Gene vector
09951328 ยท 2018-04-24
Assignee
Inventors
Cpc classification
C12N15/111
CHEMISTRY; METALLURGY
C12N2320/32
CHEMISTRY; METALLURGY
C12N2310/51
CHEMISTRY; METALLURGY
A61P7/00
HUMAN NECESSITIES
A61K48/00
HUMAN NECESSITIES
C12N2799/027
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/63
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A gene vector for use in gene therapy comprising at least one miRNA sequence target operably linked to a nucleotide sequence having a corresponding miRNA in a hematopoietic progenitor cell (HSPC) or hematopoietic stem cell (HSC) which prevents or reduces expression of the nucleotide sequence in a HSPC or HSC but not in a differentiated cell.
Claims
1. A method of regulating expression of a transgene comprising delivering a gene vector to a haematopoietic stem or progenitor cell, wherein the gene vector comprises at least one mir-126 and/or mir-130a target sequence operably linked to the transgene, wherein the transgene encodes interferon-alpha, lysosomal enzyme galactocerebrosidase or gp91 phox, and wherein expression of the transgene is prevented or reduced in the haematopoietic stem or progenitor cell but not in a differentiated cell.
2. The method of claim 1, wherein the gene vector comprises at least one mir-126 target sequence and at least one mir-130a target sequence.
3. The method of claim 2, wherein the gene vector comprises twice as many copies of the mir-130a target sequence as copies of the mir-126 target sequence.
4. The method of claim 1, wherein the gene vector is a viral vector.
5. The method of claim 1, wherein the gene vector is derivable from a lentivirus.
6. The method of claim 1, wherein the gene vector comprises a tissue-specific promoter.
7. The method of claim 6, wherein the tissue-specific promoter promotes expression in cells of the myeloid lineage.
8. The method of claim 6, wherein the tissue-specific promoter is selected from the group consisting of CD11 b, c-Fes, CYBB and TEK.
9. The method of claim 1, wherein the transgene encodes interferon-alpha, and wherein the gene vector comprises a TEK promoter operably linked to the transgene.
10. The method of claim 1, wherein the method is for increasing the chances of survival of the haematopoietic stem or progenitor cell in relation to gene therapy.
11. The method of claim 1, wherein the method is for preventing apoptosis of the haematopoietic stem or progenitor cell, whereby the apoptosis is caused by expression of the transgene.
12. The method of claim 1, wherein the method is for haematopoietic cell therapy.
Description
DESCRIPTION OF THE FIGURES
(1) The present invention will be described further, by way of example only, with reference to preferred embodiments thereof as illustrated in the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25) The indicated LVs (A) were used to transduce murine and human HSPC obtained from Galc/ (/) and wild type (+/+) mice, as well as cord blood (CB) and bone marrow (BM) from normal donors, respectively. GALC activity (B) and vector copy number (VCN) (C) were measured in the in vitro culture progeny of the transduced murine (top panels) and human (bottom panels) HSPC (pooled data from / and +/+ HSPC are shown in top panel C). (D) The number (#) of colonies retrieved from clonogenic assays (CFC) performed at the end of transduction with the indicated LV on murine / (top panel) and human (bottom panel) HSPC is reported. (E) TUNEL assay was performed two days after transduction with the indicated LV on murine / HSPC (top panel) and CD34.sup.+ cells from normal donors' CB and BM (bottom panel). The frequency of apoptosis among transduced cells was assessed (% TUNEL.sup.+ cells). Each dot represents an individual sample (B-E). In E, 8 fields and 100 cells were counted for each sample. *:p<0.05**: p<0.01; ***: p<0.001. (F) Representative TUNEL staining on GFP LV- and GALC LV-transduced HSPC is shown.
(26) Magnification 100.
(27)
(28) MicroRNAs (miRNAs)
(29) It has long been a central dogma of biology that genetic information flows from DNA to mRNA to protein. In other words, it has been assumed that genes code for proteins, and that proteins fulfil all cellular functions, including the regulation of gene expression programs. However, only a minority of RNA transcripts (2-3%) code for proteins in higher eukaryotes, calling into question the central dogma that proteins are the only effectors of cell function (Mercer et al., 2009). In fact, there is now emerging evidence that a class of non-coding small RNAs, called microRNAs, fulfil a fundamental role in the regulation of gene expression. MicroRNAs (miRNAs) are (Biffi et al., 2004; Sadelain M., 2006; Sadelain et al., 2005; Gaziev et al., 2005; Yesilipek M A., 2006; Abonour et al., 2000) nucleotide long, non-coding RNAs that negatively regulate gene expression at the post-transcriptional level by triggering a process called RNA interference (RNAi, see below) (Bartel D P., 2004). MicroRNAs were first discovered in Caenorhabditis elegans in the form of lin-4 and let-7, and they were shown to regulate the timing of larval development. (Lee et al., 1993; Reinhart et al., 2000). This finding led to the search for similar non-coding RNAs controlling gene expression in higher eukaryotes. The discovery that all organisms express miRNAs, many of which are phylogenetically conserved across species, has been conceived as a revolution in the field of biology. According to the reference microRNA database (http://microma.sanger.ac.uld) 695 different miRNAs have been identified in humans at the time of writing. MicroRNAs have been implicated in almost all biological processes, including development, differentiation, proliferation and apoptosis (Xiao and Rajewsky, 2009). They also play important roles in diseases such as cancer, heart failure and metabolic disorders (Xiao et al., 2009; Divaka et al., 2008; Krutzfeldt et al., 2006).
(30) MicroRNA genes are scattered across all human chromosomes, except for the Y chromosome. They can be either located in non-coding regions of the genome or within introns of protein-coding genes. Around 50% of miRNAs appear in clusters which are transcribed as polycistronic primary transcripts (Lagos-Quintana et al., 2003). Similar to protein-coding genes, miRNAs are usually transcribed from polymerase-II promoters, generating a so-called primary miRNA transcript (pri-miRNA). This pri-miRNA is then processed through a series of endonucleolytic cleavage steps, performed by two enzymes belonging to the RNAse Type III family, Drosha and Dicer. From the pri-miRNA, a stem loop of about 60 nucleotides in length, called mima precursor (pre-mirna), is excised by a specific nuclear complex, composed of Drosha and DiGeorge syndrome critical region gene (DGCR8), which crops both strands near the base of the primary stem loop and leaves a 5 phosphate and a 2 bp long, 3 overhang. The pre-mirna is then actively transported from the nucleus to the cytoplasm by RAN-GTP and Exportin(Yi et al., 2003; Lund et al., 2004). Then, Dicer performs a double strand cut at the end of the stem loop not defined by the Drosha cut, generating a 19-24 bp duplex, which is composed of the mature miRNA and the opposite strand of the duplex, called miRNA* (Bartel D P., 2004). In agreement with the thermodynamic asymmetry rule, only one strand of the duplex is selectively loaded into the RNA-induced silencing complex (RISC), and accumulates as the mature microRNA. This strand is usually the one whose 5end is less tightly paired to its complement, as was demonstrated by single-nucleotide mismatches introduced into the 5end of each strand of siRNA duplexes (Tomari et al., 2005). However, there are some miRNAs that support accumulation of both duplex strands to similar extent (Schwarz et al., 2003).
(31) MicroRNAs trigger RNAi, very much like small interfering RNAs (siRNA) which are extensively being used for experimental gene knockdown. The main difference between miRNA and siRNA is their biogenesis. Once loaded into RISC, the guide strand of the small RNA molecule interacts with mRNA target sequences preferentially found in the 3 untranslated region (3UTR) of protein-coding genes. It has been shown that nucleotides 2-8 counted from the 5end of the miRNA, the so-called seed sequence, are essential for triggering RNAi (Brennecke et al., 2005). If the whole guide strand sequence is perfectly complementary to the mRNA target, as is usually the case for siRNAs and plant miRNAs, the mRNA is endonucleolytically cleaved by involvement of the Argonaute (Ago) protein, also called slicer. of the small RNA duplex into the RNA-induced silencing complex (RISC). DGRC (DiGeorge syndrome critical region gene 8) and TRBP (TAR (HW) RNA binding protein 2) are double-stranded RNA-binding proteins that facilitate mature miRNA biogenesis by Drosha and Dicer RNase III emzymes, respectively. The guide strand of the miRNA duplex gets incorporated into the effector complex RISC, which recognizes specific targets through imperfect base-pairing and induces post-transcriptional gene silencing. Several mechanisms have been proposed for this mode of regulation: miRNAs can induce the repression of translation initiation, mark target mRNAs for degradation by deadenylation, or sequester targets into the cytoplasm is P-body.
(32) On the other hand, if only the seed is perfectly complementary to the target mRNA but the remaining bases show incomplete pairing, RNAi acts through multiple mechanisms leading to translational repression (Bartel D P., 2004; Pillai R S., 2005; Bartel D P., 2009). Eukaryotic mRNA degradation mainly occurs through the shortening of the polyA tail at the 3 end of the mRNA, and de-capping at the 5end, followed by 5-3 exonuclease digestion and accumulation of the miRNA in discrete cytoplasmic areas, the so called P-bodies, enriched in components of the mRNA decay pathway (Lui et al., 2005).
(33) MiRNAs which are useful in the present invention are miRNAs which are expressed in hematopoietic stem and/or progenitor cells but which are not expressed extensively in differentiated cells. Preferred examples include mir-130a, mir-126 and mir-223. Other suitable microRNAs include microRNAs expressed in embryonic stem cells and the so-called iPS cells. For example, miR-302a, miR-373 and miR-292 are specifically expressed in pluripotent cells (ES, iPS) but not in adult-type stem cells or differentiated cells. let-7 family microRNAs are expressed in all cells except from pluripotent ones (ES, iPS). miR-124a is specifically expressed in neurons.
