CYANOBACTERIAL STRAINS CAPABLE OF UTILIZING PHOSPHITE

20180112225 ยท 2018-04-26

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides genetically modified cyanobacterial cells that are capable of utilizing phosphite as a primary phosphorus source, and can out-compete contaminant organisms for certain forms of phosphorus more effectively.

Claims

1. A genetically modified cyanobacterial cell for the production of a product of interest, comprising: a) at least one recombinant gene that encodes a heterologous phosphite dehydrogenase enzyme EC:1.20.1.1 that catalyzes the oxidation of phosphite to phosphate; b) an operon comprising at least one recombinant phosphite transporter gene encoding at least one phosphite transporter protein for transporting phosphite into the cell; and c) at least one recombinant production gene encoding a polypeptide for the production of said product of interest.

2. The genetically modified cyanobacterial cell of claim 1, wherein the recombinant phosphite dehydrogenase gene encodes a polypeptide that has a sequence identity of greater than 60% to the protein sequence of the phosphite dehydrogenase enzyme from Cyanothece (SEQ ID NO: 16) or from Ralstonia (SEQ ID NO: 12).

3. The genetically modified cyanobacterial cell of claim 1, wherein the recombinant phosphite dehydrogenase gene is operably linked to a regulatable promoter selected from the group consisting of: a metal-regulatable promoter, a nitrate-regulatable promoter, and a phosphorus-regulatable promoter.

4. The genetically modified cyanobacterial cell of claim 1, wherein at least one of the phosphite transporter genes is derived from a different organism than the phosphite dehydrogenase gene.

5. The genetically modified cyanobacterial cell of claim 1, wherein the at least one phosphite transporter gene is from Desulfotignum phosphitoxidans or Cyanothece.

6. The genetically modified cyanobacterial cell of claim 1, wherein the at least one phosphite transporter protein is selected from the group consisting of PtxA, PtxB, PtxC, and PtdC.

7. The genetically modified cyanobacterial cell of claim 1, wherein the recombinant phosphite transporter operon comprises a gene encoding a protein that has a nucleic acid sequence identity of at least 60% to at least one of the ptxABC operon sequences selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 20, and SEQ ID NO: 23.

8. The genetically modified cyanobacterial cell of claim 1, wherein the recombinant phosphite transporter operon comprises a gene encoding a protein that has a sequence identity of greater than 60% to the protein sequence of PtdC from Desulfotignum phosphitoxidans (SEQ ID NO: 28).

9. The genetically modified cyanobacterial cell of claim 1, wherein the at least one recombinant phosphite transporter gene is operably linked to a regulatable promoter selected from a group consisting of: a metal- regulatable promoter, a nitrate-regulatable promoter, and a phosphorus-regulatable promoter.

10. The genetically modified cyanobacterial cell of claim 1, further comprising a modification of a gene encoding an endogenous repressor protein PhoU or a homolog thereof, which in its native form represses the expression of a phosphate transporter protein in the cyanobacterial cell, wherein the modification results in a knockout or knockdown of the endogenous repressor protein.

11. The genetically modified cyanobacterial cell of claim 10, wherein the modification of the gene encoding the endogenous repressor protein results in cellular metabolism consistent with a constant phosphorus starvation mode, resulting in an enhanced capability to take up and incorporate phosphorus from the medium.

12. The genetically modified cyanobacterial cell of claim 1, wherein the at least one recombinant production gene comprises a gene encoding a pyruvate decarboxylase enzyme and a gene encoding an alcohol dehydrogenase enzyme.

13. The genetically modified cyanobacterial cell of claim 1, wherein the promoter operably linked to said gene encoding said pyruvate decarboxylase enzyme is a regulatable promoter, and wherein the promoter operably linked to said alcohol dehydrogenase enzyme is a constitutive promoter, further wherein the product of interest is ethanol.

14. A recombinant expression cassette comprising at least one recombinant phosphite transporter gene encoding an enzyme that is at least a part of a transporter system for phosphite, and further comprising at least one recombinant phosphite dehydrogenase gene encoding an enzyme that catalyzes the oxidation of phosphite to phosphate, wherein at least one of said genes is operably linked to a regulatable promoter, wherein said expression cassette provides sufficient expression of said enzymes in a genetically modified cyanobacterial cell comprising said expression cassette to confer an ability on said genetically modified cyanobacterial cell to metabolize phosphite as a phosphorus source for supporting growth of said cyanobacterial cell, further comprising at least one recombinant production gene encoding a polypeptide for the production of a product of interest.

15. A method of producing a product of interest comprising the following method steps: a) providing a genetically modified cyanobacterial cell of claim 1; and b) growing said genetically modified cyanobacterial cell in a liquid medium exposed to photosynthetically active radiation, wherein the medium comprises phosphite as a source of phosphorus, the cell thereby producing the product of interest; wherein method step b) comprises a non-axenic culturing condition wherein contaminating heterotrophic organisms are present in the medium, further wherein the ratio of contaminating heterotrophic organisms to cyanobacterial cells is less than when phosphate is the main source of phosphorus in the medium.

16. The method of claim 15, wherein during method step b) the presence of contaminant cells is maintained below 110.sup.6 colony forming units per milliliter (CFU/mL), preferably below 110.sup.4 CFU/mL, after about 30 days of cultivation.

17. The method of claim 15, wherein during method step b) the growth of contaminant cells is reduced or inhibited by limiting availability of phosphate in the medium to less than 5 M.

18. The method of claim 15, wherein the contaminating heterotrophic organisms are present in at least a 5-fold lower concentration than when a normal amount of phosphate is provided to the medium.

19. The method of claim 15, wherein the product of interest is selected from the group consisting of: an alcohol, a biofuel, an alkane, a nutraceutical, a pharmaceutical, a lipid, a carbohydrate, biomass, a protein, an amino acid, a cell extract, and a pigment.

20. A method of producing a product of interest from cyanobacteria, comprising: a) providing a genetically modified cyanobacterial cell of claim 1, wherein the phosphite dehydrogenase gene and at least one of the recombinant production genes are present on the same extrachromosomal plasmid; and b) growing the genetically modified cyanobacterial cell in a medium comprising phosphite as the main source of phosphorus, under conditions to produce the product of interest, wherein the proportion of cells in which the at least one recombinant production gene remains functional in the host cyanobacterial cell is higher at the end of the cultivation period than in an otherwise identical cyanobacterium that does not have the phosphite dehydrogenase gene, cultured under identical conditions but growing on phosphate instead of phosphite.

21. The method of claim 20, wherein the phosphite dehydrogenase gene and at least one of the recombinant production genes are included in the same operon and operably linked to one regulatable promoter, further wherein the at least one recombinant production gene is located upstream of the phosphite dehydrogenase gene.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 is a schematic diagram of possible phosphate and/or phosphite uptake, utilization, and storage systems found in cyanobacteria.

[0021] FIG. 2 is a bar graph showing cell growth (average OD.sub.600) of isolated contaminant bacterial strains inoculated on bacterial minimal medium (BMM) broth for 48 hours in either phosphate or two concentrations of phosphite (50 and 230 M). The OD.sub.600 was calculated as OD=OD48 hours (+P)OD.sub.48 hours (P).

[0022] FIG. 3 is a line graph showing the cell growth (OD.sub.750) of wild type Cyanobacterium sp. PTA-13311 (AB1), in medium containing 230 M phosphate (black circles), 230 M phosphite (grey triangles), or no P source (empty squares). The cyanobacterial culture was previously grown on P-free medium for two rounds to reach a P-starvation stage. The graph shows that while the wild type strain can grow well on phosphate, it does not, without further modification, have the ability to utilize phosphite.

[0023] FIG. 4 is a maximum likelihood phylogenetic tree for phosphite dehydrogenase PtxD, based on 272 positions of an amino acid alignment. Bootstrap values are indicated. The strain name and GenBank accession number of the protein are listed on each leaf, along with whether the gene is located on the chromosome (C) or a plasmid (P), and if the ptx operon contains the PtxE regulator X). A question mark with X indicates that a regulator was found in the correct position or near the operon, but it is not similar to ptxE. A dash in place of an X indicates that the strain lacks a regulator near the ptx operon.

[0024] FIG. 5 is a table of several of the plasmid constructs discussed herein. The strain identification numbers, plasmid identification numbers, genotypes, promoters, and SEQ ID NOs. are indicated.

[0025] FIG. 6 is a map of the plasmid #1962 (SEQ ID NO: 1), present in cyanobacterial strain AB0493, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, Porf221-ptxABCD2104, having copper-inducible expression of phosphite utilization genes from Cyanothece, which are present in a single operon.

[0026] FIG. 7 is a map of the plasmid AB1617 (SEQ ID NO: 2), present in cyanobacterial strain AB0524, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing PnirA*2-ptxDR4506(AB1opt)-His6-IScpcBA-ptxABC2104-Toop, which allows nitrate inducible expression of phosphite utilization genes.

[0027] FIG. 8 is a map of the 17.6 kB plasmid pAB0611 (SEQ ID NO: 3), which is present in cyanobacterial strain AB701, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing Porf0316-pdc(AB1opt1)-TdsrA-PcpcB-adh111(AB1opt)-TrbcS-PpstS_ptxDR4506(AB1opt)-His6_IScpcBA_ptxABC2104, having phosphorus-regulatable (P-starvation inducible) expression of phosphite utilization genes, plus a copper inducible ethanol cassette.

[0028] FIG. 9 is a map of the plasmid cc215 (SEQ ID NO: 6), present in cyanobacterial strain AB0762, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Toop-Porf00615-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB0011-PpsaA-ptxDR4506(AB1opt)-His6-TpsaB, which has constitutive expression of the phosphite utilization genes, plus a nitrate inducible ethanol cassette.

[0029] FIG. 10 is a map of the plasmid cc220 (SEQ ID NO: 7) present in cyanobacterial strain AB764, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB 1opt)-TrbcS-Porf0316-ptxDR4506(AB1opt)-His6-IScpcBA-ptdCDp(AB1opt)-Toop-Porf0221-ptxABC2104-TB0011, allowing copper inducible expression of phosphite utilization genes with two phosphite transporters and a nitrate inducible ethanol cassette.

[0030] FIG. 11 is a map of the plasmid cc222 (SEQ ID NO: 8), present in cyanobacterial strain AB0765, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing Porf0316-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-PnirA*2-ptxDR4506(AB1opt)-His6-IScpcBA-ptxABC2104-Toop, which allows nitrate inducible expression of phosphite utilization genes, plus copper inducible expression of the ethanol cassette.

[0031] FIG. 12 is a map of the plasmid cc233 (SEQ ID NO: 9), present in cyanobacterial strain AB0766, as indicated in the table in FIG. 5. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311, containing PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Porf0316-ptxDR4506(AB1opt)-His6-IScpcBA-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB0011, which allows copper inducible expression of the phosphite utilization genes, and a nitrate inducible ethanol cassette.

[0032] FIG. 13 is a map of the plasmid #1980 (SEQ ID NO: 10), which was used to generate cyanobacterial knock-out strain AB0040, as indicated in the table in FIG. 5. The strain AB0040 is Cyanobacterium sp. PTA-13311 having a knockout of the phosphate transport regulator gene phoU (orf0666). This results in a faster rate of phosphate uptake into the cell, when phosphate is present in the medium.

[0033] FIG. 14A is a graph showing the comparative cell growth (OD.sub.750) of the phosphite-utilizing, ethanologenic strain AB0766 on phosphite as the phosphorus source, with the control ethanologenic strain AB0250 on phosphate as the phosphorus source. Additional nutrients and the indicated P source were added at day 10. The graph shows similar cell growth in the two strains.

[0034] FIG. 14B is a graph showing the comparative chlorophyll content (in mg/L) of the phosphite-utilizing, ethanologenic strain AB0766 on phosphite as the phosphorus source, with the control ethanologenic strain AB0250 on phosphate as the phosphorus source. The graph shows similar chlorophyll content in the two strains.

[0035] FIG. 14C is a graph showing comparative ethanol production (in v/v) of the phosphite-utilizing, ethanologenic strain AB0766 on phosphite as the phosphorus source, with the control ethanologenic strain AB0250 on phosphate as the phosphorus source. The graph shows similar ethanol production in the two strains.

[0036] FIG. 15 is a line graph showing the ethanol production (in v/v) of a phosphite-utilizing, ethanologenic strain AB0701 on either phosphate or phosphite as the phosphorus source, in comparison to the control ethanologenic strain AB0012 (see FIG. 5), growing with phosphate as the sole phosphorus source. At day 20, two of the cultures were switched from one form of phosphorus to the other, showing that this change in phosphorus source does not affect ethanol production.

[0037] FIG. 16 is a line graph showing that certain contaminants grow poorly on PO.sub.3. The common contaminant bacterium Alcanivorax was added to an axenic culture containing the phosphite utilizing cyanobacterial strain AB0493, with either phosphate or phosphite as the sole phosphorus source. The Alcanivorax cell count (in CFU/ml), was determined over a 13 day growth period. Alcanivorax grew well when PO.sub.4 was the sole phosphorus source, but grew poorly when the sole phosphorus source was PO.sub.3.

[0038] FIG. 17 is a line graph showing the bacterial consumption of artificially added (spiked) ethanol in a culture of the phosphite utilizing cyanobacterial strain AB0493, which was artificially contaminated with the bacterium Alcanivorax, grown in either phosphate or phosphite as the sole phosphorus source. At day 8 a second dose of ethanol was added to the culture grown on phosphate. The Alcanivorax strain was incapable of consuming the artificially added ethanol when the sole phosphorus source was PO.sub.3. However, when the sole phosphorus source was phosphate, Alcanivorax was able to rapidly consume the added ethanol.

[0039] FIG. 18A is a line graph showing the cyanobacterial cell growth (in OD.sub.750) of the phosphite-utilizing cyanobacterial strain AB0701, spiked with either the bacterial contaminant Alcanivorax, or with a contaminant mix, when grown on phosphate as the sole phosphorus source. Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added. At day 14, the cultures were harvested, and a portion was re-suspended in new medium.

[0040] FIG. 18B shows the ethanol levels (in % v/v) in the culture media for the same time period as for FIG. 18A. Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added. The graph shows that the ethanol consumption was rapid when the culture was grown on phosphate. By the second batch, most of the ethanol was consumed by the contaminants.

[0041] FIG. 19A is a line graph showing the cyanobacterial cell growth (in OD.sub.750) of the phosphite-utilizing cyanobacterial strain AB0701, spiked with either the bacterial contaminant Alcanivorax, or with a contaminant mix, when grown on phosphite as the sole phosphorus source. Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added.

[0042] FIG. 19B is a line graph showing the ethanol levels (in % v/v) in the culture medium for the same time period as in FIG. 19A. Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added. The ethanol accumulation is increased by use of phosphite rather than phosphate as a phosphorus source (compare to FIG. 18B). This is particularly noticeable during the second batch after day 14.

[0043] FIG. 20A is a line graph showing cell growth (in OD.sub.750) of the phosphite-utilizing cyanobacterial strain AB0701, intentionally contaminated with either the bacterial contaminant Alcanivorax, or with a contaminant mix, when grown with phosphate for the first 14 days, then switched to growth on phosphite for the second batch. Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added.

[0044] FIG. 20B is a line graph showing ethanol levels (in v/v) in the culture media for the culture described in FIG. 20A. The switching from phosphate to phosphite after dilution does not appear to diminish cell growth or ethanol production and ethanol accumulation is increased by switching to phosphite rather than continuing with phosphate as the phosphorus source (compare to FIG. 18B). Empty squares: Axenic culture. Grey triangles: Culture with Alcanivorax added. Black circles: Culture with a contaminant mix added.

[0045] FIG. 21A is a line graph showing bacterial growth (in CFU/ml) in an intentionally contaminated cyanobacterial culture (either Alcanivorax or a mixed contaminant culture) over a 28 day batch, with a harvest/dilution to new medium with the same phosphorus source at day 14. The cultures were grown on either phosphite or phosphate as the sole phosphorus source. The bacterial count was much lower when the contaminated cultures were grown on PO.sub.3 than when they were grown on PO.sub.4.

[0046] FIG. 21B is a line graph showing bacterial growth (in CFU/ml) in an intentionally contaminated cyanobacterial culture (either Alcanivorax or a mixed contaminant culture) over a 28 day batch, grown for the first 14 days on either phosphite or phosphate as the sole phosphorus source. The cells were then harvested/diluted to new medium with the opposite phosphorus source (phosphate or phosphite) at day 14. The bacterial count was much lower when the contaminated cultures were grown on PO.sub.3 than when they were grown on PO.sub.4.

[0047] FIG. 22A is a line graph showing cyanobacterial cell growth (in OD.sub.750) in medium intentionally contaminated with either Alcanivorax or a contaminant mix, with either PO.sub.4 or PO.sub.3 as the sole P source, when grown for a 24 day batch.

[0048] FIG. 22B is a line graph showing ethanol yield (% v/v) in the same culture as in FIG. 22A, with medium intentionally contaminated with either Alcanivorax or a contaminant mix, where the medium contained either PO.sub.4 or PO.sub.3 as the sole P source, when grown for a 24 day batch. The intentionally contaminated cultures growing on PO.sub.3 had a higher yield of ethanol than the intentionally contaminated cultures growing on PO.sub.4. By the end of the run at 24 days, very little ethanol remained in the intentionally contaminated cultures growing on PO.sub.4.

[0049] FIG. 22C is a line graph showing the level of contamination present (in CFU/ml) in the experiment described above in FIG. 22A and 22B. The PO.sub.4grown cells had a higher level of bacterial contamination than the PO.sub.3grown cells throughout the length of the run.

DETAILED DESCRIPTION

[0050] As an alternative to the use of costly antibiotics and other chemicals in large scale culture systems, cyanobacteria can be designed to effectively utilize alternative nutrient components that are not utilized by many contaminants. Although contaminating organisms would still be likely to be present in the culture, their growth can be limited such that they are no longer a major challenge to the cyanobacterial production process.

[0051] Aspects of the invention utilize techniques and methods common to the fields of molecular biology, microbiology and cell culture. Useful laboratory references for these types of methodologies are readily available to those skilled in the art. See, for example, Molecular Cloning: A Laboratory Manual (Third Edition), Sambrook, J., et al. (2001) Cold Spring Harbor Laboratory Press; Current Protocols in Microbiology (2007) Edited by Coico, R, et al., John Wiley and Sons, Inc.; The Molecular Biology of Cyanobacteria (1994) Donald Bryant (Ed.), Springer Netherlands; Handbook Of Microalgal Culture Biotechnology And Applied Phycology (2003) Richmond, A.; (ed.), Blackwell Publishing; and The Cyanobacteria, Molecular Biology, Genomics and Evolution, Edited by Antonia Herrero and Enrique Flores, Caister Academic Press, Norfolk, UK, 2008.

[0052] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

Definitions

[0053] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

[0054] The term about is used herein to mean approximately, in the region of, roughly, or around. When the term about is used in conjunction with a numerical value/range, it modifies that value/range by extending the boundaries above and below the numerical value(s) set forth. In general, the term about is used herein to modify a numerical value(s) above and below the stated value(s) by a variance of 20%.

[0055] The term cyanobacterium refers to a member from the group of photoautotrophic prokaryotic microorganisms which can utilize solar energy and fix carbon dioxide. Cyanobacteria are also referred to as blue-green algae.

[0056] The terms host cell and recombinant host cell are intended to include a cell suitable for metabolic manipulation, e.g., which can incorporate heterologous polynucleotide sequences, e.g., which can be transformed. The term is intended to include progeny of the cell originally transformed. In particular embodiments, the cell is a prokaryotic cell, e.g., a cyanobacterial cell. The term recombinant host cell is intended to include a cell that has already been selected or engineered to have certain desirable properties and to be suitable for further genetic enhancement.

[0057] The terms phosphorus and P refer to a chemical element that is a nutrient source for cell growth. Phosphorus can be present in several different forms, such as phosphoric acid, phosphorus acid, hypophosphorous acid, phosphate, and phosphite. Salts with various compounds, such as calcium, potassium, sodium, are also common forms.

[0058] The term phosphate means phosphoric acid (PO.sub.4.sup.3) and related salts, such as sodium salt, potassium salt, and calcium salt.

[0059] The term phosphite means phosphorous acid (H.sub.3PO.sub.3) and related salts. Other common names for phosphite include, for example, phosphonic acid, phosphonate, and phosphorous acid. Phosphite may be provided as any suitable phosphite compound or combination of phosphite compounds. Exemplary forms of phosphite include, but are not limited to phosphite salts of sodium, potassium, ammonium, calcium, or magnesium, or any combination thereof. An example of a sodium salt of phosphite is Na.sub.2HPO.sub.3 pentahydrate. Phosphite can be oxidized to phosphate.

[0060] The terms phosphite dehydrogenase, phosphonate dehydrogenase, NAD:phosphite oxidoreductase, and PtxD refer to a protein in the class EC 1.20.1.1, which can catalyze the following reactions: [0061] phosphite+NAD(P).sup.++H.sub.2O.fwdarw.phosphate+NAD(P)H.sup.+ [0062] or [0063] phosphonate+NAD(P).sup.+H.sub.2O.fwdarw.phosphate+NAD(P)H.sup.+

[0064] The term phosphite transporter refers to a protein or complex that is capable of importing phosphite into the cyanobacterial cell. This can be an ABC transporter complex of several polypeptides (such as PtxA,B,C). ABC transporters belong to the ATP-Binding Cassette (ABC) superfamily, which uses the hydrolysis of ATP to provide energy for the transport. ABC transporters are involved in the export or import of a wide variety of substrates. The major function of ABC import systems is to provide essential nutrients to cells. ABC transporters typically have two conserved regions: a highly conserved ATP binding cassette (ABC) and a less conserved transmembrane domain (TMD).

[0065] The polypeptide PtxA refers to a phosphite transport system ATP binding protein having a Transporter Classification number of TC 3.A.1.9.1. The polypeptide is homologous to a phosphonate transport ATP binding protein (PhnC).

[0066] The polypeptide PtxB refers to a phosphite transport system substrate binding protein having a Transporter Classification number of TC 3.A.1.9.1. The polypeptide is homologous to a phosphonate transport system substrate binding protein (PhnD).

[0067] The polypeptide PtxC refers to a phosphite transport system permease protein having a Transporter Classification number of TC 3.A.1.9.1. The polypeptide is homologous to a phosphonate transport system permease protein (PhnE).

[0068] The term phosphite transporter can also encompass other types of phosphite transporter systems or phosphonate transporter systems, such as the single protein phosphite transport system that is exemplified by the PtdC protein from Desulfotignum phosphitoxidans, an organophosphate:inorganic phosphate antiporter (OPA) family protein.

