PROCESS FOR DE NOVO MICROBIAL SYNTHESIS OF TERPENES

Abstract

The invention relates to microbial terpene production. Known methods for microbial production of terpenes are mostly based on the direct conversion of sugars. Therefore alternative substrates, in particular alternative carbon sources, for use in microbial terpene production were desirable. The invention relates to a methylotrophic bacterium containing recombinant DNA coding for at least one polypeptide with enzymatic activity for heterologous expression in said bacterium, wherein said at least one polypeptide with enzymatic activity is selected from the group consisting an enzyme of a heterologous mevalonate pathway, a heterologous terpene synthase and optionally a heterologous synthase of a prenyl diphosphate precursor. The invention further relates in particular to a method for de novo microbial synthesis of sesquiterpenes or diterpenes from methanol and/or ethanol.

Claims

1. A methylotrophic bacterium containing a heterologous terpene synthase and recombinant DNA coding for at least one polypeptide with enzymatic activity for expression in said bacterium, characterized in that said at least one polypeptide with enzymatic activity is selected from the group consisting of at least one enzyme of a heterologous mevalonate pathway selected from the group consisting of hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase), hydroxymethylglutaryl-CoA reductase (HMG-CoA reductase), mevalonate kinase, phosphomevalonate kinase, pyrophosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase; and a synthase of a prenyl diphosphate precursor.

2. A methylotrophic bacterium containing a heterologous hydroxymethylglutaryl-CoA synthase (HMG-CoA synthase) and a hydroxymethylglutaryl-CoA reductase (HMG-CoA reductase) as enzymes of a heterologous mevalonate pathway and recombinant DNA coding for at least one polypeptide with enzymatic activity for expression in said bacterium, characterized in that said at least one polypeptide with enzymatic activity is selected from the group consisting of at least one further enzyme of a heterologous mevalonate pathway selected from the group consisting of mevalonate kinase, phosphomevalonate kinase, pyrophosphomevalonate decarboxylase and isopentenyl pyrophosphate isomerase; a heterologous terpene synthase and a synthase of a prenyl diphosphate precursor.

3. The bacterium according to claim 1 or 2, characterized in that the at least one enzyme of the heterologous mevalonate pathway contains a peptide sequence with an identity of respectively at least 60% to the peptide sequence according to SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 or SEQ ID No. 6.

4. The bacterium according to any one of claims 1 to 3, characterized in that the heterologous terpene synthase is selected from the group consisting of a sesquiterpene synthase and a diterpene synthase.

5. The bacterium according to claim 4, characterized in that the heterologous terpene synthase is a sesquiterpene synthase, wherein the sesquiterpene synthase is an enzyme for the synthesis of a cyclic sesquiterpene, the sesquiterpene in particular is selected from the group consisting of -humulene and epimers of santalene, such as -santalene, -santalene, epi--santalene or -exo-bergamotene, and bisabolenes, such as b-bisabolene.

6. The bacterium according to claim 4, characterized in that the heterologous terpene synthase is a diterpene synthase, in particular an enzyme for the synthesis of a diterpene, the diterpene in particular selected from the group consisting of sclareol, cis-abienol, abitadiene, isopimaradiene, manool and larixol.

7. The bacterium according to any one of claims 1 to 6, characterized in that the synthase of a prenyl diphosphate precursor is an enzyme selected from the group consisting of farnesyl diphosphate synthase (FPP synthase) and gerany/geranyl diphosphate synthase (GGPP synthase).

8. The bacterium according to any one of 1 to 7, characterized in that the synthase of a prenyl diphosphate precursor is a heterologous FPP synthase, wherein the heterologous FPP synthase is a eukaryotic or prokaryotic FPP synthase.

9. The bacterium according to any one of 1 to 7, characterized in that the synthase of a prenyl diphosphate precursor is a heterologous GGPP synthase, wherein the heterologous GGPP synthase is an enzyme from an organism which is selected from the group consisting of bacteria, plants and fungi.

10. The bacterium according to any one of claims 1 to 9, characterized in that the recombinant DNA for heterologous expression of said enzymes is provided with a common inducible promoter or several mutually independently inducible promoters.

11. The bacterium according to any one of claims 1 to 10, characterized in that the recombinant DNA is in each case mutually independently expressible on plasmid or chromosomally.

12. The bacterium according to any one of claims 1 to 11, characterized in that the bacterium is a methylotrophic proteobacterium, in particular a bacterium of the genus Methylobacterium or of the genus Methylomonas , preferably the bacterium Methylobacterium extorquens.

13. The bacterium according to any one of claims 1 to 12, characterized in that the bacterium is a strain lacking carotenoid biosynthesis activity, in particular lacking diapolycopene oxidase activity.

14. A method for de novo microbial synthesis of sesquiterpenes or diterpenes from methanol and/or ethanol, comprising the following steps: providing a methanol and/or ethanol-containing aqueous medium, culturing a methylotrophic bacterium according to any one of claims 1 to 13 in said medium in a bioreactor, wherein methanol and/or ethanol is converted into a terpene by the bacterium, separating the sesquiterpene or diterpene formed in the bioreactor.

15. The method according to claim 14, characterized in that in said medium methanol and/or ethanol is/are contained as the sole carbon source(s) for culturing said bacterium.

16. Use of a methanol and/or ethanol-containing medium for culturing a recombinant methylotrophic bacterium according to any one of claims 1 to 13 for the de novo microbial synthesis of sesquiterpenes or diterpenes from methanol and/or ethanol.

17. Use of a methylotrophic bacterium according to any one of claims 1 to 13 for the de novo microbial synthesis of sesquiterpenes or diterpenes from methanol and/or ethanol.

Description

FIGURES

[0165] FIG. 1 shows a schematic overview of the central metabolism of Methylobacterium extorquens AM1 including the endogenous terpene synthesis via the desoxyxylulose-5-phosphate pathway (DXP), the heterologously integrated mevalonate pathway (indicated by two boxes), a heterologous -humulene synthase zssl and a heterologous FPP synthase ERG20. M. extorquens possesses no IPP isomerase (fni). The heterologously integrated MVA genes relate to a hydroxymethylglutaryl-CoA synthase (hmgs), hydroxymethylglutaryl-CoA reductase (hmgr), mevalonate kinase (mvaK), phosphomevalonate kinase (mvaK2), pyrophosphomevalonate decarboxylase (mvaD) and isopentenyl pyrophosphate isomerase (fni). Further genes: dxs: 1-desoxy-D-xylulose-5-phosphate synthase, dxr: 1-desoxy-D-xylulose-5-phosphate reductase, hrd: HMB-PP reductase, ispA: endogenous FPP synthase; molecule abbreviations: 2PG: 2-phosphoglycerate, 3PG: 3-phosphoglycerate, 1,3-DPG: 1,3-bisphosphoglycerate, GA3P: glyceraldehyde-3-phosphate, PEP: phosphoenol pyruvate, HMG-CoA: hydroxymethylglutaryl-CoA, DXP: 1-desoxy-D-xylulose-5-phosphate, MEP: 2-C-methyl-D-erythritol-4-phosphate, HMB-PP: (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate, IPP: isopentenyl pyrophosphate, GPP: geranyl pyrophosphate, FPP: farnesyl pyrophosphate.

[0166] FIG. 2 shows a chromatographic comparison of -humulene standard (upper panel, black line) and a sample from M. extorquens containing pFS33 (pCM80-zssl, upper panel, light gray line). The internal standard zerumbone elutes after 11.5 minutes. -Humulene in the pFS33 sample was identified by comparison of the mass spectra shown under the chromatogram.

[0167] FIG. 3 shows the tolerance of Methylobacterium extorquens AM1 towards -humulene directly dissolved in the aqueous phase or dissolved in the dodecane phase as a second organic phase. Maximum growth rates in respective medium without -humulene (.sub.max) are compared with growth rates () at different -humulene concentrations. It can be seen that -humulene has only minimal growth-inhibiting effects on M. extorquens, even at concentrations of 1 g/I., -humulene in the dodecane phase has a slightly lesser influence than in the aqueous phase, since it has less contact with the cells.

[0168] FIG. 4 shows the -humulene production of M. extorquens AM1 bearing the plasmids pFS33 (pCM80-zssl), pFS34 (pCM80-zssl-ERG20), pFS45 (pHC115-zssl), pFS46 (pHC115-zssl-ERG20), pFS49 (pQ2148F-zssl) and pFS50 (pQ2148F-zssl-ERG20). Black bar sections show the production without induction, whereas the gray bar sections represent the production with induction. pCM80 bears a constitutive promoter. The concentrations were compared 48 hours after culturing (pFS33, 34) and after induction (pFS45, 46, 49 50) respectively;

[0169] FIG. 5 shows the -humulene production of M. extorquens bearing the plasmids with optimized ribosome binding sites (RBS) for -humulene synthase (zssl), FPP synthase (ERG20) and IPP isomerase (fni) in various combinations. The translation initiation rates for the genes are stated on the y-axis in brackets. The concentrations are average product concentrations from three 3 transformants, wherein each was grown in two separate cultures. Black bars: plasmids (pFS49, pFS57) which contain only zssl, hatched bars: plasmids (pFS50, pFS58, pFS60a, pFS60b) which contain zssl and ERG20, gray bars: plasmids (pFS61b, pFS62a, pFS62b) containing zssl, ERG20 and the six genes of the mevalonate pathway.

[0170] FIG. 6 A: Chromatograms (n=502 nm) of unsaponified carotenoid extract from E. coli expressing the diapophytoene synthase and diapophytoene desaturase from S. aureus via pACCRT-MN (A1) and from M. extorquens carotenoid biosynthesis deficient strain CM502 (A2). The theoretical retention time of lycopene is indicated with the arrow. B: -humulene production of M. extorquens AM1 and CM502 bearing plasmid pFS62b (pQ2148F-zssl.sup.225k-ERG20.sup.22k-fni.sup.65k-MVA) in shaker flasks 48 hours after induction (n=3).