(34) Gene Vectors
(35) The miRNA may be used with a suitable gene vector, i.e. a vector suitable for delivering a gene (transgene) of interest, such as a viral vector. Viral vectors suitable for gene therapy are well known in the art. Examples of viral vectors useful for the present invention are described in WO2007/000668.
(36) Viruses from several different families have been modified to generate viral vectors for gene delivery. Viruses which can be used in the present invention include retroviruses, lentivirus, adenoviruses, adeno-associated viruses, herpes simplex viruses, picornaviruses, and alphaviruses. The present invention preferably employs retroviruses, including lentiviruses.
(37) The present invention can be used to control expression of a transgene included in the vector. The invention can also be used to control expression of the vector. For example, a vector which can be controlled by the mir-RNAs of the present invention is an oncolytic virus.
(38) Hematopoietic Stem Cell Transplantation
(39) Hematopoietic stem cell transplantation (HSCT) is the transplantation of blood stem cells derived from the bone marrow (in this case known as bone marrow transplantation) or blood. Stem cell transplantation is a medical procedure in the fields of hematology and oncology, most often performed for people with diseases of the blood, bone marrow, or certain types of cancer.
(40) With the availability of the stem cell growth factors GM-CSF and G-CSF, most hematopoietic stem cell transplantation procedures are now performed using stem cells collected from the peripheral blood, rather than from the bone marrow. Collecting peripheral blood stem cells provides a bigger graft, does not require that the donor be subjected to general anesthesia to collect the graft, results in a shorter time to engraftment, and may provide for a lower long-term relapse rate.
(41) Hematopoietic stem cell transplantation remains a risky procedure with many possible complications; it has traditionally been reserved for patients with life-threatening diseases. While occasionally used experimentally in nonmalignant and nonhematologic indications such as severe disabling auto-immune disease and cardiovascular disease, the risk of fatal complications appears too high to gain wider acceptance.
(42) Many recipients of HSCTs are multiple myeloma or leukemia patients who would not benefit from prolonged treatment with, or are already resistant to, chemotherapy. Candidates for HSCTs include pediatric cases where the patient has an inborn defect such as severe combined immunodeficiency or congenital neutropenia with defective stem cells, and also children or adults with aplastic anemia who have lost their stem cells after birth. Other conditions treated with stem cell transplants include sickle-cell disease, myelodysplastic syndrome, neuroblastoma, lymphoma, Ewing's Sarcoma, Desmoplastic small round cell tumor and Hodgkin's disease. More recently non-myeloablative, or so-called mini transplant, procedures have been developed that require smaller doses of preparative chemo and radiation. This has allowed HSCT to be conducted in the elderly and other patients who would otherwise be considered too weak to withstand a conventional treatment regimen. The present invention aims to widen the therapeutic application of such treatments by improving their safety and/or efficacy.
(43) Diseases
(44) The present invention is particularly useful in gene therapy. In particular those therapies which involve the expression of a potentially toxic transgene. Diseases which can be treated in accordance with the present invention include lysosomal storage disorders (LSD) such as globoid Cell Leukodystrophy (GLD). Another example of a disease treatable by the present invention is chronic granulomatous disease (CGD).
(45) Globoid Cell Leukodystrophy (GLD) or Krabbe disease is caused by mutations in the GALC gene, which causes a deficiency of an enzyme called galactosylceramidase. The buildup of unmetabolized lipids affects the growth of the nerve's protective myelin sheath (the covering that insulates many nerves) and causes severe degeneration of motor skills. As part of a group of disorders known as leukodystrophies, Krabbe disease results from the imperfect growth and development of myelin. A gene therapy treatment of GLD involves inducing the GALC gene into the patient. For example, the GALC could be intoduced into HSPC or HSC which is then transplanted into the patient. The present inventors found toxicity and in vitro and in vivo functional impairment of murine and human HSPC after LV-mediated GALC gene transfer and expression. This toxicity could be overcome by using the gene vectors of the present invention.
(46) The delivery of one or more therapeutic genes by a vector system according to the present invention may be used alone or in combination with other treatments or components of the treatment.
(47) For example, the vector of the present invention may be used to deliver one or more transgene(s) useful in the treatment of the disorders listed in WO-A-98/05635. For ease of reference, part of that list is now provided: cancer, inflammation or inflammatory disease, dermatological disorders, fever, cardiovascular effects, haemorrhage, coagulation and acute phase response, cachexia, anorexia, acute infection, HIV infection, shock states, graft-versus-host reactions, autoimmune disease, reperfusion injury, meningitis, migraine and aspirin-dependent anti-thrombosis; tumour growth, invasion and spread, angiogenesis, metastases, malignant, ascites and malignant pleural effusion; cerebral ischaemia, ischaemic heart disease, osteoarthritis, rheumatoid arthritis, osteoporosis, asthma, multiple sclerosis, neurodegeneration, Alzheimer's disease, atherosclerosis, stroke, vasculitis, Crohn's disease and ulcerative colitis; periodontitis, gingivitis; psoriasis, atopic dermatitis, chronic ulcers, epidermolysis bullosa; corneal ulceration, retinopathy and surgical wound healing; rhinitis, allergic conjunctivitis, eczema, anaphylaxis; restenosis, congestive heart failure, endometriosis, atherosclerosis or endosclerosis.
(48) In addition, or in the alternative, the vector of the present invention may be used to deliver one or more transgene(s) useful in the treatment of disorders listed in WO-A-98/07859. For ease of reference, part of that list is now provided: cytokine and cell proliferation/differentiation activity; immunosuppressant or immunostimulant activity (e.g. for treating immune deficiency, including infection with human immune deficiency virus; regulation of lymphocyte growth; treating cancer and many autoimmune diseases, and to prevent transplant rejection or induce tumour immunity); regulation of haematopoiesis, e.g. treatment of myeloid or lymphoid diseases; promoting growth of bone, cartilage, tendon, ligament and nerve tissue, e.g. for healing wounds, treatment of burns, ulcers and periodontal disease and neurodegeneration; inhibition or activation of follicle-stimulating hormone (modulation of fertility); chemotactic/chemokinetic activity (e.g. for mobilising specific cell types to sites of injury or infection); haemostatic and thrombolytic activity (e.g. for treating haemophilia and stroke); antiinflammatory activity (for treating e.g. septic shock or Crohn's disease); as antimicrobials; modulators of e.g. metabolism or behaviour; as analgesics; treating specific deficiency disorders; in treatment of e.g. psoriasis, in human or veterinary medicine.
(49) In addition, or in the alternative, the retroviral vector of the present invention may be used to deliver one or more transgenes(s) useful in the treatment of disorders listed in WO-A-98/09985. For ease of reference, part of that list is now provided: macrophage inhibitory and/or T cell inhibitory activity and thus, anti-inflammatory activity; anti-immune activity, i.e. inhibitory effects against a cellular and/or humoral immune response, including a response not associated with inflammation; inhibit the ability of macrophages and T cells to adhere to extracellular matrix components and fibronectin, as well as up-regulated fas receptor expression in T cells; inhibit unwanted immune reaction and inflammation including arthritis, including rheumatoid arthritis, inflammation associated with hypersensitivity, allergic reactions, asthma, systemic lupus erythematosus, collagen diseases and other autoimmune diseases, inflammation associated with atherosclerosis, arteriosclerosis, atherosclerotic heart disease, reperfusion injury, cardiac arrest, myocardial infarction, vascular inflammatory disorders, respiratory distress syndrome or other cardiopulmonary diseases, inflammation associated with peptic ulcer, ulcerative colitis and other diseases of the gastrointestinal tract, hepatic fibrosis, liver cirrhosis or other hepatic diseases, thyroiditis or other glandular diseases, glomerulonephritis or other renal and urologic diseases, otitis or other oto-rhino-laryngological diseases, dermatitis or other dermal diseases, periodontal diseases or other dental diseases, orchitis or epididimo-orchitis, infertility, orchidal trauma or other immune-related testicular diseases, placental dysfunction, placental insufficiency, habitual abortion, eclampsia, pre-eclampsia and other immune and/or inflammatory-related gynaecological diseases, posterior uveitis, intermediate uveitis, anterior uveitis, conjunctivitis, chorioretinitis, uveoretinitis, optic neuritis, intraocular inflammation, e.g. retinitis or cystoid macular oedema, sympathetic ophthalmia, scleritis, retinitis pigmentosa, immune and inflammatory components of degenerative fondus disease, inflammatory components of ocular trauma, ocular inflammation caused by infection, proliferative vitreo-retinopathies, acute ischaemic optic neuropathy, excessive scarring, e.g. following glaucoma filtration operation, immune and/or inflammation reaction against ocular implants and other immune and inflammatory-related ophthalmic diseases, inflammation associated with autoimmune diseases or conditions or disorders where, both in the central nervous system (CNS) or in any other organ, immune and/or inflammation suppression would be beneficial, Parkinson's disease, complication and/or side effects from treatment of Parkinson's disease, AIDS-related dementia complex HIV-related encephalopathy, Devic's disease, Sydenham chorea, Alzheimer's disease and other degenerative diseases, conditions or disorders of the CNS, inflammatory components of stokes, post-polio syndrome, immune and inflammatory components of psychiatric disorders, myelitis, encephalitis, subacute sclerosing pan-encephalitis, encephalomyelitis, acute neuropathy, subacute neuropathy, chronic neuropathy, Guillaim-Barre syndrome, Sydenham chora, myasthenia gravis, pseudo-tumour cerebri, Down's Syndrome, Huntington's disease, amyotrophic lateral sclerosis, inflammatory components of CNS compression or CNS trauma or infections of the CNS, inflammatory components of muscular atrophies and dystrophies, and immune and inflammatory related diseases, conditions or disorders of the central and peripheral nervous systems, post-traumatic inflammation, septic shock, infectious diseases, inflammatory complications or side effects of surgery, bone marrow transplantation or other transplantation complications and/or side effects, inflammatory and/or immune complications and side effects of gene therapy, e.g. due to infection with a viral carrier, or inflammation associated with AIDS, to suppress or inhibit a humoral and/or cellular immune response, to treat or ameliorate monocyte or leukocyte proliferative diseases, e.g. leukaemia, by reducing the amount of monocytes or lymphocytes, for the prevention and/or treatment of graft rejection in cases of transplantation of natural or artificial cells, tissue and organs such as cornea, bone marrow, organs, lenses, pacemakers, natural or artificial skin tissue.