[0069] The term phosphate transporter refers to a protein or complex that is capable of importing phosphate into the cyanobacterial cell. The transporter protein can be, for example, a membrane-bound protein.

[0070] The term phosphate metabolism regulating protein refers to a protein that modulates (either increases or decreases), inter alia, the entry of phosphate into the cell. It can be a regulatory protein that regulates the expression or the activity of other proteins involved in the phosphate uptake process. In an embodiment, the phosphate metabolism regulating protein is PhoU, and its elimination from the cell can lead to an increase in phosphate uptake rates. PhoU is a global phosphate response regulator which is responsible for the repression of the high affinity PstSCAB uptake system in cyanobacteria and also regulates expression of other genes involved in the response to phosphate limitation. Other genes encoding proteins involved in the phosphate transport system can be genetically modified to alter the rate of entry of phosphate into the cell.

[0071] As used herein, the term biomass refers to the cellular material produced from the cyanobacterial cultures. Biomass can be comprised of lipids, protein, and /or carbohydrates. Biomass can be obtained from axenic or non-axenic cyanobacterial cell cultures. A cyanobacterial biomass can be in a liquid, or condensed to a paste, or can be substantially dried. At least some of the cell components can have been previously removed, such as a product (for example, ethanol), or a lipid, or another compound, leaving the remaining material as biomass. Cyanobacterial biomass can also mean whole, live or dead cells.

[0072] Competent to express refers to a host cell that provides a sufficient cellular environment for expression of endogenous and/or exogenous polynucleotides.

[0073] As used herein, the term genetically modified refers to any change in the endogenous genome of a wild type cell or to the addition of non-endogenous genetic code to a wild type cell, e.g., the introduction of a heterologous gene. More specifically, such changes are made by the hand of man through the use of recombinant DNA technology or mutagenesis. The changes can involve protein coding sequences or non-protein coding sequences, including regulatory sequences such as promoters or enhancers.

[0074] The terms polynucleotide and nucleic acid also refer to a polymer composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof) linked via phosphodiester bonds, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof. Thus, the term includes nucleotide polymers in which the nucleotides and the linkages between them include non-naturally occurring synthetic analogs. It will be understood that, where required by context, when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which U replaces T.

[0075] The nucleic acids can be modified chemically or biochemically or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as uncharged linkages, charged linkages, alkylators, intercalators, pendent moieties, modified linkages, and chelators. Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions.

[0076] The term nucleic acid (also referred to as polynucleotide) is also intended to include nucleic acid molecules having an open reading frame encoding a polypeptide, and can further include non-coding regulatory sequences and introns. In addition, the terms are intended to include one or more genes that map to a functional locus. In addition, the terms are intended to include a specific gene for a selected purpose. The gene can be endogenous to the host cell or can be recombinantly introduced into the host cell.

[0077] In one aspect the invention also provides nucleic acids which are at least 50%, 60%, 70%, 80% 90%, 95%, 99%, or 99.5% identical to the nucleic acids disclosed herein.

[0078] The percentage of identity of two nucleic acid sequences or two amino acid sequences can be determined using the algorithm of Thompson et al. (CLUSTALW, 1994, Nucleic Acids Research 22: 4673-4680). A nucleotide sequence or an amino acid sequence can also be used as a so-called query sequence to perform a search against public nucleic acid or protein sequence databases in order, for example, to identify further unknown homologous promoters, which can also be used in embodiments of this invention. In addition, any nucleic acid sequences or protein sequences disclosed in this patent application can also be used as a query sequence in order to identify yet unknown sequences in public databases, which can encode for example new enzymes, which could be useful in this invention. Such searches can be performed using the algorithm of Karlin and Altschul (1990, Proceedings of the National Academy of Sciences U.S.A. 87: 2,264 to 2,268), modified as in Karlin and Altschul (1993, Proceedings of the National Academy of Sciences U.S.A. 90: 5,873 to 5,877). Such an algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al. (1990, Journal of Molecular Biology 215: 403 to 410). Suitable parameters for these database searches with these programs are, for example, a score of 100 and a word length of 12 for BLAST nucleotide searches as performed with the NBLAST program. BLAST protein searches are performed with the XBLAST program with a score of 50 and a word length of 3. Where gaps exist between two sequences, gapped BLAST is utilized as described in Altschul et al. (1997, Nucleic Acids Research, 25: 3,389 to 3,402).

[0079] In one aspect the invention also provides amino acid sequences which are at least 50%, 55%, 60%, 70%, 80% 90%, 95%, 97%, 99%, or 99.5% identical to the amino acid sequences disclosed herein.

[0080] Database entry numbers given in the following are for the CyanoBase, the genome database for cyanobacteria (http://bacteria.kazusa.orjp/cyanobase/index.html); Nakamura et al. Cyan Base, the genome database for Synechocystis sp. Strain PCC 6803: status for the year 2000, Nucleic Acid Research, 2000, Vol. 18, page 72.

[0081] Recombinant refers to polynucleotides synthesized or otherwise manipulated in vitro (recombinant polynucleotides) and to methods of using recombinant polynucleotides to produce gene products encoded by those polynucleotides in cells or other biological systems. For example, a cloned polynucleotide may be inserted into a suitable expression vector, such as a bacterial plasmid, and the plasmid can be used to transform a suitable host cell. A host cell that comprises the recombinant polynucleotide is referred to as a recombinant host cell or a recombinant bacterium or a recombinant cyanobacterium. The gene is then expressed in the recombinant host cell to produce, e.g., a recombinant protein. A recombinant polynucleotide may serve a non-coding function (e.g., promoter, origin of replication, ribosome-binding site, etc.) as well.

[0082] The term homologous recombination refers to the process of recombination between two nucleic acid molecules based on nucleic acid sequence similarity. The term embraces both reciprocal and nonreciprocal recombination (also referred to as gene conversion). In addition, the recombination can be the result of equivalent or non- equivalent cross-over events. Equivalent crossing over occurs between two equivalent sequences or chromosome regions, whereas nonequivalent crossing over occurs between identical (or substantially identical) segments of nonequivalent sequences or chromosome regions. Unequal crossing over typically results in gene duplications and deletions. For a description of the enzymes and mechanisms involved in homologous recombination see Court et al., Genetic engineering using homologous recombination, Annual Review of Genetics 36:361-388; 2002.

[0083] The term expressed endogenously refers to polynucleotides that are native to the host cell and are naturally expressed in the host cell.

[0084] The term vector as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a plasmid, which generally refers to a circular double stranded DNA molecule into which additional DNA segments may be ligated, but also includes linear double-stranded molecules such as those resulting from amplification by the polymerase chain reaction (PCR) or from treatment of a circular plasmid with a restriction enzyme.

[0085] Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as recombinant expression vectors (or simply expression vectors).

[0086] An endogenous plasmid is one that is from the host cyanobacterial cell itself, rather than being obtained from a different organism. One exemplary endogenous plasmid is the p6.8 plasmid from Cyanobacterium sp. PTA-13311. This plasmid, when carrying inserted genes, is able to remain in the cell at a relatively high copy number.

[0087] A heterologous plasmid is derived from other than the host cyanobacterial cell.

[0088] The phrase operably linked means that the nucleotide sequence of the nucleic acid molecule or gene of interest is linked to the regulatory sequence(s) in a manner which allows for regulation of expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the nucleotide sequence and expression of a gene product encoded by the nucleotide sequence (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism).

[0089] A promoter is an array of nucleic acid control sequences that direct transcription of an associated polynucleotide, which may be a heterologous or native polynucleotide. A promoter includes nucleic acid sequences near the start site of transcription, such as a polymerase binding site. The promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. The term promoter is also intended to include a polynucleotide segment that can transcriptionally control a gene of interest that it does or does not transcriptionally control in nature. In one embodiment, the transcriptional control of a promoter results in an increase in expression of the gene of interest. In an embodiment, a promoter is placed 5 to the gene of interest. A heterologous promoter can be used to replace the natural promoter, or can be used in addition to the natural promoter. A promoter can be endogenous with regard to the host cell in which it is used or it can be a heterologous polynucleotide sequence introduced into the host cell.

[0090] The term regulatable promoter refers to a promoter that can up-regulate or down-regulate the transcription of its operably linked gene by the presence or absence of a compound, an environmental factor, or another stimulus. For example, certain promoters can be up-regulated (inducible) by the presence of a nutrient, while other promoters are up-regulated by the absence of the nutrient.

[0091] The term phosphorus-regulatable promoter is a promoter that is regulated by the presence or absence of phosphorus. For example, the pstS promoter is a phosphorus-regulatable promoter that is induced under phosphorus starvation conditions.

[0092] The term metal-regulatable promoter is a promoter that is regulated by the level of a specific metal ion in the culture medium.

[0093] The term nitrate-regulatable promoter is a promoter that is regulated by the level of nitrate in the culture medium.

[0094] The term inducible promoter is a regulatable promoter that up-regulates an operably linked gene in response to certain stimuli (such as nutrient availability, nutrient starvation, heat shock, environmental stress, cold stress, salt stress, mechanical stress, light exposure, etc.), leading to the transcription of the gene.

[0095] The term recombinant nucleic acid molecule includes a nucleic acid molecule (e.g., a DNA molecule) that has been altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides). The recombinant nucleic acid molecule (e.g., a recombinant DNA molecule) also includes an isolated nucleic acid molecule or gene of the present invention.

[0096] The term gene refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids. Gene also refers to a nucleic acid fragment that expresses a specific protein or polypeptide, including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence.

[0097] The term endogenous gene refers to a native gene in its natural location in the genome of an organism.

[0098] A foreign gene or heterologous gene refers to a gene not normally found in the host organism, but that is introduced into the host organism by gene transfer. Foreign genes can comprise native genes inserted into a non-native organism, or chimeric genes. A transgene is a gene that has been introduced into the genome by a transformation procedure.

[0099] The term fragment refers to a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over the common portion, a nucleotide sequence substantially identical to the reference nucleic acid. Such a nucleic acid fragment according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length from at least about 6, 50, 100, 200, 500, 1,000, to about 1,500 or more consecutive nucleotides of a polynucleotide according to the invention.

[0100] The term open reading frame, abbreviated as ORF, refers to a length of nucleic acid sequence, either DNA, cDNA or RNA, that comprises a translation start signal or initiation codon, such as an ATG or AUG, and a termination codon and can be potentially translated into a polypeptide sequence.

[0101] The term upstream refers to a nucleotide sequence that is located 5 to reference nucleotide sequence. In particular, upstream nucleotide sequences generally relate to sequences that are located on the 5 side of a coding sequence or starting point of transcription. For example, most promoters are located upstream of the start site of transcription.

[0102] The term downstream refers to a nucleotide sequence that is located 3 to a reference nucleotide sequence. In particular, downstream nucleotide sequences generally relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription.

[0103] The term homology refers to the percent of identity between two polynucleotide or two polypeptide moieties. The correspondence between the sequence from one moiety to another can be determined by techniques known to the art. For example, homology can be determined by a direct comparison of the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions that form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s) and size determination of the digested fragments.

[0104] As used herein, substantially similar refers to nucleic acid fragments wherein changes in one or more nucleotide bases results in substitution of one or more amino acids, but do not affect the functional properties of the protein encoded by the DNA sequence. The term substantially similar also refers to modifications of the nucleic acid fragments of the instant invention such as deletion or insertion of one or more nucleotide bases that do not substantially affect the functional properties of the resulting transcript.

[0105] The terms restriction endonuclease and restriction enzyme refer to an enzyme that binds and cuts within a specific nucleotide sequence within double stranded DNA.

[0106] The term expression, as used herein, refers to the transcription and stable accumulation mRNA derived from a nucleic acid or polynucleotide. Expression may also refer to translation of mRNA into a protein or polypeptide.

[0107] An expression cassette or construct refers to a series of polynucleotide elements that permit transcription of a gene in a host cell. Typically, the expression cassette includes a promoter and a heterologous or native polynucleotide sequence that is transcribed. Expression cassettes or constructs may also include, e.g., transcription termination signals, polyadenylation signals, and enhancer elements.

[0108] The term codon refers to a triplet of nucleotides coding for a single amino acid.

[0109] The term codon-anticodon recognition refers to the interaction between a codon on an mRNA molecule and the corresponding anticodon on a tRNA molecule.

[0110] The term codon bias refers to the fact that different organisms use different codon frequencies.

[0111] The terms codon optimization, codon improvement, and codon optimization refer to the modification of at least some of the codons present in a heterologous gene sequence from a triplet code that is not generally used in the host organism to a triplet code that is more common in the particular host organism. This can result in a higher expression level of the gene of interest.

[0112] The term transformation is used herein to mean the insertion of heterologous genetic material into the host cell. Typically, the genetic material is DNA on a plasmid vector, but other means can also be employed. General transformation methods and selectable markers for bacteria and cyanobacteria are known in the art (Wirth, Mol Gen Genet. 216:175-177 (1989); Koksharova, Appl Microbiol Biotechnol 58:123-137 (2002). Additionally, transformation methods and selectable markers for use in bacteria are well known (see, e.g., Sambrook et al, supra).

[0113] The term selectable marker means an identifying factor, usually an antibiotic or chemical resistance gene, that is able to be selected for based upon the marker gene's effect, i.e., resistance to an antibiotic, resistance to a herbicide, colorimetric markers, enzymes, fluorescent markers, and the like, wherein the effect is used to track the inheritance of a nucleic acid of interest and/or to identify a cell or organism that has inherited the nucleic acid of interest. Examples of selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, spectinomycin, kanamycin, hygromycin, and the like.

[0114] A polypeptide is a polymeric molecule comprised of covalently linked amino acid residues. A protein is a polypeptide that performs a structural or functional role in a living cell.

[0115] A heterologous protein refers to a protein not naturally produced in the cell.

[0116] An isolated polypeptide or isolated protein is a polypeptide or protein that is substantially free of those compounds that are normally associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids).

[0117] The term fragment of a polypeptide refers to a polypeptide whose amino acid sequence is shorter than that of the reference polypeptide. Such fragments of a polypeptide according to the invention may have a length of at least about 2, 50, 100, 200, or 300 or more amino acids.

[0118] A variant of a polypeptide or protein is any analogue, fragment, derivative, or mutant which is derived from a polypeptide or protein and which retains at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or post-translational modification. The skilled artisan can produce variants having single or multiple amino acid substitutions, deletions, additions, or replacements.

[0119] As used herein, the phrase increased activity refers to any genetic modification resulting in increased levels of enzyme function in a host cell. As known to one of ordinary skill in the art, enzyme activity may be increased by increasing the level of transcription, either by modifying promoter function or by increasing gene copy number; increasing translational efficiency of an enzyme messenger RNA, e.g., by modifying ribosomal binding; or by increasing the stability of an enzyme, which increases the half-life of the protein, leading to the presence of more enzyme molecules in the cell. All of these represent non-limiting examples of increasing the activity of an enzyme. (mRNA Processing and Metabolism: Methods and Protocols, Edited by Daniel R. Schoenberg, Humana Press Inc., Totowa, N.J.; 2004; ISBN 1-59259-750-5; Prokaryotic Gene Expression (1999) Baumberg, S., Oxford University Press, ISBN 0199636036; The Biomedical Engineering Handbook (2000) Bronzino, J. D., Springer, ISBN 354066808X).

[0120] The terms pyruvate decarboxylase and Pdc refer to an enzyme that catalyzes the decarboxylation of pyruvic acid to acetaldehyde and carbon dioxide. A pdc gene refers to the gene encoding an enzyme that catalyzes the decarboxylation of pyruvic acid to acetaldehyde and carbon dioxide.

[0121] The terms alcohol dehydrogenase and Adh refer to an enzyme that facilitates the interconversion between alcohols and aldehydes or ketones. An adh gene refers to the gene encoding an enzyme that facilitates the interconversion between alcohols and aldehydes or ketones, Pdc/Adh refers to the Pdc and Adh enzymes collectively. A pdc/adh cassette refers to a nucleic acid sequence encoding a Pdc enzyme and an Adh enzyme.

[0122] The term ethanologenic cassette refers to any polynucleotide sequence that encodes enzymes capable of producing ethanol alone or in combination with other exogenous or endogenous enzymes. In a certain embodiment, an ethanologenic cassette comprises genes encoding an alcohol dehydrogenase and a pyruvate decarboxylase.

[0123] The term primer is an oligonucleotide that hybridizes to a target nucleic acid sequence to create a double stranded nucleic acid region that can serve as an initiation point for DNA synthesis under suitable conditions. Such primers may be used in a polymerase chain reaction.

[0124] The term polymerase chain reaction, also termed PCR, refers to an in vitro method for enzymatically amplifying specific nucleic acid sequences. PCR involves a repetitive series of temperature cycles with each cycle comprising three stages: denaturation of the template nucleic acid to separate the strands of the target molecule, annealing a single stranded PCR oligonucleotide primer to the template nucleic acid, and extension of the annealed primer(s) by DNA polymerase. PCR provides a means to detect the presence of the target molecule and, under quantitative or semi-quantitative conditions, to determine the relative amount of that target molecule within the starting pool of nucleic acids.

[0125] The term knockdown refers to a partial suppression of the expression of a target gene. A knockdown can occur, for example, when antisense is used. Some expression may still remain when using antisense, so this term is used rather than knockout.

[0126] The term knockout generally refers to a partial or complete suppression of the expression of at least a portion of a protein encoded by an endogenous DNA sequence in a cell. As used herein, the knockout relates to the deletion or insertional inactivation of a target gene.

[0127] The term knockout construct refers to a nucleic acid sequence that is designed to decrease or suppress expression of a protein encoded by endogenous DNA sequence in a cell. The knockout construct is inserted into a cell, and integrates with the genomic DNA of the cell in such a position so as to prevent or interrupt transcription of the native DNA sequence. Such insertion usually occurs by homologous recombination. The knockout construct nucleic acid sequence may comprise (1) a full or partial sequence of the gene to be suppressed, (2) a full or partial promoter sequence of the gene to be suppressed, or (3) combinations thereof. Typically, the knockout construct is inserted into a cyanobacterial host cell and is integrated into the cell genomic DNA to delete a target gene, usually by the process of homologous recombination.

[0128] The phrases disruption of the gene and gene disruption refer to a deletion or insertion of a nucleic acid sequence into one region of the native DNA sequence and/or the promoter region of a gene so as to decrease or prevent expression of that gene in the cell as compared to the wild-type or naturally occurring sequence of the gene.

[0129] The term environmental stress means a stress caused by the area surrounding the growing cell. Exemplary environmental stresses include heat stress, cold stress, pH stress, nutrient stress, high oxygen stress, and the like. An environmental stress can cause slower growth and can also trigger altered biosynthetic pathways.

[0130] The term plurality means more than one.

Phosphite as a Phosphorus Source

[0131] Microorganisms have evolved to utilize different forms of nutrient sources, such as phosphorus. Phosphorus is available in the environment in several forms. The phosphate form of phosphorus is more generally available in the natural environment, in comparison to other forms, such as phosphite or organic phosphorus sources. Further, phosphate is the form that most organisms can utilize most effectively. Phosphate is also the form that is most commonly used in cyanobacterial culture media. A schematic diagram of possible phosphate and/or phosphite uptake, utilization, and storage systems is shown in FIG. 1.

[0132] Most microorganisms take up and utilize phosphite poorly, if at all. To demonstrate this, as shown in Example 3 and in FIG. 2, 14 strains of bacterial contaminants found in cyanobacterial photobioreactors were isolated, purified, and tested for their ability to grow on phosphite. The strains either grew poorly or not at all when the only source of phosphorus present in the medium was phosphite.

[0133] Two fungal strains that were isolated from outdoor cyanobacterial cultures were also tested for their ability to utilize phosphiteboth of these strains utilized phosphite poorly (Example 4).

[0134] Thus, a cyanobacterial cell that is able to take up and adequately utilize phosphite can have a growth advantage when grown in the presence of phosphite over contaminants that utilize only phosphate. In an embodiment, cyanobacteria can be genetically modified to utilize alternative forms of phosphorus, such as phosphite, and can have a higher likelihood of out-competing contaminating heterotrophic bacteria and other organisms for phosphorus when it is supplied as phosphite.

[0135] The cyanobacterial production strain Cyanobacterium sp. PTA-13311 (AB1) is currently being utilized as a base organism for ethanol production, particularly due to its fast growth and its ability to withstand environmental stresses. Unfortunately, however, this cyanobacterial strain (as well as most other cyanobacterial strains) does not, by itself, take up or utilize phosphite (Example 5; FIG. 3). The genes involved in phosphite utilization and uptake would accordingly need to be identified and transferred into the cyanobacterial production strain in order to allow it to grow on phosphite.

[0136] The phosphite dehydrogenase enzyme has been described previously (Costas, et al., (2001), Purification and characterization of a novel phosphorus-oxidizing enzyme from Pseudomonas stutzeri WM88, J. Biol. Chem. 276:17429-17436; Vrtis et al. (2001), Phosphite dehydrogenase: An unusual phosphoryl transfer reaction, J. Am. Chem. Soc. 123:2672-2673). The international application publication number WO2010/058298, to Herrera-Estrella, teaches transgenic plants and fungi that have been modified by the addition of the phosphite dehydrogenase (ptxD) gene from Pseudomonas stutzeri to utilize phosphite as a phosphorus source.

[0137] US patent application US20040091985 to Metcalf teaches a phosphite dehydrogenase enzyme from several microorganisms, including Pseudomonas stutzeri and cyanobacteria such as Nostoc sp. PCC 7120. The PtxD gene was transferred to E. coli, where it was produced at high levels, followed by purification, in order to aid in the biochemical characterization of the enzyme.

[0138] Higher plants have previously been genetically modified to utilize phosphite. Lopez-Arredondo (2012), for example, described the production of transgenic Arabidopsis and tobacco plants that were engineered with a ptxD gene derived from Pseudomonas stutzeri in order to utilize phosphite. Fertilization of the transformed plants with phosphite resulted in vigorous growth and increased biomass while also controlling nearby weed growth. In comparison, the control plants died a few days after fertilization with phosphite (Engineering phosphorus metabolism in plants to produce a dual fertilization and weed control system, Nature Biotechnology, 30:889-893).

[0139] Most (but not all) microorganisms are incapable of utilizing phosphite. Loera-Quezada (2015), noting that certain strains of bacteria and cyanobacteria are capable of utilizing phosphite as the sole P source, attempted to utilize phosphite as a P source for several eukaryotic algal species. The algal cells grew poorly if phosphite was present in the medium (along with phosphate), and did not survive with phosphite as the sole source of P. They concluded that although phosphite was non-toxic to the algae, the algae cells were unable to metabolize it (Phosphite cannot be used as a phosphorus source but is non-toxic for microalgae, Plant Science 231: 124-130).