[0171] FIG. 7: Cell dry weight and -humulene concentration formed from the strain CM502 bearing pFS62b in fermentation 5 (according to Table 3). The time point 0 gives the time point of induction with cumate, represented by the dotted vertical line. Standard deviations of the -humulene concentrations were determined from the same sample by threefold analysis. Black squares: -humulene concentration, gray circles: cell dry weight.

[0172] FIG. 8 shows the chromatographic comparison of cis-abienol standard (upper panel, labeled line) and a sample from M. extorquens containing ppjo16 (pQ2148F-AbCAS-ERG20F96C-MVA, upper panel, labeled line). The internal standard zerumbone elutes after 11.3 minutes. Cis-abienol in the 16s6 sample was identified by comparison of the mass spectra shown below the chromatogram.

[0173] FIG. 9 shows a chromatographic comparison of sandalwood oil (upper panel (a), dark gray line) and a sample from M. extorquens containing ppjo03 (pQ2148F-SanSyn-ERG20-MVA), upper panel (a), black line). -Santalene in the ppjo03 sample was identified by comparison of the mass spectra (b, c) shown under the chromatogram.

EXAMPLES

[0174] The following examples serve to illustrate the invention. They must not be interpreted as limiting with regard to the scope of protection.

Example 1

Recombinant -Humulene Production

[0175] 1. Material and Methods

[0176] 1.1 Chemicals, Media and Bacterial Strains

[0177] Methylobacterium extorquens AM1 (Peel and Quayle, 1961. Biochem J. 81, 465-9) was cultured at 30 C. in minimal media, wherein for the culturing in the shaker flask the medium according to Kiefer et al., 2009 (PLoS ONE. 4, e7831) was used. The fermentation medium contains an end concentration of 30 mM PIPES, 1.45 mM NaH.sub.2PO.sub.4, 1.88 mM K.sub.2HPO.sub.4, 1.5 mM MgCl.sub.2, 11.36 mM (NH.sub.4).sub.2SO.sub.4, 20 M CaCl.sub.2, 45.6 M sodium citrate (Na.sub.3C.sub.6H.sub.5O.sub.7*2H.sub.2O), 8.7 M ZnSO.sub.4*7H.sub.2O, 15.2 M MnCl.sub.2*4H.sub.2O, 36 M FeSO.sub.4*7H.sub.2O, 1 M (NH.sub.4).sub.6Mo.sub.7O.sub.24*4H.sub.2O, 0.3 M CuSO.sub.4*5H.sub.2O and 12.6 M CoCl.sub.2*6H.sub.2O.

[0178] Escherichia coil strain DH5 (Gibco-BRL, Rockville, USA) was cultured in lysogeny broth

[0179] (LB) medium (Bertani, 1951. J. Bacteriol. 62, 293-300) at 37 C. Tetracycline hydrochloride was used at concentration 10 g/ml for E. coil and M. extorquens. Cumate (4-isopropylbenzoic acid) was used as inducer with an end concentration of 100 M diluted from a 100 mM stock solution dissolved in ethanol (culturing in the shaker flask) or methanol, (culturing in the bioreactor).

[0180] Cumate, tetracycline hydrochloride, -humulene, zerumbone and (RS)-mevalonic acid lithium salt were purchased from Sigma-Aldrich (Steinheim, Del.). Dodecane was purchased from VWR (Darmstadt, Del.).

[0181] 1.2 Genetic Manipulations and Plasmid Construction

[0182] The standard cloning techniques were performed according to the procedures known to those skilled in the art. The transformation of plasmids into M. extorquens AM1 or CM502 was performed as described in Toyama et al. (Toyama et al., 1998, FEMS Microbiol. Lett. 166, 1-7).

[0183] Ribosome binding sites (RBS) were designed with the aid of the ribosome binding site calculator (Sails, 2011, Methods in Enzymology, ed. V. Christopher, 19-42. Academic Press). The codon adaptation index (CAI) was determined with the CAI calculator (Puigbo et al., 2008, BMC Bioinformatics. 9, 65).

[0184] 1.3 Cloning of Mevalonate Pathway (MVA) Genes from Myxococcus xanthus

[0185] Genomic DNA from Myxococcus xanthus DSM16525 was purchased from DSMZ

[0186] (Braunschweig, Del.), The EcoRI restriction site of hmgs, coding for HMG-CoA synthase, was removed by Overlap extension PCR with insertion of a silent mutation (gagttc to gagttc). For this, the first part of the gene was amplified by means of the primers HMGS-fw and HMGS-over-rev, while HMGS-over-fw and HMGS-rev were used for the second part. The resulting PCR products were utilized as mega primers together with HMGS-fw and HMGS-rev for the final amplification of hmgs (SEQ ID No. 7) without the EcoRI restriction site.

[0187] The mevalonate pathway operon from M. xanthuscontaining the genes hmgr (SEQ ID No. 8), mvaK1 (SEQ ID No. 9), mvaK2 (SEQ ID No. 10), mvaD (SEQ ID No. 11) and fni (SEQ ID No. 12) coding respectively for HMG-CoA reductase, mevalonate kinase, phosphomevalonate kinase, pyrophosphomevalonate reductase and isopentenyl-pyrophosphate isomerase, was cleaved out of the plasmid pUC18-mva-op (Mi et al., 2014, Microbial cell factories. 13, 170).

[0188] 1.4 Cloning of Plasmids Containing the -Humulene Synthase

[0189] The multiple cloning site of plasmid pQ2148 (Kaczmarczyk et al., 2013, Appl. Environ. Microbiol. 79, 6795-802) was modified for increased cloning flexibility. For this, primers pQF-MCS-fw and pQF-MCS-rev were annealed by heating 100 l annealing buffer (10 mM TRIS pH7.5, 50 mM NaCl, 1 mM EDTA) containing 10 M of each primer for 15 mins followed by slow cooling to room temperature for three hours. The annealed primers were ligated into pQ2148 which had been cleaved with Spel and Xhol, yielding plasmid pQ2148F.

[0190] The -humulene synthase gene zssl, originally deriving from Zingiber zerumbet (Yu et al., 2008, Planta. 227, 1291-9) (Accession number AB263736.1), was codon-optimized for M. extorquens AM1 with obtention of the DNA sequence according to SEQ ID No. 16. The codon-optimized gene according to SEQ ID No. 16 was amplified for insertion into pCM80 (Marx and Lidstrom, 2001, Microbiology. 147, 2065-2075) and pHC115 (Chou and Marx, 2012, Cell reports. 1, 133-40) using the primers ZSSI-fw and ZSSI-rev. An RBS-optimized variant (translation initiation rate (TIR) of 221,625) for pQ2148F was amplified using the primers ZSSI-RBS-fw and ZSSI-rev. The RBS-optimized variant of zssl with a TIR of 221,625 contains the nucleic acid sequence AGCTTAAGGATAAAGAAGGAGGTAAAAC (SEQ ID No. 41). The gene for the FPP synthase ERG20 from Saccharomyces cerevisiae was amplified from genomic DNA with the primers ERG20-fw and ERG20-rev. RBS-optimized variants were amplified with primers ERG20-RBS35k-fw or ERG20-RBS20k-fw in combination with ERG20-rev-2 resulting in two ERG20 PCR products, each having an RBS with a TIR of 36,800 or 22,000. The RBS-optimized variant of ERG20 with a TIR of 22,000 contains the nucleic acid sequence ACATCAAACCAAAGGACTTTACAGGTAGTAGAA (SEQ ID No. 39). The RBS-optimized variant of ERG20 with a TIR of 36,800 contains the nucleic acid sequence GAGAAGAGCAGACTCGATCATAACAGGGGACTAG (SEQ ID No. 40).

[0191] The zssl PCR product was digested with Sphl and Xbal and inserted into identically digested plasmid pCM80, yielding plasmid pFS33. C/al and Snaal digested PCR product from ERG20 was then cloned into the same restriction sites of pFS33 resulting in pFS34. The hmgs gene without the EcoRl restriction site (see above) was inserted behind ERG20 using the restriction cleavage sites Xbal and BamH1. The M. xanthus mevalonate operon was cleaved out of pUC18-mva-op with BamH1 and EcoRl and reinserted into identically digested pFS34-hmgs yielding pFS44.

[0192] The plasmids pFS45 (pHC115-zssl), pFS46 (pHC115-zssl-ERG20) and pFS47 (pHC115-zssl-ERG20-hmgs-MVAop) were constructed by cleaving zssl out from pFS33, zssl-ERG20 out from pFS34 and zssl-ERG20-hmgs-MVAop out from pFS44 with MH and EcoRl followed by their insertion into identically digested pHC115.

[0193] The plasmids pFS49 (pQ2148F-zssl) and pFS50 (pQ2148F-zssl-ERG20) were constructed by cleaving zssl and zssl-ERG20 out from pFS33 and pFS34 respectively with Af/ll and Xbal followed by their insertion into identically digested pQ2148F. Hmgs and MVAop were cleaved out from pFS44 by Xba1 and EcoRl and subsequent insertion into the same restriction sites of pFS50 resulted in pFS52 (pQ2148F-zssl-ERG20-hmgs-MVAop).

[0194] The PCR product of the -humulene synthase gene zssl with optimized RBS was digested with Spel and Xbal and ligated into identically digested pQ2148F yielding pFS57. The PCR product of ERG20 with optimized RBS was cloned behind zssl from pFS57 with Clal and Xbal resulting in pFS58 (pQ2148F-zssl.sup.RBSopt_-ERG20). Hmgs-MVAop was inserted into pFS58 as described for pFS52 yielding pFS59. RBS variants for ERG20 (TIR=35,000 and 20,000) were digested with Clal and Xbal and inserted into correspondingly cleaved pFS57 yielding pFS60a (zssl.sup.RBSopt_-ERG20.sup.35k) and pFS60b (zssl.sup.RBSopt_-ERG20.sup.20k) respectively. Insertion of hmgs-MVAop into pFS60a and pFS60b resulted in plasmids pFS61a (zssl.sup.RBSopt_-ERG20.sup.35K-hmgs-MVAop) and pFS61b (zssl.sup.RBSopt_-ERG20.sup.35k-hmgs-MVAop) respectively. The RBS of the IPP isomerase gene fni was optimized for pFS61a and pFS61 b by insertion of initially annealed primers fni-RBSopt-fw and fni-RBSopt-rev (annealing method see above) into restriction sites Hpal and BamH1. The resulting plasmids pFS62a and pFS62b have a TIR of 65,000 for the fni RBS. The optimized RBS for the gene fni here has the nucleotide sequence gttctaggaggaataata (SEQ ID No. 48). The optimized RBS for the gene hmgs in plasmids pFS61a and pFS61b and also pFS62a and pFS62b has the nucleotide sequence SEQ ID No. 90 with a TIR of 189.