(50) The present invention also provides a pharmaceutical composition for treating an individual by gene therapy, wherein the composition comprises a therapeutically effective amount of the vector of the present invention comprising one or more deliverable therapeutic and/or diagnostic transgenes(s) or a viral particle produced by or obtained from same. The pharmaceutical composition may be for human or animal usage. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular individual.
(51) The composition may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant. The choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions may comprise asor in addition tothe carrier, excipient or diluent any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents that may aid or increase the viral entry into the target site (such as for example a lipid delivery system).
(52) Where appropriate, the pharmaceutical compositions can be administered by any one or more of: inhalation, in the form of a suppository or pessary; topically in the form of a lotion, solution, cream, ointment or dusting powder, by use of a skin patch, orally in the form of tablets containing excipients such as starch or lactose, or in capsules or ovules either alone or in admixture with excipients, or in the form of elixirs, solutions or suspensions containing flavouring or colouring agents, or they can be injected parenterally, for example intracavernosally, intravenously, intramuscularly or subcutaneously. For parenteral administration, the compositions may be best used in the form of a sterile aqueous solution which may contain other substances, for example enough salts or monosaccharides to make the solution isotonic with blood. For buccal or sublingual administration the compositions may be administered in the form of tablets or lozenges which can be formulated in a conventional manner.
(53) The delivery of one or more therapeutic genes by a vector system according to the invention may be used alone or in combination with other treatments or components of the treatment. Diseases which may be treated include, but are not limited to: cancer, neurological diseases, inherited diseases, heart disease, stroke, arthritis, viral infections and diseases of the immune system. Suitable therapeutic genes include those coding for tumour suppressor proteins, enzymes, pro-drug activating enzymes, immunomodulatory molecules, antibodies, engineered immunoglobulin-like molecules, fusion proteins, hormones, membrane proteins, vasoactive proteins or peptides, cytokines, chemokines, anti-viral proteins, antisense RNA and ribozymes.
EXAMPLES
(54) Nucleotide sequences: in bold: target sequence complementary to the miRNA. In general, we use 4 copies of miRNA targets separated by a 4-6 nucleotide linker. This can, however, be optimized.
(55) TABLE-US-00001 (SEQIDNO:1) miR-126:UCGUACCGUGAGUAAUAAUGCG miR-126Tsequence: (SEQIDNO:2) GCATTATTACTCACGGTACGACGATGCATTATTACTCACGGTACGAACG CGTGCATTATTACTCACGGTACGATCACGCATTATTACTCACGGTACGA (SEQIDNO:3) miR-130a:CAGUGCAAUGUUAAAAGGGCAU miR-130aTsequence: (SEQIDNO:4) ATGCCCTTTTAACATTGCACTGTTCGAAATGCCCTTTTAACATTGCACTG ACGCGTATGCCCTTTTAACATTGCACTGATGCATATGCCCTTTTAACATT GCACTG (SEQIDNO:5) miR-223:UGUCAGUUUGUCAAAUACCCCA miR-223Tsequence: (SEQIDNO:6) GGGGTATTTGACAAACTGACACGATGGGGTATTTGACAAACTGACAACC GGTGGGGTATTTGACAAACTGACATCACGGGGTATTTGACAAACTGACA 126T/130aT2/2combination: (SEQIDNO:7) GCATTATTACTCACGGTACGACGATGCATTATTACTCACGGTACGAACGC GTATGCCCTTTTAACATTGCACTGATGCATATGCCCTTTTAACATTGCAC TG 126T(2targets): (SEQIDNO:8) GCATTATTACTCACGGTACGACGATGCATTATTACTCACGGTACGA Triplecombinationtarget(126T/130aT/223T, 2targetseach): (SEQIDNO:9) GCATTATTACTCACGGTACGACGATGCATTATTACTCACGGTACGAACGC GTATGCCCTTTTAACATTGCACTGATGCATATGCCCTTTTAACATTGCAC TGCCCCGGTGGGGTATTTGACAAACTGACATCACGGGGTATTTGACAAAC TGACA
Example 1
(56) Construction and Validation of Lentiviral microRNA Reporter Vectors
(57) In order to determine the activity of miRNAs in hematopoietic cells including rare and poorly characterized populations like HSC, we took advantage of our prior observation that transgenes expressed from lentiviral vectors can be down-regulated by endogenous miRNA for which artificial binding sites (miRT, miRNA target sites) are added to the transgene cassette (Brown B D., 2006). We thus aimed at constructing lentiviral miRNA reporter vectors reading out miRNA activity in real time and at single cell resolution. Bidirectional lentiviral vectors (Bd.LV) allow the coordinate expression of two reporter genes driven by a constitutive promoter with bidirectional activity, composed of the human phosphoglycerate kinase (PGK) promoter fused to a TATA-box in the form of a minimal cytomegalovirus (CMV) promoter in opposite orientation (Amendola M., 2005) Since this design allows both reporters to be expressed as two independent transcripts, one of them can be made responsive to miRNA activity by adding miRT to the 3UTR (miRNA reporter), while the other one, not equipped with miRT, will not be affected by the miRNA and will serve as an internal control (normalizer). We cloned a panel of such Bd.LVs containing the green fluorescent protein (GFP) as the miRNA reporter and a truncated version of the human low-affinity nerve growth factor receptor (NGFR) as a constitutively expressed normalizer.
(58) We chose to investigate two miRNAs thought to be expressed in the hematopoietic tissue, miR-223 and miR-126-3p. miR-223 was reported to be highly and specifically expressed in differentiated myeloid cells, but absent in lymphocytes (Fazi F., 2005), allowing us to test the performance of our reporter Bd.LVs in well characterized lineages. Moreover, we wanted to explore how miR-223 was expressed in hematopoietic stem and progenitor cell (HSPC) populations. From a gene therapy perspective, it would be highly relevant to identify miRNAs that are strongly expressed in HSPC but not in differentiated progeny, in order to prevent off-target transgene expression in sensitive stem cell populations while fully maintaining therapeutic correction of the diseased progeny. Large-scale miRNA cloning has suggested that miR-126 might fulfil these criteria, as it was specifically detected in human CD34.sup.+ HSPC but not in other hematopoietic cell population (Landgraf et al., 2007).
(59) We produced reporter Bd.LVs for miR-223 and miR-126-3p (Bd.LV-223T and Bd.LV-126T, respectively), as well as a control Bd.LV not containing any miRT (
(60) In HEK293T cells, the GFP mean fluorescence intensity (MFI) of NGFR-expressing, transduced cells was identical for all three Bd.LVs (
(61) To describe miRNA activity in more quantitative terms, we calculated a Protein Fold Repression value (FR) based on normalized mean fluorescence intensities (MFI) of the miRNA reporter Bd.LV respect to the control Bd.LV (
(62) Taken together, these results indicate that our miRNA-regulated Bd.LVs faithfully reported miRNA activity in cell lines, consistent with our own and previously published miRNA expression data. In addition to conventional miRNA profiling techniques, our vectors report not just the presence of a miRNA, but also its bioactivity. FACS analysis of cells carrying our Bd.LV reporter allows assessing miRNA activity at the single cell level and is thus suitable for analyzing heterogenous cell mixtures, which can be further subdivided by immunophenotyping.