[0140] Most cyanobacterial species are capable of taking up and transporting phosphate into the cell. However, only a few cyanobacteria have the natural capability for phosphite uptake. Some of these phosphite-utilizing organisms have been found, and their phosphite uptake genes (such as, for example, ptxA,B,C) have been identified. The phosphite utilizing organisms also typically contain genes that encode a phosphite dehydrogenase enzyme (PtxD) that can catalyze the conversion of phosphite to phosphate.

Recombinant Expression of Phosphite Dehydrogenase (PtxD and homologs) in Cyanobacteria

[0141] In an embodiment, the genes for phosphite utilization, as well as the genes encoding proteins involved in phosphite uptake into the cell, have been identified and transferred to cyanobacterial strains that have been genetically modified to produce ethanol or other products of interest. The growth advantage this provides allows the genetically modified cyanobacterial strains to produce the product of interest in a non-axenic culture.

[0142] Because most heterotrophic bacteria utilize phosphite poorly, a culture of cyanobacteria engineered to utilize phosphite that has been contaminated with such heterotrophic bacteria has a better chance of surviving, thriving, and producing product for a longer time than a cyanobacterial culture that only utilizes phosphate. Furthermore, consumption of a product secreted by the cyanobacteria by contaminating heterotrophic bacteria is less likely to occur.

[0143] The gene encoding phosphite dehydrogenase is capable of catalyzing the transformation of phosphite to phosphate, once the phosphite molecule is transported to the interior of the cyanobacterial cell. The gene encoding phosphite dehydrogenase can be obtained from any suitable source. Other names for phosphite dehydrogenase include, for example, phosphonate dehydrogenase and NAD:phosphite oxidoreductase. In an embodiment, any enzyme that is capable of oxidizing phosphite to phosphate would be suitable. In an embodiment, the phosphite dehydrogenase enzyme belongs to the enzyme class EC: 1.20.1.1. The purification and characterization of a phosphite dehydrogenase was described, for example, in Costas et al., (2001) Purification and characterization of a novel phosphorus-oxidizing enzyme from Pseudomonas stutzeri WM88, Jour. Biol. Chem., 276:17429-17436.

[0144] In an embodiment, the phosphite dehydrogenase gene is obtained from a cyanobacterial cell. In another embodiment, the phosphite dehydrogenase can be obtained from a member of the genus Ralstonia, such as, for example, Ralstonia sp. strain 4506.

[0145] In another embodiment, the phosphite dehydrogenase gene can be obtained from a member of the cyanobacterial genus Cyanothece, such as Cyanothece sp. ATCC 51142. The gene can be codon optimized for optimal expression in the cyanobacterial strain of interest.

[0146] Other exemplary prokaryotic PtxD homologs include, for example, WP_004629224.1 from Ralstonia pickettii; WP_046983515.1 from Delftia lacustris; WP_029043082.1 from Cupriavidus sp. WS; EFP65990.1 from Ralstonia sp. 5_7_47FAA;WP_004757466.1 from Acinetobacter; WP_044432324.1 from Acinetobacter; WP_011610233.1 from Trichodesmium erythraeum; and WP_008277007.1 from Cyanothece sp. CCY0110.

[0147] The phosphite dehydrogenase gene or protein sequence can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to the phosphite dehydrogenase sequence of Ralstonia sp. strain 4506 or Cyanothece sp. ATCC 51142. Exemplary phosphite dehydrogenase sequences are listed below in Table 1. In an embodiment, the phosphite dehydrogenase gene can be obtained from other genera of cyanobacteria, or from other types of microorganisms such as bacteria, fungi, yeast, or eukaryotic algae. FIG. 4 is a phylogenetic tree of several phosphite dehydrogenase sequences.

[0148] The expression of the phosphite dehydrogenase gene can be controlled by its own separate promoter, or the phosphite dehydrogenase gene can be part of an operon. The gene can be present on an extrachromosomal plasmid. In an embodiment, the phosphite dehydrogenase gene is present on the same extrachromosomal plasmid that carries an ethanol production cassette. In an embodiment, the phosphite dehydrogenase gene is regulatable by a copper-inducible promoter. In an embodiment, the phosphite dehydrogenase gene is regulatable by a phosphorus-regulatable promoter such as the pstS phosphorus-starvation-inducible promoter. In another embodiment, the phosphite dehydrogenase gene is controlled by a constitutive promoter.

TABLE-US-00001 TABLE 1 Phosphite Dehydrogenase Sequences Codon- Source Nucleic acid optimized Protein Name Organism sequence sequence sequence Phosphite Ralstonia sp. SEQ ID SEQ ID Dehydrogenase strain 4506 NO: 11 NO: 12 (PtxD) Phosphite Ralstonia sp. SEQ ID SEQ ID Dehydrogenase strain 4506 NO: 13 NO: 14 (PtxD) - codon optimized with His Tag Phosphite Cyanothece sp. SEQ ID SEQ ID Dehydrogenase ATCC 51142 NO: 15 NO: 16 (PtxD)

[0149] As shown herein, modifying a cyanobacterial production strain so that it is capable of utilizing phosphite (rather than just phosphate) allows for an improved competitive advantage. Many contaminating organisms (both prokaryotic and eukaryotic) are incapable of utilizing phosphite, so if that is the only phosphorus source in the medium, the cyanobacterial cells carrying the gene can grow at a normal rate, while contaminants are unable to proliferate.

[0150] This system is particularly useful when the cyanobacterial production product is ethanol, as it helps keep heterotrophic contaminants from consuming the ethanol product, because the contaminants will grow very slowly or not at all in a phosphite medium. Unfortunately, even if phosphate is not added to the medium, it may leak out of the cyanobacterial cells themselves (through cell death or by other means) and may be present in the medium at a low level.

Recombinant Expression of a Phosphite Transporter System

[0151] In addition to the phosphite dehydrogenase enzyme, an additional protein complex is often needed to allow the transport of the phosphite molecule into the cyanobacterial cell. The cyanobacterium Cyanothece ATCC 51142, for example, contains a phosphite transporter system that is encoded by three or more genes, including ptxA, ptxB, and ptxC. This operon also includes ptxD. The cyanobacterial species Ralstonia sp. strain 4506 was also found to contain an operon containing three phosphite transporter genes (ptxA,B,C).

[0152] The operon (or separate genes) encoding the phosphite transporter complex can be obtained from any other suitable source organism. The phosphite dehydrogenase gene and at least one of the phosphite transporter complex genes can be derived from the same organism or from different source organisms. In an embodiment, these genes are obtained from another cyanobacterial species.

TABLE-US-00002 TABLE 2 Multi-Gene Phosphite Transporter (ABC transporter from Cyanothece sp. ATCC 51142) Codon- Source Nucleic acid optimized Protein Name Organism sequence sequence sequence phosphite Cyanothece sp. SEQ ID SEQ ID SEQ ID transport system ATCC 51142 NO: 17 NO: 18 NO: 19 ATP binding protein (PhnC or PtxA) phosphite Cyanothece sp. SEQ ID SEQ ID SEQ ID transport system ATCC 51142 NO: 20 NO: 21 NO: 22 substrate binding protein (PhnD or PtxB) phosphite Cyanothece sp. SEQ ID SEQ ID SEQ ID transport system ATCC 51142 NO: 23 NO: 24 NO: 25 permease protein (PhnE or PtxC)

[0153] One system that is present in several microbial species is the three gene ptxA,B,C, transporter system. In an embodiment, the operon is obtained from Cyanothece. The genes can be codon-optimized for optimal expression in the cyanobacterial strain of interest. In yet another embodiment, the genes encoding the three transporter proteins PtxA, PtxB, and PtxC can be obtained from different source organisms, or the genes can be modified as needed.

[0154] In an embodiment, the ptxA protein is SEQ ID NO: 19, as shown above, or can have at least 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 19. In yet another embodiment, the ptxA protein can be, for example, WP_008277010.1 from Cyanothece sp. CCY0110; WP_011610230.1 from Trichodesmium erythraeum; or WP_012409717.1 from Nostoc punctiforme.

[0155] In an embodiment, the PtxB protein is SEQ ID NO: 22, or can have, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 22. PtxB homologs can include, for example, WP_047156767.1 from Trichodesmium erythraeum; and WP_010994146.1 from Nostoc sp. PCC 7120.

[0156] The PtxC sequence can be, for example, SEQ ID NO: 25, or can have, for example, at least 80%, 85%, 90%, 95%, 97%, or 99% identity to SEQ ID NO: 25. Other exemplary PtxC homologs include, for example, WP_009544750.1 from Cyanothece sp. ATCC 51472; WP_008277008.1 from Cyanothece sp. CCY0110; WP_011610232.1 from Trichodesmium erythraeum; and WP_014707853.1 from Methylophaga nitratireducenticrescens.

[0157] In an embodiment, the PtxA, PtxB, or PtxC transporter system genes are chosen from a cyanobacterial species. This is because it may be difficult for a host cell to import phosphite if it is genetically modified to contain a transport system from an unrelated organism. Entry of phosphite into the cyanobacterial host cell may be quite different than it would be in, for example, a eukaryotic cell, or even in a non-photosynthetic bacterial cell. Such an unrelated transport protein could, for example, have difficulty localizing to the correct location for proper function. Thus, in an embodiment, it is an advantage to use cyanobacterial transporter genes to allow the phosphite to enter the cell.

[0158] In another embodiment, the phosphite transporter system that is utilized is a system encoded by a single gene. For example, in an embodiment, the phosphite transporter gene is obtained from the organism Desulfotignum phosphitoxidans. This transporter system is encoded by only one gene. The gene can be codon-optimized for improved expression in the cyanobacterial host cell, if desired.

TABLE-US-00003 TABLE 3 Single Gene Phosphite Transporter Codon- Source Nucleic acid optimized Protein Name Organism sequence sequence sequence Phosphite Desulfotignum SEQ ID SEQ ID SEQ ID Transporter phosphitoxidans NO: 26 NO: 27 NO: 28 (PtdC)

[0159] The phosphite transporter proteins can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical to the phosphite transporter proteins of Cyanothece sp. ATCC 51142 or Desulfotignum phosphitoxidans. In an embodiment, the genes encoding the phosphite transporter can be obtained from other genera of cyanobacteria, or from other types of microorganisms such as bacteria, fungi, yeast, or eukaryotic algae. In another embodiment, the phosphite transporter protein can be, for example, at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, or 99% identical WP_006968136.1 from Desulfotignum phosphitoxidans; or ABU54328.1 from Desulfotignum phosphitoxidans DSM 13687.

[0160] The phosphite transporter genes can be on the same operon as the phosphite dehydrogenase, or the genes can be on a different operon. The expression of at least one of the genes can be controlled by a constitutive promoter. The expression of at least one of the genes can be controlled by a regulatable promoter, such as an inducible promoter.

The Phosphite-Utilizing Cyanobacterial Strains Can Out-Compete Contaminants

[0161] In many situations, such as outdoor large-scale cyanobacterial production facilities, cyanobacterial culture systems are likely to be non-axenic. If so, the new phosphite-utilizing cyanobacterial strains can out-compete non-phosphite utilizing contaminants, including many bacteria and fungi, for phosphorus when phosphite is supplied as the sole phosphorus source.

[0162] Many bacteria and fungi utilize phosphate, but not phosphite. When these species are contaminants in a cyanobacterial culture with phosphite-utilizing strains such as those provided herein, such contaminants typically grow poorly, if at all, when phosphite is the main or sole phosphorus source in the medium. Other bacterial contaminant strains can utilize both phosphite and phosphate.

[0163] In some cases, although the initial inoculum is typically axenic, it may become contaminated during growth in outdoor, large-scale systems. By the use of phosphite-utilizing cyanobacteria with a medium comprising phosphite rather than phosphate, the contamination (if any) will be delayed, and any contaminant organisms will be likely to grow slowly enough so as not to be a hindrance to the cyanobacterial growth and accumulation of product.

Consumption of Product Such as Ethanol by Contaminating Microorganisms

[0164] Another advantage of the invention is related to the fact that many contaminants actually consume the ethanol that is produced by the modified ethanologenic cyanobacteria. Left unchecked in a phosphate-containing system, some of these contaminants can grow to the point where most or even all of the ethanol produced in the culture is consumed by the contaminants. However, when these contaminants are starved for phosphorus, they typically grow poorly or not at all. Ethanol or other products that accumulate in the culture medium are thus not consumed, or are consumed at a much lower rate. The cyanobacterial cultures can be run for much longer times, and can accumulate much more ethanol, by using this method.

Cultures of the Phosphite-Utilizing Cyanobacterial Strains Can Accumulate More Product

[0165] Cultures of the new phosphite-utilizing cyanobacterial strains are less likely to become contaminated, and if they do become contaminated, the contaminant growth is typically slower than would occur if the cultures are grown on phosphate as the phosphorus source. Because of this, the cyanobacterial cultures can accumulate more product. When ethanol is the product made by the cyanobacteria, for example, as shown in FIG. 19B and Example 17, more product can be accumulated, and if contamination occurs, it is less pronounced than with a phosphate system. Thus, cultures can be kept producing for a longer amount of time before the system is re-started. The cyanobacterial cultures can be grown for, for example, 1, 2, 3, 4, 5, 6, or more months, to produce the product of interest.

Plasmids Containing the Phosphite-Utilizing Genes Have Increased Genetic Stability

[0166] When the phosphite-utilizing genes (also termed phosphite genes herein) are present on a plasmid in the cyanobacterial host cell, that plasmid can have an increased stability when the cultures are grown on phosphite as the phosphorus source. Thus, other genes of interest (such as the ethanologenic cassette) can be added to the same plasmid and will be more likely to remain on the plasmid and in the host cell, because cells that have lost the plasmid harboring the phosphite gene(s) would not be able to survive on phosphite as the only phosphorus source. Similarly, cells that have lost some (but not all) of the copies of plasmids containing the phosphite utilizing genes would not be able to compete well in a phosphite-only medium. Thus, the presence of the phosphite genes creates a strong selection pressure, increasing the likelihood of keeping the phosphite genes, neighboring genes (such as genetically modified production genes), and the entire plasmid in the cell. This provides a simple system to ensure transgene stability in a host cell.

Co-localizing Phosphite-utilizing Genes with Production Genes to Increase Genetic Stability of Production Genes

[0167] In an embodiment, the phosphite dehydrogenase gene, or other genes required for phosphite utilization in cyanobacteria, can be located on the same operon as at least one production gene. This can further increase the stability of the production gene when the cultures are grown in phosphite as the phosphorus source. This is because an inactivation, deletion, insertion, or certain other mutations of the production gene would be more likely to also negatively affect the phosphite utilization gene if it is located near the production gene, and particularly if it is downstream of the production gene, and controlled by the same inducible promoter. If the upstream production gene is inactivated, it is likely that the downstream gene in the same operon would also exhibit reduced expression.

[0168] In an embodiment, a single operon containing at least a promoter, at least one production gene, and at least one phosphite utilization gene are present on a plasmid, or are present in the chromosomal DNA. In an embodiment, the construct is fully segregated.

[0169] In an embodiment, the product production gene is a pdc gene, and the product is ethanol. In an embodiment, a regulatable promoter, such as an inducible promoter, controls both the pdc gene and the phosphite dehydrogenase gene. In this way, phosphate can be used as the phosphorus source during scale-up, after which the inducing agent is added to initiate phosphite utilization, along with the production of the product. A suitable example of this system is described in Example 20.

The Method can be Improved Further by a Knock-out of the Phosphate Metabolism Regulatory Gene PhoU

[0170] As mentioned herein, most contaminating bacterial species utilize phosphate, but are relatively poor at utilizing phosphite. However, even when the only source of phosphorus that is fed to the cyanobacterial cell culture is phosphite, typically some amount of phosphate can still be found in the medium, allowing the contaminants to survive and grow. The source of this residual phosphate is unknown, but may be from leakage of the cyanobacterial cells, cyanobacterial cell death, trace contamination in medium components, or even the slight non-biological conversion of phosphite to phosphate that can occur in aqueous medium over time. Even a small amount of phosphate in the medium can cause contaminant growth, so a method has been devised to allow the cyanobacterial cells to take up any residual amounts of phosphate rapidly.

[0171] In an embodiment, the competitive advantage of a cyanobacterial cell genetically modified to utilize phosphite can be further improved by modifying the cell so that it also allows for faster uptake of any residual phosphate, particularly if it is present at a low level in the medium. This was achieved by the use of a knockout of the phosphate metabolism regulator PhoU. With the knockout of this gene, cyanobacterial cells can more quickly consume residual amounts of phosphate that may be present in the medium. This prevents phosphate-utilizing contaminating microorganisms from obtaining the phosphate needed for their own growth. The PhoU knockout, in combination with the phosphite utilization genes, allows the cyanobacterial host cells to more successfully out-compete contaminants for phosphorus. Even when contamination does occur, growth of the contaminants is delayed, and the cultures can accumulate the product of interest (such as ethanol) to higher levels.

[0172] To accomplish this, a knock-out of the phosphate metabolism regulatory gene phoU can be performed. This results in much faster uptake of phosphate from the medium into the cyanobacterial cell, independent of the levels of phosphate or phosphite in the medium or already in the cell. The nucleic acid sequence of the phoU gene endogenous to Cyanobacterium sp. PTA-13311, for example, is shown in SEQ ID NO: 29. The amino acid sequence of the PhoU protein endogenous to Cyanobacterium sp. PTA-13311 is shown in SEQ ID NO: 30.

[0173] In general, this knock-out allows for phosphate released from the cells to the medium to be taken up faster by the cyanobacterial production cultures than by many of the contaminating organisms that may be present. In this way, the genetically modified cyanobacteria can both 1) utilize an uncommonly used source of phosphorus and 2) quickly take up the commonly used phosphorus source phosphate, if it becomes present in the medium. Accordingly, it is likely that this combination is particularly effective in providing a competitive advantage to the cyanobacterial production cells.

Exemplary Phosphite Utilization Gene Cassettes

[0174] Several configurations of phosphite dehydrogenase genes in combination with phosphite uptake genes have been prepared and tested. The table present in FIG. 5 lists several constructs that have been prepared, as well as the genotype, host strain, promoter type, Ptx or Pt transporter type, and the sequence identification number.

[0175] New cyanobacterial strains having different sources of the genes, as well as combinations thereof, different promoters for their induction, as well as various gene cassettes for ethanol production, were prepared and examined. The strains have been tested both without and with the production of a product of interest (ethanol in these cases). Some of the strains have also been tested in the presence of bacterial contaminants, to determine whether the modified cyanobacteria can better out-compete common heterotrophic bacterial contaminants.

Preparation of Recombinant Vectors for Genetic Modification of Cyanobacteria

[0176] Cyanobacteria can be modified by the addition of phosphite dehydrogenase genes and phosphite transport genes, and can also be modified to produce ethanol or other products of interest. The DNA comprising the genes described herein can be amplified by polymerase chain reaction (PCR) using specific primers. The amplified PCR fragments were digested with the appropriate restriction enzymes and cloned into either a self-replicating plasmid or a plasmid designed for genome integration. An antibiotic resistance cassette for selection of positive clones can be present on the appropriate plasmid.

[0177] In an embodiment, the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. PCR can be used to amplify the genes from genomic DNA, mRNA, cDNA, genomic libraries, or from cDNA libraries. PCR and other in vitro amplification methods can also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA or DNA in samples, and for nucleic acid sequencing.

[0178] To use isolated sequences in the above techniques, recombinant DNA vectors suitable for transformation of cyanobacteria can be prepared. Techniques for transformation are well known and described in the technical and scientific literature. For example, a DNA region containing one or more of the genes described herein can be combined with transcriptional and other regulatory sequences which will direct the transcription of the gene or genes in the transformed cyanobacteria.

[0179] Transformation vectors for genetic modification of cyanobacterial cells can be derived from endogenous plasmids, or can be from heterologous sources. The cyanobacterial host strain Cyanobacterium sp. PTA-13311, for example, contains endogenous plasmids. In combination with other genotypic and phenotypic attributes, these endogenous plasmids differentiate Cyanobacterium sp. PTA-13311 from other Cyanobacterium strains.

[0180] A transformation vector derived from endogenous plasmid p6.8 from Cyanobacterium sp. PTA-13311 was developed. In an embodiment, this transformation vector can be used to transform the Cyanobacterium sp. PTA-13311 strain from which it was derived.

[0181] The endogenous p6.8 plasmid was isolated by an in vitro transposition reaction with an EZ-Tn5 R6K Ori/Kan-2 transposition kit from Epicentre (Madison Wis., USA) by following the manufacturer's protocol. The plasmid 6.8 has been modified for use as a transformation vector containing genes of interest for the production of products of interest.

[0182] In an embodiment, the phosphite utilization genes are located on the same plasmid as the genes of interest for the production of products of interest. In another embodiment, at least one of the inserted genes is located on a different plasmid or on the cyanobacterial chromosome. In an embodiment, the genes of interest are inserted into the cyanobacterial chromosome. When the cell is polyploid, the gene insertions can be present in all of the copies of the chromosome, or in some of the copies of the chromosome. In another embodiment, the inserted genes are present on an extrachromosomal plasmid. The extrachromosomal plasmid can be derived from an outside source, such as, for example, RSF10-based plasmid vectors, or it can be derived from an endogenous plasmid from the cyanobacterial cell or from another species of cyanobacteria.

[0183] In an embodiment, the inserted genes are present on an extrachromosomal plasmid, wherein the plasmid has multiple copies per cell. The plasmid can be present, for example, at about 1, 3, 5, 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or more copies per host cyanobacterial cell. In an embodiment, the plasmids are fully segregated. In another embodiment, the inserted genes are present on one cassette driven by one promoter. In another embodiment, the inserted genes are present on separate plasmids, or on different cassettes. In yet another embodiment, a transformation vector from the above-described p6.8 endogenous plasmid can be used to transform cyanobacteria from a broad range of genera.

Codon Improvement of Recombinant Genes

[0184] The inserted genes can be modified for optimal expression by modifying the nucleic acid sequence to accommodate the cyanobacterial cell's protein translation system. This method utilizes codon improvement (sometimes referred to as codon optimization or codon adaptation), which can be performed to increase the expression level of foreign genes such as antibiotic resistance genes, genes for production of ethanol or other products of interest, and any other inserted genes to be expressed in the host cell.

[0185] The underlying rationale is that the codon usage frequency of highly expressed genes is generally correlated to the host cognate tRNA abundance. (Bulmer, Nature 325:728-730; 1987). Modifying the nucleic acid sequences in this manner (codon improvement) of the recombinant gene can be performed for improved expression in the cyanobacterial host cell. Codon improvement can also be performed by adapting the codon usage of the recombinant gene to the codon usage in the host cell. In an embodiment, only 2% to 6% or 1% to 10% of the codons of variants of recombinant genes are codon improved. In another embodiment, highly codon improved variants of recombinant genes, at least 25%, to at least 50%, 65% or even at least 70% of the codons have been changed. In another embodiment, recombinant genes are used which are not codon improved.