[0195] An overview of the primers, plasmids and strains used is shown in Table 1,

TABLE-US-00001 TABLE1 Primers,plasmidsandstrainsused. Name Description Reference Primers HMGS-fw AGTCTAGAGAGGAGCGCAGGATGAAGAAGCGCGTGGGAAT (SEQIDNo.17) HMGS-rev ATCTGGATCCGTTTAAACCCTGCAGGACCGGTGTTAACTCAG TTCCCTTCGGCGTAC(SEQIDNo.18) HMGS- GCTGCGCGGCCGAGTTCTACTCCGGCACG(SEQIDNo.19) over-fw HMGS- CGTGCCGGAGTAGAACTCGGCCGCGCAGC(SEQIDNo.20) over-rev MVA1_fw ATCTGGATCCTAGGAGGAATAATATGGGCGACGACATCACT G(SEQIDNo.21) MVA- AACACCATGGCGAGCTCTC(SEQIDNo.22) SacIA-rev MVA- GAGAGCTCGCCATGGTGTT(SEQIDNo.23) SacIA-fw MVA- GTGCCCGTTGAGCTCCACCT(SEQIDNo.24) SacIB-rev MVA- AGGTGGAGCTCAACGGGCAC(SEQIDNo.25) SacIB_fw MVA2_rev ATCGAATTCAAGCTTTCAGCTCAGCGCGCGCACC(SEQID No.26) pQF_MCS- CTAGTCTGCAGCTTAAGCATGCTCTAGAAGATC(SEQIDNo. fw 27) pQF_MCS- TCGAGATCTTCTAGAGCATGCTTAAGCTGCAGA(SEQIDNo. rev 28) ZSSI-fw TAGCATGCTTAAGAAGGATCAGTCATAATGGAACGCCAGTC GATGG(SEQIDNo.29) ZSSI-RBS- ATACACTAGTAGCTTAAGGATAAAGAAGGAGGTAAAACATG fw GAACGCCAGTCGATGG(SEQIDNo.30) ZSSI-rev AGTCTAGATACGTAATCGATTCAGATGAGGAACGACTCGA (SEQIDNo.31) ERG20_fw ATCGTATCGATAGGAGCGCAGGATGGCTTCAGAAAAAGAAA TTAG(SEQIDNo.32) ERG20-RBS ATCGTATCGATGAGAAGAGCAGACTCGATCATAACAGGGG (35k)-fw ACTAGATGGCTTCAGAAAAAGAAATTAG(SEQIDNo.33) ERG20-RB ATCGTATCGATACATCAAACCAAAGGACTTTACAGGTAGTA S(20k)-fw GAAATGGCTTCAGAAAAAGAAATTAG(SEQIDNo.34) ERG20_rev atcgtacgtaCTATTTGCTTCTCTTGTAAACT(SEQIDNo.35) ERG20_rev- ACTATCTAGATAAAGTAGAGGAGGATTAATCTATTTGCTTCTC 2 TTGTAAACT(SEQIDNo.36) fni-RBSopt- AACCTAAAATTAACGAGGAAAGAGGGAGGTTACAG(SEQID fw No.37) fni-RBSopt- GATCTGTAACCTCCCTCTTTCCTCGTTAATTTTAGGTT(SEQ rev IDNo.38) Plasmids pUC18 ExpressionvectorforEscherichiacoli;Amp.sup.R,lacZpromoter, Norrander pBR322ori 1983 pACCRT- Plasmid,forexpressionofdiapophytoenesynthaseand Sandmann MN desaturaseinEscherichiacoli;Amp.sup.R;containsgenesfor diapophytoenesynthase(crtM)anddiapophytoenedesaturase (crtN)fromStaphylococcusaureusundercontrolofalacZ promoter pCM80 ConstitutiveexpressionvectorforMethylobacteriumextorquens; Marx Tet.sup.R,pmxaF,oriT,pBR322ori 2001, Microbiology. 147, 2065- 2075. pHC115 ExpressionvectorforMethylobacteriumextorquenswithcumate Chou induciblepmxaFpromotervariant;Kan.sup.R,oriT,pBR322ori 2012,Cell reports.1, 133-40. pQ2148 ExpressionvectorforMethylobacteriumextorquenswithcumate Kaczmarczyk induciblepromoter2148;Tet.sup.R,oriT,pBR322ori 2013, Appl. Environ. Microbial. 79,6795- 802. pQ2148F pQ2148withadaptedMCS pUC18- pUC18withMyxococcusxanthusMVAoperon(hmgr,mvaK, MVAop mvaK2,mvaD,fni) pCM80- pCM80withhydroxymethylglutarylsynthasehmgs HMGS pCM80- pCM80withcompletemevalonate(MVA)pathway MVA pCM80- pCM80withcompletemevalonatepathwayandFPPsynthase MVA- ERG20 ERG20 pFS33 pCM80withalpha-humulenesynthasezssl pFS34 pCM80withalpha-humulenesynthasezsslandFPPsynthase ERG20 pFS44 pFS34-hmgs-MVAop pFS45 pHC115withalpha-humulenesynthasezssl pFS46 pHC115withalpha-humulenesynthasezsslandFPPsynthase ERG20 pFS47 pFS46-hmgs-MVApp pFS49 pQ2148Fwithalpha-humulenesynthasezssl pFS50 pQ2148Fwithalpha-humulenesynthasezsslandFPPsynthase ERG20 pFS52 pFS50-hmgs-MVAop pFS57 pQ2148Fwithalpha-humulenesynthasezsslwithoptimizedRBS pFS58 pFS57-ERG20 pFS59 pFS58-hmgs-MVApp pFS60a pFS57-ERG20.sup.35k(RBSwithauof35,000) pFS60b pFS57-ERG20.sup.20k(RBSwithauof35,000) pFS61a pFS60a-hmgs-MVAop pFS61b pFS60b-hmgs-MVAop pFS62a pFS61awithoptimizedRBSoftheIPPisomerasefni pFS62b pFS61bwithoptimizedRBSoftheIPPisomerasefni Strains E.coli F-,80dlacZM15,(lacZYA-argF)U169,deoR,recA1,endA1, ATCC DH5 hsdR17(rK.sup.mK.sup.+),phoA,supE44,.sup.,thi-1 M. Facultativelymethylotrophic,obligatorilyaerobic,gram-negative, Peel& extorquens pinkpigmenteda-proteobacterium,Cm.sup.R Quayle AM1 1961, Biochem J,81,465- 9. DSM1338 M. Carotenoidbiosynthesisdeficientstrain VanDien extorquens etal., CM502 2003, Appl. Environ. Microbiol. 69,7563- 6. Saccharomyces MATa;ura3-52;trp1-289;leu2-3,112;his3 1;MAL2-8.sup.c;SUC2 Entian& cerevisiae Mittel- CEN.PK2- 1998, 1c Academic PressLtd., San Diego,pp. 431-449 Underlined and italic sequences (all 5 .fwdarw. 3) indicate recognition sites for restriction enzymes. Bold letters show sequences of ribosome binding sites (RBS), au: translation initiation rate (TIR) according to Salis Lab RBS calculator; op: operon, MVA: mevalonate pathway.

[0196] 1.5 -Humulene Production in Aqueous Organic Two Phase Shaker Flask Culture Methylobacterium extorquens AM1 or CM502, containing the -humulene production plasmids, were cultured in methanol minimal medium containing tetracycline hydrochloride (see above). Precultures were inoculated from agar plates into test tubes with 5 ml medium and shaken for 48-72 h at 30 C. and 180 rpm. Main cultures with 12 ml medium in 100 ml baffled shaker flasks were inoculated with a preculture to an OD600 of 0.1. After culturing for 16 h at 30 C. and 120 rpm the main cultures reached the early exponential growth phase (OD.sub.6000.3-0.6). Next, cumate was added for the induction and 3 ml dodecane added as organic phase. After 48 h incubation a total culture volume of 15 ml was decanted and centrifuged for 10 min at 3220 g. 1 ml of the upper dodecane layer was used for the -humulene analysis. The cell pellet was resuspended in 1 ml dH.sub.2O for intracellular -humulene analysis.

[0197] 1.6 Dodecane and -Humulene Tolerance of M. extorquens AM1

[0198] M. extorquens AM1 precultures were cultured in test tubes with 5 ml methanol minimal medium (MM) for 48 h. The tolerance of M. extorquens AM1 towards 20% (v/v) dodecane was studied by growth comparison ( OD.sub.600) of cultures containing 15 ml MM and cultures with 12 ml MM and 3 ml dodecane. The cultures for the growth comparison with and without dodecane were inoculated from one preculture.

[0199] The -humulene tolerance was tested in two ways: tolerance towards -humulene added directly to the aqueous phase and tolerance towards -humulene dissolved in the organic dodecane layer. For the first experiment, pure -humulene dissolved in ethanol was added to 100 ml baffled shaker flasks containing 15 ml MM with end concentrations of -humulene of 1000, 500, 250, 100, 50, 25, 10 and 5 mg/L. Corresponding quantities of ethanol were added to the MM as negative controls. The flasks with the different -humulene concentrations and the corresponding negative controls were inoculated with a preculture without -humulene to an OD.sub.600 of 0.1. The OD.sub.600 was recorded over 30 h.

[0200] For the second said experiment, pure -humulene was dissolved in dodecane and solutions with 1000, 500, 100, 50 and 10 mg/L -humulene prepared. Two cultures each with 12 ml MM and 3 ml dodecane for each -humulene concentration were inoculated to an OD.sub.600 of 0.1 from a preculture of M. extorquens AM1 without dodecane. Cultures with dodecane without -humulene were used as negative controls. OD.sub.600 was measured over 30 h.