(63) Characterization of miR-223 and miR-126 Activity in the Mouse Hematopoietic System
(64) Once demonstrated the reliability of the reporter Bd.LVs in measuring miRNA activity in cell lines, we moved to investigate the activity of the aforementioned miRNAs in primary hematopoietic cells. To this aim, we took advantage of the murine model because it is widely available, easily manipulated in an experimental setting and well-characterized. In fact, when aiming to define miRNA activity in rare HSPC populations, the murine hematopoietic system, well characterized by surface markers, represents a great advantage. Our experimental approach was to enrich murine HSPC from bone marrow by depleting lineage-marker positive cells, to transduce them with lentiviral miRNA reporter vectors and transplant these cells into lethally irradiated congenic recipient mice. microRNA activity was then monitored in peripheral blood leukocytes over time to determine their activity in differentiated cells. After stable engraftment had been reached, mice were euthanized, and miRNA activity was determined in multiple bone marrow populations defined by surface immunophenotyping. In this way, we wanted to assess whether these miRNAs were expressed in prospectively identified HSPC. In particular, we wanted to determine whether miR-126 is present in the most primitive HSC compartment. The first set of mice was transplanted with HSPC transduced by the previously described reporter Bd.LVs (see
(65) Peripheral blood (PB) was sampled 8 weeks after transplantation, and leukocyte populations were sorted according to physical parameter and surface markers into granulocytes (CD11b+ side scatterhi SSChi), monocytes (CD11b+SSClo), B cells (CD19+) and T cells (CD11bCD19) (
(66) Footprinting microRNA Activity in Murine HSPC and their Progeny
(67) We then quantified BdLV reporter protein levels in multiple, prospectively identified hematopoietic subpopulations isolated from the reconstituted mice. The HSPC compartment was defined as bone marrow (BM) cells having a c-Kit.sup.hi Lineage markers.sup./low immunophenotype, and further subdivided into fractions with different self-renewal and differentiation potential based on expression of Sca-1, CD150, CD48 and CD45. Of note, 3 out of 5 cells with the immunophenotype c-Kit.sup.+ Sca-1.sup.+ Lin.sup. (KSL) CD150.sup.hi CD48.sup. were reported to have long-term, multilineage repopulating potential upon single cell transplantation, and thus represent bona fide HSC (Kiel M J., 2005). Moreover, based on the literature (Pronk C J., 2007) and our own findings, we subdivided Kit.sup.+Sca.sup.Lineage.sup. cells into subsets enriched for granulocyte/monocyte progenitors (GMPs) vs. megakaryocyte and erythrocyte progenitors (EP), and assessed miRNA expression. Interestingly, miR-126, miR-130a and miR-196b showed the highest activity in fractions enriched for the most primitive HSC, and this activity was lost during early stages of differentiation (
(68) Protection of HSC from Conditional Suicide by miR-126
(69) The aforementioned miRNA activity footprints were based on prospective isolation of hematopoietic cell populations according to immunophenotype. In order to conclusively establish the activity of selected miRNAs in functionally defined cell subsets, we devised a conditional suicide system based on lentiviral vectors expressing the herpes simplex virus thymidine kinase (TK) gene regulated by different miRT sequences (
(70) We then developed an in vivo suicide assay to demonstrate miRNA activity in functionally defined HSC. The TK/GCV suicide system requires cell division in order to become toxic. Pilot experiments co-transplanting TK-transduced cells with untransduced BM supporting cells indicated that a 1-week time course of GCV given within the first 2 weeks of engraftment efficiently eliminates TK-transduced long-term repopulating HSC (data not shown). We then transduced HSPC with either a miRNA-regulated bidirectional suicide vector expressing dTK-126T or dTK-142T and GFP, or a control bidirectional suicide vector expressing dTK and NGFR. Cells transduced with the control or one of the miRNA-regulated suicide vectors were then co-transplanted into congenic mice, which did or did not receive GCV during the engraftment phase (
(71) Safety of Exploiting miR-126 Regulation for Gene Therapy
(72) We then derived a transgenic mouse line (Tg.126T mice) which harbors germline integrations of a lentiviral vector expressing a d4GFP.126T transcript from the same promoter used in the BdLV studies described above. FACS analysis of Lin.sup.BM cells of young adult Tg.126T mice showed a similar pattern of miR-126 activity as observed in the transplanted mice (
(73) Characterization of Candidate miRNA Activity in Human Hematopoietic Cells
(74) Our characterization of miR-223, miR-130a and miR-126 activity in the murine hematopoietic system proposed these miRNAs as promising endogenous regulators for limiting transgene toxicity in HSPC while allowing therapeutic expression in differentiated myeloid and lymphoid cells. We next sought to investigate the activity of these miRNAs in human hematopoietic cells, which are the actual targets for gene therapy. We transduced human CB CD34.sup.+ cells with reporter Bd.LVs for miR-126, miR-130a, miR-223 (
Example 2
(75) Forced GALC Expression in HSPC
(76) In order to assess the feasibility of GALC over-expression in murine HSPC (mHSPC), we isolated Lin-cells from FVB/twi (GALC /) mice. mHSPC were transduced at MOI 100 with GALC.LV in the presence of an optimized cytokine combination (Biffi et al., 2004). After transduction, cells were cultured 10-14 days in vitro to assess enzymatic activity and the vector copy number (VCN) by Q-PCR. We compared the expression level of GALC with the over-expression of other lysosomal enzymes, Arylsulfatase A (ARSA) and -Iduronidase (IDUA), obtained by transducing mHSPC with the control vectors ARSA.LV and IDUA.LV. All vectors expressed the transgene from the same expression cassette containing the human PGK promoter. Since our aim was to compare the enzyme over-expression in transduced /HSPC with respect to physiological enzyme levels in wild type HSPC, mHSPC obtained from ARSA KO mice and from IDUA KO mice were used for ARSA.LV and IDUA.LV transduction, respectively. Transduction of mHSPC reconstituted lysosomal enzyme activity in / cells and led to enzyme over-expression with respect to wild type levels in the cultured progeny of transduced / mHSPC (
(77) A similar experiment was performed on human HSPC (hHSPC), isolated through CD34.sup.+ selection from CB obtained from normal donors (n.d.). hHSPC were transduced at MOI 100 with GALC.LV, ARSA.LV and IDUA.LV, using previously optimized transduction protocols 105. Similarly to mHSPC, we evaluated enzyme activity reconstitution and VCN upon in vitro culture of the transduced cells. GALC.LV transduction of HSPC from n.d. CB (n=4) led to limited over-expression of the enzyme in the cultured cell progeny as compared to IDUA.LV (n=3) and ARSA.LV (n=6) controls (
(78) Impaired In Vitro Function of GALC Expressing HSPC Upon LV-Mediated GALC Expression
(79) The effects of transduction and enzyme expression on mHSPC clonogenic potential were assessed by CFC assay. Equal number of GALC/GFP/ARSA.LV transduced mHSPC were seeded for colony assay. ARSA was chosen as control lysosomal enzyme since it was previously shown to not affect HSPC function (Capontondo et al., 2007). In 12 independent experiments GALC.LV transduced / and +/+ mHSPC gave rise to a significantly reduced number of colonies as compared to GFP.LV and ARSA.LV transduced cells (
(80) The reduced clonogenic potential of GALC.LV transduced mHSPC could result from the death of highly transduced GALC over-expressing hematopoietic progenitors. In order to investigate the possible occurrence of an negative selection of highly transduced mHSPC, we quantified the VCN of colonies by Q-PCR. Q-PCR was performed on DNA extracted from each pool of 4 colonies (pools were made in order to have a sufficient amount of material for the analysis). Colonies obtained from GALC.LV transduced mHSPC showed a significantly lower vector content when compared to controls (
(81) According to these data, we could not discriminate whether functional impairment and in vitro selection were due to a toxic effect of transduction or to the presence of contaminants released by vector-producer cells and co-purified with the vector. It must be mentioned that, during GALC.LV production, 293T cells detach from plates, suggesting that GALC expression is toxic also to these cells. For this reason, the incorporation of toxic molecules deriving from dead 293T cells into the vector preparation could not be excluded. To address this issue, we generated a control vector regulated by an hematopoietic-specific microRNA, GALCmir142T.LV 56. Four target sequences for the microRNA 142 incorporated downstream the transgene allow to suppress expression in mHSPC and in their progeny without impairing GALC expression in non-hematopoietic cells, such as 293T LV-producing cells. This technology is based on microRNA post-transcriptional regulation: microRNA 142, expressed only by hematopoietic cells, recognizes its target sequence downstream the transgene and inhibits the translation of the transcript and expression of the transgene. As expected, transduction of mHSPC with GALCmir142T.LV was not associated to an increase of GALC activity (
(82) We investigated the effect of GALC over-expression also on human HSPC. hHSPC were isolated from n.d. CB and BM and from the collected BM of a GLD patient that was scheduled to be discarded. An equal number of hHSPC were transduced with GALC.LV or ARSA.LV or GFP.LV control vectors were seeded for CFC assay, in order to assess the clonogenic potential of transduced hHSPC. As in the case of murine cells, GALC.LV transduced n.d. and GLD hHSPC showed an impaired clonogenic potential (
(83) Overall these data indicate that forced GALC de novo expression upon LV transduction exerts a detrimental effect both on murine and human HSPC, leading to negative selection of GALC over-expressing cells and to functional impairment.
(84) Impaired in vivo function of HSPC upon LV-mediated GALC expression We performed in vivo experiments with the aim of assessing the repopulation potential of m- and hHSPC upon GALC.LV transduction and GALC de novo expression. In vivo studies were performed on twi and FVB/twi mice for mHSPC, and on Rag2c mice for hHSPC.
