antigen (marker) expressed by a target cell.
[0754] Preferably, the antigen-binding complex comprises a target-binding single-chain variable fragment (scFv) against the target antigen.
[0755] Preferably, the target antigen is a cancer antigen selected from HER2/neu (ERBB2), HER3 (ERBB3), EGFR, VEGF, VEGFR2, GD2, CTLA4, CD19, CD20, CD22, CD30, CD33 (Siglec-3), CD52 (CAMPATH-1 antigen), CD326 (EpCAM), CA-125 (MUC16), MMP9, DLL3, CD274 (PD-L1), CEA, MSLN (mesothelin), CA19-9, CD73, CD205 (DEC205), CD51, c-MET, TRAIL-R2, IGF-1R, CD3, MIF, folate receptor alpha (FOLR1), CSF1, OX-40, CD137, TfR, MUC1, CD25 (IL-2R), CD115 (CSF1R), IL1B, CD105 (Endoglin), KIR, CD47, CEA, IL-17A, DLL4, CD51, angiopoietin 2, neuropilin-1, CD37, CD223 (LAG-3), CD40, LIV-1 (SLC39A6), CD27 (TNFRSF7), CD276 (B7-H3), Trop2, Claudin1 (CLDN1), PSMA, TIM-1 (HAVcr-1), CEACAM5, CD70, LY6E, BCMA, CD135 (FLT3), APRIL, TF(F3), nectin-4, FAP, GPC3, FGFR3, ICAM-1 (CD54), ROBO1, NKG2D ligands, CD123, CS1/SLAMF7/CD319/CRACC, CD7, CD142 (platelet tissue factor, factor III, tissue factor), CD38, CD138, EGFR VIII, EGFR, EGFR806, EGFR family member, PD-1, ROR1, CSPG4, CLL-1 (CLEC12A), CD147, PSCA, EPHA2, GPRC5D, CD133, B7H6, DSC2, AE1 (SLC4A1), GUCY2C, CDH17, HPSE, CD24, MUC4, AFP-L3, SP17, DCLK1, CAIX (CA9), IL13RA2, IL13Ra, CD56, CD44v6, TCR beta-chain, ligands of chlorotoxin, claudin-6, claudin-18.2, EIIIB (fibronectin), Glypican-1 (GPC1), PLAP (Placental alkaline phosphatase), uPAR, HCMV glycoprotein B (gB), HLA-DR (Lym1 antibody target), tumor-associated αvβ6 integrin, LunX, integrin αvβ3, folate receptor beta (FRβ), LILRB4, MISIIR (Müllerian inhibiting substance type 2 receptor), 5T4, CD83 ligand, HBsAg, CD171 (L1-CAM), TAG72 (TAG72 (Tumour-associated glycoprotein 72)), B7-H4, CD166 (ALCAM), AC133 (PROM1), LeY, CD13 (TIM1), CD117, TEM8 (ANTXR1), CD26, IL13Ra2, IGF1R, Muc3a, IL1RAP, TSLPR (CRLF2), LMP1, Siglec7, Siglec9, Epstein-Barr Virus gp350, CD1a, CLEC14A, MAGE-A1, MAGE-A4, Neurofilament M (NEFM), HERV-K env protein, HLA-A*0201/NY-ESO-1(157-165) peptide, 2B4, TACI (TNFRSF13B), CD32A(131R), AXL, Lewis Y, CD80, CD86, ROR2, a killer-cell immunoglobulin-like receptors (KIRs), a T cell receptor, a major histocompatibility complex protein, a TNF receptor protein, an immunoglobulin protein, a cytokine receptor, an integrin, activating NK cell receptors, and combinations thereof.
[0756] Preferably, the antigen-binding complex is a chimeric antigen receptor (CAR).
[0757] Preferably, a chromosome DNA sequence of the cell is at least 90% or 95% similar to the corresponding chromosome DNA sequence of the natural killer cell deposited at NPMD having the deposit number NITE BP-03017.
[0758] Preferably, a chromosome DNA sequence of the cell is at least 99%, 99.99%, or 99.995% similar to the corresponding chromosome DNA sequence of the natural killer cell deposited at NPMD having the deposit number NITE BP-03017.