[0186] Codon improvement of heterologously derived genes (such as genes encoding antibiotic resistance genes, the phosphite uptake and utilization genes, and the recombinant genes for the production of products of interest, such as genes in an ethanologenic cassette) was guided by the Cyanobacterium sp. PTA-13311 codon usage table derived from ribosomal proteins and highly expressed genes (such as photosynthesis genes). To improve heterologous gene expression, original gene sequences of interest (such as Z. mobilis pdc and Synechocystis sp. PCC 6803 adh) were assessed with the online software OPTIMIZER (Puigb P, Guzmn E, Romeu A, & Garcia-Vallv S (2007), (OPTIMIZER: a web server for optimizing the codon usage of DNA sequences Nucleic Acids Research 35(suppl 2):W126-W131), based on the codon-usage table derived from the Cyanobacterium sp. PTA-13311 genome.

[0187] The codon adaptation index is a measure of directional synonymous codon usage bias, and its potential applications, (see Nucleic Acids Research 15(3):1281-1295). The effective number of codons (see, Wright F (1990) Gene 87(1):23-29) are designed to match those of highly expressed genes (such as ribosomal proteins) in the Cyanobacterium sp. PTA-13311 genome. The resulting polynucleotides using improved codons were further modified and optimized to avoid the presence of any known or predicted putative Cyanobacterium sp. PTA-13311 endonuclease restriction sites (Aval, BsaHI, Kasl, XhoI etc.); internal Shine-Dalgarno sequence and RNA destabilizing sequences; an internal terminator sequence; and a repeat sequence of greater than about 10 bp (see, Welch et al., PLOS One 4, e7002; 2009; and Welch et al., Journal of the Royal Society; Interface 6 (Suppl 4), S467-S476; 2009).

[0188] In an embodiment, the nucleic acid sequences of the recombinant genes are modified so that they will have improved expression in cyanobacteria. For example, the selectable marker gene that confers gentamycin or kanamycin resistance was codon optimized for higher expression in cyanobacteria. In an embodiment, as a result of codon improvement, the GC % of the antibiotic resistance genes decreased from 40-53% to 33-40%, which is similar to that of Cyanobacterium sp. PTA-13311 coding genes (about 36% on average). The codon adaptation index of the codon improved antibiotic resistance genes is significantly improved from less than 0.4 to greater than 0.8, which is similar to that of Cyanobacterium sp. PTA-13311 endogenous genes.

[0189] Table 4, below, depicts the codon usage statistics within the cyanobacterial strain Cyanobacterium sp. PTA-13311.

TABLE-US-00004 TABLE 4 Codon Usage Table for Cyanobacterium sp. PTA-13311 Amino Frequency Acid Codon Fraction Number (/1000) Ala GCA 0.293 20724 18.356 Ala GCC 0.214 15144 13.414 Ala GCG 0.14 9870 8.742 Ala GCT 0.353 24915 22.068 Arg AGA 0.347 16040 14.207 Arg AGG 0.09 4158 3.683 Arg CGA 0.106 4886 4.328 Arg CGC 0.131 6043 5.353 Arg CGG 0.039 1813 1.606 Arg CGT 0.288 13329 11.806 Asn AAC 0.22 14609 12.94 Asn AAT 0.78 51712 45.804 Asp GAC 0.193 11063 9.799 Asp GAT 0.807 46399 41.098 Cys TGC 0.218 2501 2.215 Cys TGT 0.782 8976 7.95 Gln CAA 0.806 43747 38.749 Gln CAG 0.194 10554 9.348 Glu GAA 0.787 60690 53.756 Glu GAG 0.213 16451 14.571 Gly GGA 0.324 22709 20.114 Gly GGC 0.125 8720 7.724 Gly GGG 0.151 10542 9.338 Gly GGT 0.401 28065 24.859 His CAC 0.251 4859 4.304 His CAT 0.749 14516 12.858 Ile ATA 0.195 18334 16.239 Ile ATC 0.19 17872 15.83 Ile ATT 0.616 57964 51.342 Leu CTA 0.088 10776 9.545 Leu CTC 0.058 7129 6.314 Leu CTG 0.033 4040 3.578 Leu CTT 0.116 14162 12.544 Leu TTA 0.571 69559 61.612 Leu TTG 0.133 16235 14.38 Lys AAA 0.836 59396 52.61 Lys AAG 0.164 11694 10.358 Met ATG 1 20093 17.797 Phe TTC 0.172 8420 7.458 Phe TTT 0.828 40450 35.829 Pro CCA 0.169 7746 6.861 Pro CCC 0.275 12613 11.172 Pro CCG 0.066 3012 2.668 Pro CCT 0.491 22560 19.982 Ser AGC 0.088 6435 5.7 Ser AGT 0.306 22393 19.835 Ser TCA 0.14 10217 9.05 Ser TCC 0.102 7465 6.612 Ser TCG 0.044 3196 2.831 Ser TCT 0.321 23473 20.791 Thr ACA 0.26 15649 13.861 Thr ACC 0.236 14251 12.623 Thr ACG 0.083 5024 4.45 Thr ACT 0.42 25340 22.445 Trp TGG 1 14964 13.254 Tyr TAC 0.187 7364 6.523 Tyr TAT 0.813 31912 28.266 Val GTA 0.28 18541 16.423 Val GTC 0.117 7778 6.889 Val GTG 0.184 12184 10.792 Val GTT 0.419 27713 24.547 End TAA 0.63 2495 2.23 End TAG 0.22 848 0.76 End TGA 0.15 591 0.53

Choice of Promoters

[0190] Any desired promoter can be used to regulate the expression of the inserted genes. Exemplary promoter types include but are not limited to, for example, constitutive promoters, regulatable promoters such as inducible promoters (e.g., by nutrient starvation, heat shock, mechanical stress, environmental stress, metal concentration, light exposure, etc.), endogenous promoters, heterologous promoters, and the like. Additional promoters that can be used are described, for example, in U.S. Pat. Nos. 6,699,696, 9,650,642, 8,163,516, 8,404,466, 9,315,820, 9,765,364, 9,551,014, 9,476,067, 8,848,369, 9,315,832, 9,157,101, 9,127,297, 9,493,794, 9,493,795, and International Patent Application Nos. PCT/EP2012/067534, PCT/US2013/065568, PCT/US2013/065574, PCT/US2015/000210, all of which are incorporated herein by reference in their entireties.

[0191] The inserted genes can be controlled by one promoter, or they can be controlled by different individual promoters. The promoter sequences can be derived, for example, from the host cell, from another organism, or can be synthetically derived.

[0192] The recombinant gene(s) can be under the transcriptional control of a constitutive promoter. In this way, a sustained level of transcription and, therefore, enzymatic activity of the corresponding protein can be maintained during the whole period of cultivation. For example, the constitutive promoter can be endogenous to the cyanobacterial cell. This has the advantage that no recombinant transcription factor has to be present in the host cell. The endogenous promoter is usually well-recognized by the metabolically enhanced cyanobacterial cell without the need to introduce further genetic modifications.

[0193] Suitable constitutive promoters include, without limitation, the PrpsL promoter (Gene ID: ABICyano1_orf1758), PpsaA promoter (ABICyano1_orf3243), PpsbB (ABICyano1_orf2107), PcpcB promoter (ABICyano1_orf2472), PatpG (ABICyano1_orf1814), PrbcL promoter (ABICyano1_orf1369), PpetE promoter (ABICyano1_orf2417), and variations thereof. Further suitable endogenous constitutive promoters from genes with unknown function exhibiting appropriate transcriptional activity include, without limitation, the promoters of Gene IDs ABICyano_orf1924, ABICyano_orf1997, ABICyano_orf3446, ABICyano_orf0865, ABICyano_orf1919, ABICyano_orf3278, ABICyano_orf1181, ABICyano_orf1627, ABICyano_orf0265 and ABICyano_orf2536, ABICyano_orf0615, and variants thereof.

[0194] In an embodiment, the promoters can be derived from the cyanobacterial strain Cyanobacterium sp. PTA-13311, or they can be derived from another cyanobacterium or from another organism. In an embodiment, the promoters can be about 60%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99%, or 100% identical to the promoter sequences described herein.

[0195] The promoters can be regulatable promoters, such as inducible promoters. For example, certain promoters are up-regulated by the presence of a compound, while other promoters can be up-regulated by the absence of a compound (also termed repressible).

[0196] Various promoters that can be used include promoters that are regulatable by the presence (or in other promoters, by the absence) of inductors such as different metal ions, different external stimuli such as heat, cold or light. In some embodiments, the regulatable or inducible promoters are induced under conditions such as nutrient starvation, stationary growth phase, heat shock, cold shock, oxidative stress, salt stress, light, darkness, metal ions, organic chemical compounds, and combinations thereof. For example, a particularly tight control of the expression of gene can be achieved if a gene is under the transcriptional control of a Zn-, Ni-, or Co-inducible promoter. Exemplary Zn-regulatable promoters and their variants are described, for example, in International Application No. PCT/EP2013/077496. Exemplary Zn, Ni, and Co-regulatable promoters are described, for example, in International Application No. PCT/2012/076790, both of which are incorporated by reference herein in their entireties.

[0197] In a further embodiment, the regulatable or inducible promoter is inducible by a change of a metal-ion concentration. Such a change of metal-ion concentration includes for instance the addition or depletion of certain metal ions. Suitable inducible promoters include, without limitation, the PziaA promoter, the PsmtA promoter, PaztA promoter, the PcorT promoter, the PnrsB promoter, the PpetJ promoter, the Porf0316 promoter, the Porf0221 promoter, the Porf0223 promoter, the Porf3126 promoter, the PmntC promoter, and variations thereof.

[0198] Preferably, the regulatable or inducible promoter is endogenous to the cyanobacterial cell. An endogenous inducible promoter is usually well-recognized by the metabolically enhanced cyanobacterial cell without the need to introduce further genetic modifications.

[0199] In further embodiments, the choice of regulatable or inducible promoters can include, but are not limited to, PntcA, PnblA, PisiA, PpetJ, PggpS, PpsbA2, PsigB, PlrtA, PhtpG, PnirA, PnarB, PnrtA, PhspA, PclpB1, PhliB, PcrhC, PziaA, PsmtA, PcorT, PnrsB, PnrsB916, PaztA, PbmtA, Pbxal, PzntA, PczrB, PnmtA, PpstS, and the like.

[0200] The regulatable or inducible promoter can, for instance, also be a nitrate inducible promoter. Suitable nitrate inducible promoters include, without limitation, the PnirA promoter, the PnrtA promoter, the PnarB promoter, and variations thereof.

[0201] In certain other preferred embodiments, truncated or partially truncated versions of these promoters including only a small portion of the native promoters upstream of the transcription start point, such as the region ranging from 35 to the transcription start can often be used. Furthermore, introducing nucleotide changes into the promoter sequence, e.g. into the TATA box, the operator sequence, 5-untranslated region and/or the ribosomal binding site (RBS) can be used to tailor or optimize the promoter strength and/or its induction conditions, e.g. the concentration of inductor required for induction. In some preferred variants, the different inducible promoters are inducible by different metal ions.

[0202] The promoters hspA, clpB1, and hliB can be induced by heat shock (raising the growth temperature of the host cell culture from 30 C. to 40 C.), cold shock (such as, for example, reducing the growth temperature of the cell culture from 30 C. to 20 C.), oxidative stress (for example by adding oxidants such as hydrogen peroxide to the culture), or osmotic stress (for example by increasing the salinity). The promoter sigB can be induced by stationary growth, heat shock, and osmotic stress. The promoters ntcA and nblA can be induced by decreasing the concentration of nitrogen in the growth medium and the promoters psaA and psbA2 can be induced by low light or high light conditions. The promoter htpG can be induced by osmotic stress and heat shock. The promoter crhC can be induced by cold shock. An increase in copper concentration can be used in order to induce the promoter petE, whereas the promoter petJ is induced by decreasing the copper concentration. Additional details of these promoters can be found, for example, in PCT/EP2009/060526, which is incorporated by reference herein in its entirety.

[0203] In an embodiment, the promoters of any of the above embodiments may be selected from the endogenous inducible promoters identified in Cyanobacterium sp. with the ATCC accession number PTA-13311 listed in Table 5, below, and variants thereof.

