Poxvirus expression system

Abstract

There is provided a method for inserting a nucleic acid sequence that encodes a foreign peptide into a poxvirus genome, said method comprising: identifying in the poxvirus genome a poxvirus open reading frame wherein said open reading frame is characterized by an initial ATG start codon and wherein expression of said open reading frame is driven by an operably-linked poxvirus promoter located upstream of the open reading frame and wherein expression of said open reading frame provides a peptide that is non-essential to viability of the poxvirus; and inserting the nucleic acid sequence that encodes the foreign peptide at a position downstream of the poxvirus promoter; wherein following said insertion, (i) the nucleic acid that encodes the foreign peptide is operably-linked to the poxvirus promoter and expression of said nucleic acid is driven by said poxvirus promoter; and (ii) translation of the foreign peptide is initiated at an ATG start codon located at the same position as the ATG start codon of the poxvirus open reading frame. Also provided are a poxvirus vector and corresponding uses of the poxvirus vector in medicine.

Claims

1. A method for inserting a nucleic acid sequence that encodes a foreign peptide into a poxvirus genome, said method comprising: A) identifying in the poxvirus genome a poxvirus open reading frame wherein said open reading frame is characterised by an initial ATG start codon and wherein expression of said open reading frame is driven by an operably-linked poxvirus promoter located upstream of the open reading frame and wherein expression of said open reading frame provides a peptide that is non-essential to viability of the poxvirus; and B) inserting the nucleic acid sequence that encodes the foreign peptide at a position downstream of the poxvirus promoter; wherein following said insertion, (i) the nucleic acid that encodes the foreign peptide is operably-linked to the poxvirus promoter and expression of said nucleic acid is driven by said poxvirus promoter; and (ii) translation of the foreign peptide is initiated at an ATG start codon located at the same position relative to the poxvirus promoter as the ATG start codon of the poxvirus open reading frame, wherein the nucleic acid sequence that encodes a foreign peptide is inserted in frame with and immediately after the initial ATG start codon; or the nucleic acid sequence is inserted together with a start codon into the position previously occupied by the initial start codon of the poxvirus open reading frame.

2. The method of claim 1, wherein the nucleic acid sequence that encodes a foreign peptide lacks any promoter capable of driving expression of the foreign peptide.

3. The method of claim 1, wherein following insertion of the nucleic acid sequence that encodes a foreign peptide at least part of the poxvirus open reading frame remains present in the poxvirus genome.

4. The method of claim 1, wherein during step A) a poxvirus genome is identified that comprises a nucleic acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-10 and wherein the start codon of the open reading frame is located at positions 26-28 of any one of SEQ ID NOs: 1-10.

5. The method of claim 4, wherein the nucleic acid sequence that encodes a foreign peptide is inserted in frame with the ATG located at positions 26-28 of any one of SEQ ID NOs: 1-10.

6. The method of claim 1, wherein the nucleic acid sequence that encodes a foreign peptide is inserted by homologous recombination.

7. The method of claim 1, wherein the poxvirus is selected from: vaccinia virus, modified vaccinia virus Ankara (MVA), NYVAC, fowlpox virus, and canarypox virus.

8. The method of claim 7, wherein the poxvirus open reading frame is selected from the following MVA open reading frames: 176R, 041L, 027L, 157L, 052R, 005R, and 168R.

9. The method of claim 7, wherein the poxvirus is vaccinia virus.

10. The method of claim 9, wherein the poxvirus open reading frame is selected from the following vaccinia virus open reading frames: B8R, F11L, K6L, A44L, E5R, C11R, and B2R.