[0201] 1.7 -Humulene Analysis

[0202] 1 ml dodecane sample was dried with NaSO.sub.4. As the internal standard 25 l of 1 mM zerumbone dissolved in dodecane were added to 225 l dodecane sample.

[0203] Intracellular -humulene was extracted as follows: resuspended cell pellet was placed in a 4 ml GC vessel together with ca. 300 mg of 0.2 mm glass balls. The cells were intensively vortexed 330 s with interim ice cooling. The lysed cells were extracted three times with 1 ml hexane followed by a volume reduction to 1 ml by means of a current of nitrogen. As the internal standard, 25 l of 1 mM zerumbone dissolved in hexane was added to 225 l sample.

[0204] -humulene was analyzed and quantified by means of GC-MS (GC17A with Q5050 Mass Spectrometer, Shimadzu, Kyoto, Japan) equipped with an Equity 5 column (Supelco, 30 m0.25 mm0.25 M). Measurements were performed twice as follows: carrier gas: helium; split injection (8:1) at 250 C.; flow rate: 2.2 ml/min; interface temperature: 250 C.; program: 80 C. hold for 3 mins, 16 C./min to 240 C., hold for 2 mins. The retention time was 9.3 mins for -humulene and 11.5 min for zerumbone, -Humulene in the samples was identified by comparison of three main fragmentations of the mass spectra with a commercially obtained -humulene standard (rel. intensity in brackets): 93 (15.5), 41 (11.4), 80 (6.7). For a quantification, a calibration curve with the concentrations 4500, 2250, 900, 675, 450, 225, 90, 67.5, 22.5, 9 and 4.5 M -humulene each with 100 M zerumbone was used.

[0205] 1.8 Carotenoid Extraction and Analysis

[0206] For the carotenoid extraction, cells of M. extorquens AM1 or E. coli were pelleted by centrifugation, washed with ddH.sub.2O and lyophilized in the dark.

[0207] For unsaponified extracts, 2 mi methanol were added to 50 mg of disintegrated freeze-dried cells with subsequent incubation at 65 C. for 30 mins. After centrifugation (10 mins, 4000g, 4 C.) the supernatant was dried with nitrogen and resuspended in 0.5 ml of a petroleum ether (40-60 C.): diethyl ether: acetone: methanol (40:10:15:5) mixture. Precipitated proteins were removed by centrifugation (5 mins, 16,000g, 4 C.) and the supernatant was taken up in 100 l tetrahydrofuran (THF) for the HPLC analysis after drying with nitrogen. For saponified extracts, after protein removal with 10% KOH solution (dissolved in methanol) the supernatant was incubated for 2 h at RT. The upper organic phase was then dried with nitrogen and taken up in 100 l THE for the HPLC analysis.

[0208] The HPLC analysis was performed with a Shimadzu SCL10 system (SPD10A UVNIS detector, SPD-M10A diode array detector, SIL10A autosampler, CTO-10AC column oven; each Shimadzu, Kyoto, Japan). Carotenoids were separated on a reverse phase C18 column (250 mm4.5 mm5 ; Alltech, Deerfield, USA) using a gradient program of acetonitrile: methanol: 2-propanol (85:10:5) as solvent A and 100% 2-propanol as solvent (Solv.) B. At a flow rate of 1 ml/min at 32 C. the following elution program was run: 100% Solv. A, 0% Solv. B 0-31 min, 0% Solv. A, 100% Solv. B 31-36 min, 100% Solv. A and 0% Solv. B 36-45 min. A wavelength range of 190-600 nm was monitored by diode array detector. The retention time of lycopene was 25.38 mins. Diapolycopene was identified via a comparison with a carotenoid extract from E. coli, which expresses diapophytoene synthase and diapophytoene desaturase from Staphylococcus aureus via pACCRT-MN (see Table 1).

[0209] 1.9 Fermentation

[0210] Fed batch cultures were performed in a 2.4 I KLF 2000 fermenter (Bioengineering AG, Wald, Switzerland) with a pH and pO.sub.2 electrode from Mettler-Toledo (Greifensee, Switzerland), two six-paddle turbine stirrers and a downward directed paddle stirrer. Filter-sterilized air or oxygen was provided at a flow rate of 50 l/h. All experiments were performed at 30 C. and at a pH of 6.75, which was regulated by automatic introduction of NH.sub.4OH (30%). The concentration of dissolved oxygen (DO) was automatically regulated by adjustment of the stirring speed beginning at 700 rpm. Oxygen and carbon dioxide were measured in the exhaust air with a BINOS 1001 gas analyzer (Rosemount Analytical, Hanau, Del.).The methanol concentration was monitored online and regulated half-hourly with a ProcessTRACE 1.21 MT system (Trace Analytics, Braunschweig, Del.), equipped with a dialysis probe. The methanol feed was configured as follows: below a concentration of 1 g/I, 0.79 g (1 ml) and below 0.5 g/I, 1.42 g (1.8 ml) methanol was introduced via a Watson-Marlow 505Du peristaltic pump (Cornwall, England). Anti-foam B emulsion (Sigma-Aldrich) was manually added to reduce foaming, in addition to a six-paddle turbine stirrer, which is mounted directly over the liquid phase as a mechanical foam breaker.

[0211] After in situ sterilization of 900 ml fermentation medium (see above), the fermenter with an OD.sub.600 of 0.5-1 was inoculated with a preculture which has grown for 72 h in a shaker flask. After attainment of an OD.sub.600 of 5-10, 100 M cumate from a freshly prepared stock solution in methanol and 15% dodecane were added. The methanol feed rate was doubled after the induction. The induced culture was further cultured for 120 h, and samples were withdrawn manually, the cell dry mass and OD.sub.600 thereof were determined from the aqueous phase and -humulene in the organic dodecane phase were measured as described above.

[0212] 2. Results

[0213] 2.1 -Humulene Production Using Plasmids with Constitutive Promoter (Comparative Example)

[0214] Methylobacterium extorquens AM1 endogenously produces a farnesyl pyrophosphate (FPP) pool which is however converted into menaquinone, hopanes and carotenoids (see FIG. 1). In principle, this bacterium could synthesize -humulene through integration of a heterologous -humulene synthase. Plasmid pCM80 bears the strong pmxaF promoter and was selected as the vector for the expression of the -humulene synthase gene zssl. A codon-optimized variant of the gene from Zingiber zerumbet was introduced into in pCM80 with obtention of pFS33. To further increase the -humulene production, the FPP synthase from Saccharomyces cerevisiae (ERG20) was cloned into pFS33 behind the zssl gene with obtention of pFS34 (pCM80-zssl-ERG20).

[0215] The culturing was performed under the conditions described above, as aqueous organic two phase cultures, wherein dodecane is used as the organic phase. The strong hydrophobicity of -humulene results in complete accumulation in the dodecane phase, since intracellular -humulene was not detectable.

[0216] Two advantages in particular derive from this: -humulene concentrations can be measured directly in the dodecane phase and evaporation of -humulene is decreased by the high boiling point of dodecane. Furthermore, M. extorquens AM1 tolerates 20% dodecane, without any toxic effects or influence on growth being observable.

[0217] M. extorquens AM1 (also abbreviated below as: AM1) containing plasmid pFS33 was able to produce -humulene, as is shown by the peak with similar retention time and mass spectrum in comparison to the -humulene standard in FIG. 2. In contrast to this, no -humulene is detectable for M. extorquens AM1 with the empty vector control.

[0218] Both for AM1_pFS33 and also AM1_pFS34, 2.3 mg/L -humulene were measured. The FPP synthase ERG20 from pFS34 appears not to increase the -humulene concentration. The more detailed reasons for this are not known.

[0219] 2.2 Integration of the Heterologous Mevalonate Pathway (MVA)

[0220] Surprisingly, however, here it could be found that the heterologous expression in particular of enzymes of the MVA pathway leads to improved formation of -humulene.

[0221] This is all the more astonishing since the MVA precursor, acetoacetyl-CoA, is a component of the primary metabolism of M. extorquens (see FIG. 1). Through the withdrawal of acetoacetyl-CoA for the heterologously introduced MVA pathway, a considerable imbalance in the primary metabolism of M. extorquens was to be expected.

[0222] This fear was at first substantiated by the following preliminary experiment. The transformation of pFS44 containing zssl, ERG20 and the M. xanthus MVA genes hmgs, fni, hmgr, mvaK, mvaK2 and mvaD into electrocompetent M. extorquens AM1 yielded no discernible growth, neither on methanol minimal medium nor on succinate minimal medium. The constitutive expression of the MVA pathway appears not to be well tolerable for M. extorquens.

[0223] 2.3 Toxicity of -Humulene to M. extorquens AM1

[0224] In order to establish whether M. extorquens is suitable at all as a production strain for terpenes, it was firstly checked whether the bacterium is inhibited in growth by terpenes in higher concentrations.

[0225] Terpenes often have toxic effects on bacteria. The toxicity of -humulene to M. extorquens was studied by growth analyses in the presence of different -humulene concentrations. A dodecane layer containing -humulene was added to M. extorquens cultures as a second phase. In a second approach, -humulene was added directly to the aqueous phase. The results presented in FIG. 3 show that M. extorquens is suitable as a production platform for terpenes, in particular for -humulene.

[0226] 2.4 -Humulene Production Using a Cumate-Inducible Promoter

[0227] For the inducible expression of the MVA genes, a suitable plasmid system with inducible promoter was used below. For this, the genes for the -humulene synthase were cloned alone, in combination with FPP synthase ERG20 and in combination with ERG20 and the MVA pathway genes, into plasmid pHC115, which bears a cumate inducible promoter (Chou and Marx, 2012), yielding the plasmids pFS45, pFS46 and pFS47 respectively.

[0228] After transformation, colonies were obtained for pFS45 and pFS46, but scarcely detectable for pFS47. Without being bound thereto, the data shown in FIG. 4 for pFS45 and pFS46 could explain this: more than 50% -humulene was already produced without induction. The gene expression of pHC115 is not tight and remaining expression of the MVA genes has an adverse effect on growth for M. extorquens.