TABLE-US-00005 TABLE5 Cyanobacteriumsp.ABICyano1endogenouspromotersequences SEQ Promoter Sequence IDNO: PnirA AATTAATAACTTCTTCCTGTACGGGCGAATGGCCATTTGCTCCTAAC 31 TAACTCCGTACTGCTTTGCGGAACGAGCGTAGCGAACTCTCCGAATT ACTAAGCCTTCATCCCTGATAGATGCAAAAAACGAATTAAAATTATG TGTAAAAAGAAAATGTGTCTTTATTTAGTAGTCAAAGTTACAAAATA TTAAGAATCAAATTAATAATGTATTGGGCAGTTAAGTATATAAGTCT TTAAATATTTATTTGTATTCAATATATTAACCGAGGACAAATT Porf3126 CCAATATCTTGTCATACATACTTATTTGCCTCACTATTAGCCCTATAT 32 (PsmtA) GTCTCTATTGTATTTTTCTTTTTCTCCTATTCCTAGATCTTGTAATGAA TCATTACTCTCTGAAATATAGCTACTAATTTTATGGTTGTTTGTAAAA TATATTAACAAATGAACAATAAATCATATTTTGTGTTAATCTAATTA TTAGACAACTACTGAATTTATATTCAGATATTCACAGATAGGAGAAT TTTGATT PnrtA TATTATTTTTCGTTTATATGCAGATTTAGAATAAACAAAATTCATTTA 33 CTGCAAATTTTCAAAAAAATGTGACTAAACATACAAAATAAAGAAA AAATAAAGTTTTAAATTTATGTACATCAAACTTAAGAAATGTTTAAA TTACTTAGAAATTTATAGTTC Porf3461 TTTATATATAAACTCGAATAAAATTATCAATATAAAGTCAAACTATA 34 (petJ) TCTATCCTATTTTAACTGCTATTGGTAAGTCCCTTAATTAGTGTTGGG GTGAATAGATTTTAAAAGGGCAAACCCCCCTTTATCCTCCCTCGAGA GGGGGGAGGGCAAAAGGCAAGGGGCAAGGGAAAAATTAAGAATTA AGAATTAAAAACTCCGAACACCTGTAGGGGCGAATAGCCATTCGCT TCCCCTCATCCCCCCATCTCCCCAACACCCTAAGCCCCTACTCGTTAC TCATTTATTTACATCATTTATTTACATCATTAAGAAAAGTAACAAATT TTGACAAGTAGTCTTTTGACAGGAAAAAGCAAATTCTCGAAGATGA AAACAATAGAAAAAAATTCAATCTTACAGTAACGATGAAAAAACTT TTAGGCTTAATT PnarB TGTCTCAAAAAGACAGGTTTTTTTTATGAAAGTAATAAGAAATAAGT 35 AGAAGTGAGGAGTTGGAAAGATAGGATTAAGAATTAGGAGTTAACT ATTTTCATTCTTTATTCTTCCATTGCCCATTGAGAAATCATATCTAAA ATCAGCAACGCCAAATTTTAGATGCAAAATAACCATAAATAAAATG CAGAAAAAAGAATACTTTAGATCTTCCGTATCAGAAGATACATTTCT TAACAAAATCTGGTGACAAGATTAAACACACGAAATCCGAGGTTTT ATATATTGATTAGTCCTAG Porf1071 ATTCTGTGAATTGATTAGATTTGAGGTTTTTTAAGAGGTTGATTACCT 36 (PmntC) TGCCTCCAAAAAAATCATAACACACTAATGCTCTATATGAAAGGGCT TTAGACCCATAGGTTTTTGAGAAAAAAACTTGCTAACTCTCGGACAA TGTCAGCATAACTAAAGTCAATTCTTTTCGTACTTTATAATTGTCTAT AATTTAATATACAACTGTTCTGAAACTAGTTTTTCTCTACATTCCTTA GTTTTATCTGAGTAAGGTTGCTTGTAACTTAACTTCGGTTGGGCCTAA AAATATCCGATTAGGAGCAGGTGTCAGACTTTAATTAATTATTAATT ATTAATTGCTTATTGCCAACCCTCGGCGACACCACTTTTTCATCAGCC CCAGATAAAGATTGATGTTTTAGTTTTGTTTCTTTTTATCCCCTAATT CAACTAATACAAGTAAAACTAAGGTTGTTTATCAAAAATGATGGTTG ATGTTTGGGTAAATTTTAAGATATTATGAAAAGAAAATGAATAAAA AATGAAAAATCTTT Porf0221 GAATATCTCATCCTTAGCTTCTACTTATACCTTCAGCATAGTTAAAAA 37 TCATCCCTTTATTGATGGTAATAAAAGAACAGGTTTTATTAGTGGAG TAACCTTTTTAATGCTCAATGGTTCTCACTTTACTGCTTCTGAAGTGG AAGTAGTACATATCATCCAAACCTTAGCTAGTGGCAGAATTACCGAG GAAGAATTACAACAATGGTTCGTAAGGAAAAGTAAGCAGATGAATA ATTAAAGCATCATTTCATCCTCATTTCATATTCTCCTGTCACCATGGT ATGGAAGATTAGGTAAAAATGAGGAAAAAGTTTATT Porf0223 ATACATGGTTGGTTCACTGACTTTTACCCCAGTTTTCTCTTTGAACAA 38 TTGGCATAACTCTGAAAAAATCAGATCGGGCTTTTGTTGAATTATTT GTTCAATCAAAGCAAAACCGTGATTGTCTATTTTCTTTTTTTTCCCAC CACTCATAGATAAAAATTTATCCCGAACTCAGGTTATATTAAGTTCG GATGATCACTTAAGATAATTGATCAGATTGGTTAAGATAGAGAAAA ATTCTTTTTCATAGTGATTTCATAATTGATAGTTACAATAACGATTAT TATTTAGTAAAAAGATTTTCAAATC Porf0316 TGGTCAAGTTACTATATGTTTAGAAACAACAAAAAAAGAAGTCATT 39 ATAAAAATAATTGATACAGGAATTGGCATTAATAAAGAAGAACAAA AATTAATTTTTAATCGTTTTTATCGAATCAATAAAGCAAGAAATAGA GAGAAAGGCAGTTGCGGATTAGGTTTAGCTATTGCAAATGCGATCG CGCTTAATCATGGTGGTAGAATAATTTTAGAAAGTCAAGAAAATCA AGGCAGTATTTTTACCGTTTATTTACCGAAAATCATTTCATCCTAATT TCATATTCTTTTGACAGAATCAAAGGTAAAGATAAAAAGAGAGAAA CAGTC Porf0128 CCTCAACTACAAGTTCTTTTATATATTACTTTAACCTGAGTTTTGGAT 40 AAGCTGAAAGCATTATTTTCTCGTAGTCAGAAAACCTTATAGCTTCT TAGAAATAACGATAAAATTACCTTAATCCGAACTGACGTTAAATATA TTCACCCCTATCACCCCAAAACCCTAAGCCCCTACTTCCCCCTTTCCC TTCATCACCTCATCCCCCCATCCCCTAACACTTAACCTTATTCTTTAT TCTTAAACCGAACTGAGGTGAAGTTGCAGAATACCCATGGGGGGTT ACAGCATTGTAGAAAAATAAATATTCTTTCATTATTAAGGTTGTTTG GTAAAAATATGTGAAAACCCTAATAATT Porf1486 GGGGACAGACATATTTTTATCATAATGGTAAATTCATAATAATTTTA 41 GACTTTTTTTTGCAAAAATTAATCTCACTCTCTTCTTTCCCTATCTCCC ATTGTTTCTTATATCCCAATGCCCCAATACCCAAAGCTCAGAAAATA GGTATTAGCGAAGAGGTGTTGATCCCCTCCCCTAGCAAAATATACTC CTATATAGTAAAGTGAGAAAGTGAAGAAATAAGATCAAGTTCGCAA TTT Porf3293 TTGACGATTGTATTGACTTACGCCAAATGGCTTACCCTCATAGTGAA 42 TAGTTGATAATTAAGAATTAAAAATCCCGTTCACGACAGAAGGGAG TGTAAGAGCCTTCGGTGCGAACTCTCATCTTCCCTGAAACCTGACAC CTGAAACCTGACACCTGAAACCTGACACCTCATCTCCCTAATCCCCT AATTTTAATGAAAAAATACCCTGAGTGGGCATTGAAAAAAAAGAAA AGTTGTTCGACTATGAAATAAGAATTCTGCACTTCGTGAGAAAAAAG GAAATGAAAT Porf3621 CTATTTAACTAGGAAAAGGTAAAGTTAAAAGGACAAGGGTAAATAA 43 TTAAAAATTAAGAATTAAGAACTTCTAACTCTCATTACTCATTACTT ATTTCCTCCTCTCACCCCTTCTCCTGATCACCTCTTCTCCTCAATACTC GGAACTCATTTCCCCATGGTGTGACACTCAAATCAAAAGTCTGTTAT TGACTTTCAGATGAAATATTACTATGATAACAATATCCCCCCTATGG GTATATAAAAATATGAGCGATATTAGTTAAAAATCAAATTTGGATTT TTTTTCTGAAAATATTTTAAGATTAAGTAAAGATAAGTAAAGAAATT ATAAGCAATTTTGTTAAATCATACC Porf3635 CTCACACTGAAAATATTGCCACAAGAAATAAAGATCAAGCAATAAT 44 CCTGACTAAAAAGGAATAAAGTAATTATCCTTTTCCTGATATGTTAT CTGACTTGTTGTTTCTTAGTCATGTTCCTTCCATTTTTATTTTTGTTTT TATCATTTTTATTACAAAAATTTCTTAATAGGGCTAAAGCATTTAGTT AGTTTTTTAGCTCTCAACAAGTTGACTAATCAATATAATGCCCTAAG TTAATTTGCCCTTGGTTTGACGGAGGATATTGGAAAAAAGAAACTTC TCGTTGTATTTCACAGGGAAAAGGGGGAAATTTTATTAATAACTAAA CAATAGAAAATAATTATTTATTTATATTATTTTGTGAACAAATGTTCA AGAATTAAAGTGTAATAAGAAAATTTATTTTTTTATATTTATTTAAA ACTTAGATATAAGCCTAAAGGTCTGAAATTATTATTAGACAATCAAT TGATTCAGAGGTAATAGTTTTTTACTTAAAAATATTTTTTCAAAATTA TCCCCTATTTGGGTATTGAAAAATAAATAAATTCAAGTAATAATATA CAGAATAAAGGAAAATCTAATCTTAAAAATTTTGTGTGTGAGGAATT GAAA Porf3164 CAAATCACGAGAATTTATGTAGGGACTATTTTGGGTTGACGGTGGAG 45 AGTATGTCGCCCTTGAATTATGACCCGAAGATGAAGATGTCGGGGA GGTGGAAGGACGGTCTTTAAGAGGTTTAACATCAAAGTTGGTCATA ATCTCTGTCCCTGTTTGATAACTACTATTTAATTTTGAGTTGTTTTAG GTACATCAAAATACCCAAATCCTTACTCTCCCCTCAATATACAACAA AAAAAACTTTTTGATTCACTTTAGTCATAAAAATTAGAATTTATCTA CCGAAATATTACATAAATGTAATGTATATATTTTCTGATTTATTCCGT GTGAGCCATGATTCATAATTTATAATTCATAATTTCTAAATATGCCCC TACAATGGATATAGAATGTCATTTTAATTATAGGTATCATAATCGTG GTAGTTACTCCGGAAAAAACTATTGAATCAAATTCAGTCTCACCTGC TACAGATAGAGTAGCCGTTATTCTT Porf1072 CTACAGGGGCAAGATTTGGCGGAAATCTATATGTGGATTCTCTTTCA 46 AGTGAAGAAGGTGCAGTGCCGACTTATCTGGACTTATTAGAATACG ATATTCGCACTATTACTAATGGTTTGTTAGCAGGAGTGAACAATTAA AAATTTTTTCCTAATTGACGAATAAAAAATCAATGTCAACTAATAGT TAACAATACTCTCTGAAAACCAAAAATTGTCAACCAAAACATAACA TAATTTTTACCCAAAAACCTCATTTATAAACTTTAAGGATAAAATCA ATG Porf1074 GGGATTAGAGAGTTCAAAGTTAGGAATGAGGTGTCAGGTTTTAGGTT 47 TCAGGTTTAGGGGAGCAATGAGAAAGAGGTTTCAGGTTTCAGGTGT CAGGTTGCAGGTGTCACAGGTGATGAGGGGATGGGGGATGAGGGGG AAACAAGTAAGTAATAAGTGTTCGGAGTTTTTAATTCTTAATTCTTA ATTTTTCCTTTGCCTCTTGCCTTTTGCCTTGTCTTAATTACTAATTTCT AATTAAAATGATTGTGTTTTCTAGTTTAGTCTCATGGTTACTTGAACC CTTACAGCATAGTTTT Porf01075 TTACAAACGGCGGGAATTATTATGGTAGTAGCGATGTTAGTAACCCC 48 GGGTGCGATCGCATATTTACTTACAGATCGTTTTGATCAAATGTTAA TCTTATCAATAGTTAGTAGTGTTCTATCTTGTGTTTTAGGCACTTATT TAAGTTATCATTTTGATGTTTCTACGGGGGGAAGTATTGTCGTTTTAA TGACCATAATTTTTATTTTAGCGATGATTTTTGCTCCTAAATATGGCA TCATCAATCAAAATACCAAAATATATTCTGCTTAACTTGTTTACTGAT ACTTCAAATAATCATATAACCTATCTTCCGAGTTAAAAATAATGGAT ATTATCCAACTGAGGTCGAGAATAGAGTTTCTTTTTTGATAGAATTTT TTTACACCAGTTATTCATTACTATCATGGGATAAT Porf1542 TAATATAGTGATTATTATAAATGCAATGTGAATCAAACCTATATTTT 49 ACCGTACATTGACCATGGAACTTAATTTGAGGTGATTAGTAGAGGGT GCGATCGCCCTATTTGTCAAATAATAAAGATAACATTTGACATTGCT GATTGAAGACATAAAACACAGAAAAAATCAGGTAAAAATATAAAGC TAAAGTCTAAATATGGTTTACTTTTGCCTTCGACTTACAACAAAAAA TCATAGCTAGAATCACCAACGCCTAATATTTTATTTAGCTGAAATTTT GGGATGAACTTTTTGTAAAAATCGGGGGTCTAAAAATATAGCAACC ACGATATTAAATAACTGAGTGATTATTTTAATCTATTGGGGGCTTAT TAACTAAATACTTGCATTTTTATGGAGGGTTTTAATT Porf1823 AAAGATTATTTTCTACAGAAGCAACCCTTTCATCTTCCGAATTTTCAG 50 GAATTTCCTGCTTTTGTTTCTGAATATTAGCATAGGCGGCTTTTGCCC ACTCTAAAGAAGGTTGAGACTGAATTTCTGAGGTTTCAGAAGGAGC ATTAGATTGTTTATCTTCAACAACAGGAGGTTTTTGTTCAATATTTTC CTTATTCTCTTTTTTACGGCGAAACCAATTAAACATAATGATTGTGCA TAAATATTCGTTAATATATTGTAACCCTAGAAAGGAATCGGTTTCAG GTTTATCCCCAGAGAATGTGAACCTTTACAGAAAGTAAAAAGTCTAA AATCGTAGCAACAATAAATCACAGAAATTGAG Porf0222 GCGATTATCAACCACGAAAACATACAATTATTATCAAACCTGCTGAG 51 AAATTATCCACAGAAATAGATGTTTCTGCGAAGGGAAAATGGGCTTT TCATTGCCATTTAATGTATCACATGGATGTGGGAATGTTTCGGACTA TTAATGTTATTTCCTAAAAAATAATAGTATTAAAGCCTAAAATTTTT ATAAAAAAATTCATGTCTTTTATTAGGGTGAGCATTCTTCCTTTATGT CTCCTTATTTTACCTCTTTAGAGGTAACTACAAACTTAATCAAAAAA TTTAGATAATTAATTATATCA Porf3232 CATCTTTACTTTTGACTAACATTTCATAGGTATCATGACGAAAATTTT 52 TTAGTCTGTTATATTTGTTCATGTAGAGAGATTTTAATTTGTGATTAT TTTATTTTCTCTCTATTTTTCTTTTTTGTCTTGTCCTTCCTCATTTTTCT CTACATTTAGTCTAAACTACAGCTCTTTAATCTTCAGTTTCTCTTTCC TCCTCTTCCTCATCAAGGTAATCATCCCAATTAATATCTTCTTCTTGT TCTAATTTGGGTTGAGATTGTTGTTTATCAATCATATTTCATACTCCT AAAACTTTCTTACTTATTTATCAGTTACTTTTTACCCATTTATGCAAT AGTGTAGAAATTTTTTTCGATCGAGTTAATTAATTTTTATTTCAACCA TATCTAAATAATTCTTGATGGACATTCTAGTTAACTAGAAGGTTTAA GCTAAAAATAATTATTGATATTGCCTTCGGTATAACTAACTATATCC AGAGAAAAAG Porf3749 CTCAAGAGATAGTTAAAAAACAAATAGCTTTAGTCTATCAATTAATC 53 GAATTATTTTTACAAACAAATTTTCATAAACCCATAGAACTAGAGGA GGAAGTTATTTATGTTTAAAAATCTAAAAGAGTTTTATATTCCCCTA AAACCCCCTTAGTAAGAGTGACTTTTTTCATCATTTGCCTGTAAATTC TCCTCTTTTAATAAGAGAGCTAGGGTGTTTTAAAAGAGGATTTTATT GCTTTCCAATTCTAACTACTTCAAAAACTTATTTTATACTCAATAATT TATTAATCAAGAGGAAATTACC PrbcL TCGAGCGCTCGTTCCGCAAAGCGGTACGGAGTTAGTTAGGGGCTAAT 54 (Prbc) GGGCATTCTCCCGTACAGGAAAGAGTTAGAAGTTATTAATTATCAAC AATTCTCCTTTGCCTAGTGCATCGTTACCTTTTTAATTAAAACATAAG GAAAACTAATAATCGTAATAATTTAACCTCAAAGTGTAAAGAAATG TGAAATTCTGACTTTTATAACGTTAAAGAGGGAAAAATTAGCAGTTT AAAATACCTAGAGAATAGTCTGGGGTAAGCATAGAGAATTAGATTA GTTAAGTTAATCAAATTCAGAAAAAATAATAATCGTAAATAGTTAAT CTGGGTGTATAGAAAATGATCCCCTTCATGATAAGATTTAAACTCGA AAAGCAAAAGCCAAAAAACTAACTTCCATTAAAAGAAGTTGTTACA TATAACGCTATAAAGAAAATTTATATATTTGGAGGATACCAAC PrnpA AATAGTTGATAATTACTCGTTACTCATTACTCACTTAAACCTGCCACC 55 TGATACCTGCCACCTCTCCCCCCATCACCTCATCCCCTCAACATTCCG AACCCCTTGACACTTTGAACTAAAATTGTATTAAAGTGCAAATCTGG ACGGGGTTAACCAGTGTGACTTATAATAGTAAACGCTGTTTTTTATA ATAAATAAGCTAAATATTTAAAAACTATGAGTAAATATACACTAAAT GGTACTAGACGTAAGCAGAAAAGAACCTCCGGTTTCCGCGCCCGTA TGAGAACCAAAAATGGTAGAAAAGTAATTCAAGCTCGTCGTAATAA GGGTAGAAAAAGATTAGCAGTATAAAATTACTGTTAAATAAGGAAG CTAAGTTTAGCATTTTAAGTTTGATATTACTAATCATTAAATTTACTG TGAAATATAGGTGGGACTACCATCAAAGCATCGACTGAAACGGCGT TTAAATTTCCAATCTGTTTATCAACAGGGTATTCGCCGCTCTAGTCGT TATTTTATTGTCCGAGGGTTACGG PrpsL CTCCGCTTAAAAAATTTCATTTTTCGATCAAAAAAGACAAATTATTA 56 CTAATTAGCTCATGGCAATAAATAATCAGTAGTAATCTGTTTTCACA TTTTATTGTTAATTTTTATTATTGCTAATATCAACCTTTTCTACTTCTG CTTAATATTTTATTTATGCTCAATGGGAAAATCTGAAATAAGATTGA GAACAGTGTTACCAATAGAAGTATTTAAGGTTTAAAGCATACCTTAA AGATAACATTTTTTTTTGAAAAGAGTCAAATTATTTTTGAAAGGCTG ATATTTTTGATATTTACTAATATTTTATTTATTTCTTTTTCCCTTAAAA TAAGAGCTAAATCTGTTTTTATTATCATTTATCAAGCTCTATTAATAC CTCAACTTTTTCAAGAAAAAATAATAATAATTTTTCCCTCTATTCTCA TGACCTTTTAGGAAAATTAATTTTAGAAAAACTATTGACAAACCCAT AAAAAATGAGATAAGATTATAGATTGTCACTGGTATTTTATACTAGA GGCAAATTATATTTATATATACAAAAATGCTGTATAAAAAACATCT PrpoA AGTAAAGATTATCACCAACATCTGAAACCTGACTTCATCAACTGAGG 57 AAATAACCACTGTGGCTGTGTTTAAAATCGACTGCGTAGCAAGTAAA ACTCAAAAAAATCAAGGTCAATACGGAAAGTTTGTGCTTGAACCCTT AGAAAAAGGACAAGGCATAACT PpsaA CTACATCAACTAATCAAAAGTTAAGAAAAAAGATAGAAACGCCCAT 58 GAATATTAAAGATTAATCTGTGTCCTTTAACTTTTTATCCCCTTAAAA GAGCATAACTAAAACATTGATAGATTTTATAAAGAAAAGTAACAAA ATCTTGACTTAAATGAGAAAGGATTAAAAACCAAAGCCTTATCTGA GGGAATGTTAAACAAATTTTAAATATTGTTAAGCAAGAACCACAAT GGTGACAAATAGCCCTTATCATCTTCAGTAATGTAGTAGTTTAAGTA TTTGTCGAGAGAGGAATCCCTC PpsbA2 GATCGAATTTTTGACTATTTAATAATTTCTTTACTATTCATAATATCT 59 CAAAAGACTTCTATCTTTTTAAGTAAACTACCTCCTCTAAGAATAAA CACTTATTGACTATATTCCTTTTTAGTTATAAAATGGCATTTAAAGTT ACTCAAAATATTTGCAATCATTCTACAAAACATAGTGTATTTCCTTGT ATTAAGCGTATTGTGTCCTGTTAGATAATGTAGGAAAGATTGTGAGT TGATAGGTGATAAATACATAACTCATTAGACAACAAGATAAAGTTG TAGGAGTTCTAAATT PpsbD AAGAGTTTGGCATTTTTATTGGTAAGACTATTCTGAGAAAAATGTGA 60 CAATTTGTTAAAATATTTGCTAGAAATAGAAAAAGTAATTTGGCAAA GATACTTAAATCGTATCGAAAAACGGAGTTACATTAACTCTAACTCA TGCTATATTAAGAAAAGTTAATTGCAGATCAGTATTATTGCTGAGTA GCAGTGCCGTCTCCAATAATATAAAGAGAGACAATATAAAAGTAAA ACTTGACAAGTTAAAAAAAGAAAGATT PcpcB AACTTTAGATATTCGTAGTTGGCAATGTCGTAAATGCGGAACAATAC 61 ATGGAAAACATATAGATTTGTAATGAGAAAAAGTGTAAACAAATAT TAAGAAAAAGATCAGAAAAATTTAACAACACGTAATAAAAAAATGC GTCACTACGGGTTATAAATTTACATGAAAGGTTAAAACACTTTTCTG AGACGATTTTGATAAAAAAGTTGTCAAAAAATTAAGTTTCTTTACAA ATGCTTAACAAAAACTTGGTTTTAAGCACAAAATAAGAGAGACTAA TTTGCAGAAGTTTTACAAGGAAATCTTGAAGAAAAAGATCTAAGTA AAACGACTCTGTTTAACCAAAATTTAACAAATTTAACAAAACAAACT AAATCTATTAGGAGATTAACTACA

[0204] In certain other preferred embodiments, truncated or partially truncated versions of these promoters including only a small portion of the native promoters upstream of the transcription start point, such as the region ranging from 35 to the transcription start can often be used. Furthermore, introducing nucleotide changes into the promoter sequence, e.g. into the TATA box, the operator sequence and/or the ribosomal binding site (RBS) can be used to tailor or optimize the promoter strength and/or its induction conditions, e.g. the concentration of inductor required for induction.

Products of Interest Produced by the Cyanobacterial Host Cells

[0205] In certain embodiments, a variety of different products of interest can be produced using the genetically modified cyanobacterial host cells. Plasmid vectors disclosed herein (either endogenous to the cyanobacterial strain, or heterologous) can be used to carry a gene or genes involved in various biosynthetic pathways that produce a product of interest in the cyanobacterial cell. Exemplary products of interest include, but are not limited to, organic carbon compounds, alcohols, fatty acids, oils, carotenoids, proteins, amino acids, cell extracts, colorants or pigments such as phycocyanin, enzymes, biofuels, biomass, nutraceuticals, beauty products such as lotions, skin products, and hair products, vitamins, pharmaceuticals, and the like.

[0206] In an embodiment, the 6.8 kb endogenous plasmid vector from the cyanobacterial strain Cyanobacterium sp. PTA-13311 is genetically enhanced to include recombinant genes encoding enzymes that produce a product of interest. In an embodiment, the 6.8 kb endogenous plasmid vector from Cyanobacterium sp. PTA-13311 is used as the backbone of a vector useful for introducing exogenous polynucleotides for the production of a product of interest.

[0207] The production of 1,2-propanediol in cyanobacteria is described, for example, in PCT/US2013/65568. The production of 1,3-propanediol in cyanobacteria is described in PCT/US2013/065574. The production of isoprene in cyanobacteria is described in PCT/EP2012/067534. Additional information on compounds that can be produced from cyanobacteria can be found, for example, in PCT/EP2009/000892 and in PCT/EP2009/060526, and all of the above are incorporated by reference herein in their entirety. Genes involved in the biosynthetic pathway for the production of a product of interest can be inserted into cyanobacterial host cell, either in a plasmid or in the cyanobacterial chromosome.

[0208] In one embodiment, propanol and butanol are products of interest. Similar to ethanol, they can be produced by fermentation processes. In certain embodiments, genes encoding enzymes involved in isopropanol and isobutanol fermentation are incorporated into recombinant vectors and transformed into a cyanobacterial host cell. Examples of enzymes involved in isopropanol fermentation include acetyl-CoA acetyltransferase (EC 2.3.1.9), acetyl-CoA: acetoacetyl-CoA transferase (EC 2.8.3.8), acetoacetate decarboxylase (EC 4.1.1.4) and isopropanol dehydrogenase (EC 1.1.1.80). Examples of enzymes involved in isobutanol fermentation include acetolactate synthase (EC 2.2.1.6), acetolactate reductoisomerase (EC 1.1.1.86), 2,3-dihydroxy-3-methylbutanoate dehydratase (EC 4.2.1.9), a-ketoisovalerate decarboxylase (EC 4.1.1.74), and alcohol dehydrogenase (EC 1.1.1.1).

[0209] In another embodiment, ethylene is produced as a product of interest. In an embodiment, at least one recombinant gene encodes an enzyme for ethylene formation. Examples of enzymes involved in the production of ethylene include ethylene forming enzyme 1-aminocyclopropane-1-carboxylate oxidase (EC 1.14.17.4), which catalyzes the last step of ethylene formation, the oxidation of 1-aminocyclopropane-1-carboxylic acid to ethylene. The substrate for the ethylene forming enzyme is synthesized by the enzyme 1-aminocyclopropane-1-carboxylic acid synthase (EC 4.4.1.14) from the amino acid methionine.

[0210] In another embodiment, the product of interest is isoprene. In an embodiment the recombinant vector used to transform a cyanobacterial host cell for the production of isoprene includes at least one recombinant gene encoding an enzyme such as isoprene synthase. Isoprene synthase (EC 4.2.3.27) catalyzes the chemical reaction from dimethylallyl diphosphate to isoprene and pyrophosphate.

[0211] In another embodiment, products of interest are terpenes and terpenoids. Terpenes are a large and very diverse class of organic compounds, produced primarily by a wide variety of plants, particularly conifers. Terpenes are derived biosynthetically from units of isoprene and are major biosynthetic building blocks in nearly every living organism. For example, steroids are derivatives of the triterpene squalene. When terpenes are modified chemically, such as by oxidation or rearrangement of the carbon skeleton, the resulting compounds are generally referred to as terpenoids. Terpenes and terpenoids are the primary constituents of the essential oils for many types of plants and flowers. Examples of biosynthetic enzymes are farnesyl diphosphate synthase (EC 2.5.1.1), which catalyzes the reaction of dimethylallyl diphosphate and isopentenyl diphosphate yielding farnesyl diphosphate. Another example is geranylgeranyl diphosphate synthase (EC 2.5.1.29), which catalyzes the reaction between transfarnesyl diphosphate and isopentenyl diphosphate yielding pyrophosphate and geranylgeranyl diphosphate.

[0212] In and embodiment, the product of interest is hydrogen, and the recombinant genes can, for example, encode for hydrogenase. In an embodiment, hydrogenase is an enzyme catalyzing the following reaction: 12H.sup.++12X(reduced).fwdarw.6 H.sub.2 12X(oxidized), where X is an electron carrier such as ferredoxin.

[0213] In an embodiment, examples of products of interest include non-ribosomal peptides (NRP) and the polyketides (PK). These compounds are synthesized by plants, fungi and only a few bacteria such as actinomycetes, myxobacteria and cyanobacteria. They are a group of structurally diverse secondary metabolites and often possess bioactivities that are of pharmacological relevance. Hybrids of non-ribosomal peptides and polyketides also exist, exhibiting both peptide and polyketide parts. Recombinant genes for the production of non-ribosomal peptides as products of interest are encoded by, for example, gene clusters encoding non-ribosomal peptide synthetases (NRPS). NRPS are characteristic modular multidomain enzyme complexes encoded by modular non-ribosomal peptide synthetase gene clusters. Examples for non-ribosomal peptide synthetases are actinomycin synthetase and gramicidin synthetase.

[0214] In an embodiment, polyketides are products of interest. In general, there are two distinct groups of polyketides, the reduced polyketides of type I, macrolides, and the aromatic polyketides of type II. Type I polyketides are synthesized by modular polyketide synthases (PKS), which are characteristic modular multidomain enzyme complexes encoded by modular PKS gene clusters. Examples for recombinant genes useful for encoding enzymes for the production of type I polyketides are the rapamycin synthase gene cluster and the oleandomycin synthase gene cluster. One example for a recombinant gene for type II polyketides is the actinorhodin polyketide synthase gene cluster.

[0215] In another embodiment, hybrids of polyketides and non-ribosomal peptides are products of interest. Examples for recombinant genes for the production of hybrids of polyketides and non-ribosomal peptides are the microcystin synthetase gene cluster, microginin synthetase gene cluster, and myxothiazole synthetase gene cluster.

[0216] In another embodiment, alkaloids are products of interest. Alkaloids are a group of compounds containing mostly basic nitrogen atoms and which are synthesized by many organisms, including plants. Alkaloids have highly complex chemical structures and pronounced pharmacological activities. Examples for biosynthetic enzymes for alkaloids which can be encoded by recombinant genes for the production of the compound are strictosidine synthase, which catalyzes the reaction of tryptamine and secologanin to form 3a(S)-strictosidine. Strictosidine is a precursor for the biosynthetic pathway of ajmaline and it also initiates all pathways leading to an entire monoterpene indole alkaloid family. Another example of an enzyme that could be encoded by a recombinant gene is strictosidine glucosidase from the ajmaline biosynthetic pathway. This enzyme is able to activate strictosidine by deglycosylation, thus generating an aglycon which is the precursor for more than 2,000 monoterpenoid indole alkaloids.

[0217] In an embodiment, additional examples of enzymes encoded by at least one recombinant gene are (R,S)-3-hydroxy-N-methylcoclaurine 4-O-methyltransferase (4OMT) which is central to the biosynthesis of most tetrahydrobenzylisoquinolin-derived alkaloids; berberine bridge enzyme (BBE) of the sanguinarine pathway; (R,S)-reticuline 7-O-methyltransferase (7OMT) part of laudanosine formation; as well as salutaridinol 7-O-acetyltransferase (SalAT) and codeinone reductase involved in the production of morphine.