11. A poxvirus vector obtainable by the method of claim 1.

12. A poxvirus vector, comprising: at least one transgene; wherein said transgene comprises a poxvirus promoter and a nucleic acid sequence that encodes a foreign peptide, and wherein said poxvirus promoter is located upstream of said nucleic acid sequence that encodes a foreign peptide; wherein said poxvirus promoter is operably-linked to said nucleic acid sequence and expression of said nucleic sequence is driven by said poxvirus promoter; wherein the poxvirus promoter is a promoter that drives the expression of an open reading frame that is non-essential to the viability of a naturally-occurring poxvirus; wherein said nucleic acid sequence that encodes a foreign peptide includes an ATG start codon located at the same position relative to the poxvirus promoter as the ATG start codon of said non-essential poxvirus open reading frame; and wherein the nucleic acid sequence that encodes a foreign peptide is in frame with and immediately after the ATG start codon of the non-essential poxvirus open reading frame; or the nucleic acid sequence together with a start codon occupy the position previously occupied by the ATG start codon of non-essential poxvirus open reading frame.

13. The poxvirus vector of claim 12, wherein at least part of the nucleic acid sequence encoding the non-essential poxvirus open reading frame is present.

14. The poxvirus vector of claim 12, wherein the poxvirus vector comprises nucleotides 1-25 of any one of SEQ ID NOs: 1-10, or nucleotides 1-25 of a nucleotide sequence having at least 80% sequence identity to any one of SEQ ID NOs: 1-10; preferably wherein the ATG start codon of the open reading frame is located at a position immediately downstream of said nucleotides 1-25.

15. The poxvirus vector of claim 14, wherein the nucleic acid sequence that encodes a foreign peptide is located in frame with the ATG start codon located at a position immediately downstream of said nucleotides 1-25.

16. The poxvirus vector of claim 11, wherein the poxvirus is selected from: vaccinia virus, modified vaccinia virus Ankara (MVA), NYVAC, fowlpox virus, and canarypox virus.

17. A poxvirus vector according to claim 11, for use in medicine, for use in stimulating or inducing an immune response in a subject, or for use in the treatment or prevention of at least one infectious disease, wherein the poxvirus vector is administered to a subject, and wherein the poxvirus vector is attenuated or inactivated.

18. The poxvirus vector according to claim 17, wherein said vector is administered as part of a prime-boost vaccination regime.

19. A pharmaceutical composition comprising: a poxvirus vector according to claim 11; and a pharmaceutically acceptable carrier, wherein the poxvirus vector is attenuated or inactivated.

Description

LIST OF FIGURES

(1) FIG. 1:

(2) tPA-Pb9-rLuc8PV expression levels in culture supernatants of BHK cells 24 h after infection with recombinant MVAs at 1 pfu per cell in the presence or absence of AraC.

(3) FIG. 2:

(4) CD8+ T cell responses elicited by vaccination with recombinant MVAs measured by ELIspot assay. SFC=spot-forming cells.

(5) FIG. 3:

(6) Immunogenicity in mice immunized with rMVA-BACs after single shot MVA. Refer to Table 1 to convert this nomenclature into the BGXX nomenclature.

(7) FIG. 4:

(8) (TOP) Pb9-specific splenic CD8+ IFN?+ cell responses were measured 2 weeks post-boost (day 70) by ELISPOT.

(9) (BOTTOM) Antibody responses to rLuc assessed by ELISA.

(10) Refer to Table 1 to convert this nomenclature into the BGXX nomenclature.

(11) FIG. 5a-b:

(12) tPA-Pb9-rLuc8PV expression levels in culture supernatants of BHK cells at different time points post infection with the indicated recombinant MVAs and at 24 h post infection in the cell lysate (figure legend applies to both FIG. 5a and FIG. 5b).

(13) FIG. 6:

(14) Data relating to genetic stability, as presented in Example 4.

(15) FIG. 7:

(16) Data relating to promoter E3L, as presented in Example 5.