[0229] Plasmid pQ2148 contains the very tight cumate inducible 2148 promoter. Zssl alone and once again in combination with ERG20 and with the MVA genes were introduced into pQ2148F with obtention of pFS49 (zssl), pFS50 (zssl-ERG20) and pFS52 (zssl-ERG20-MVA). Colonies were obtained after transformation into M. extorquens for pFS49, pFS50 and also pFS52, even though the colonies for pFS52 were very small even after 8 days growth at 30 C. The -humulene concentrations reached 11 mg/L in AM1_pFS49 and 17 mg/L in AM1_pFS50 (see FIG. 4), which is a 6-fold or 1.6 times increase in the zssl-ERG20 construct compared to pFS34 and pFS46. In the comparison to pHC115 constructs, the background production, i.e. without induction, was only 5%.

[0230] The compensation of flux imbalances in the metabolism can be achieved by a great variety of measures. Thus for example the promoter strength, the concentration of the inducer, the plasmid copy number or combinations thereof can be decisive. Here it was now surprisingly found that the translation initiation rates (TIR) of different ribosome binding sites (RBS) are of importance for an improved terpene synthesis.

[0231] Firstly, the TIR of the -humulene synthase RBS in the plasmids pFS57 (zssl.sup.225k), pFS58 (zssl.sup.225k-ERG20) and pFS59 (zssl.sup.225k-ERG20-MVA) were increased 146-fold (see Table 2).

TABLE-US-00002 TABLE 2 Translation initiation rates (TIR) of the native and optimized ribosome binding sites (RBS) of the heterologous mevalonate pathway genes hmgs (hydroxymethylglutaryl-CoA synthase) and fni (IPP isomerase) from Myxococcus xanthus, the FPP synthase ERG20 and -humulene synthase zssl of the various plasmids. Translation initiation rates (TIR) fni Plasmids hmgs IPP Growth Gene: AAc- HMG- ERG20 zssl -hu- Intermediate: CoA .fwdarw. CoA DMAPP .fwdarw. FPP .fwdarw. mulene pFS49 wt 1514 +++ pFS50 558 1514 ++ pFS52 1995 87.3 558 1514 /+.sup. pFS57 wt 221625 ++ pFS58 558 221625 +++ pFS59 1995 87.3 558 221625 /+.sup. pFS60a 36800 221625 ++ pFS60b 22000 221625 +++ pFS61b 6345 87.3 22000 221625 + pFS62a 6345 65000 36800 221625 + pFS62b 6345 65000 22000 221625 ++ .sup.various colony sizes, Growth: colony formation of AM1 on methanol agar after transformation: ++++: like empty vector (3-4 days), +++: 4-5 days, ++: 5-6 days, +: 6-7 days, : no colonies discernible after 8 days; wt: native FPP synthase from M. extorquens AM1 with unknown RBS; intermediates: AAc-CoA: acetoacetyl-CoA, HMG-CoA: hydroxymethylglutaryl-CoA, IPP: isopentenyl pyrophosphate, DMAPP: dimethylallyl pyrophosphate, FPP: farnesyl pyrophosphate:

[0232] As can be seen in FIG. 5, an optimization of the RBS of zssl alone does not lead to increased -humulene production without additional provision with precursors of the MVA pathway (pFS57 and pFS58). Transformants with pFS59 (zssl.sup.225k-ERG20-MVA) grew slowly, comparably to pFS52-containing strains without zssl RBS optimization (see Table 2).

[0233] The TIR of the ERG20 RBS was increased in the ratio of about 1:10 (pFS61b) to the TIR of the zssl RBS (see Table 2). The RBS optimization of ERG20 in combination with zssl RBS optimization did not lead to the increase in the -humulene formation without MVA (pFS60a and pFS60b, see FIG. 5).

[0234] The combination of RBS optimized -humulene synthase, RBS optimized FPP synthase and MVA enzymes present led to the plasmid pFS61b, which enables good growth (TIR of ERG20 is 22,000). Concentrations of up to 60 mg/L -humulene were reached by some AM1 transformants with pFS61b (average production was 35 mg/L), even though high fluctuations were to be observed.

[0235] Optimizations of the RBS of the IPP Isomerase led to a further increase in the average -humulene production and to a diminution of the high fluctuations in the -humulene production between the transformants. The TIR of the fni RBS was increased in plasmids pFS62a and pFS62b to 65,000 (see Table 2). The strains AM1_pFS62b and AM1_pFS62a show further improved growth compared to AM1_pFS61b.

[0236] With strain AM1_pFS62b, concentrations of 58 mg/L -humulene were formed with significantly reduced variance between the transformants in comparison to AM1_pFS61b (see FIG. 5). The optical density was about 3 after 48 h induction, which corresponds to a cell dry weight of 1 g/I.

[0237] The heterologous expression of the MVA pathway in M. extorquens was effected according to the last described embodiments by adaptation of the RBS of the -humulene synthase, the FPP synthase and the IPP isomerase. Concentrations of 58 mg/L -humulene were reached by M. extorquens containing pFS62b (zssl.sup.220k-ERG20.sup.20k-fnl.sup.65k-MVA). This is at any rate a threefold increase compared to a strain with overexpressed -humulene synthase and overexpressed FPP synthase in the absence of the heterologous MVA pathway.

[0238] 2.5 -Humulene Production in Carotenoid Biosynthesis Deficient M. extorquens Strains

[0239] The carotenoid biosynthesis in M. extorquens competes with the -humulene synthase for the precursor FPP (see FIG. 1). The use of a carotenoid synthesis deficient mutant might be able according to a further practical example to increase the -humulene production further. For this, the colorless M. extorquens AM1 mutant strain CM502 (Van Dien et al. 2003) was. The carotenoid extraction and analysis (see above) from strain CM502 showed that it produces diapolycopene, but no lycopene, which has an identical UV spectrum, but a different retention time (see FIG. 6A). The data indicate that the strain CM502 is a diapolycopene oxidase mutant (crtNb), since it still produces diapolycopene, but no esterified/glycosylated derivatives.

[0240] The -humulene production of strain crtNb with plasmid pFS62b was once more significantly increased by about 30% to M. extorquens AM1 wild type with plasmid pFS62b (see FIG. 6B). A production titer of at any rate 75 mg/I -humulene in the shaker flask could thus be achieved.

[0241] It is noteworthy here that the aforesaid concentrations, such as for example 58 mg/L or 75 mg/L -humulene, are already reached without for example costly lithium acetoacetate or DL-mevalonate having to be added externally. It is moreover advantagous that the aforesaid concentrations were already achieved with use of inexpensive methanol minimal medium. In contrast to the prior art, no TB or LB-based fermentation medium is necessary. This results in a further advantage in the simplification of the purification of the terpene products obtained, since a clearly defined minimal medium can be used. Laborious removal of side products can be minimized. In addition, the strains described here open up the use of *Methanol as the sole carbon source for growth.

[0242] 2.6 -Humulene Production in Fed Batch Cultures

[0243] In order to test the productivity of the M. extorquens-based -humulene production according to the invention, methanol-limited fed batch fermentations were performed. The aqueous organic two phase cultures described above were utilized.

[0244] M. extorquens AM1 or crtNb containing the plasmid pFS62b were grown up to an OD600 of 5-10 before expression of the -humulene synthesis pathway was induced with cumate and a dodecane phase was added. The further culturing took place at constant pH, dissolved oxygen level of >30% and methanol concentrations of about 1 g/L. Average OD60 values of 80-90 were achieved per fermentation (see Table 3) corresponding to a cell density of about 30 g/I. As shown in FIG. 7, the -humulene production was growth-dependent. High -humulene concentrations of 0.73 g/I to 1.02 WI were formed by strain M. extorquens AM1 with plasmid pFS62b. A maximum -humulene concentration of 1.65 g/I was formed by strain M. extorquens crtNb with plasmid pFS62b, a 57% increase compared with the highest concentration of 1.02 WI by strain AM1 with plasmid pFS62b (see Table 3). The maximum product concentration of 1.65 g/I signifies a 22 fold increase compared with the highest concentration which was reached by culturing in the shaker flask, wherein the -humulene/OD.sub.600 ratio is constant at about 20 mg*I.sup.1/OD600.

[0245] The maximum theoretically possible yield of de novo synthesizable -humulene per methanol is 0.26 g/g. The maximum yield of 0.031 g.sub.-humulene/g.sub.meOH, achieved in fermentation 5 (see Table 3), corresponds to 12% of the maximum theoretical yield.

TABLE-US-00003 TABLE 3 Method properties of methanol-limited fed batch fermentations performed with the strains AM1 and crtNb containing plasmid pFS62b. Cumate induction was effected after attainment of the early exponential growth phase (OD.sub.600 about 10). The values shown represent measurements at a time point after induction. Time [h] to max. - max. - humulene humulene concentration cdw Y.sub.P/S.sup.a STY.sup.b Strain Fermentation concentration [g/l] OD600 [g/l] [g/g.sub.MeOH] [mg/l * h] AM1 1 63 0.74 90 30 0.023 11.7 2 70.5 1.02 148 n.d. 0.024 15 3 93 0.73 84 27.9 0.015 7.8 CM502 4 80 1.37 79 28.4 0.023 17.1 5 104 1.65 85 30 0.031 14.6 .sup.amaximum theoretical yield is 0.26 g/g.sub.MeOH .sup.baverage STY after induction (t = 0) up to method end n.d.: not determined, cdw: cell dry weight, STY: space time yield:

Example 2

Recombinant cis-Abienol Production

[0246] 1 Material and Methods

[0247] 1.1 Chemicals, Media and Bacterial Strains

[0248] Methylobacterium extorquens AM1 (Peel and Quayle 1961, Biochem J, 81, 465-9) was cultured at 30 C. in minimal medium according to Kiefer et al. (Kiefer et al. 2009) with 123 mM methanol.