[0218] In yet another embodiment, vitamins are products of interest. Vitamins are organic compounds that are essential nutrients for certain organisms and act mainly as cofactors in enzymatic reactions but can also have further importance, e.g. as antioxidants. In plants, vitamin C can be made via the L-ascorbic acid (L-AA) biosynthetic pathway starting from D-glucose. In an embodiment, recombinant genes encoding enzymes involved in vitamin C synthesis are disclosed and include hexokinase, glucose-6-phosphate isomerase, mannose-6-phosphate isomerase, phosphomannomutase, mannose-1-phosphate guanylyltransferase, GDP-mannose-3,5-epimerase, GDP-L-galactose phosphorylase, L-galactose 1-phosphate phosphatase, L-galactose dehydrogenase, and L-galactono-1,4-lactone dehydrogenase.

[0219] In another embodiment, an amino acid is the product of interest. Amino acids as products of interest include naturally occurring amino acids as well as amino acid derivatives. The amino acid can be, for example, naturally occurring in the cell, naturally occurring in another organism, or a non-naturally occurring amino acid.

[0220] In an embodiment, lactams are products of interest. Lactams are cyclic amides and the prefix indicates how many carbon atoms (apart from the carbonyl moiety) are present in the ring. For example, -lactam (2 carbon atoms outside the carbonyl, 4 ring atoms in total), -lactam (3 and 5), -lactam (4 and 6). One example for a -lactam is pyrrolidone, a colorless liquid which is used in industrial settings as a high-boiling, non-corrosive, polar solvent for a wide variety of applications. Pyrrolidone is also an intermediate in the manufacture of polymers such as polyvinylpyrrolidone and polypyrrolidone.

[0221] In another embodiment, ethers are products of interest. Ethers are a class of organic compounds that contain an ether group, an oxygen atom connected to two alkyl or aryl groups of general formula R-O-R. An example of an ether is tetrahydrofuran (THF) which is a colorless, water-miscible organic liquid. THF is a heterocyclic compound and is one of the most polar ethers miscible in many solvents. THF is also useful as a solvent and as a precursor to polymers. Other examples of ethers that are products of interest include naturally occurring ethers such as divinyl ether oxylipins. Enzymes involved in the biosynthesis of divinyl ether oxylipins include lipoxygenase and divinyl ether synthase.

[0222] In yet another embodiment, alkanes (also known as saturated hydrocarbons) are products of interest. Alkanes consist only of the elements carbon (C) and hydrogen (H), i.e. hydrocarbons. When the carbon and hydrogen atoms of alkanes are linked together exclusively by single bonds, the alkanes are saturated alkanes. Each carbon atom must have 4 bonds (either CH or CC bonds), and each hydrogen atom must be joined to a carbon atom (HC bonds). The simplest possible alkane is methane, CH.sub.4. There is no limit to the number of carbon atoms that can be linked together. Alkanes, observed throughout nature, are produced directly from fatty acid metabolites. A two gene pathway, widespread in cyanobacteria, is responsible for alkane biosynthesis. In an embodiment, these genes may be part of the recombinant vector and include genes encoding acyl-ACP reductase (EC 1.3.1.9) which converts a fatty acyl-ACP into a fatty aldehyde that may subsequently be converted into an alkane/alkene by an aldehyde decarbonylase (EC 4.1.99.5).

[0223] In an embodiment, biopolymers such as polyhydroxyalkanoates (PHAs) are products of interest. PHAs are linear polyesters produced in nature by bacterial fermentation of sugar or lipids. They are produced by the bacteria to store carbon and energy. The simplest and most commonly occurring form of PHA is the fermentative production of poly-3-hydroxybutyrate (P3HB) but many other polymers of this class are produced by a variety of organisms. PHAs include poly-4-hydroxybutyrate (P4HB), polyhydroxyvalerate (PHV), polyhydroxyhexanoate (PHH), polyhydroxyoctanoate (PHO) and their copolymers. In an embodiment, recombinant genes encoding enzymes involved in P3HB synthesis are part of recombinant vectors. These genes include genes encoding -ketothiolase (EC 2.3.1.9) that produces acetoacetyl-CoA which is converted to (R)-3-hydroxybutyryl-CoA (3HBCoA) by NADPH-dependent acetoacetyl-CoA reductase (EC 1.1.1.36). The 3HBCoA is subsequently polymerized by poly(3-hydroxyalkanoate) synthase (EC 2.3.1) and is converted to P3HB.

[0224] In an embodiment, esters, including fatty acid esters, are a product of interest. Simple esters with lower chain alcohols (methyl-, ethyl-, n-propyl-, isopropyl- and butyl esters) are used as emollients in cosmetics and other personal care products and as lubricants. Esters of fatty acids with other alcohols, such as sorbitol, ethylene glycol, diethylene glycol and polyethylene glycol are consumed in foods, personal care, paper, water treatment, metal working fluids, rolling oils and synthetic lubricants. Fatty acids are typically present in the raw materials used for the production of biodiesel. A fatty acid ester (FAE) can be created by a transesterification reaction between fats or fatty acids and alcohols. The molecules in biodiesel are primarily fatty acid methyl esters FAMEs, usually obtained from vegetable oils by transesterification with methanol. The esterification of the ethanol with the acyl moieties of coenzyme A thioesters of fatty acids can be obtained enzymatically by a nonspecific long chain alcohol O-fatty-acyltransferase (EC 2.3.1.75) from Acinetobacter baylyi strain ADP1, for example.

[0225] In an embodiment, the product of interest is a colorant, such as phycocyanin, phycobiliprotein, or a derivative thereof. Other colorants of interest can be, for example, allophycocyanin, phycoerythrin, or phycoerythrocyanin, and the like. The genes for the production of the colorant can be endogenous to the cyanobacterial cell, or can be exogenously derived.

[0226] The product of interest can also be a pigment such as a carotenoid. The genes for the production of a carotenoid of interest can be endogenous to the cyanobacterial cell, or can be exogenously derived. Exemplary carotenoids that can be obtained from cyanobacterial cultures include, but are not limited to, lutein, zeaxanthin, beta-carotene, astaxanthin, canthaxanthin, and the like.

[0227] In an embodiment, the product of interest is an amino acid, or a derivative thereof

[0228] In yet another embodiment, the product of interest is a cell extract.

[0229] In another embodiment, the product of interest is an industrial enzyme. The enzyme can be endogenous to the cell or can be exogenously derived. An exogenously derived gene encoding an enzyme of interest can be inserted into the plasmid vector or integrated into the genome of the cyanobacteria. A culture of the cells is grown, the cells are harvested, and the enzyme of interest is isolated and purified.

[0230] In an embodiment, the genetically modified cyanobacterial host cell contains the entire sequences of recombinant genes that encode for all of the enzymes used in a cascade of enzymatically catalyzed reactions that results in the production of a product of interest.

[0231] In an embodiment, a first protein encoded by a first recombinant gene can produce a first intermediate which is further converted by a second protein encoded by a second recombinant gene into a second intermediate, which then in turn is further converted by a third protein encoded by a third recombinant gene into a third intermediate such that a sequence of reactions provide intermediates for the next enzyme leading to the eventual production of a product of interest. In an embodiment, the recombinant genes encoding the enzymes that catalyze the sequence of reactions can be introduced into the desired cyanobacterial host cells.

[0232] In an embodiment, the product of interest is biomass. The methods described herein can allow cyanobacterial cultures to grow faster and to a higher cell density, with less competition from other organisms, and can thus result in a higher biomass harvest at the end of the culture run.

[0233] In an embodiment, the products of interest that are produced from the genetically modified cyanobacterial host cells can be removed intermittently as the culture grows, or the compounds can be separated at the end of a batch growth period. The cultures can be grown indoors, or can be grown outdoors in enclosed containers such as bioreactors, or in another suitable type of container.

Production of Ethanol in Genetically Modified Cyanobacterial Host Cells

[0234] In an embodiment, the product of interest that is produced by the cyanobacterial host cell is ethanol. Genes encoding the enzymes pyruvate decarboxylase and alcohol dehydrogenase can be transformed to the cell, either on a plasmid vector or at a location on the cyanobacterial chromosome.

[0235] In an embodiment, the 6.8 kb endogenous plasmid vector from the cyanobacterial strain Cyanobacterium sp. PTA-13311 (p6.8) is genetically enhanced to include recombinant genes encoding enzymes that produce a product of interest. In an embodiment, the 6.8 kb endogenous plasmid vector from Cyanobacterium sp. PTA-13311 is used as the backbone of a vector useful for introducing exogenous polynucleotides for the production of a product of interest.

[0236] In an embodiment, a plasmid vector is prepared which comprises one or more recombinant genes encoding an enzyme used in ethanol production. In an embodiment, the genes are adh and pdc. The gene pdc encodes pyruvate decarboxylase (Pdc), which catalyzes the conversion of pyruvate to acetaldehyde. The gene adh encodes alcohol dehydrogenase (Adh) which catalyzes the interconversion between acetaldehyde and ethanol. Thus, Pdc and Adh act in concert to produce ethanol. In another embodiment, the gene is adhE which encodes an AdhE enzyme (alcohol dehydrogenase E) which catalyzes the interconversion between acetyl-coenzyme A and ethanol.

[0237] Ethanol produced by the cyanobacterial cells can be measured by any means well known in the art. In an embodiment, the ethanol produced is measured using gas chromatographic analysis of a growth media and/or the headspace above a growth media.

[0238] In an embodiment, Pdc activity is measured by a photometric kinetic reaction that can be monitored at 340 nm using a spectrophotometer. Pyruvate is enzymatically converted to acetaldehyde by pyruvate decarboxylase, which is reduced to ethanol by alcohol dehydrogenase coupled to NADH or NADPH oxidation.

[0239] In particular embodiments, the Adh enzyme is, for example, a Zn.sup.2+-dependent alcohol dehydrogenase such as Adhl from Zymomonas mobilis (ZmAdh) or the Adh enzyme from Synechocystis sp. PCC 6803 (SynAdh encoded by the synadh gene). Alternatively or in addition, the enzyme is an iron-dependent alcohol dehydrogenase (e.g. AdhII from Z. mobilis). The Zn.sup.2+-dependent alcohol dehydrogenase can, for example, be an alcohol dehydrogenase enzyme having at least 60%, 70%, 80%, 90% or even more than 90% sequence identity to the amino acid sequence of Zn.sup.2+ dependent alcohol dehydrogenase from Synechocystis sp. PCC 6803. Relative to other alcohol dehydrogenases, SynAdh (annotated open reading frame s1r1192 from the Synechocystis sp. PCC 6803 genome) favors higher overall ethanol production because the reduction of acetaldehyde to ethanol is preferred to the reaction from ethanol to acetaldehyde. Thus, in an embodiment, a SynAdh encoding recombinant gene is useful for production of ethanol in a host cell.

[0240] AdhE is an iron-dependent, bifunctional enzyme that interconverts acetyl coenzyme A to ethanol. One characteristic of iron-dependent alcohol dehydrogenases (e.g. AdhE and AdhII) is their sensitivity to oxygen. In an embodiment, AdhE used to transform Cyanobacterium sp. PTA-13311 is derived from E. coli or from thermophilic organisms such as Thermosynechococcus elongatus BP-1.

[0241] Genes encoding other types of ADH enzymes, such as those described in PCT/EP2014/062594, which is incorporated by reference herein in its entirety, can be used to produce ethanol in cyanobacterial host cells. Thus, genes encoding ADH enzymes derived from Arthrospira platensis, Arthronema africanum, Chroococcidiopsis sp., Synechococcus sp., Lyngbya sp., Cyanothece sp., and Cyanobacterium sp. can be used. In a preferred embodiment, the ADH enzyme is derived from Lyngbya sp.

[0242] In an embodiment, pyruvate decarboxylase can be derived from, for example, Zymomonas mobilis, Zymobacter palmae or the yeast Saccharomyces cerevisiae. In an embodiment, nucleic acid sequences, protein sequences and properties of ethanologenic enzymes such as alcohol dehydrogenases and pyruvate decarboxylases disclosed herein, can be found within PCT patent application WO 2009/098089 A2, which is hereby incorporated for this purpose.

[0243] In an embodiment, ethanologenic cassettes are introduced into the cyanobacterial host cells and those host cells are used for the production of ethanol. Ethanologenic cassettes disclosed herein vary in promoters used as well as the source of adh and pdc genes.

Transformation of Cyanobacterial Cells

[0244] Cyanobacteria can be transformed by several suitable methods. Exemplary cyanobacteria that can be transformed with the constructs described herein include but are not limited to Synechocystis, Synechococcus, Acaryochloris, Anabaena, Thermosynechococcus, Chamaesiphon, Chroococcus, Cyanobacterium, Cyanobium, Dactylococcopsis, Gloeobacter, Gloeocapsa, Gloeothece, Microcystis, Prochlorococcus, Prochloron, Chroococcidiopsis, Cyanocystis, Dermocarpella, Myxosarcina, Pleurocapsa, Stanieria, Xenococcus, Arthrospira, Borzia, Crinalium, Geitlerinema, Halospirulina, Leptolyngbya, Limnothrix, Lyngbya, Microcoleus, Cyanodictyon, Aphanocapsa, Oscillatoria, Planktothrix, Prochlorothrix, Pseudanabaena, Spirulina, Starria, Symploca, Trichodesmium, Tychonema, Anabaenopsis, Aphanizomenon, Calothrix, Cyanospira, Cylindrospermopsis, Cylindrospermum, Nodularia, Nostoc, Chlorogloeopsis, Fischerella, Geitleria, Nostochopsis, Iyengariella, Stigonema, Rivularia, Scytonema, Tolypothrix, Cyanothece, Phormidium, Adrianema, and the like.

[0245] Exemplary methods suitable for transformation of Cyanobacteria, include, as nonlimiting examples, natural DNA uptake (Chung, et al. (1998) FEMS Microbiol. Lett. 164: 353-361; Frigaard, et al. (2004) Methods Mol. Biol. 274: 325-40; Zang, et al. (2007) J. Microbiol. 45: 241-245), conjugation, transduction, glass bead transformation (Kindle, et al. (1989) J. Cell Biol. 109: 2589-601; Feng, et al. (2009) Mol. Biol. Rep. 36: 1433-9; U.S. Pat. No. 5,661,017), silicon carbide whisker transformation (Dunahay, et al. (1997) Methods Mol. Biol. (1997) 62: 503-9), biolistics (Dawson, et al. (1997) Curr. Microbiol. 35: 356-62; Hallmann, et al. (1997) Proc. Natl. Acad. USA 94: 7469-7474; Jakobiak, et al. (2004) Protist 155:381-93; Tan, et al. (2005) J. Microbiol. 43: 361-365; Steinbrenner, et al. (2006) Appl Environ. Microbiol. 72: 7477-7484; Kroth (2007) Methods Mol. Biol. 390: 257-267; U.S. Pat. No. 5,661,017) electroporation (Kjaerulff, et al. (1994) Photosynth. Res. 41: 277-283; Iwai, et al. (2004) Plant Cell Physiol. 45: 171-5; Ravindran, et al. (2006) J. Microbiol. Methods 66: 174-6; Sun, et al. (2006) Gene 377: 140-149; Wang, et al. (2007) Appl. Microbiol. Biotechnol. 76: 651-657; Chaurasia, et al. (2008) J. Microbiol. Methods 73: 133-141; Ludwig, et al. (2008) Appl. Microbiol. Biotechnol. 78: 729-35), laser-mediated transformation, or incubation with DNA in the presence of or after pre-treatment with any of poly(amidoamine) dendrimers (Pasupathy, et al. (2008) Biotechnol. J. 3: 1078-82), polyethylene glycol (Ohnuma, et al. (2008) Plant Cell Physiol. 49: 117-120), cationic lipids (Muradawa, et al. (2008) J. Biosci. Bioeng. 105: 77-80), dextran, calcium phosphate, or calcium chloride (Mendez-Alvarez, et al. (1994) J. Bacteriol. 176: 7395-7397), optionally after treatment of the cells with cell wall-degrading enzymes (Perrone, et al. (1998) Mol. Biol. Cell 9: 3351-3365). Biolistic methods (see, for example, Ramesh, et al. (2004) Methods Mol. Biol. 274: 355-307; Doestch, et al. (2001) Curr. Genet. 39: 49-60; all incorporated herein by reference in their entireties).

Culturing the Cyanobacterial Cells

[0246] In an embodiment, the product of interest is synthesized in cyanobacterial cultures by preparing host cyanobacterial cells having the gene constructs discussed herein, growing cultures of the cells, and harvesting the product.

[0247] The choice of culture medium can depend on the cyanobacterial species. In an embodiment of the invention, BG-11 medium (as shown in Example 1) can be used as the basic medium for growing cyanobacteria. When salt water species are grown, NaCl is added to the culture medium. The medium is also adjusted as needed for a particular experiment. For example, the medium may be modified by replacing phosphate with phosphite, or by substituting urea for nitrate, as needed for a particular situation. This is further described in the example section.

[0248] In an embodiment, the cells are grown autotrophically, and the only carbon source is CO.sub.2. In another embodiment, the cells are grown mixotrophically, for example with the addition of a carbon source such as glycerol along with CO.sub.2.

[0249] The cultures can be grown indoors or outdoors. The light cycle indoors can be set as desired, for example: continuous light, or 16 hours on and 8 hours off, or 14 hours on and 10 hours off, or 12 hours on and 2 hours off.

[0250] In an embodiment, the cyanobacteria are grown in enclosed bioreactors in quantities of at least about 100 ml, 500 ml, 1 liter, 1.5 liters, 5 liters, 10 liters, 50 liters, 100 liters, 500 liters, 1000 liters, 2000 liters, 5,000 liters, or more. In an embodiment, the cyanobacterial cell cultures are grown in flexible photobioreactors made of a clear plastic material.

[0251] In another embodiment, the cultures are grown indoors, with continuous light. In another embodiment, the cultures are grown outdoors in an open pond type of photobioreactor.

EXAMPLES

Example 1

Culture Medium for Cyanobacterial Growth

[0252] Artificial Seawater medium (ASW) was the standard medium used for cultivation of marine cyanobacteria strains. The ASW medium uses the standard cyanobacterial medium BG-11 as its base, with the addition of the salts listed below. This medium is also known as mBG-11 medium.

TABLE-US-00006 TABLE 6 Culture Medium Components Artificial Seawater Medium Compound Amount in 1 L (g) NaCl 25.84 MgSO.sub.47H.sub.20 6.36 MgCl.sub.26H.sub.2O 5.06 KCl 0.62 CaCl.sub.22H.sub.2O 1.36

[0253] Before use, 1 ml stock solutions of ferric ammonium citrate, phosphate, and trace metal solution is added to the medium.

TABLE-US-00007 TABLE 7 Additional Components for Medium Stock Solution Component g * L.sup.1 in dH.sub.2O mL * L.sup.1 mM FeNH.sub.4-citrate 6 1 0.022 K.sub.2HPO.sub.4 3H.sub.20 52.49 1 0.229 Trace metals 1

[0254] The following is a basic recipe for the common cyanobacterial culture medium BG-11:

TABLE-US-00008 TABLE 8 Basic BG-11 Medium Recipe Compound Amount BG-11 Medium NaNO.sub.3 1.5 g K.sub.2HPO.sub.4 0.04 g or 1 mL of prepared stock solution MgSO.sub.47H.sub.2O 0.075 g CaCl.sub.22H.sub.2O 0.036 g Citric acid 0.006 g Ferric ammonium citrate 0.006 g or 1 mL of prepared stock solution EDTA (disodium salt) 0.001 g NaCO.sub.3 0.02 g Trace metal mix A5 1.0 ml Distilled water to 1.0 L Composition of Trace Metal Mix H.sub.3BO.sub.3 2.86 g MnCl.sub.24H.sub.2O 1.81 g ZnSO.sub.47H.sub.2O 0.222 g NaMoO.sub.42H.sub.2O 0.39 g CuSO.sub.45H.sub.2O 0.079 g Co(NO.sub.3).sub.26H.sub.2O 49.4 mg Distilled water to 1.0 L

[0255] The medium was also modified based on the choice of inducible promoters for the chosen added constructs. Thus, the nitrogen source and amount, as well as the amount and timing of any added copper was dependent on the strain and the promoters used to control the expression of the ethanol cassette or phosphite utilization genes, respectively. Further, the phosphorus source (such as phosphate or phosphite) and amount were modified as indicated for individual experiments.

[0256] Unless noted otherwise, the following standard growth conditions were used: mBG-11 medium; 38 mL min' aeration rate with 15% CO.sub.2 supply on demand; pH 7.3+/0.1 as the set-point for CO.sub.2 delivery during the day; a light cycle of 12 hours light/12 hours dark. The temperature cycle was set at 25 C. (during the dark phase) and 35 C.-37 C. (during the light phase) The light intensity was set at approximately 350 mol photons m.sup.2s.sup.1 from one side of the vertical photobioreactors.

Example 2

Long-Term Cultivation in 0.5 L Photobioreactors (PBRs) and 1.2 L Vertical Photobioreactors (vPBRs)

1. Cultivation in 0.5 L PBRs

[0257] For scale up, the cyanobacterial culture was maintained under repressed conditions, using mBG-11 (35 psu) with ammonium and urea (2 mM of each) instead of nitrate as nitrogen source, 5 mM TES was used as buffer. For plasmid maintenance and contamination control, kanamycin (150 mg L.sup.1) was used. For induction of ethanol production, cells were switched back to normal mBG-11 with nitrate and no ammonium/urea. Cells were cultivated in 0.5 L round Schott bottles. Mixing was achieved using a magnetic stir bar at continuous 250 rpm. The gas flow rate was continuously 15 ml min.sup.1 with CO.sub.2 enriched air (5% CO.sub.2). A light/dark period of 12 h:12 h was applied. Illumination of cultures was done with fluorescence lamps (Sylvana Grolux FHO 39 W/T5/GRO). The cultures were illuminated from two sides with a photon flux density (PFD) of 230 mol photons m.sup.2s.sup.1 each.

2. Cultivation in 1.2 L vertical vPBRs

[0258] The strains were scaled up in 1 liter mBG-11 with 0.5% continuous CO.sub.2 supply and continuous illumination with a PFD of 200-300 mol photons m.sup.2s.sup.1. The strains were cultivated under repressed conditions in media containing 2 mM ammonium and 2 mM urea as the nitrogen source. Furthermore 200 mg/L kanamycin was added and 5 mM TES buffer was used to keep the pH at 8.0.

[0259] 1.2 L vPBRs were inoculated at a cell density of OD.sub.750nm=0.5 in mBG-11 medium (35 psu) containing kanamycin (200 mg/L). The strains were cultivated at pH 7.30.01. CO.sub.2 (15% CO.sub.2 in air) was injected into the liquid phase in a pH controlled manner with continuous aeration (38 mL/min). The vPBRs were illuminated from one side using fluorescent bulbs with a PFD of 230 mol photons m.sup.2s.sup.1 during the photoperiod of 12 hours. The temperature profile ranged from 25 C. during the dark period and 37 C. during the light period.