(17) FIG. 8:

(18) Vaccination regime: All mice were primed intramuscularly with Adenovirus-Photinus+Adenovirus-Pb9?1e7ifu each and boosted intramuscularly 14 weeks later with the following MVA viruses:

(19) 1) B8R-Photinus+MVA-BAC empty vector?10e6 pfu/mouse each given separately

(20) 2) C11R-Pb9rLuc+MVA-BAC empty vector?10e6 pfu/mouse each given separately

(21) 3) MVA-BAC-B8R-Photinus+MVA-BAC-C11R-Pb9rLuc?10e6 pfu/mouse each given separately

(22) 4) Double MVA-B8R-Photinus-C11R-Pb9rLuc?10e6 pfu/mouse

(23) ELIspot assay was done with mouse PBMC

EXAMPLES

Example 1

(24) Methods

(25) We selected seven MVA genes to demonstrate proof-of-concept (Tables 1 and 2) by using the promoters assumed to be present upstream of the ORFs to drive expression of an inserted transgene at the promoters' authentic loci.

(26) TABLE-US-00003 TABLE 1 Genes selected for proof-of-concept study Seq. MVA Vaccinia ID. ORF ortholog Notes BG02 176R B8R 3 inactivating truncation in MVA BG03 041L F11L Fragmented in MVA (041L + 040L) BG04 027L K6L Fragmented in vaccinia (K5L + K6L) and MVA (026L + 027L) compared to other poxviruses BG05 157L A44L Does not affect growth or immunogenicity in MVA; also non-essential in vaccinia BG06 052R E5R Polymorphic amongst vaccinia strains. Possible component of virosomes BG07 005R C11R Non-essential in MVA; non-essential in vaccinia BG08 168R B2R Fragmented in MVA (168R to 170R) and in vaccinia (B2R + B3R) compared to other poxviruses

(27) TABLE-US-00004 TABLE2 Sequencesandpositionsofinsertionsitesofselectedgenes Sequence25bpeithersiteofutilisedstartcodon(capitalised) PositionofAof Seq. Italicisationindicatescodingsequencetobereplacedby indicatedATGin ID. thatofthetransgene. GenBankU94848.sup.? BG02 cagtagtcaaataacaaacaacaccATGagatatattataattctcgcagttt 157621(topstrand) BG03 tatttttatcgttggttgtt *cactATGgggttttgcattccattgagatcaa 33771(bottomstrand) BG04 gcaaactgtatgttcaatctggacaATGattacatatcctaaggcattagtat 24694(bottomstrand) BG05 tagtctgatattatgagtggcagcaATGgccgtgtacgcggttactggtggtg 15377(bottomstrand) BG06 ttgatattaacaaaagtgaatatatATGttaataattgtattgtggttatacg 44810(topstrand) BG07 agcataaacacaaaatccatcaaaaATGttgataaattatctgatgttgttgt 10203(topstrand) BG08 ctcggtgggtacgacgagaatcttcATGcctttcctggaatatcatcgactgt 152144(topstrand) *This A at position ?5 of F11L is a mutation unique to MVA, and was changed to T during construction to make the promoter identical to the vaccinia virus sequence, with the aim of improving expression. This assumes that the mutation has a negative effect on expression, but no comparative data exists. .sup.?[Antoine, G., et al., Virology, 1998. 244(2): p. 365-96.]

(28) Using recombination mediated genetic engineering of a bacterial artificial chromosome clone of the genome of MVA with GalK selection, as described in Cottingham, M. G., et al., PLoS ONE, 2008. 3(2): p. e1638. (this publication is hereby incorporated by reference), we inserted a transgene encoding a model antigen, tPA-Pb9-rLuc8PV (described below), into these insertion loci such that the endogenous promoter presumed to lie upstream of the selected gene drove the expression of the transgene rather than the endogenous gene. In other words, the ATG capitalized in Table 2 was now the initiator codon for the transgene instead of the viral gene. The position of the 5 end of the transgenic insert is therefore fixed at this ATG, but that of the 3 end may vary: in the examples described, the targeted viral genes were additionally partly or wholly deleted. The factors affecting choice of the deleted region include removal of useless sequence (potentially coding for nonsense or truncated proteins) that is now transcribed at a much reduced level or not transcribed at all, balanced against retention of putative regulatory sequences that may overlap with the inactivated ORF (e.g. promoters, T5NT terminators).