(85) Our initial experiments were performed on twi mice, a severe model of GLD, as described in the Methods section. A first set of experiments was devoted to set the condition for HCT in twi mice. Total BM transplantation from wild type donors was performed in these mice, resulting in a significant increase of their lifespan up to 100 days, as previously reported by 115. These preliminary experiments allowed defining the optimal irradiation dose. The use of donor HSC carrying the CD45.1 allele allowed evaluating donor cell engraftment, since twi mice carry the CD45.2 allele. Because our goal was to transduce twi HSC, we tried to set up transplantation of Lin-HSPC, in order to reduce the number of cells to be transduced and transplanted as compared to the use of total BM cells. HSPC from wild type (+/+) mice were transduced at MOI 100 with PGK GFP.LV (GFP.LV), in the presence of an optimized cytokine combination (Biffi et al., 2004) (
(86) We thus decided to support GFP.LV transduced HSPC engraftment by co-transplantation of untransduced BM-derived hematopoietic committed progenitors, depleted of HSC. These cells were obtained by magnetic depletion of Sca1+ cells from total BM of +/+ mice. Interestingly, twi mice transplanted with GFP.LV transduced +/+ Lin cells and untransduced +/+ Sca1 cells reached a survival similar to the one obtained with +/+ total BM transplantation (
(87) Once the transplantation procedures had been optimized with +/+ HSPC and GFP.LV, twi mice were transplanted with GALC.LV transduced / HSPC and with either +/+ or GALC.LV transduced / Sca1 cells. Twi mice that received GALC.LV transduced / HSPC and +/+ untransduced cells survived significantly longer than mice transplanted with +/+ total BM or with +/+ HSPC and Sca1 progenitors, and showed amelioration of their phenotype and slower disease progression (
(88) Nevertheless, twi mice that received / Lin and Sca1 cells, both transduced with GALC.LV, died after lethal conditioning or had a lifespan similar to untreated mice. These results suggested that GALC.LV transduced progenitors failed to support HSPC engraftment, resulting in engraftment failure and autologous reconstitution of hematopoiesis.
(89) We decided to use FVB/twi mice instead of the usual twi model of GLD to take advantage from the slightly less severe model: previous experiments showed us that the successful transplantation of Lin cells without the need of Sca1-supporting cells was possible in this model. Moreover, FVB/twi mice have larger litters, thus allowing us to have a larger number of / mice to isolate mHSPC.
(90) Transduced mHSPC were transplanted into lethally irradiated 8 day-old FVB/twi / and heterozygous (+/) recipients (
(91) Apoptosis of GALC Expressing Murine and Human HSPC.
(92) Having detected a functional impairment of GALC.LV transduced HSPC, we evaluated whether this could be due to apoptosis of the transduced cells mediated by de novo GALC expression. The occurrence of apoptosis was evaluated at two different time points, 2 and 5 days after transduction, when transgene expression presumably reaches steady state (see GFP expression in
(93) Sensitivity to GALC Expression Toxicity is Dependent on Differentiation and Cel Lineage
(94) Macrophages and microglia represent the HSPC effector progeny reconstituting enzyme activity in affected tissues, including the nervous system, in HSPC gene therapy approaches for LSD. We evaluated whether a prototypical monocytic cell line (U937), primary human monocytes, primary murine macrophages and microglia could experience GALC expression toxicity upon LV mediated gene transfer. Moreover, for further dissecting the specificity of GALC-induced apoptosis along hematopoietic differentiation, we tested T and B lymphocytes. To permit immunodetection of GALC and estimate transduction efficiency, in some experiments we used a C-terminally tagged transgene, in which the gene is fused in frame with the sequence encoding the HA peptide from the hemagglutinin protein of the human influenza virus. The HA-tagged enzyme had a specific activity comparable with that of the un-modified enzyme, and was properly sorted to the lysosomal compartment (data not shown). After transduction, we evaluated at different time points the occurrence of apoptosis by TUNEL assay and GALC activity. As expected, all the cell types analyzed showed a different level of basal GALC activity (
(95) Murine macrophages were obtained as the adherent fraction of peritoneal cell collection. Primary cultures of microglia were isolated from the brain of +/+ and / FVB/twi mice by established protocols (Armstrong R C., 1998; Gritti et al., 1996). Further, we tested both primary monocytes and U937 monocytic cell line. Human monocytes were isolated from PBMC by positive selection for the CD14 monocytic marker. Transduction conditions were set up using GFP.LV and analyzing the transduction efficiency by cytofluorimetry (when possible) or by confocal microscopy. Once the transduction protocol had been optimized, microglia and macrophages were efficiently transduced with GALC.LV/GALC-HA.LV and control vectors at MOI 50 and 200, respectively, and expressed GALC above basal levels (
(96) Human T and B lymphocytes were obtained upon PHA-stimulation and EBV transformation of total PBMC, respectively. Similarly to the experiments with monocytes and macrophages, transduction was optimized by using GFP.LV and flow cytometry. B lymphocytes were efficiently transduced with GALC.LV/GALC-HA.LV and control vectors at MOI 100 while two hits at MOI 100 were used for T lymphocytes. Despite sustained increase on GALC activity upon transduction, no apoptosis was detected at all the examined time points (
(97) In Vitro Regulation on GALC Expression by miRNA126.
(98) In order to evaluate the effect of miRNA126-regulated GALC expression in HSPC, we transduced mHSPC with GALC.miR126T.LV or with GFP.miR126T.LV or GALC.LV at MOI 100. After washing, cells were seeded for CFC assay or cultured in vitro for two weeks for GALC activity assay and Q-PCR analysis. Transduction with GALC.miR126T.LV allowed a reconstitution of GALC activity at supraphysiological levels in the differentiated mHSPC progeny, up to 2 fold over wild type levels (
(99) In vivo regulation on GALC expression by miRNA126.
(100) The effect of miRNA126-regulated GALC expression on mHSPC repopulation potential was evaluated in +/ FVB/twi mice. Lethally irradiated 8 day-old mice were transplanted with GALC.miR126T.LV transduced / mHSPC or with PGK GALC.LV transduced cells and survival was evaluated at both short- and long-term. Similarly to what observed with CD11b_GALC.LV, +/ FVB/twi mice transplanted with GALC.miR126T.LV transduced mHSPC were rescued from lethality and survived long term (more than 3 months after HSCT), differently from PGK GALC.LV-transplanted mice that did not survive after lethal conditioning. When mice transplanted with GALC. miR126T. LV transduced mHSPC were euthanized at the age of 80 days and Q-PCR analysis was performed on BM, we found an average VCN of 5, thus confirming the presence of transduced cells in the BM long-term after HCT.
(101) Overall, these results together to those observed with CD11 b_GALC.LV transduced cells, show successful rescue of the GALC deficiency and protection from de novo GALC expression in HSPC by our improved regulated gene therapy strategies.
(102) Forced GALC Expression is Toxic to HSPC but not to Differentiated Hematopoietic Cells
(103) To develop a model of gene therapy, we transduced HSPC from wild type and GLD mice, carrying a point mutation resulting in <5% residual enzyme activity (Tr s).sup.45, with a GALC- or GFP-expressing lentiviral vector (
(104) Upon HSC transplantation, macrophages and microglia are the effector progeny responsible for reconstituting GALC activity in the affected tissues. To test whether toxicity by forced/de novo GALC expression also affected differentiated cells, we transduced human primary monocytes, T and B lymphocytes, as well as mouse microglia cells with GALC- or control vectors (
(105) miR-126 Regulation Rescues HSPC from GALC Expression Toxicity and Enables Gene Therapy of GLD
(106) The selective toxicity of de novo GALC expression in HSPC highlights the need to tightly regulate transgene expression in HSPC for successful gene therapy of GLD. We thus tested the efficacy of our novel miR-126 based regulatory system and compared it to a transcriptional strategy based on the myeloid-specific CD11b promoter to target GALC expression to the differentiated HSPC progeny. Both strategies rescued the transduced HSPC from GALC-induced toxicity (see
(107) HSPC from Trs mice were transduced with the GALC-126T lentiviral vector and transplanted into newborn Trs mice. The transplanted mice were successfully engrafted (
DISCUSSION
(108) Deep Profiling of miRNA Expression in the Hematopoietic System
(109) The miRNA reporter vectors used in this work offer the opportunity to measure miRNA bioactivity rather than relying only on miRNA expression levels, thus providing a biologically meaningful, quantitative readout of miRNA function. Brown et al. have proposed that a threshold level of miRNA expression must be reached for significant suppressive activity against miRNA targets to occur, which might be the result of a limiting RNAi machinery available within a cell (Brown et al., 2007). If small RNAs compete for limited RNAi effector complexes, a sufficiently high level of expression may be necessary to ensure incorporation of the miRNA into an active RISC. Thus, those miRNA species, which are expressed to very low levels, may have little to no activity because they are not part of a functioning RISC. miRNA profiling studies often consider only relative differences in miRNA expression and can thus indicate statistically significant differences which may be, however, irrelevant to gene regulation. Combining the breadth of genome-wide miRNA expression analysis (e.g. by microarrays or deep sequencing) with the miRNA reporter Bd.LV approach adds another dimension to the study of microRNAs. It allows to stringently validate the biological significance of differential miRNA expression and can be used to longitudinally study the expression of a selected miRNA across multiple cell populations, with single cell resolution and in living cells. We used this approach to study the expression of selected miRNAs in rare and poorly accessible cell populations like HSC. Our miRNA reporter vector studies not only confirmed data on miR-223 and miR-126 expression profiles described in the literature, but added further information on the activity of these miRNA in highly pure HSPC subpopulations and their progeny. miR-223 has previously been described to be abundantly expressed in the myeloid lineage of mice and humans (Chen et al., 2004; Fazi et al., 2005; Rosa et al., 2007). Indeed, our reporter vector data found the highest miR-223 activity in granulocytes. Moreover, miR-223 activity was also revealed in monocytes and in a hierarchy of HSPC, in particular progenitors committed to the granulocyte-monocyte lineage. Our data suggest that at least some pluripotent hematopoietic cells express miR-223, in both mice and humans. One possibility is that these cells are primed for a granulocyte-monocyte fate. Our bidirectional reporter vectors allow fractionating these HSPC populations according to miR-223 expression and probe their differentiation potential. These studies may provide a novel way to prospectively identify myeloid progenitors relying not only on surface markers, and possibly investigate the earliest steps of lineage commitment.