[0260] Vapor loss correction: An average value of 2.5% ethanol vapor loss per day was assumed in order to compensate for the ethanol loss through vapor phase. The value 2.5% was calculated from several evaporation tests with ethanol spiked medium in 1.2L vPBRs under these standardized conditions, where the decline of ethanol in the liquid phase had been determined experimentally. Nutrients were added several times during the cultivation. Ethanol production rates were calculated by subtracting ethanol values from the first day and the last day divided by the number of cultivation days.

Example 3

Most Heterotrophic Contaminants Do Not Utilize Phosphite Efficiently

[0261] The following experiment confirmed that most bacterial organisms that contaminate cyanobacterial cultures do not have the ability to utilize phosphite (or utilize phosphite inefficiently). A contaminated outdoor cyanobacterial photobioreactor was sampled for contaminating heterotrophic bacteria, and the sample strains were isolated and purified.

[0262] Bacterial Minimal Media (BMM) was prepared, containing the following components per liter of ASW: 1 mL Trace Metal Mix, 1 mL ferric ammonium citrate solution, 1 g sodium pyruvate, 0.1 g ammonium chloride, 10 mM Tris (ph 7.5), 10 mL RPMI amino acid solution (Sigma R7131), and 10 mL of BME vitamin solution (Sigma B6891).

[0263] Several of the strains were then grown in bacterial minimal medium with either 50 M or 230 M NaPO.sub.3 as the sole phosphorus source. After 48 hours, the OD.sub.600 was measured to determine bacterial cell growth. As shown in FIG. 2, six of the strains had negligible growth on phosphite as the only phosphorus source, and eight of the strains had relatively slow growth on phosphite (slower than with phosphate, but slightly higher than with no phosphorus in the medium).

Example 4

Common Fungal Contaminants Do Not Grow Well on Phosphite

[0264] Two fungal strains were obtained from outdoor contaminated cultures. These strains were isolated, purified, and identified as a Fusarium and Cladosporium. The two isolates were then tested to determine whether they were capable of growth when the only phosphorus source was phosphite.

[0265] The assay was conducted on fungal minimal medium (FMM) agar. The medium contained the following components per liter of ASW: 1 mL Trace Metal Mix, 1 mL ferric ammonium citrate solution, 10 g sucrose, 1.0 g sodium nitrate, and 10 mM Tris (ph 7.5).

[0266] The two isolated contaminant strains (Fusarium and Cladosporium) were plated on FMM containing 230 M phosphate, FMM containing 230 M sodium phosphite, and P-free FMM. After four consecutive transfers, the Fusarium and Cladosporium isolates displayed decreased growth in P-free medium while maintaining high growth in the control phosphate treatments. Further, both of the fungal test strains grew more slowly in sodium phosphite than in P-free medium.

Example 5

Wild Type Cyanobacterium sp. PTA-13311 Does Not Utilize Phosphite

[0267] The wild type cyanobacterial strain, Cyanobacterium sp. PTA-13311, was tested to determine whether it was capable of utilizing phosphite as a sole phosphorus source. The strain was first grown for 3 weeks on phosphorus-free medium to reach a phosphorus limitation stage. The strain was then pelleted and resuspended in growth medium with either 230 M phosphite (as Na.sub.2HPO.sub.3), 230 M phosphate (as K.sub.2HPO.sub.4), or no P source. Cells were grown in 0.5 L PBRs at a light intensity of 250 mol photons m.sup.2s.sup.1 light from one side, with a light cycle of 12 hours light/12 hours dark, at a temperature of 28 C. After 14 days, the cyanobacterial cells growing on phosphite showed no improved growth compared to cells grown in P-free medium, while comparable cells growing in phosphate had exponential growth over the same period (FIG. 3). Thus, it was concluded that the Wild Type (WT) Cyanobacterium sp. PTA-13311 strain, without further modification, does not have the ability to utilize phosphite.

Example 6

Identification of the ptxABCD Genes in Other Organisms

[0268] Although most cyanobacterial strains (including the Cyanobacterium sp. PTA-13311 strain previously chosen to be suitable as the host strain for commercial-scale ethanol production) do not utilize phosphite, some cyanobacterial strains are actually able to utilize phosphite. A search of the publicly available sequence databases found that the ptxABCDE operon is found in proteobacteria, cyanobacteria, and actinobacteria (FIG. 4). Bacteria harboring a biochemical pathway (ptxABCDE operon) for the oxidation of reduced phosphorus (i.e. phosphite) were identified by performing a BLAST search (world wide web: blast.ncbi.nlm.nih.gov) using the blastp algorithm and the PtxD protein from Pseudomonas stutzeri (YP_006457277) as the query sequence. Sequences producing significant alignment were examined for the presence of the phosphite dehydrogenase (PTDH) conserved domain (cd12157).

[0269] Phylogenetic analysis of the ptxD gene showed that well-supported clades did not form based on taxonomy, although similar organisms did group together. For example, strains of the genera Halomonas and Marinobacter grouped together but were separate from other -proteobacteria such as Pseudomonas and Salmonella (non-ptxE like). The cyanobacteria strains formed three well-supported clades that grouped together, but the clade had a low bootstrap value (21%). Most of the bacteria strains harboring ptxD also contained the ABC transporter genes. In contrast, not all strains contained ptxE. Further, some strains lacked a transcriptional regulator nearby. Other strains were found to have a different type of regulator. The operon was located on either the chromosome (75% of the strains) or a plasmid (<25% of the strains). Only one strain, Methylobacterium extorquens, contained more than one copy of the operon, with two copies on its megaplasmid.

Example 7

Codon Optimization

[0270] Some of the phosphite utilization genes that were chosen for insertion into the cyanobacterial host cells were codon optimized for optimal expression in Cyanobacterium sp. PTA-13311. The ptxD gene sequence from the bacterium Ralstonia, for example, was codon optimized. In some cases, such as for the ptxABC phosphite transporter and ptxD phosphite dehydrogenase genes, both codon-optimized and non-codon-optimized variants were cloned. Codon modification of heterologous genes for optimal expression in Cyanobacterium sp. PTA-13311 was performed utilizing the codon usage table shown in Table 4.

Example 8

General Cloning Methods Used to Generate Plasmid Vectors

[0271] The plasmid vectors used herein were produced using PCR-based cloning techniques and the Invitrogen GENEART Seamless Cloning and Assembly Kit from Life Technologies (Carlsbad, Calif., USA). Heterologous phosphite utilization genes were synthetically produced by custom synthesis. The plasmid backbone used was pAB1Cyano1-6.8, which is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0272] The ethanologenic plasmid backbones used were #1904 (pAB1-6.8::PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111-TrbcS) or #1938 (Porf0316- pdc(AB1opt1)-TdsrA-PcpcB-adh111 (AB1opt)-Trbc, respectively, also synthetic derivatives of the endogenous 6.8 kB extrachromosomal plasmid pAB1Cyano1-6.8 of Cyanobacterium sp. PTA-13311.

Example 9

Construction of Phosphite Utilization Plasmid Vectors and Ethanologenic Plasmid Vectors

[0273] Several plasmid vectors were constructed to add various phosphite utilization genes to Cyanobacterium sp. PTA-13311. The phosphite dehydrogenase gene (ptxD) from various sources, as well as genes to transport phosphite into the cell (either multi-gene systems ptxA,B,C, or single gene systems such as the ptdC from Desulfotignum phosphitoxidans). FIG. 5 shows a summary of the different constructs that were prepared.

[0274] Plasmid annotations were made using vector NTI software (Thermo Fisher Scientific Inc., Waltham, Mass.). Abbreviations: CDS (coding DNA sequence); RBS (ribosome binding site); ORF (open reading frame); Km (kanamycin resistance gene). Asterisks (*) or (**), optionally followed by a number, denote recombinantly modified genes or promoters. All of the plasmids listed below were transformed to Cyanobacterium sp. PTA-13311 (ABICyanol) or (AB1).

[0275] Plasmid construct #1904 (pAB1-6.8::PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111-TrbcS) is present in a control ethanologenic control strain AB0250, without the phosphite utilization genes, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0276] Plasmid construct #1938 (Porf0316- pdc(AB1opt1)-TdsrA-PcpcB-adh111 (AB1opt)-Trbc) is present in an ethanologenic control strain AB0012, without modification of phosphite utilization or phosphate uptake genes, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0277] Plasmid construct #1962 (pAB1_6.8::Porf221-ptxABCD2104; SEQ ID NO: 1; FIG. 6) is present in strain AB0493 for copper inducible expression of phosphite utilization genes in a non-ethanologenic Cyanobacterium sp. PTA-13311 (AB1) wild-type background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0278] Plasmid construct pAB1617 (pAB1_6.8::PnirA*2-ptxDR4506(AB1opt)-His6-IScpcBA-ptxABC2104-Toop; SEQ ID NO: 2; FIG. 7) is present in strain AB0524 for nitrate inducible expression of phosphite utilization genes in a non-ethanologenic Cyanobacterium sp. PTA-13311 (AB1) wild-type background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0279] Plasmid construct pAB611 (pAB1_6.8::Porf0316-pdc(AB1opt1)-TdsrA-PcpcB-adh111(AB1opt)-TrbcS-PpstS_ptxDR4506(AB1opt)-His6_IScpcBA_ptxABC2104; SEQ ID NO: 3; FIG. 8) is present in strain AB0701 allowing for phosphorus regulatable (P-starvation inducible) expression of phosphite utilization genes, plus a copper inducible ethanol cassette, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311. This construct was prepared from the parent plasmid pAB0609, with the original ptdC-Dp(Opt1) gene replaced by ptxABC2104 operon. To prepare the plasmid, the parent vector pAB0609 was digested with NsiI and XhoI to remove the ptdC-Dp(Opt1) gene. The NsiI/XhoI digested ptxABC2104 operon from pAB1617 was ligated with digested pAB0609. Transformation was performed using nitrate-free plates with kanamycin selection for transformation. Testing for transformants was performed by the use of PCR, using PtxD-R4506-753F/2104ptxA-599R, which would be expected to generate a PCR product of 980 bp using the following primers:

TABLE-US-00009 PtxD-R4506-753F: (SEQIDNO:4) 5'-TGCTTTAGCTAGTGGTAAATTAGC-3' 2104ptxA-599R: (SEQIDNO:5) 5'-CTAACCACTGCCCCAATACCATC-3'

[0280] Plasmid construct cc215 (pAB1_6.8:: PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Toop-Porf00615-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB 0011-PpsaA-ptxDR4506(AB1opt)-His6-TpsaB; SEQ ID NO: 6; FIG. 9) is present in strain AB0762 allowing for constitutive expression of the phosphite utilization genes, plus a nitrate inducible ethanol cassette, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0281] Plasmid construct cc220 (pAB1_6.8:: PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Porf0316- ptxDR4506(AB1opt)-His6-IScpcBA-ptdCDp(AB1opt)-Toop-Porf0221-ptxABC2104-TB0011; SEQ ID NO: 7; FIG. 10) is present in AB0764 allowing for copper inducible expression of phosphite utilization genes with two phosphite transporters and a nitrate inducible expression of the ethanol cassette, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0282] Plasmid construct cc222 (pAB 1_6.8:: Porf0316-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-PnirA*2-ptxDR4506(AB1opt)-His6-IScpcBA-ptxABC2104-Toop; SEQ ID NO: 8; FIG. 11) present in strain AB0765 harbors a nitrate inducible expression cassette of phosphite utilization genes, plus copper inducible expression of the ethanol cassette, in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0283] Plasmid construct cc233 (pAB1-6.8:: PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Porf0316-ptxDR4506(AB1opt)-His6-IScpcBA-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB0011; SEQ ID NO: 9; FIG. 12) present in strain AB0766 harbors a copper inducible expression cassette of the phosphite utilization genes, and a nitrate inducible ethanol cassette in a wild-type Cyanobacterium sp. PTA-13311 background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

[0284] Cyanobacterial strain AB0040 (AB1_orf0666) is Cyanobacterium sp. PTA-13311 having a knockout of the phosphate metabolism regulatory gene phoU (orf0666) (FIG. 13). This results in a faster rate of phosphate uptake into the cell, when phosphate is present in the medium.

[0285] Plasmid construct cc233 (pAB1-6.8:: PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Porf0316-ptxDR4506(AB1opt)-His6-IScpcBA-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB0011) present in strain AB0793 contains copper inducible expression cassette of the phosphite utilization genes and a nitrate inducible ethanol cassette in a AphoU background. The plasmid construct is a synthetic derivative of an endogenous 6.8 kB extrachromosomal plasmid of Cyanobacterium sp. PTA-13311.

Example 10

Transformation of Cyanobacterium sp. PTA-13311

[0286] Due to a significant layer of extracellular polymeric substances (EPS) outside the cell of the production strain Cyanobacterium sp. PTA-13311 (AB1), the following method was used to decrease the EPS layer prior to conjugation. The method involved several steps: treatment of cells with N-acetylcysteine (NAC); washing steps that utilize NaCl; a treatment with lysozyme and subsequent washing. Firstly, 200 ml of an exponentially growing culture (0.5<OD.sub.750nm<1) was incubated with N-acetylcysteine (NAC) for 2 days at 16 C. at 0.1 mg/ml final concentration without shaking. The culture was then pelleted at 4400 rpm and washed with 0.9% NaCl containing 8 mM EDTA. The cell pellet was resuspended in 0.5 M sucrose and incubated for 60 minutes at room temperature (RT) with slow shaking at 85 rpm. Cells were then centrifuged and resuspended in 40 ml of a solution containing 50 mM Tris pH 8.0, 10 mM EDTA pH 8.0, 4% sucrose, and 20-40 g/ml lysozyme. After incubation at RT for 10-15 minutes, cells were centrifuged and washed three times using different washing solutions, namely i) with 30 mM Tris containing 4% sucrose and 1 mM EDTA, ii) with 100 mM Tris containing 2% sucrose and iii) with BG-11 medium. All centrifugation steps before the lysozyme treatment were performed at 4400 rpm for 10 min at 10 C., all centrifugations after the lysozyme treatment were performed at 2400 rpm for 5 minutes at 4 C. The cells were then resuspended in 400 l BG-11 culture medium containing Tris/sucrose buffer and used for gene transfer via conjugation.

[0287] Triparental mating was performed as follows. E. coli strain J53 bearing a conjugative RP4 plasmid and E. coli strain HB101 bearing the plasmid cargo to be introduced into Cyanobacterium sp. PTA-13311 and the pRL528 helper plasmid for in vivo methylation were used. E. coli strains were grown in LB broth supplemented with the appropriate antibiotics overnight at 37 C. with shaking at 100 rpm. An aliquot of 3 to 5 ml of each culture was centrifuged, washed twice with LB medium and resuspended in 200 L LB medium. Subsequently, the E. coli strains were mixed, centrifuged and resuspended in 100 L BG-11 medium. A 100 L aliquot of the resuspended cyanobacterial cells and the E. coli cultures were mixed and applied onto a membrane filter (Millipore GVWP, 0.22 m pore size) placed on the surface of solid BG-11 medium supplemented with 5% LB. Petri dishes were incubated under dim light of 5 mol photons m.sup.2s.sup.1 for two days. Cells were then resuspended in fresh BG-11 medium and plated onto selective medium containing 10 and 15 g/ml kanamycin, respectively. The following selection conditions were used: light intensity approximately 20-40 mol photons m.sup.2s.sup.1 at a temperature of approximately 28 C. Transformants were visible after approximately 10-14 days. The transformant colonies were then plated on BG-11 medium containing 15 g/ml kanamycin and then stepwise transferred to higher kanamycin concentrations up to kanamycin 60 g/ml to aid in the selection process.

Example 11

Characterization of the New Phosphite-Utilizing Cyanobacterial Host Cells

[0288] The new phosphite utilization strain AB0766, containing the phosphite dehydrogenase gene from Ralstonia sp. strain 4506, and the phosphite uptake genes ptxABC from Cyanothece sp. ATCC-51142, codon optimized for optimal expression in Cyanobacterium sp. PTA-13311, was tested to confirm that the modified strain was capable of utilizing phosphite. Both strains were also modified to contain an ethanologenic (pdc/adh) construct.

[0289] The cultures were grown in triplicates over a 24 day period in 1.2 L indoor photobioreactors, under a 12 hour on/12 hour off light cycle, essentially following the culture method of Example 2, above. Cell density (OD.sub.750), chlorophyll, and ethanol production were measured periodically. At day 10, additional nutrients and phosphorus (as PO.sub.4 or PO.sub.3) were added to the culture.

[0290] As shown in FIG. 14A, the cell growth measurements were similar between the phosphite utilization strain grown on phosphite (AB0766) and a control strain (AB0250) grown on phosphate. The chlorophyll levels and ethanol production were also comparable between the phosphite utilizer strain (AB0766) and the phosphate utilizer strain (AB250) (FIG. 14B). Lastly, the ethanol production (% v/v) was also similar between the two strains (FIG. 14C).

[0291] Thus, cyanobacterial cells that are not able to grow on phosphite can be modified with phosphite uptake and utilization genes from other organisms. As demonstrated here, the modified cells have a similar growth rate, chlorophyll content, and ethanol production as ethanologenic cyanobacterial cells that are grown on phosphate.

Example 12

The New Phosphite-Utilizing Cyanobacterial Strains Can Switch Between Utilization of Phosphate and Phosphite

[0292] The new phosphite utilization strains are capable of utilizing both phosphate and phosphite. As shown in the above experiments, cell growth rates and ethanol production levels were similar when the new strains are fed either phosphate or phosphite as the sole source of phosphorus. Because the new strains can utilize both sources of phosphorus, the modified host cell cultures can also switch back and forth between the use of phosphate and phosphite, without sacrificing production levels. Since many contaminating organisms are unable to utilize both phosphorus sources efficiently, switching back and forth between phosphate and phosphite as the sole phosphorus source is useful for contamination control.

[0293] To demonstrate the phosphorus source switching capability, and to see whether these changes affect ethanol production, the cultures were grown on one phosphorus source first, then diluted and switched to the other phosphorus source. Additionally, a one-time, bulk feeding of the phosphorus source at the beginning of the run was compared with the feeding of smaller intermittent doses of phosphorus over time.

[0294] The following copper-regulatable ethanologenic strains with the indicated phosphite gene modifications were used: Control strain was AB0012: (Porf0316-pdc(AB1opt1)-TdsrA-PcpcB-adh111 (AB1opt)-TrbcS). The phosphite utilization strain was AB0701 (Porf0316- pdc(AB1opt1)-TdsrA-PcpcB-adh111 (AB1opt)-TrbcS-PpstS-ptxDR4506His-IScpcBA-ptxABC2104-Toop-).

[0295] The cells were inoculated at an initial cell density of 0.2 OD.sub.750 in 500-mL vertical photobioreactors with 350 mL culture medium (1 NWW+BG-11-P-free+17 mM Nitrate+P-source).

[0296] The photobioreactors receiving an intermittent dose of P-source were fed as follows: the cultures received 35 M P-source at inoculation, and at every increase of 1.0 OD.sub.750, starting at 1.0 OD.sub.750. The photobioreactor cultures that received a bulk dose of P-source at the beginning of the culture were given 230 M of the indicated P-source.

[0297] Copper induction of ethanologenesis was initiated when cell density reached approximately 1 OD.sub.750 by addition of 0.85 M CuSO.sub.4 per OD.sub.750. The light was set at approximately 350 mol photons m.sup.2s.sup.1 on one side, with a 12 hour/12 hour photoperiod. The cultures were given continuous aeration with 25 SCCM inflow, and CO.sub.2 was added at a constant rate, from 1-6% ramped manually during the light period with 0.25% during the dark period. The cultures were grown for 41 days, with one 20 dilution to new medium at day 20.

[0298] At day 20, the cells were diluted 20-fold in culture medium, with the phosphorus source switched as indicated in FIG. 15.

[0299] Empty square: control strain AB0012 (not capable of utilizing phosphite).

[0300] Grey circle: phosphite-utilizing strain AB0701, grown on phosphite for the first 19 days, then grown in new medium, again with phosphite.

[0301] Grey triangle: phosphite-utilizing strain AB0701, grown on phosphate for the first 19 days, then switched to phosphite.

[0302] Black circle: phosphite-utilizing strain AB0701, grown on phosphite for the first 19 days, then switched to phosphate.

[0303] The graph shows that the cells were able to produce comparable amounts of ethanol when they were switched to a different phosphorus source (either phosphite to phosphate or phosphate to phosphite). Thus, either phosphate or phosphite can be used as needed, and the phosphorus source can be switched from one to another without affecting ethanol production.

Example 13

Contaminating Bacteria Have a Lower Cell Density When the Cyanobacterial Culture is Grown on Phosphite

[0304] Previous research found that outdoor cultivated ethanologenic cyanobacterial cultures often became contaminated with bacterial species such as Alcanivorax. To determine whether the new phosphite-utilizing cyanobacterial strains would have an advantage over the wild type phosphate utilizing cyanobacteria when grown in a non-axenic culture, the following experiment was performed in 1.2 L vertical photobioreactors using a 12/12 hour light cycle essentially following the method described in Example 2. The non-ethanologenic phosphite utilizing strain AB0493 was spiked with the common heterotrophic bacterial contaminant Alcanivorax to mimic outdoor contaminated growth conditions. Alcanivorax grew poorly when phosphite was the sole phosphorus source, in comparison to phosphate (FIG. 16). This graph demonstrates that the phosphite-utilizing cyanobacterial strains are less likely to become highly contaminated in outdoor production cultures.

Example 14

Contaminating Bacteria are Less Able to Consume Spiked Ethanol When the Phosphorus Source is Phosphite

[0305] In addition to the problem of rapid growth of certain bacterial contaminants such as Alcanivorax in the cyanobacterial production cultures, these contaminants can also consume most or even all of the ethanol that is produced by the ethanologenic cyanobacterial cultures. To test whether this would also be the case when phosphite was used as the sole phosphorus source instead of phosphate, an amount of ethanol was added (spiked) at day 0 and day 8 to the combined cyanobacteria and Alcanivorax culture (the mixed culture of non-ethanologenic phosphite utilizing strain AB0493 and Alcanivorax as described in the above experiment). The ethanol levels were then measured throughout the culture run. It was found that ethanol consumption by Alcanivorax was significantly lowered when the phosphorus source was phosphite rather than phosphate (FIG. 17).

Example 15

Characterization of Artificially Contaminated Ethanologenic, Phosphite-Utilizing Cyanobacterial Cultures

[0306] The following several experiments were performed to determine whether cells cultured on phosphite would produce comparable amounts of ethanol as when grown on phosphate alone, as well as what effect the phosphite system has on contaminants.