[0249] Escherichia coli strain DH5a (Gibco-BRL, Rockville, USA) was cultured in lysogeny broth (LB) medium (Bertani 1951, J Bacteriol, 62, 293) at 37 C. Tetracycline hydrochloride was used in a concentration of 10 g/mI for E. coil and M. extorquens. Cumate (4-isopropylbenzoic acid) was used as the inducer and used in an end concentration of 100 M starting from a 100 mM stock solution dissolved in ethanol.

[0250] Cumate, tetracycline hydrochloride and zerumbone were purchased from Sigma-Aldrich (Steinheim, Del.). Cis-abienol was purchased from Toronto Research Chemicals (Toronto, Calif.). Dodecane was purchased from VWR (Darmstadt, Del.).

[0251] 1.2 Genetic Manipulations and Plasmid Construction

[0252] The standard cloning techniques were performed according to the procedure known to those skilled in the art. The transformation of M. extorquens AM1 with plasmids was performed as described in Toyama et al. (Toyama, Anthony and Lidstrom 1998). Ribosome binding sites (RBS) were designed with the aid of the ribosome binding sites calculator (Salis 2011).

[0253] 1.3 Cloning of Plasmids for the Production of Cis-Abienol

[0254] Plasmids for the synthesis of cis-abienol were constructed starting from plasmid pfs62b. For the construction of ppjo16 (pQ2148F-AbCAS-ERG20F96C-MVA), the cis-abienol synthase gene AbCAS, originally deriving from Abies balsamea (Zerbe et al. 2012, J Biol Chem, 287, 12121-31) (Accession number JN254808.1), was codon-optimized for M. extorquens AM1 with obtention of the DNA sequence according to SEQ ID No. 50. The codon-optimized gene according to SEQ ID No. 50 was amplified for insertion into pfs62b using the primers pj05 and pj25. The RBS of the AbCAS gene has the nucleic acid sequence TATTAATATTAAGAGGAGGTAATAA (SEQ ID No. 51) with a translation initiation rate (TIR) of 233,000. The gene for the GGPP synthase ERG20F96C (SEQ ID No. 52) (Ignea et al. 2015, Metabolic Engineering, 27, 65-75) from Saccharomyces cerevisiae was obtained from ERG20 by mutagenesis PCR with the primers pj26, pj16, pj17 and pj10. The TIR of the RBS of ERG20F96C was set at 10,000 and has the nucleic acid sequence CTTAAACTAACCGAGATAGGAACGAATTTTACAA (SEQ ID No. 53). Plasmid ppjo16 was constructed by insertion of the PCR products from AbCAS and ERG20F96C by Gibson cloning into the vector pfs62b. 2 cleaved with Spel and Xbal.

[0255] For the construction of plasmid ppjo17 (pQ2148F-NtLPPS-NtABS-ERG20F96C-MVA), the LPP synthase gene NtLPPS from Nicotiana tabacum (Sallaud et al. 2012, Plant J, 72, 1-17) (Accession number HE588139.1) and the cis-abienol synthase gene NtABS from Nicotiana tabacum (Sallaud et al. 2012, Plant J, 72, 1-17) (Accession number HE588140.1) were codon-optimized for M. extorquens AM1 with obtention of the DNA sequence SEQ ID No. 54 and SEQ ID No. 55 respectively. The corresponding RBS have a TIR of 145,000 for the gene NtLPPS with the DNA sequence CAACGGCCCTTACAAAAGGAGGTTAATTATT (SEQ ID No. 56) and a TIR of 130,000 for the gene NtABS with the DNA sequence GATAGAAACCCTTAATTAAGAAGGAGGTCCTTA (SEQ ID No. 57). The codon-optimized NtLPPS gene according to SEQ ID No. 54 was amplified with the primers pj05 and pj27, and for the amplification of the codon-optimized NtABS (SEQ ID No. 55) the primers pj28 and pj29 were used. For plasmid ppjo17, the gene ERG20F96C (SEQ ID No. 52) was obtained by mutagenesis PCR with the primers pj30, pj16, pj17 and pj10. The TIR of the RBS of ERG20F96C in ppjo17 was set at 9,500 and has the nucleic acid sequence AACCACTAAGAACACAGACTTATACACAGGAGGAT (SEQ ID No. 58). Plasmid ppjo17 was constructed by insertion of the PCR products from NtLPPS, NtABS and ERG20F96C by Gibson cloning into the vector pfs62b cleaved with Spel and Xbal.

[0256] An overview of the primers, plasmids and strains used is shown in Table 4.

TABLE-US-00004 TABLE4 Primers,plasmidsandstrainsused Name Description Reference Primers pj05(SEQIDNo.70) AACAGACAATCTGGTCTGTTTGTAAC pj10(SEQIDNo.71) TCTTCATCCTGCGCTCCTGTCTAGAAA TACTCTAATTAATCTATTTGCTTCTCTT GTAAACTTTG pj16(SEQIDNo.72) ATCGGCGACCAAGCAGTAAG pj17(SEQIDNo.73) TTACTGCTTGGTCGCCGATG pj25(SEQIDNo.74) CGTTCCTATCTCGGTTAGTTTAAGATC GATTCAGGTGGC pj26(SEQIDNo,75) CTTAAACTAACCGAGATAGGAACGAAT TTTACAATATGGCTTCAGAAAAAGAAAT TAGGAG pj27(SEQIDNo.76) GACCTCCTTCTTAATTAAGGGTTTCTAT CTACGTATCAGACCTGCTGGAAC pj28(SEQIDNo.77) GATAGAAACCCTTAATTAAGAAGGAGG pj29(SEQIDNo.78) TATAAGTCTGTGTTCTTAGTGGTTATC GATTCACGGCGAG pj30(SEQIDNo.79) AACCACTAAGAACACAGACTTATACAC AGGAGGATATGGCTTCAGAAAAAGAAA TTAGGAG Plasmids pQ2148F ExpressionvectorforMethylobacterium extorquenswithcumateinducible promoter2148andadaptedmultiple cloningsite(MCS);TetR,oriT,pBR322ori pfs62b ExpressionvectorforMethylobacterium extorquensforsynthesisofa-humulene ppjo16 ExpressionvectorforMethylobacterium extorquensforsynthesisofcis-abienol withGGPPsynthaseERG20F96Cand cis-abienolsynthaseAbCAS ppjol7 ExpressionvectorforMethylobacterium extorquensforsynthesisofcis-abienolwith GGPPsynthaseERG20F96C,LPP synthaseNtLPPSandcis-abienolsynthase NtABS Strains E.coliDH5 F-,80dlacZM15, ATCC (lacZYA-argF)U169,deoR, recA1,endA1,hsdR17(rKmK+),phoA,supE44,,thi- 1 M.extorquens Facultativelymethylotrophic, (PeelandQuayle1961) AM1 obligatorilyaerobic,gram- DSMZ133 negative,Pinkpigmented- proteobacterium,CmR

[0257] 1.4 Cis-Abienol Production in Aqueous Organic Two Phase Shaker Flask Culture

[0258] Methylobacterium extorquens AM1 containing the cis-abienol production plasmids were cultured in methanol minimal medium containing tetracycline-5 hydrochloride (see above). Precultures were inoculated from agar plates into test tubes with 5 ml medium and shaken for 48 h at 30 C. and 180 rpm. Main cultures with 12 ml medium in 100 ml baffled shaker flasks were inoculated with a preculture to an OD600 of 0.1. After culturing for 16 h at 30 C. the main cultures reached the early exponential growth phase ( OD600 0.3-0.6). Next, cumate was added for the induction and 3 ml dodecane added as organic phase. After 48 h incubation, a total culture volume of 15 ml was decanted and centrifuged for 10 min at 3220 g. 1 ml of the upper dodecane layer was used for the cis-abienol analysis.

[0259] 1.5 Cis-Abienol Analysis

[0260] 1 ml dodecane sample was dried with NaSO4. As the internal standard, 25 l of a dodecane solution with 1 mM zerumbone was added to 225 l dodecane sample. Cis-abienol was analyzed and quantified by means of a GC-MS (GC17A with Q5050 mass spectrometer, Shimadzu, Kyoto, Japan), equipped with an Equity 5 column (Supelco, 30 m0.25 mm0.25 M). Measurements were performed as follows: carrier gas: helium; split injection (2:1) at 250 C.; flow rate: 2.2 ml/min; interface temperature: 250 5 C.; program: 80 C. hold for 3 mins, 16 C./min to 240 C., hold for 2 min. The retention time was 14.1 mins for cis-abienol and 11.3 mins for zerumbone. Cis-abienol in the samples was identified by comparison of three main fragmentations in the mass spectra with a commercially obtained cis-abienol standard (rel. intensity in brackets): 119 (15.9), 134 (30.3), 191 (6.0). For a quantification, a calibration curve with the concentrations 100, 50, 20, 10, 5, 2, 1 mg/L cis-abienol each with 100 M zerumbone was used.

[0261] 2 Results

[0262] 2.1 Cis-Abienol Production Using Plasmids with Constitutive Promoter (Comparative Example)

[0263] For the production of cis-abienol with Methylobacterium extorquens AM1, as well as the mevalonate operon from Myxococcus xanthus the GGPP synthase ERG20F96C (a variant of the FPP synthase ERG20 from Saccharomyces cerevisiae) and further genes were expressed. GGPP should be converted either directly to cis-abienol by the bifunctional cis-abienol synthase AbCAS from Nicotiana tabacum or stepwise via the formation of LPP from GGPP by the LPP synthase NtLPPS from Nicotiana tabacum, wherein LPP should then be converted to cis-abienol by the cis-abienol synthase NtABS, likewise deriving from Nicotiana tabacum. Overall, two plasmid variants (ppjo16 and ppjo17) for the cis-abienol synthesis were constructed.

[0264] After transformation of Methylobacterium extorquens AM1 with the plasmids ppjo16 or ppjo17, the first colonies appeared after 6 days' incubation at 30 C. For AM1 with ppjo16 and ppjo17 respectively, a clone was in each case visible at this time point; in comparison to this, far more than 3,000 transformants were discernible with the empty vector pQ2148F. Only after a total of 8 days' incubation at 30 C. did further, but markedly smaller, colonies also appear with transformants with the cis-abienol production plasmids. These observations indicate that the cis-abienol production plasmids, presumably because of accumulation of prenyl phosphate intermediates toxic for Methylobacterium extorquens, markedly impair the growth of the organism, and as a result the formation of suppressors occurs.