(110) The expression of miR-126 in the hematopoietic system was poorly characterized until now. A broad, deep-sequencing based, miRNA profiling study broadly assigned it to CD34.sup.+ HSPC. We now show that miR-126 is active in murine and human HSPC, and in particular within subsets enriched for the most primitive HSC. During early steps of differentiation, miR-126 activity progressively decreases. The association of miR-126 to human HSC is further corroborated by an analysis of BdLV.126T-transduced CB HSPC freshly isolated from NOD/SCID mice performed by our collaborator at UHN, Toronto (Lechman et al., 2008, ASH Abstract). Our data support a stem/early progenitor-specific expression pattern for miR-126, with silencing in most downstream lineages.
(111) Interestingly, a subgroup of acute myelogenous leukemia (AML) characterized by mutations in the core-binding factor (CBF) expresses high levels of miR-126 121. The authors identified polo-like kinase (PLK-2 as a validated target of miR-126. PLK-2 has been recognized as a regulator of the cell cycle and might act as a tumor suppressor gene in hematologic malignancies. Given the tight association of miR-126 with HSC, we are studying, in collaboration with the group of John Dick at UHN, Toronto, the activity of miR-126 in leukemic stem cells (LSC), a rare subpopulation standing at the apex of the developmental hierarchy of AML, which is thought to be responsible for chemotherapy resistance and relapse (Barabe et al., 2007; Kennedy et al., 2007). Preliminary results suggest that AML samples, in particular those belonging to other subgroups than CBF-AML, manifest a gradient of miR-126 expression, being highest in the LSC-enriched CD34.sup.+38.sup. fraction and low in non-engrafting fractions. This pattern of miR-126 activity is maintained upon transplantation of LSC into immunodeficient NOD/SCID mice. Thus, miR-126 activity, visualized by a lentiviral reporter Bd.LV, could serve as a new biomarker and potentially therapeutic target for leukemic AML stem cells (Lechman et al., 2008, ASH Abstract).
(112) Outside the hematopoietic system, miR-126 has been extensively described as a positive regulator of angiogenic signaling in endothelial cells. Angiogenesis describes the formation of new blood vessels through the growth of pre-existing vessels. Signals promoting angiogenesis include vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF), which activate mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) cascades, regulating motility and proliferation of endothelial cells and consequent vessel sprouting. miR-126 has two validated targets involved in the angiogenic process, Sprouty-related EVH1 domain containing protein (Spred1) and a regulatory subunit of PI3K, both negative regulators of VEFG/FGF signalling. Endothelial cells lacking miR-126 fail to respond to angiogenetic signals. Knockdown of miR-126 in zebrafish resulted in loss of vascular integrity and haemorrhage during embryonic development (Fish et al., 2008), while deletion of miR-126 in mice causes leaky vessels, haemorrhaging, and partial embryonic lethality, due to a loss of vascular integrity and defects in endothelial cell proliferation, migration, and angiogenesis (Wang et al., 2008).
(113) In summary, miR-126 is expressed to biologically relevant levels in angiogenic endothelial cells as well as hematopoietic stem cells and their immediate progeny. Interestingly, expression of miR-126 is another factor that endothelial cells and HSC have in common. In fact, during embryonic development, the simultaneous appearance of endothelial and hematopoietic cells (red blood cells) in the yolk sac, and the successive emergence of HSC and endothelial cells in the aorta-gonado-mesonephros region (AGM) underline the common origin of these 2 lineages, arising from a so-called hemangioblast cell population. No surprisingly, there is a growing list of genes, originally thought to be exclusively expressed in vascular endothelium, that have turned up in HSC and transcription factors and membrane receptors such as the Tie2 receptor, Sca-1, VEGFR-(Flt-1), VEGFR-(Flk-1) and CD31.
(114) Given the functional and anatomical association between microvasculature and HSC through development and in the adult bone marrow, miR-126 may contribute to the homeostasis of the hematopoietic niche and regulate proliferation of both its endothelial and HSC components.
(115) Interference of miRNA-Regulated LV with miRNA Function
(116) One concern about exploiting miRNA regulation is the possibility to interfere with the regulation of natural miRNA targets by over-expressing transcripts containing miRNA target sequences. In order to understand the biology and safety of microRNA-regulated LV, we quantified the dose requirement for saturating an miRNA's activity (Gentner et al., 2009). Measuring the loss of regulation of sensitive reporters and a natural miRNA target upon challenging the cells with increasing doses of transcripts containing miRNA target sequences, we found that the threshold for interfering with physiological miRNA regulation is generally high and can only be reached when driving expression from strong, viral promoters. miRNA target sequences expressed from a moderate promoter like the phosphoglycerate kinase (PGK) promoter did not saturate miRNA activity, even at high vector copy number (up to 50 integrations). This suggested that miRNA regulation could safely be exploited for HSC gene therapy when expressing the miRNA regulated transcript from a moderate promoter and from a limited number of integrations per cell. However, we found that lentiviral vectors can be engineered for deliberately interfering with miRNA activity and thus be used as a tool to characterize miRNA function.
(117) When over-expressing miRNA target sequences from strong promoters, we demonstrated that miRNA activity could be saturated, resulting in the loss of regulation of natural targets for that miRNA 126. Furthermore, we found that saturation could be favored by changing the design of our target sequences. For our gene-regulated vectors, such as the one described in this thesis, we exploited perfectly complementary miRNA binding sites which primarily result in degradation of the mRNA transcript (see
(118) Applications of microRNA-Regulated Vectors for Hematopoietic Stem Cell Gene Therapy
(119) The pattern of reporter gene expression that we describe in this work has also relevant implications for gene therapy. Most clinical gene therapy constructs contain ubiquitously expressing promoters which guarantee robust expression of the transgene in the target cell types, but also result in off-target expression. This ectopic expression can result in toxicity, counterselection of gene-modified cells, triggering of an immune response directed against the transgene product, or even oncogenic transformation (Weil et al., 1997; Ott et al., 2006; Brown et al., 2006; Brown et al., 2007; Woods et al., 2006).
(120) Adding miR-223 target sequences to a therapeutic transgene delivered to HSC would prevent expression in the myeloid progeny, including granulocyte monocyte progenitors and at least a subfraction of HSC. Importantly, this strategy would result in full therapeutic expression in the lymphoid and red cell lineage.
(121) The identification of miR-126, which is strongly expressed in HSPC but not in differentiated progeny of the myeloid and lymphoid lineage, allows preventing expression of a potentially toxic transgene in sensitive stem cell populations, while maintaining expression and therapeutic efficacy in the diseased progeny.
(122) Toxicity of GALC De Novo Expression
(123) Enzyme replacement and gene therapy applications in LSD patients (Rohrbach et al., 2007; Brady et al., 2004) and animal models (Biffi et al., 2006; Sano et al., 2005; Hofling et al., 2004; Sands et al., 1997) have generally demonstrated the lack of toxicity of lysosomal enzyme administration and expression above normal levels. In the case of Metachromatic Leukodystrophy (MLD), the safety of LV-mediated over-expression of ARSA, catalyzing the step upstream of GALC in sulfatide metabolism, was demonstrated in mHSPC, hHSPC, and transgenic mice (Biffi et al., 2004; Capontondo et al., 2007), prompting clinical testing of HSPC gene therapy for this disease. Here, we report the unexpected finding of overt toxicity and in vitro and in vivo functional impairment of murine and human HSPC after LV-mediated GALC gene transfer and expression. GALC.LV transduced murine HSPC showed impaired clonogenic potential and failed to engraft and long-term repopulate myeloablated transplant recipients. This was associated to negative selection and and apoptosis of highly transduced HSPC. The lack of apoptosis and functional impairment observed in murine and human HSPC, transduced with a control vector in which GALC expression is regulated by the microRNA (Mechtcheriakova et al; 2007) (exclusively expressed in hematopoietic lineage cells) ((Brown et al., 2006), confirmed the unique role of expressed GALC in determining the death of transduced cells.
(124) Differentiated Cells are Less Sensitive to GALC-Related Toxicity
(125) We noticed that differentiated cells of the hematopoietic lineage (lymphocytes, monocytes, macrophages and microglia) and cells from other lineages (oligodendrocytes, as well as neural progenitors) (Gritti et al., personal communication), are not affected by LV-mediated GALC over-expression. Therefore, HSPC appear to have a unique sensitivity to GALC- and sphingolipid-mediated control of cell survival, which is apparently lost during differentiation into mature myeloid, T and B cells, and which is restricted to the hematopoietic lineage. A possible explanation for this, might be the very low basal GALC activity detected in HSPC, compared to other cell types, such as microglia or oligodendrocytes. Moreover, the role of sphingolipid metabolism and the consequences of an alteration in the content of Cer and derived molecules such as So and S1P, might vary according to cell types and differentiation stages. For example, the effect of intracellular Cer accumulation in oligodendrocytes was studied in depth, with conflicting findings. A recent study reported that induction of acid sphingomyelinase, which is responsible for Cer production from sphingomyelin degradation, resulted in Cer accumulation and induction of apoptosis (Chudakova et al., 2008). The same pathway seems to be involved in oligodendrocytic cell death induced by oxidative stress or by amyloid-beta peptide accumulation in Alzheimer's disease (Jana et al., 2007; Lee et al., 2004). However, mature oligodendrocytes were also described as being resistant to some pro-apoptotic stimuli, inducing Cer accumulation. Similarly, a differential response to pro-apoptotic TNF-stimulation was observed in oligodendrocytic precursors, where a high level of apoptosis was observed and in mature oligodendrocytes, which appeared to be resistant to apoptotic stimulation (Scurlock et al., 1999). Mature oligodendrocytes are also resistant to apoptosis induced by IL-1 administration (Brogi et al., 1997). This suggests that the increase of intracellular Cer could be managed in different ways, according to the pathways activated in that particular cell type and at that particular differentiation stage. Supporting this hypothesis, it has been reported that the increase of intracellular Cer in neural tissue, is managed by the high activity of acid ceramidase (Huang et al., 2004). This enzyme catalyzes the degradation of Cer to So, which, in turn, is phosphorylated to S1P. S1 P rescues cells from Cer-induced apoptosis (Betito et al., 2006) and induces proliferation in neural progenitor cells (Harada et al., 2004). It could be hypothesized that a similar mechanism was responsible for the reduced sensitivity of oligodendrocytes to GALC over-expression-related apoptosis. The sphingolipid metabolic pathway is also very active in oligodendrocytes, which are involved in myelination in order to produce the myelin glycosphingolipids (GalCer and Sulfatide). Moreover, these molecules participate in carbohydrate-carbohydrate interactions, forming glycosynapses (for a review see (Boggs et al., 2008).