(29) In order to facilitate measurement of transgenic expression levels and immunogenicity, we designed the reporter protein tPA-Pb9-rLuc8PV. This has a secretory signal sequence from tissue plasminogen activator (tPA), fused to an H-2K.sup.d restricted murine CD8.sup.+ T cell epitope from Plasmodium berghei circumsporozoite protein (Pb9) [Romero, P., et al., Immunol Lett, 1990. 25(1-3): p. 27-31], fused to Renilla reniformis luciferase (rLuc) containing 8 point mutations that improve protein stability and activity upon secretion [Loening, A. M., et al., Protein Eng Des Sel, 2006. 19(9): p. 391-400.] and a silent mutation to remove a poxviral terminator (T5NT) sequence (8PV). The reporter protein is secreted into the cell culture medium of cells infected with recombinant viruses expressing tPA-Pb9-rLuc8PV and can be quantified using a standard luminometric assay for renilla luciferase in vitro as well as by in vivo imaging. Pb9 peptide specific CD8.sup.+ T cells in immunised BALB/c mice can be enumerated using standard IFN-? ELIspot assays or intracellular cytokine staining and flow cytometry. Thus, by placing this construct downstream of the candidate endogenous-promoter-driven insertion loci (EPDILs) BG02 to BG08 (Table 1), we could evaluate their characteristics and utility.

(30) Results

(31) Recombinant MVA carrying tPA-Pb9-rLuc8PV at all seven of the EPDILs BG02 to BG08 were successfully isolated, checked for identity and clonality, amplified in bulk, purified by sucrose cushion ultracentrifugation, and titred by standard methods. The purified yields of all six viruses fell within the range typically achieved in our laboratory and were very similar to one another (between 1.8 and 5.4?10.sup.9 pfu/mL): though we have yet to perform formal analyses of yield, productivity and growth rate, this is strongly indicative of normal in vitro propagation. For comparative purposes, two conventional recombinants were included, one with p7.5 and one with SSP driving tPA-Pb9-rLuc8PV, plus a negative control lacking the transgene (titres 4.5 and 4.7?10.sup.9 pfu/mL). It proved more difficult to obtain a clonal preparation of the BG06-EPDIL virus than the other recombinants, possibly (but not necessarily) indicating an adverse effect of E5R deletion. The function of this gene is largely uncharacterised, but E5 protein has been reported to localise to early virosomes post-infection.

(32) Luciferase activity was assayed at 24 h post-infection with the recombinant MVAs in the presence and absence of cytosine arabinoside (AraC), a nucleoside analog which blocks viral DNA replication and therefore inhibits intermediate and late poxviral gene expression (FIG. 1). Thus, in the absence of AraC, the observed expression could derive from early, intermediate or late transcription, but in the presence of AraC, only early (pre-replicative) transcription is responsible. All viruses also expressed an independent green fluorescent protein (GFP) reporter to allow equality of infection to be verified by fluorimetry (data not shown), thus ensuring that differences arise from the promoters rather than merely from inaccurate viral titration and dilution.

(33) In the absence of AraC, the highly active synthetic promoter SSP produced the most luciferase activity, as expected. None of the novel endogenous promoter driven insertion sites approached this level, but three were comparable with the more modest activity of the commonly-used p7.5 promoter. When treated with AraC, the early activity of some of the novel promoters even exceeded that of SSP. In both conditions, BG04 exhibited very poor expression. These results indicate that, with the exception of BG04, all the EPDIL promoters have early activity comparable to or better than both canonical promoters, and overall (early+intermediate+late) activity comparable to or somewhat lower than p7.5.