[0759] Preferably, the chromosome DNA sequence is a DNA of chromosome 17, a DNA sequence of chromosome 19, a DNA sequence of chromosome 22, a DNA sequence of chromosome 4, a DNA sequence of chromosome 18, a DNA sequence of chromosome Y, or a DNA sequence of chromosome X. Preferably, the chromosome DNA sequence is a DNA sequence of chromosome 1, a DNA sequence of chromosome 2, a DNA sequence of chromosome 5, a DNA sequence of chromosome 6, a DNA sequence of chromosome 7, a DNA sequence of chromosome 8, a DNA sequence of chromosome 9, a DNA sequence of chromosome 10, a DNA sequence of chromosome 11, a DNA sequence of chromosome 12, a DNA sequence of chromosome 13, a DNA sequence of chromosome 14, a DNA sequence of chromosome 15, a DNA sequence of chromosome 16, a DNA sequence of chromosome 20, a DNA sequence of chromosome 21, or a DNA sequence of chromosome 3.
[0760] Preferably, a whole genome of the cell is at least 99.995% similar to the whole genome of the natural killer cell deposited at NPMD having the deposit number NITE BP-03017.
[0761] From the embodiments of the present invention, it demonstrated that all of the non-transgenic human CD16.sup.+ natural killer cell line obtained by the method of the present invention, the exogenous targeting unit complexed-natural killer cell of the present invention, and the chimeric antigen receptor (CAR)-expressing oNK cells of the invention can indeed kill the target cell (e.g., cancer cells) though ADCC-like process. Therefore, the applicable fields of these cells of the present invention, include but not limited to cancer treatment, autoimmune disease treatment, neuronal disease treatment, human immunodeficiency virus (HIV) eradication, hematopoietic cell-related diseases, metabolic syndrome treatment, pathogenic disease treatment, treatment of viral infection, and treatment of bacterial infection. [0762] Reference 1—Eileen Scully and Galit Alter, 2016. NK cells in HIV disease. Curr HIV/AIDS Rep. 13 (2):85-94. [0763] Reference 2—Jordan S. Orange, 2013. Natural killer cell deficiency. J Allergy Clin Immunol 132(3):515-525. [0764] Reference 3—Kallioniemi A, Visakorpi T, Karhu R, Pinkel D, and Kallioniemi OP, 1996. Gene Copy number analysis by fluorescence in situ hybridization and comparative genomic hybridization. Methods. 9(1):113-121. [0765] Reference 4—Littwitz-Salomon E, Dittmer U, Sutter K, 2016. Insufficient natural killer cell responses against retroviruses: how to improve NK cell killing of retrovirus-infected cells. Retrovirology. 13(1):77. [0766] Reference 5—Pernick, N, 2018.
[0767] http://www.pathologyoutlines.com/topic/cdmarkerscd56.html
[0768] http://www.pathologyoutlines.com/topic/cdmarkerscd3.html
[0769] http://www.pathologyoutlines.com/topic/cdmarkerscd2.html
[0770] http://www.pathologyoutlines.com/topic/cdmarkerscd16.html [0771] Reference 6—Rezvani K and Rouce RH, 2015. The application of natural killer cell immunotherapy for the treatment of cancer. Front Immunol. 6:578. [0772] Reference 7—Vindeløv, L. L., Christensen, I. J., and Nissen, N. I., 1983. A Detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis. Cytometry. 3(5), 323-327. [0773] Reference 8—Zimmermann, J, Nicolaus, T, Neuert, G. and Blank, K. 2010. Thiol-based, site-specific and covalent immobilization of biomolecules for single-molecule experiments. Nat. Protoc. 5(6):975-985. [0774] Reference 9—Rigo V, Emionite L, Daga A, Astigiano S, Comas MV, Quintarelli C, Locatelli F, Ferrini S, Croce M. 2017. Combined immunotherapy with anti-PDL-1/PD-1 and anti-CD4 antibodies cures syngeneic disseminated neuroblastoma. Sci. Rep. 7(1):14049. [0775] Reference 10—Manual of Human IL-15 Immunoassay (DL1500, R&D Systems) https://resources.rndsystems.com/pdfs/datasheets/d1500.pdf [0776] Reference 11—Robert Weinkove, Philip George, Nathaniel Dasyam, Alexander D McLellan, 2019. Selecting costimulatory domains for chimeric antigen receptors: functional and clinical considerations. Clin Transl Immunology. 8(5): e1049.
[0777] The foregoing descriptions are merely the preferred embodiments of the present invention and are not intended to limit the scope of the patent application of the present invention. Therefore, any alteration or modification that does not depart from the spirits disclosed herein should be included within the scope of the patent application of the present invention.