(126) The reduced sensitivity to GALC de novo expression-induced apoptosis observed in monocytes and macrophages might be explained both by the activity of ceramidase and their secretory action. Reports show that in endothelial cells and cells of the immune system, Cer is rapidly converted to So and S1P, which are secreted. In the plasma, these molecules bind albumin and act as signals for specific receptors on lymphocytes (for a review see 78 142 143Hannun et al., 2008; Mechtcheriakova et al., 2007; Rivera et al., 2008).
(127) Post-Transcriptional Regulation of GALC Expression for Safe and Efficacious GLD Gene Therapy
(128) The regulation of transgene expression is of great interest in the field of gene therapy. In particular, the possibility of post-transcriptional regulation by micro RNA (miRNA), has recently open new perspectives for tuning the expression level of the transgene, according to cell type and to differentiation (Gentner et al., 2008). In this study, we applied this innovative technology in order to suppress GALC expression in HSPC, which have been shown to be the most sensitive cells to GALC over-expression toxicity, while allowing enzyme over-expression in differentiated cells, which are responsible for GALC secretion and cross correction of oligodendrocytes. In particular, we selected the microRNA126, which was reported to be more highly expressed in HSPC, as compared to peripheral blood mononuclear cells 145. Our data demonstrated that the regulation of GALC expression by the HSC-specific miRNA126, protects HSPC from GALC de novo-induced apoptosis in vitro and Transduction of GALC / HSPC with GALC.miR126T.LV permitted the reconstitution of enzymatic activity in their differentiated progeny at supra-physiological levels, without impairing the clonogenic potential of the multipotent progenitors, as assessed by the CFC assay. This data confirmed that miRNA126 suppresses GALC expression only in HSPC and not in their differentiated progeny. The unaffected clonogenic potential may indicate that GALC expression is repressed not only in HSC, but also in multipotent progenitors responsible for the formation of the hematopoietic colonies in CFC assay.
(129) Moreover, transplantation of GALC.miR126T.LV-transduced HSPC into GALC +/ FVB/twi mice, resulted in long-term survival of treated animals. This data demonstrates that the suppression of GALC activity in the more primitive HSC by miRNA126, allows their long-term repopulation and differentiation potential, to be preserved. The presence of highly transduced cells in the BM ten weeks after HSCT, further confirmed that long-term HSC were rescued from GALC over-expression apoptosis.
(130) Importantly, the post-transcriptional regulation by HSC-specific miRNA, permitted the use of a strong promoter, such as PGK, thereby reaching the same expression level of the transgene in the differentiated HSPC progeny, as that obtained with unregulated PGK GALC.LV. As discussed above, the level of GALC expression required for HSC gene therapy to be effective, is not known. However, even if a low enzyme expression level might be sufficient to obtain a clinical benefit, the use of a stronger promoter may allow the vector copy number(s) to be reduced, but reach the desired enzymatic expression. This issue could be relevant for the safety of clinical translation of HSC gene therapy.
CONCLUSIONS
(131) The lentiviral vector platform represents a versatile and highly useful tool to study microRNA function. The bidirectional miRNA reporter vectors developed allow measuring miRNA activity at the single cell level in complex cell mixtures, adding a new dimension to conventional miRNA expression profiling approaches. Using this approach, we dissect the expression of several miRNAs in hematopoietic stem and progenitor cell (HSPC) populations with unprecedented resolution. Changing promoter and miRNA target design can result in lentiviral vectors capable of accomplishing stable miRNA knockdown, useful for generating loss-of-function phenotypes as a basis to elaborate the physiologic role of an miRNA. Proteomic analysis after stable miRNA knockdown will allow the identification of key targets for that miRNA that are modulated in the natural setting.
(132) Besides addressing these basic biology questions, miRNA-regulated vectors have significant therapeutic potential. Added to the 3UTR of a therapeutic transgene, miRNA target sequences can reduce ectopic transgene expression and thus alleviate or avoid transgene toxicity. In particular, hematopoietic stem cell (HSC) biology must not be disturbed by the gene therapy treatment, as HSC represent the guarantor for long-term disease correction by continuously supplying gene-modified daughter cells. The miRNAs characterized here, miR-126, miR-130a and miR-223 restrict unwanted transgene expression in HSPC, while allowing it in the differentiated progeny, and will be further developed into clinical gene therapy protocols.
(133) Each of the applications and patents mentioned in this document, and each document cited or referenced in each of the above applications and patents, including during the prosecution of each of the applications and patents (application cited documents) and any manufacturer's instructions or catalogues for any products cited or mentioned in each of the applications and patents and in any of the application cited documents, are hereby incorporated herein by reference. Furthermore, all documents cited in this text, and all documents cited or referenced in documents cited in this text, and any manufacturer's instructions or catalogues for any products cited or mentioned in this text, are hereby incorporated herein by reference.
(134) Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the claims.
REFERENCES
(135) Abonour R, Williams D A, Einhorn L, et al. Efficient retrovirus-mediated transfer of the multidrug resistance 1 gene into autologous human long-term rep opulating hematopoietic stem cells. Nat Med. 2000; 6:652-658. Akashi K, Traver D, Miyamoto T, Weissman I L. A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature. 2000; 404:193-197. Amendola, M., Venneri, M. A., Biffi, A., Vigna, E. & Naldini, L. Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters. Nature biotechnology 23, 108-116 (2005). Armstrong R C. Isolation and characterization of immature oligodendrocyte lineage cells. Methods 1998; 16:282-292. Barabe F, Kennedy J A, Hope K J, Dick J E. Modeling the initiation and progression of human acute leukemia in mice. Science. 2007; 316:600-604. Bartel D P. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116:281-297. Bartel D P. MicroRNAs: target recognition and regulatory functions. Cell. 2009; 136:215-233. Betito S, Cuvillier O. Regulation by sphingosine 1-phosphate of Bax and Bad activities during apoptosis in a MEK-dependent manner. Biochem Biophys Res Commun. 2006; 340:1273-1277. Biffi A, Capotondo A, Fasano S, et al. Gene therapy of metachromatic leukodystrophy reverses neurological damage and deficits in mice. J Clin Invest. 2006; 116:3070-3082. Biffi A, De Palma M, Quattrini A, et al. Correction of metachromatic leukodystrophy in the mouse model by transplantation of genetically modified hematopoietic stem cells. J Clin Invest. 2004; 113:1118-1129. Biffi A, De Palma M, Quattrini A, et al. Correction of Metachromatic Leukodystrophy in the Mouse Model by Transplantation of Genetically Modified Hematopoietic Stem Cells. J Clin Invest. 2004; 113:1118-1129. Boggs J M, Gao W, Hirahara Y. Myelin glycosphingolipids, galactosylceramide and sulfatide, participate in carbohydrate-carbohydrate interactions between apposed membranes and may form glycosynapses between oligodendrocyte and/or myelin membranes. Biochim Biophys Acta. 2008; 1780:445-455. Brady R O, Schiffmann R. Enzyme-replacement therapy for metabolic storage disorders. Lancet Neurol. 2004; 3:752-756. Brady R O. Enzyme replacement for lysosomal diseases. Annu Rev Med. 2006; 57:283-296. Brennecke J, Stark A, Russell R B, Cohen S M. Principles of microRNA-target recognition. PLoS Biol. 2005; 3:e85. Brogi A, Strazza M, Melli M, Costantino-Ceccarini E. Induction of intracellular ceramide by interleukin-1 beta in oligodendrocytes. J Cell Biochem. 1997; 66:532-541. Brown B D, Cantore A, Annoni A, et al. A microRNA-regulated lentiviral vector mediates stable correction of hemophilia B mice. Blood. 2007; 110:4144-4152. Brown B D, Gentner B, Cantore A, et al. Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state. Nat Biotechnol. 