[0265] The two transformants of AM1 with ppjo16 and ppjo17 respectively, visible after 6 days, and in each case six of the small colonies, were plated out on a fresh agar plate and incubated for 6 days at 30 C. Even with the previously small transformants, large colonies were formed after replating, i.e. suppressors. Since therefore the selective culturing of transformants with plasmid ppjo16 or ppjo17 without suppressor formation was not possible, only suppressors could be tested for product formation. For this, in order to obtain sufficient cell mass, the newly appeared suppressors were plated out onto a further, fresh agar plate and incubated for 7 days at 30 C.

[0266] The culturing was performed under the conditions described above as aqueous organic two phase cultures, wherein dodecane was used as the organic phase.

[0267] A suppressor mutant of M. extorquens AM1 containing plasmid ppjo16 (named 16s6) was capable of producing cis-abienol as is shown by the peak with the same retention time and mass spectrum in comparison to the cis-abienol standard in FIG. 1. In contrast to this, no cis-abienol was detectable for M. extorquens AM1 with the empty vector control (pQ2148F). For the suppressor mutant 16s6 of M. extorquens AM1 with ppjo16, 21.1 mg/L cis-abienol were measured in the dodecane phase, which corresponds to a product concentration of 5.3 mg/L cis-abienol in the culture broth. After plasmid isolation of ppjo16 from the suppressor mutant 16s6 and subsequent sequencing of the plasmid, the mutation giving rise to the suppressor could be identified. In the promoter region of the plasmid, exactly 115 nucleotides before the start codon of the AbCAS gene, a sequence of a total of 28 nucleotides was deleted. SEQ ID No. 59 represents the sequence of the promoter region in the plasmid ppjo16, while the mutated promoter sequence in plasmid ppjo16 from the suppressor mutant 16s6 is recorded under SEQ ID No. 60.

Example 3

Recombinant Production of Santalene

[0268] 1 Material and Methods

[0269] 1.1 Chemicals, Media and Bacterial Strains

[0270] Methylobacterium extorquens AM1 (Peel and Quayle 1961, Biochem J, 81, 465-9) was cultured at 30 C. in minimal medium according to Kiefer et al. (Kiefer et al., PLoS One, e7831) with 123 mM methanol.

[0271] Escherichia coli strain DH5a (Gibco-BRL, Rockville, USA) was cultured in lysogeny broth (LB) medium (Bertani 1951) at 37 C. Tetracycline hydrochloride was used in a concentration of 10 pg/ml for E. coli and M. extorquens. Cumate (4-isopropylbenzoic acid) was used as the inducer and dissolved in ethanol was used in an end concentration of 100 M, starting from a 100 mM stock solution.

[0272] Cumate, tetracycline hydrochloride, zerumbone and sandalwood oil were purchased from Sigma-Aldrich (Steinheim, Del.). Dodecane was purchased from VVVR (Darmstadt, Del.).

[0273] 1.2 Genetic Manipulations and Plasmid Construction

[0274] The standard cloning techniques were performed according to the procedure known to those skilled in the art. The transformation of M. extorquens AM1 with plasmids was performed as described in Toyama et al. (Toyama et al., FEMS Microbiology Letters, 166, 1-7). Ribosome binding sites (RBS) were designed by means of the ribosome binding site calculator (Sails 2011, Methods in Enzymology, ed. V. Christopher, 19-42. Academic Press).

[0275] 1.3 Cloning of Plasmids for Production of Santalene

[0276] Plasmids for the synthesis of santalene were constructed starting from the plasmids pQ2418F, pfs60b and pfs62b.

[0277] For the construction of ppjo01woMVA (pQ2148F-SSpiSSY-ERG20) and ppjo01 (pQ2148F-SSpiSSY-ERG20-MVA), the santalene synthase gene SSpiSSY, originally deriving from Santalum spicatum (Jones et al., 2011, Journal of Biological Chemistry, 286, 17445-17454) (Accession number HQ343278.1), was codon-optimized for M. extorquens AM1 with obtention of the DNA sequence according to SEQ ID No. 61. The codon-optimized gene according to SEQ ID No. 61 was amplified for insertion into pfs60b (Sonntag et al. 2015) using the primers SSpiSSY_RBSopt_fw and SSpiSSY_rev. The SSpiSSY PCR product was digested with Spel and Clal and inserted into identically digested plasmid pfs60b, yielding plasmid ppjo01_woMVA. Plasmid ppjo01 was constructed by cleaving the genes SSpiSSY and ERG20 out from ppjo01_woMVA with Xbal and EcoRl, followed by the insertion into identically digested pfs62b. In both plasmids, ppjo01 and ppjo01_woMVA, SSpiSSY had the nucleic acid sequence TGTTACACCCACAGAACAAACCCGAGGTAACT (SEQ ID No. 62) with a TIR of 44,000, the TIR of the RBS of ERG20 possessed the nucleic acid sequence ACATCAAACCAAAGGACTTTACAGGTAGTAGAA (SEQ ID No. 63) with a TIR of 20,000.

[0278] For the construction of ppjo03 (pQ2148F-SanSyn-ERG20), the santalene synthase gene SanSyn, originally deriving from Clausena lansium (Scalcinati et al., 2012, Metabolic Engineering, 14, 91-103; Scalcinati et al., 2012, Microb Cell Fact, 11, 117) (Accession number HQ452480.1), was codon-optimized for M. extorquens AM1 with obtention of the DNA sequence according to SEQ ID No. 64. The codon-optimized gene according to SEQ ID No. 64 was amplified for insertion into pfs62b using the primers pj05 and pj06. The RBS of the SanSyn gene had the nucleic acid sequence GAAGAAGGAGGTAGTCATAAAGAAGGAGGTAACTA (SEQ ID No. 65) with a TIR of 233,000. Plasmid ppjo03 was constructed by insertion of the PCR product from SanSyn by Gibson cloning into the vector pfs62b cleaved with Spel and Bsu36I. The TIR of the RBS of ERG20 is set at 22,000 and had the nucleic acid sequence TCCCCAGCGCGCCCCCCAATTCAGGATAACATAG (SEQ ID No. 66).

[0279] For the construction of ppjo04_woMVA (pQ2148F-ERG20fusSSpiSSY) and ppjo04 (pQ2148F-ERG20fusSSpiSSY-MVA), the FPP synthase gene ERG20 with C-terminal (GGGGS)x2 linker was amplified with the primers ERG20-fus_fw and ERG20-fus_rev for insertion into pQ2418F (Sonntag et al., Metab Eng, 32, 82-94). The gene SSpiSSY (SEQ ID No. 61) was amplified with the primers SSpiSSY_RBSopt_fw and SSpiSSY_rev, digested with BamHI and EcoRl and inserted into identically digested plasmid pQ2418F-ERG20fus, yielding plasmid ppjo04_woMVA. Plasmid ppjo04 was constructed by cleaving the gene ERG20fus out from ppjo04_woMVA with Asel and EcoRI, followed by insertion into identically digested pfs62b. In both plasmids, ppjo04 and ppjo04woMVA, ERG20 had the nucleic acid sequence AAACATAGCATATTAGCAGATTAAGGACATACGT (SEQ ID No. 67) with a TIR of 53,000.

[0280] For the construction of ppjo05 (pQ2148F-SSpiSSYfusERG20-MVA), the codon-optimized santalene synthase gene SspiSSY (SEQ ID No. 61) was amplified with the primers pj01 and pj08. The gene for the FPP synthase ERG20 with N-terminal (GGGGS)2 linker was amplified using the primers pj09 and pj10. The TIR of the fusion protein was set at 402,000 and had the nucleic acid sequence CCCCTTCCCTTATTTAAACCAGAGGAGGTAACAAA (SEQ ID No. 68). Plasmid ppjo05 was constructed by insertion of the PCR products from SSpiSSY and fusERG20 by Gibson cloning into the vector pfs62b cleaved with Spel and Xbal.

[0281] For the construction of ppjo06 (pQ2148F-SSpiSSY-ERG20_RBSmax), the codon-optimized santalene synthase gene SSpiSSY (SEQ ID No. 61) was amplified with the primers pj01 and pj77. The optimized RBS of the SSpiSSY gene had the nucleic acid sequence according to SEQ ID No. 68 with a TIR of 402,000. The gene for the FPP synthase ERG20 was amplified using the primers pj10 and pj78. The TIR of ERG20 was set at 1,344,000 and had the nucleic acid sequence AACCAAATAGGATTAGCACAGAAGGGGGTAATA (SEQ ID No. 69). Plasmid ppjo06 was constructed by insertion of the PCR products from SSpiSSY and ERG20 by Gibson cloning into the vector pfs62b cleaved with Spel and Xbal

[0282] The TIR of the RBS of the hmgs gene was maintained at 189 in the plasmids ppjo01, ppjo03 and ppjo04 similarly to the humulene synthesis plasmid pfs62b. For the plasmids ppjo05 and ppjo06, the TIR value of the RBS of the hmgs was set at 6345.

[0283] An overview of the primers, plasmids and strains used is given in Table 5.