(34) Murine Immunogenicity Studies:

(35) A first experiment was carried out, comparing BG02, BG04 and BG05 EPDIL recombinant MVAs to the conventional p7.5 and SSP driven recombinants. BALB/c mice were immunised intradermally with 10.sup.6 pfu of each virus and the Pb9 peptide specific T cell responses were analysed in splenocytes by ELIspot assay two weeks post-vaccination. As a control, CD8.sup.+ T cell responses to the immunodominant viral antigen encoded by F2L were measured using the F2(G) peptide [Tscharke, D. C., et al., J Virol, 2006. 80(13): p. 6318-23.] (FIG. 2).

(36) As expected, all five viruses tested elicited equal CD8.sup.+ T cell responses to the F2(G) viral antigen peptide (p=0.9 by ANoVA), but statistically significant differences were observed in the responses to the transgene-encoded Pb9 epitope, whose expression was driven by a different promoter in each virus (p<0.0001 by ANOVA). Surprisingly, both the BG02 and BG05 EPDIL recombinants elicited higher Pb9-specific CD8.sup.+ T cell responses even than the highly-active SSP, statistically significantly so in the case of BG02 (p<0.05 by Newman-Keuls post-hoc test). The BG04 EPDIL recombinant elicited a very low, but non-zero Pb9-specific CD8.sup.+ T cell response. Since the F2(G) responses were equivalent, these differences cannot be attributed to inequivalence of dose, so are therefore indicative of a promoter-dependent effect on transgene CD8.sup.+ T cell immunogenicity.

(37) A second experiment was carried out, expanding on the first murine immunogenicity experiment described above. Each group of mice (n=4) was immunized (i.m) with 106 pfu/mouse of rMVA-BACs at day 0 and spleens harvested 1 week (day 7) post immunization. Pb9-specific splenic CD8+ IFN?+ cell responses were measured by (A) intracellular cytokine staining (ICS) and flow cytometry (B) ELISPOT (FIG. 3nomenclature in FIG. 3 can be converted into the BGXX nomenclature with reference to Table 1).

Example 2

(38) Immunogenicity as Part of AdCh63-MVA Prime-Boost Regimen

(39) Prime-boost vaccination regimen to test immunogenicity of rMVA-BACs:

(40) Each group of mice (n=4) was immunized (i.m) with Chimpanzee Adenovirus 63 (AdCh63) at 108 ifu/mouse at day 0 and boosted 8 weeks later with rMVA-BACs. All viruses expressed model antigen, Pb9-rLuc8 (FIG. 4).

(41) This demonstrates the utility of these promoters when the MVA is used as a boost vaccine.

Example 3

(42) Kinetics of Reporter Gene Expression in Cells In Vitro

(43) tPA-Pb9-rLuc8PV expression levels in culture supernatants of BHK cells was measured at different time points post infection with the indicated recombinant MVAs and at 24 h post infection in the cell lysate (FIG. 5).

(44) The data obtained complement those shown in FIG. 1, and indicate that, in addition to the levels at 24 h post infection, the kinetics of gene expression from the endogenous promoter driven insertion loci are also equivalent.

Example 4

(45) Genetic Stability

(46) Recombinant viruses were subjected to five serial passages in BHK cells, after which no difference in luciferase expression in cells infected with the passage 1 or passage 5 inoculum was observed. This indicates that the transgene has remained stably integrated at all five of the novel endogenous promoter driven insertion loci (FIG. 6).

Example 5

(47) E3L/MVA050L

(48) BG17 uses the E3L (MVA050L) promoter to drive expression of the tPA-Pb9-rLuc8PV reporter gene (FIG. 7).

(49) TABLE-US-00005 ctggttgtgttagttctctctaaaaATGtctaagatctatattgacgag cgtt Postion43269inU94848(bottomstrand).

Example 6

(50) A single MVA virus was used to simultaneously express two different transgenes (in this case, two different luciferases) from two different promoters (FIG. 8). This offers superior immunogenicity to a mixture of two viruses.

(51) Mice were primed intramuscularly with Adenovirus-Photinus+Adenovirus-Pb9. An empty virus (i.e. lacking any transgene) was used as a control. ELIspot assay was done with mouse PBMC. The results show that the double virus produced a greater immune response than single administration.