2007; 25:1457-1467. Brown B D, Venneri M A, Zingale A, Sergi Sergi L, Naldini L. Endogenous microRNA regulation suppresses transgene expression in hematopoietic lineages and enables stable gene transfer. Nat Med. 2006; 12:585-591. Capotondo A, Cesani M, Pepe S, et al. Safety of Arylsulfatase A Overexpression for Gene Therapy of Metachromatic Leukodystrophy. Hum Gene Ther. 2007; [Epub ahead of print] PMID: 17845130. Chen C Z, Li L, Lodish H F, Bartel D P. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004; 303:83-86. Chudakova D A, Zeidan Y H, Wheeler B W, et al. Integrin-associated Lyn kinase promotes cell survival by suppressing acid sphingomyelinase activity. J Biol Chem. 2008; 283:28806-28816. Divaka ran V, Mann D L. The emerging role of microRNAs in cardiac remodeling and heart failure. Circ Res. 2008; 103:1072-1083. Fazi F, Rosa A, Fatica A, et al. A minicircuitry comprised of microRNA-223 and transcription factors NH-A and C/EBPalpha regulates human granulopoiesis. Cell. 2005; 123:819-831. Fish J E, Santoro M M, Morton S U, et al. miR-126 regulates angiogenic signaling and vascular integrity. Dev Cell. 2008; 15:272-284. Gaziev J, Lucarelli G. Stem cell transplantation and gene therapy for hemoglobinopathies. Curr Hematol Rep. 2005; 4:126-131. Gentner B, Schira G, Giustacchini A, et al. Stable knockdown of microRNA in vivo by lentiviral vectors. Nat Methods. 2009; 6:63-66. Gentner B, Schira G, Giustacchini A, et al. Stable knockdown of microRNA in vivo by lentiviral vectors. Nat Methods. 2008. Gritti A, Parati E A, Cova L, et al. Multipotential stem cells from the adult mouse brain proliferate and self-renew in response to basic fibroblast growth factor. J Neurosci. 1996; 16:1091-1100. Haley B, Zamore P D. Kinetic analysis of the RNAi enzyme complex. Nat Struct Mol Biol. 2004; 11:599-606. Harada J, Foley M, Moskowitz M A, Waeber C. Sphingosine-1-phosphate induces proliferation and morphological changes of neural progenitor cells. J Neurochem. 2004; 88:1026-1039. He L, He X, Lowe S W, Hannon G J. microRNAs join the p53 networkanother piece in the tumour-suppression puzzle. Nat Rev Cancer. 2007; 7:819-822. Hofling A A, Devine S, Vogler C, Sands M S. Human CD34.sup.+ hematopoietic progenitor cell-directed lentiviral-mediated gene therapy in a xenotransplantation model of lysosomal storage disease. Mol Ther. 2004; 9:856-865. Huang Y, Tanimukai H, Liu F, Iqbal K, Grundke-Iqbal I, Gong C X. Elevation of the level and activity of acid ceramidase in Alzheimer's disease brain. Eur J Neurosci. 2004; 20:3489-3497. Jana A, Pahan K. Oxidative stress kills human primary oligodendrocytes via neutral sphingomyelinase: implications for multiple sclerosis. J Neuroimmune Pharmacol. 2007; 2:184-193. Johnidis J B, Harris M H, Wheeler R T, et al. Regulation of progenitor cell proliferation and granulocyte function by microRNA-223. Nature. 2008; 451:1125-1129. Kennedy J A, Barabe F, Poeppl A G, Wang J C, Dick J E. Comment on Tumor growth need not be driven by rare cancer stem cells. Science. 2007; 318:1722; author reply 1722. Kiel M J, Yilmaz O H, Iwashita T, Terhorst C, Morrison S J. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell. 2005; 121:1109-1121. Kitsera N, Khobta A, Epe B. Destabilized green fluorescent protein detects rapid removal of transcription blocks after genotoxic exposure. Biotechniques. 2007; 43:222-227. Krutzfeldt J, Rajewsky N, Braich R, et al. Silencing of microRNAs in vivo with antagomirs. Nature. 2005; 438:685-689. Krutzfeldt J, Stoffel M. MicroRNAs: a new class of regulatory genes affecting metabolism. Cell Metab. 2006; 4:9-12. Kuehbacher A, Urbich C, Zeiher A M, Dimmeler S. Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res. 2007; 101:59-68. Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T. New microRNAs from mouse and human. RNA. 2003; 9:175-179. Landgraf P, Rusu M, Sheridan R, et al. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell. 2007; 129:1401-1414. Lee J T, Xu J, Lee J M, et al. Amyloid-beta peptide induces oligodendrocyte death by activating the neutral sphingomyelinase-ceramide pathway. J Cell Biol. 2004; 164:123-131. Lee R C, Feinbaum R L, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993; 75:843-854. Lund E, Guttinger S, Calado A, Dahl berg J E, Kutay U. Nuclear export of microRNA precursors. Science. 2004; 303:95-98. Mechtcheriakova D, Wlachos A, Sobanov J, et al. Sphingosine 1-phosp hate phosphatase 2 is induced during inflammatory responses. Cell Signal. 2007; 19:748-760. Mercer T R, Dinger M E, Mattick J S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 2009; 10:155-159. Naldini L, Blomer U, Gallay P, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science. 1996; 272:263-267. Ott M G, Schmidt M, Schwarzwaelder K, et al. Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nat Med. 2006; 12:401-409. Ott M G, Seger R, Stein S, Siler U, Hoelzer D, Grez M. Advances in the treatment of Chronic Granulomatous Disease by gene therapy. Curr Gene Ther. 2007; 7:155-161. Pillai R S. MicroRNA function: multiple mechanisms for a tiny RNA? RNA. 2005; 11:1753-1761. Pronk C J, Rossi D J, Mansson R, et al. Elucidation of the phenotypic, functional, and molecular topography of a myeloerythroid progenitor cell hierarchy. Cell Stem Cell. 2007; 1:428-442. Reinhart B J, Slack F J, Basson M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000; 403:901-906. Rivera J, Proia R L, Olivera A. The alliance of sphingosine-1-phosphate and its receptors in immunity. Nat Rev Immunol. 2008; 8:753-763. Rohrbach M, Clarke J T. Treatment of lysosomal storage disorders: progress with enzyme replacement therapy. Drugs. 2007; 67:2697-2716. Rohrbach M, Clarke J T. Treatment of lysosomal storage disorders: progress with enzyme replacement therapy. Drugs. 2007; 67:2697-2716. Rosa A, Ballarino M, Sorrentino A, et al. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation. Proc Natl Acad Sci USA. 2007; 104:19849-19854. Sadelain M, Lisowski L, Samakoglu S, Rivella S, May C, Riviere I. Progress toward the genetic treatment of the beta-thalassemias. Ann N Y Acad Sci. 2005; 1054:78-91. Sadelain M. Recent advances in globin gene transfer for the treatment of beta-thalassemia and sickle cell anemia. Curr Opin Hematol 2006; 13:142-148. Sands M S, Vogler C, Torrey A, et al. Murine mucopolysaccharidosis type VII: long term therapeutic effects of enzyme replacement and enzyme replacement followed by bone marrow transplantation. J Clin Invest. 1997; 99:1596-1605. Sano R, Tessitore A, Ingrassia A, d'Azzo A. Chemokine-induced recruitment of genetically modified bone marrow cells into the CNS of GM1-gangliosidosis mice corrects neuronal pathology. Blood. 2005; 106:2259-2268. Schwarz D S, Hutvagner G, Du T, Xu Z, Aronin N, Zamore P D. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003; 115:199-208. Scurlock B, Dawson G. Differential responses of oligodendrocytes to tumor necrosis factor and other pro-apoptotic agents: role of ceramide in apoptosis. J Neurosci Res. 1999; 55:514-522. Terstappen L W, Huang S, Safford M, Lansdorp P M, Loken M R. Sequential generations of hematopoietic colonies derived from single nonlineage-committed CD34.sup.+ CD38.sup. progenitor cells. Blood. 1991; 77:1218-1227. Tomari Y, Zamore P D. Perspective: machines for RNAi. Genes Dev. 2005; 19:517-529. Wang S, Aurora A B, Johnson B A, et al. The endothelial-specific microRNA miR-126 governs vascular integrity and angiogenesis. Dev Cell. 2008; 15:261-271. Weil W M, Linton G F, Whiting-Theobald N, et al. Genetic correction of p67phox deficient chronic granulomatous disease using peripheral blood progenitor cells as a target for ret rovirus mediated gene transfer. Blood. 1997; 89:1754-1761. Woods N B, Bottero V, Schmidt M, von Kalle C, Verma I M. Gene therapy: therapeutic gene causing lymphoma. Nature. 2006; 440:1123. Wu Y P, Matsuda J, Kubota A, Suzuki K, Suzuki K. Infiltration of hematogenous lineage cells into the demyelinating central nervous system of twitcher mice. J Neuropathol Exp Neurol. 2000; 59:628-639. Xiao C, Rajewsky K. MicroRNA control in the immune system: basic principles. Cell. 2009; 136:26-36. Yeager A M, Brennan S, Tiffany C, Moser H W, Santos G W. Prolonged survival and remyelination after hematopoietic cell transplantation in the twitcher mouse. Science. 1984; 225:1052-1054. Yeager A M, Shinn C, Shinohara M, Pardon D M. Hematopoietic cell transplantation in the twitcher mouse. The effects of pretransplant conditioning with graded doses of busulfan. Transplantation. 1993; 56:185-190. Yesilipek M A. Stem cell transplantation in hemoglobinopathies. Hemoglobin. 2007; 31:251-256. Yi R, Qin Y, Macara I G, Cullen B R. Exportin-5 mediates the nuclear export of pre-microRNAs and short hairpin RNAs. Genes Dev. 2003; 17:3011-3016.