[0307] For this series of experiments (FIG. 18A-FIG. 20B), a different phosphite-utilizing strain was used. The cyanobacterial strain AB0701 (Porf0316-pdc (AB1opt1)-TdsrA-PcpcB-adh111 (AB1opt)-TrbcS-PpstS-ptxDR4506His-IScpcBA-ptxABC2104-Toop-), contained ethanologenic genes under the regulation of a copper-inducible promoter, as well as phosphite utilization genes. The strain was grown in vertical photobioreactors in mBG-11 medium (with BG-11 nutrients, but free of P, N, and Cu), with the addition of 17 mM nitrate, 25 M phosphite or phosphate. As the culture grew, the following nutrients were added intermittently: 35 M phosphate (as phosphoric acid) or phosphite (as phosphorous acid) with 0.85 uM Copper per OD.sub.750. The cultures had a starting inoculation density of 0.3 OD.sub.750. The cultures received light in a 12 hour on/12 hour off cycle, at 300 mol photons m.sup.2s.sup.1, with a temperature of approximately 32 C.

[0308] To mimic the longer-term culture growth in outdoor large-scale, commercial systems, the cultures were grown in two semi-continuous batches. The treatments were run in duplicates, with the results of each treatment shown (FIG. 18A-FIG. 20B). After a 14 day first batch, the culture was harvested, and a portion of the culture was diluted into new medium at a starting cell density of 0.3 OD.sub.750. In some of the cultures, the phosphorus source was switched (phosphate or phosphite) during the second batch to determine the effect of the phosphorus-source switch on ethanol levels, contamination levels, and ethanol consumption by contaminants.

Example 16

Phosphate Control: Some Common Contaminating Bacteria Consume the Ethanol Produced by the Cyanobacterial Cultures

[0309] The AB701 cultures (growing in phosphate as the sole source of phosphorus) were spiked with either the contaminant bacteria Alcanivorax or spiked with a mixture of contaminating bacteria, and the cultures were analyzed intermittently for cell density and ethanol production.

[0310] The cyanobacterial cell growth (as measured by OD.sub.750) was not affected by the contamination (FIG. 18A).

[0311] However, ethanol production was affected by the presence of the contaminants (FIG. 18B). The ethanol production dropped as compared to the axenic controls. When the cultures were harvested and re-suspended at a low density in new medium at day 14 (to mimic outdoor production procedures), the ethanol yield decreased, in part due to consumption by the contaminant bacteria. Thus, when cultures were grown solely on phosphate for both first and second batches, the contaminants could grow easily and they consumed a considerable amount of ethanol.

Example 17

Growth of the Cyanobacterial Cultures on Phosphite as the Sole Phosphorus Source Yields More Ethanol Over Time, and With Less Ethanol Consumption by Contaminating Bacteria

[0312] In another experiment, the AB701 phosphite-utilizing cultures, growing in phosphite as the sole source of phosphorus, were spiked with either the contaminant bacteria Alcanivorax or spiked with a mixture of contaminating bacteria, and the cultures were analyzed intermittently for cell density and ethanol production. The cultures were grown for 14 days, and were then harvested and re-suspended at a low density in new medium at day 14 to produce a second batch (again, to mimic outdoor production procedures) (FIG. 19A; FIG. 19B).

[0313] When the phosphite-utilizing cyanobacterial strains were grown with phosphite as the only phosphorus source, ethanol yields (FIG. 19B) were higher than with the phosphate-fed cultures (FIG. 18B; see Example 16). This was particularly noticeable at the end of the second batch. Further, the cultures grown in phosphite had a 10-fold lower CFU (colony forming units) count of contaminating bacteria (data not shown). Although the ethanol consumption was lessened when phosphite was the phosphorus source rather than phosphate, some ethanol was still consumed, particularly when the contaminant was Alcanivorax (FIG. 19B, grey triangle).

[0314] As can be seen by the ethanol production graph (FIG. 19B), the use of phosphite can increase the amount of ethanol that accumulates in the cultures, and can also increase the amount of time that the culture is capable of yielding a high level of ethanol production.

Example 18

P-Source Switching: Phosphate to Phosphite Switching

[0315] Because the modified cyanobacterial strains described herein can utilize two sources of phosphorous, being able to switch from one source to another during the course of a long culture run in an outdoor, non-axenic environment may allow the modified cyanobacterial strains to better out-compete contaminating organisms that have accumulated in the culture. This possibility was tested by the following two experiments.

[0316] In one experiment, cultures of the modified cyanobacterial cells (with both phosphite and phosphate utilization capabilities) that were either axenic, treated with Alcanivorax alone, or treated with a mixture of contaminants (contaminant mix) were grown with phosphate as the sole phosphorus source for the first 14 days. The cells were then harvested and re-inoculated into new medium, switching to phosphite as the sole phosphorus source for the remainder of the culture run. Optical density and ethanol levels in the culture were measured.

[0317] As shown in FIG. 20A, the cyanobacterial cell density of the phosphate (1.sup.st batch) and phosphite (2.sup.nd Batch) cultures was similar, whether axenic or non-axenic. However, the ethanol levels of the second batch grown on phosphite (FIG. 20B) differed from the batch grown on phosphate both before and after dilution (FIG. 18B). Axenic cultures accumulated, as expected, the most ethanol during the first batch. During the second batch, when the system was switched to phosphite, while the axenic cultures again generally accumulated higher ethanol levels, some ethanol also accumulated even in the contaminated batches. This ethanol accumulation was higher than in cultures that remained on phosphate after dilution (FIG. 18B). Thus, switching from one phosphorus source to another, particularly when the contamination level rises, can, in some cases, result in a lessening of contamination that gives rise to a lower ethanol yield.

Example 19

Improved Genetic Stability of the Plasmid Containing the Phosphite Utilization Genes

[0318] It was also found that ethanologenic cyanobacterial cells having the phosphite utilization genes on the same plasmid as the ethanologenic genes had a greater genetic stability of the ethanologenic genes over the length of a culture run, in comparison to cells growing on phosphate.

[0319] A cyanobacterial culture containing a plasmid having both the ethanologenic genes and genes for the utilization of phosphite was induced for ethanol production and grown for 20 days on either phosphate or phosphite as the sole P source in the medium. At day 20, the cells were re-diluted in new medium, where the P source was either switched or remained the same. At day 40, samples were taken to test for the percentage of cells that had spontaneously lost at least a portion of the ethanol production gene cassette, presumably due to the stress that ethanol production exerts on the cell. A control cell culture (without the presence of phosphite-utilization genes), growing on phosphate for the 40 day period, had approximately 8.6-fold higher reversion rates than phosphite-utilizing cells grown on phosphite for the same amount of time, as measured by the presence of the ethanologenic enzyme Pdc in the culture cells (Table 9, below). Thus, it is possible that plasmid stability may increase in cells having the phosphite-utilizing genes, when these cells are grown on phosphite as the sole phosphorus source.

TABLE-US-00010 TABLE 9 Plasmid Stability Fold lower reversion of production gene at day 40 P Treatment (first batch - 14 days/second (in comparison to batch - 9 days) phosphate/phosphate) Phosphate/Phosphate Control Phosphite/Phosphite 8.6 lower reversion Phosphate/Phosphite 2.2 lower reversion Phosphite/Phosphate 2.6 lower reversion

[0320] The phosphite utilization genes on the plasmid may have created a selection pressure for the entire plasmid carrying the genes to remain in the cell, as long as phosphite was substantially the only P source. Cells that lost the plasmid (or the phosphite-utilization genes) would not be able to survive on phosphite. Thus, similar to the effect of antibiotic resistance genes on a plasmid, the system allowed the plasmids to be maintained in the cell, improving ethanol production and increasing the time that ethanol can be effectively produced in a culture.

Example 20

Co-localizing Product-production Genes with Phosphite Utilization Genes on the Same Operon to Increase Long Term Genetic Stability of Product Production

[0321] The presence of the phosphite dehydrogenase gene on the same operon (of a plasmid or on the chromosomal DNA) as the production gene may also improve productivity, by forcing the cell to keep the production gene in order to keep the phosphite dehydrogenase gene when the culture is grown on phosphite. This is demonstrated by combining ethanologenic production genes with a phosphite dehydrogenase gene on an extrachromosomal plasmid.

[0322] The following two constructs are prepared and transformed into Cyanobacterium sp. PTA-13311: [0323] 1) pAB1_6.8:: PnirA*2-pdc(AB1opt1)-IScpcBA*1-ptxDR45o6-TdsrA-PcpcB-adh111(AB1opt2)-TB0011-PpstS-pstABC.sub.ABCC2104-TrbcS-FRT [0324] 2) pAB1_6.8:: Porf0316-pdc(AB1opt1)-IScpcBA*1-ptxDR45o6-TdsrA-PcpcB-adh111(AB1opt2)-TB0011-PpstS-pstABC.sub.ABCC2104-TrbcS-FRT

[0325] Both of the above constructs are based on the endogenous parent plasmid pAB1_6.8, which is endogenous to Cyanobacterium sp. PTA-13311. Both constructs have a phosphite dehydrogenase gene, several other phosphite transport-related genes, and the ethanologenic genes pdc and adh.

[0326] The phosphite dehydrogenase gene is located on the same operon as the ethanologenic pdc gene, both controlled by an inducible promoter that is located upstream of the pdc gene. The first construct has a nitrate-inducible promoter PnirA*2. The second construct has a copper-inducible promoter Porf0316. The adh gene is constitutively expressed. The remaining phosphite utilization genes are located elsewhere on the plasmid.

[0327] The constructs are transformed to Cyanobacterium sp. PTA-13311. Once the transformation is confirmed, the cultures are scaled-up on culture medium with phosphate as the P source. Once the production phase is reached, expression of the pdc and ptxD genes is initiated by adding the specific inducing agent (nitrate or copper). As the culture progresses, the culture is fed with phosphite as the P source.

[0328] By use of this method, the single operon configuration allows for more ethanol to be produced over time, with a lower proportion of cells with an inactivated pdc gene, because the deletion/inactivation of the pdc gene would be likely to also inactivate the ptxD gene, and cells without the ptxD gene would not survive and thrive in phosphite medium. Further, the use of phosphite as the main P source decreases the amount of contamination with bacterial heterotrophs, resulting in less ethanol loss over time, and thus more final ethanol, in comparison to an ethanologenic culture growing on phosphate, or a culture having an ethanologenic construct where the phosphite dehydrogenase gene and pdc gene are not linked to the same promoter.

Example 21

Less Bacterial Contamination When Phosphite is the Phosphorus Source

[0329] To determine whether the use of phosphite instead of phosphate can lower bacterial contamination of the cultures, some of the above-described contaminated cultures were sampled for CFU of bacterial cells. In general, it was found that the phosphite-grown cultures had much lower contaminant cell counts than the phosphate-grown cultures (FIG. 21A). Thus, contamination can be lowered by using phosphite rather than phosphate as the phosphorus source in the medium.

[0330] Furthermore, P-source switching at culture dilution from phosphate to phosphite, results in lower bacterial abundance than continuing to deliver phosphate or when switching from phosphite to phosphate (FIG. 21B). This demonstrates the benefit of lower contaminant abundance when the phosphorous source is switched to phosphite between batchesthe contaminants that thrive on phosphate may not, in many cases, be able to thrive on phosphite.

Example 22

Growth Cultures of Cyanobacterial Cells Having Both 1) the Phosphite Utilization Genes and 2) a Knockout of the P Regulatory Gene phoU Have Less Bacterial Contamination

[0331] It was found that cultures of phosphite-utilizing strains, when growing on phosphite as the only added P source, still had a residual amount of phosphate in the medium. This situation could exist, for example, due to cell leakage or cell death, or carry-over from previous growth medium. This residual amount, even if small compared to the amount of phosphite in the culture medium, could still be enough for contaminating organisms to proliferate.

[0332] The following experiment was performed with ethanologenic cyanobacterial cells having a knockout of the phosphate metabolism regulatory gene phoU (orf0666) (see, for example, Burut-Archanai et al., (2013), Biochem. Engineering Jour. 74: 69-75; and Morohoshi et al., (2002), Appl. Envir. Microbiol. 68: 4107-4110), to see if there was a P uptake advantage over non-modified cells when a residual amount of phosphate was present in a culture medium in addition to phosphite. The strain also contained a gene cassette of the phosphite utilization genes, so the experiment was also performed to determine whether the modified host cells would produce comparable amounts of ethanol as when grown on phosphite alone as compared to phosphate. Further, the effect that the phosphite/phoU knock-out system has on contaminants was compared with cultures grown on phosphite and phosphate.

[0333] For this set of experiments, a different phosphite utilizing strain was used. The cyanobacterial strain AB0793 (AB1_orf666; pAB1-6.8:: PnirA*2-pdc(AB1opt1)-TdsrA-PcpcB-ADH111(AB1opt)-TrbcS-Porf0316-ptxDR4506(AB1opt)-His6-IScpcBA-ptxA2104(AB1opt)-IScpcBA*1-ptxB2104(AB1opt)-ISpsaAB-ptxC2104(AB1opt)-TB0011), containing the nitrate-inducible ethanologenic genes, and phosphite utilization genes, was grown in vertical photobioreactors in mBG-11 medium (with BG-11 nutrients, but free of P and N), with the addition of 17 mM nitrate, 25 M PO.sub.3 (as phosphorous acid) or PO.sub.4 (as phosphoric acid). As the culture grew, the following nutrients were added intermittently: 35 M PO.sub.4 (as phosphoric acid) or PO.sub.3 (as phosphorous acid) per OD.sub.750. The cultures had a starting inoculation density of 0.2 OD.sub.750. The cultures received light in a 12 hour on/12 hour off cycle, at 350 mol photons m.sup.2s.sup.1, with a temperature of approximately 32 C. The treatments were run in duplicates, with the average of the treatments shown in FIG. 22A, 22B, and 22C.

[0334] As shown in FIG. 22A, the cell density was slightly higher with the phosphate-grown cultures.

[0335] Axenic phosphite-grown cultures yield slightly more ethanol than the axenic phosphate-grown cultures. With the contaminated cultures, the results were more pronounced, however: when the phosphite-utilizing strain AB0793 was grown with phosphite as the only phosphorus source in the presence of contaminants, ethanol yields (FIG. 22B) were higher than with the phosphate-fed contaminated cultures.

[0336] Further, the cultures grown in phosphite had up to 15-fold lower abundance of contaminating bacteria (based on CFU counts). However, the presence of contaminants did result in some consumption of much of the ethanol present, even with phosphite as the sole phosphorus source.

[0337] As can be seen by the ethanol production graph (FIG. 22B), the use of phosphite instead of phosphate can increase the amount of ethanol that accumulates in the cultures, and can increase the amount of time that the culture is capable of yielding a high level of ethanol.

Example 23

Transformation of Synechococcus sp. with the Phosphite Utilization Genes

[0338] As a prophetic example, Synechococcus sp. PCC 7002 is transformed with the ptxD and ptxA,B,C genes from Ralstonia, harbored in a modified endogenous pAQ1 plasmid from Synechococcus sp. PCC 7002. The same plasmid also contains the pdc/adh ethanologenic cassette. The cells are screened for full segregation of the pAQ1 plasmid, and cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria. Ethanol is produced and harvested from the cultures after two to six weeks of growth. A small amount of the culture is retained in the photobioreactor, and new phosphite-containing culture medium is added. The culture grows for another two to six weeks to produce ethanol. At the end of the run, the ethanol is harvested and processed for biofuel. The remaining biomass from both runs is collected and sold to be processed for biofuel production, animal feed, or other purposes.

Example 24

Transformation of Synechocystis sp. PCC 6803 with an Isoprene Production Gene and Phosphite Utilization Genes

[0339] As another prophetic example, Synechocystis sp. PCC 6803 is transformed with the ptxD gene from Ralstonia, as well as the phosphite transporter genes from Desulfotignum phosphitoxidans. The genes are placed on the self replicating plasmid pVZ321. Another plasmid is used to carry an ispS gene for the production of isoprene, regulated by an inducible promoter. The cultures are then scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria and fungi. When the inducing agent is added, isoprene accumulates in the culture, and is harvested from the culture after about ten weeks of growth.

Example 25

Anabaena sp. Host Cells Having Phosphite Utilization Genes and Genes for the Production of 1,3-Propanediol

[0340] As a prophetic example, a strain of Anabaena sp. is transformed with a gene encoding PtxD (WP_046983515.1) from Delftia lacustris, and phosphite transporter genes from Nostoc sp. PCC 7120, all harbored in a plasmid modified to additionally contain genes for 1,3-propanediol production, as described in PCT/US2013/065574, which is incorporated by reference herein in its entirety. The cells are screened for full segregation of the plasmid. The resulting cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria. 1,3-propanediol is produced and harvested from the cultures after two to six weeks of growth. Approximately 1% of the culture is retained in the photobioreactor, and new phosphite-containing medium is added. The culture grows for another two to six weeks to produce more 1,3-propanediol. This growth and harvest cycle is repeated as many times as desired. At the end of each run, the 1,3-propanediol is harvested and processed. The remaining biomass is collected and sold for biofuel production, animal feed, or other purposes.

Example 26

Synechocystis sp. Host Cells Having Phosphite Utilization Genes and and Genes for the Production of 1,2-Propanediol

[0341] As a prophetic example, Synechocystis sp. PCC 6803_is transformed with a gene encoding PtxD (WP_044432324.1 from Acinetobacter), as well as phosphite transporter genes from Trichodesmium erythraeum. A separate plasmid is used to harbor genes for 1,2-propanediol production, as described in PCT/US2013/65568, which is incorporated by reference herein in its entirety. The cells are screened for full segregation of the plasmid, and cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria. 1,2-propanediol is produced and harvested from the cultures after two to six weeks of growth. A small amount of the culture is retained in the photobioreactor, and new phosphite-containing medium is added. The culture grows for another two to six weeks to produce more 1,2-propanediol. At the end of the run, the 1,2-propanediol is harvested and processed. The remaining biomass (from both runs) is collected and sold for biofuel production, animal feed, or other purposes.

Example 27

Synechococcus sp. Host Cells with Phosphite Utilization Genes and Ethanol Production Genes

[0342] As a prophetic example, Synechococcus sp. PCC 7002 is transformed with a gene encoding PtxD (WP_046983515.1) from Delftia lacustris, as well as phosphite transporter genes from Nostoc punctiforme, all harbored in a plasmid modified to additionally contain an operon having a regulatable promoter, a gene encoding Pdc and a gene encoding Adh for the production of ethanol. The cells are screened for full segregation of the plasmid, and cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria. Ethanol is produced and harvested from the cultures after about 30 days of growth. A small amount of the culture is retained in the photobioreactor, and new phosphite-containing medium is added. The culture grows for another 30 days to produce more ethanol. By use of this method, less contamination occurs in comparison to similar Synechococcus sp. PCC 7002 host cells, but lacking the phosphite utilization genes, and growing on phosphate.

Example 28

Spirulina sp. Host Cells with Phosphite Utilization Genes

[0343] As a prophetic example, a Spirulina strain is transformed with a gene encoding PtxD (WP_011610233.1) from Trichodesmium erythraeum, as well as phosphite transporter genes from Cyanothece sp. CCY0110. The cells are screened for full segregation of the plasmid, and cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and are capable of out-competing contaminating bacteria. After 2 weeks of growth, the culture is harvested for biomass. About 10% of the culture is retained in the photobioreactor, and new phosphite-containing medium is added. The culture grows for another 2 weeks, and is again harvested for biomass. The process is repeated as needed. By use of this method, less contamination occurs in comparison to similar Spirulina host cells, but lacking the phosphite utilization genes, growing on phosphate. By use of this method, the culture can remain viable, with less contamination over time, than similar Spirulina cultures not having the phosphite utilization genes.

Example 29

Synechococcus elongatus PCC 7942 Host Cells with Phosphite Utilization Genes, and a PhoU Homolog Knock-out

[0344] As a prophetic example, the genome of a Synechococcus elongatus PCC 7942 strain is examined to find a homolog to the phoU gene (phosphate regulation). The gene is removed from the strain, using knock-out methods known in the art. The strain is then transformed with a plasmid containing genes encoding PtxD (WP_011610233.1) from Trichodesmium erythraeum, and phosphite transporter genes from Cyanothece sp. ATCC 51142 (see Table 2). The cells are screened for full segregation of the plasmid, and cultures are scaled up for outdoor testing. The cells are capable of utilizing phosphite, and because of the additional knock-out of the phoU homolog gene, the cells can more readily take up any phosphate that occurs in the culture. Thus, the new strain is capable of out-competing contaminating bacteria. After two weeks of growth, the culture is harvested for biomass. About 10% of the culture is retained in the photobioreactor, and new phosphite-containing medium is added. The culture grows for another two weeks, and is again harvested for biomass. The process is repeated as needed. By use of this method, the culture can remain viable, with less contamination over time, than similar Synechococcus sp. PCC 7942 cultures not having the phosphite utilization genes and not having the knockout of the gene encoding the phoU homolog.

Example 30

Determination of Ethanol Production using Headspace Gas Chromatography with Flame Ionization Detection

[0345] The concentration of ethanol was determined by gas chromatography using a 0.32 mm by 30 m DB-ALC1 GC capillary column having a film thickness of 1.80 m, using flame ionization detection on an Agilent Gas Chromatograph (Agilent Technologies, model # 7890A) configured with a headspace sampler (Agilent Technologies, model #7697A). The method followed the manufacturer's instructions for blood alcohol quantitation (Agilent application note #5990-9021EN, entitled Analysis of Ethanol in Blood with the Agilent 7820A GC and 7697A headspace sampler. The samples were heated to 85 C. for 15 minutes. The N.sub.2 column flow was 12 ml/minute. The analyte concentration of each sample was determined by application of a 1/x.sup.2 weighted least squares linear calibration model to the measured response of each analyte.

[0346] Calibration method: The calibration model was generated by fitting the detector response of calibration standards to their known, or true, concentration. The calibration standards were prepared in volumetric glassware from ACS reagent grade (minimum 99.5% purity) ethanol and acetaldehyde at levels of 0.001, 0.01, 0.1, and 1.0% v/v. Since a sample matrix can affect analyte response, care was taken to ensure that calibration standards were prepared in an identical media/matrix as were the samples to be analyzed. Calibration was performed each time a sample set was analyzed, as was the confirmatory analysis of third-party certified reference materials. By use of this method, ethanol levels could be quantitated within the range of 0.001% - 1.0% v/v within about 15% accuracy, as confirmed by analysis of third-party certified standard reference materials.

[0347] Although the present invention has been described in considerable detail with reference to certain embodiments thereof, other embodiments are possible. Therefore, the spirit and scope of the appended claims should not be limited to the description of the embodiments contained therein.