TABLE-US-00005 TABLE5 Primers,plasmidsandstrainsused Name Description Reference Primers SspiSSY_RBSopt_fw ACGAACTAGTTGTTACACCCACAGAACAAACCCGA (SEQIDNo.80) GGTAACTATGGACTCGTCGACCGCC SspiSSY_rev(SEQ ATCGTATCGATTCACTCCTCGCCGAGCGG IDNo.81) pj01(SEQIDNo. GACAATCTGGTCTGTTTGTAACTAGTCCCCTTCCCT 82) TATTTAAACCAGAGGAGGTAACAAAATGGACTCGTC GACCGCCAC pj05(SEQIDNo. AACAGACAATCTGGTCTGTTTGTAAC 70) pj06(SEQIDNo. TGGGCATACCAGTCACATGC 83) ERG20-fus_fw ACGAACTAGTAAACATAGCATATTAGCAGATTAAGG (SEQIDNo.84) ACATACGTATGGCTTCAGAAAAAGAAATTAG ERG20-fus_rev ACTAGGATCCGCCGCCACCCGAGCCACCGCCACC (SEQIDNo.85) TTTGCTTCTCTTGTAAACTTTG pj08(SEQIDNo. TTTCTGAAGCCATGGATCCGCCGCCACCCGAGCCA 86) CCGCCACCCTCCTCGCCGAGCGGGATC pj09(SEQIDNo. GGATCCATGGCTTCAGAAAAAGAAATTAGGAG 87) pj10(SEQIDNo. TCTTCATCCTGCGCTCCTGTCTAGAAATACTCTAAT 71) TAATCTATTTGCTTCTCTTGTAAACITTG pj77(SEQIDNo. CTTCTGTGCTAATCCTATTTGGTTATCGATTCACTC 88) CTCGCCGAGC pj78(SEQIDNo. GATAACCAAATAGGATTAGCACAGAAGGGGGTAAT 89) AATGGCTTCAGAAAAAGAAATTAGGAG Plasmids pQ2148F ExpressionvectorforMethylobacteriumextorquens (Sonntaget withcumateinduciblepromoter2148andadapted al.,2015, multiplecloningsite(MCS);TetR,oriT,pBR322ori MetabEng, 32,82-94) pfs60b ExpressionvectorforMethylobacteriumextorquensfor (Sonntaget synthesisof-humulene,withoutgenescodingfor al.,2015, proteinsofthemevalonatepathway MetabEng, 32,82-94) pfs62b ExpressionvectorforMethylobacteriumextorquensfor (Sonntaget synthesisof-humulene al.,2015, MetabEng, 32,82-94) ppjo01_woMVA ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithEPPsynthaseERG20and santalenesynthaseSspiSSY,withoutgenescodingfor proteinsofthemevalonatepathway ppjo01 ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithEPPsynthaseERG20and santalenesynthaseSspiSSY ppj003 ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithEPPsynthaseERG20and santalenesynthaseSanSyn ppjo04_woMVA ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithafusionproteinfromthe FFPsynthaseERG20andthesantalenesynthase SSpiSSY(ERG20fusSSpiSSY),withoutgenescoding forproteinsofthemevalonatepathway ppjo04 ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithafusionproteinfromthe EPPsynthaseERG20andthesantalenesynthase SSpiSSY(ERG20fusSSpiSSY) ppjo05 ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithafusionproteinfromthe santalenesynthaseSSpiSSYandtheFPPsynthase ERG20(SSpiSSYfusERG20) ppj006 ExpressionvectorforMethylobacteriumextorquensfor synthesisofsantalenewithFPPsynthaseERG20and santalenesynthaseSspiSSY,whereintheTIRofthe RBSofERG20wassetmaximallyhigh Strains E.coliDH5a F-,80dlacZM15,(lacZYA-argF)U169,deoR,recA1, ATCC endA1,hsdR17(rkmk+),phoA,supE44,,thi-1 M.extorquens Facultativelymethylotrophic,obligatorilyaerobic,gram- (Peeland AM1 negative,Pinkpigmented-proteobacterium,CmR Quayle 1961, BiochemJ, 81,465-9.) DSMZ1338

[0284] 1.4 Santalene Production in Aqueous Organic Two Phase Shaker Flask Culture

[0285] Methylobacterium extorquens AM1 containing the santalene production plasmids was cultured in methanol minimal medium containing tetracycline-5 hydrochloride (see above). Precultures were inoculated from agar plates into test tubes with 5 ml medium and shaken for 48 h at 30 C. and 180 rpm. Main cultures with 12 ml medium in 100 ml baffled shaker flasks were inoculated with a preculture to an OD.sub.600 of 0.1. After culturing for 16 h at 30 C. the main cultures reached the early exponential growth phase (OD.sub.600 0.3-0.6). Next, cumate was added for the induction and 3 ml dodecane added as organic phase. After 48 h incubation, a total culture volume of 15 ml was decanted and centrifuged for 10 mins at 3220 g. 1 ml of the upper dodecane layer was used for the santalene analysis.

[0286] 1.5 Santalene Analysis

[0287] 1 ml dodecane sample was dried with NaSO.sub.4. As the internal standard, 25 l of a dodecane solution with 1 mM zerumbone were added to 225 l of dodecane sample.

[0288] Santalene was analyzed by means of a GC-MS (GC17A with Q5050 mass spectrometer, Shimadzu, Kyoto, Japan), equipped with an Equity 5 column (Supelco, 30 m0.25 mm0.25 M). Measurements were performed as follows: carrier gas: helium; split injection (8:1) at 250 C.; flow rate: 2.2 ml/min; interface temperature: 250 C.; program: 80 C. hold for 3 mins, 16 C./min to 240 C., hold for 2 mins. Since a santalene standard is not commercially available, sandalwood oil was used instead of this for the analysis of santalene products in the samples. Before the measurement, the sandalwood oil was diluted 1:500 in dodecane. The various substances contained in sandalwood oil eluted between 11 and 12.4 mins.

[0289] 2 Results

[0290] 2.1 Santalene Production Using Plasmids with Constitutive Promoter (Comparative Example)

[0291] For the production of santalene with Methylobacterium extorquens AM1, as well as the mevalonate operon from Myxococcus xanthus, the FPP synthase ERG20 from Saccharomyces cerevisiae and further genes were expressed. FPP should be converted to santalene by a santalene synthase from Santalum spicatum (SSpiSSY) or Clausena Iansium (SanSyn). Also, fusion proteins from the santalene synthase SSpiSSY and the FPP synthase ERG20 were tested for santalene production. In total, seven plasmid variants (ppjo01, ppjo01_woMVA, ppjo03, ppjo04, ppjo04_woMVA, ppjo05, ppjo06) were constructed for santalene synthesis.

[0292] After transformation of Methylobacterium extorquens AM1 with the santalene production plasmids, colonies appeared after 5 days' incubation at 30 C. For plasmids without mevalonate pathway (pQ2418F, ppjo01_woMVA, ppjo04_woMVA) and those in which the TIR of the RBS hmgs was set at 189, far more than 3,000 transformants were visible. In comparison to this, with plasmids with a TIR of the RBS of the hmgs of 6345 (ppjo05, ppjo06) with circa 100 visible colonies, markedly fewer transformants appeared. After a total of 8 days' incubation at 30 C., further, but markedly smaller, colonies appeared with transformants with ppjo05 and ppjo06 respectively. These observations indicated that the santalene production plasmids with a higher set TIR of the RBS of the hmgs markedly impaired the growth of the organism, presumably because of accumulation of prenyl phosphate intermediates toxic to Methylobacterium extorquens , and as a result formation of suppressors occurred.

[0293] The transformants from AM1 with ppjo05 and ppjo06 respectively, visible after 5 days, and in each case six of the smaller colonies, were plated out onto a fresh agar plate and incubated for 6 days at 30 C. Even with the previously small transformants, after replating large colonies, i.e. suppressors, formed. Since therefore the selective culturing of transformants with plasmid ppjo05 or ppjo06 without suppressor formation was not possible, only suppressors could be tested for product formation. For this, for the obtention of sufficient cell mass, the newly appeared suppressors were plated out onto a further, fresh agar plate and incubated for 7 days at 30 C. For the other strains of M. extorquens, in which suppressor formation did not occur, likewise in each case 3 different clones were plated out onto a new agar plate and incubated for 7 days at 30 C.

[0294] The culturing was performed under the conditions described above as aqueous organic two phase cultures, wherein dodecane was used as the organic phase.

[0295] M. extorquens AM1 containing the plasmids ppjo01_woMVA, ppjo03, ppjo04, ppjo04_woMVA or ppjo05 was capable of producing santalene as was shown by the -santalene peak with identical retention time and mass spectrum in comparison to substances in the sandalwood oil in FIG. 1. By way of example, the chromatogram and mass spectrum of a sample from M. extorquens AM1 containing the plasmid ppjo03 is shown. In contrast to this, for M. extorquens AM1 with the empty vector control (pQ2148F) no santalene was detectable.

[0296] Those skilled in the art recognize that the bacterial strains and fermentation conditions described here in the practical examples can readily be adapted without departing from the scope of the invention. Thus simple adaptations are conceivable for the production of other sesquiterpenes from methanol or ethanol, for example potential biofuels, such as bisabolene, or of fragrance substances such as santalene or of diterpenes such as sclareol. The invention enables the bioproduction of terpenes from the carbon source methanol or ethanol not competing with foods.

[0297] All characteristics and advantages, including constructive details, spatial arrangements and method steps following from the claims, the descriptions and the drawing can be material to the invention in themselves and also in a great variety of combinations.

CITED NON-PATENT LITERATURE

[0298] Ajikumar, P. K., Tyo, K., Carlsen, S., Mucha, O., Phon, T. H. Stephanopoulos, G., 2008. terpenoids: opportunities for biosynthesis of natural product drugs using engineered microorganisms. Molecular pharmaceutics. 5, 167-90

[0299] Asadollahi, M. A., Maury, J., Moller, K., Nielsen, K. F., Schalk, M., Clark, A., Nielsen, J., 2008. Production of plant sesquiterpenes in Saccharomyces cerevisiae: Effect of ERG9 repression on sesquiterpene biosynthesis. Biotechnology and Bioengineering. 99, 666-677;

[0300] Bertani, G. (1951) STUDIES ON LYSOGENESIS I.: The Mode of Phage Liberation by Lysogenic Escherichia coli1. J Bacteriol, 62, 293.

[0301] Caniard, Anne, et al. Discovery and functional characterization of two diterpene synthases for sclareol biosynthesis in Salvia sclarea (L.) and their relevance for perfume manufacture. BMC plant biology 12.1 (2012): 119.

[0302] Chandran, S., Kealey, J., Reeves, C., 2011. Microbial production of isoprenoids. Process Biochemistry. 46, 1703-1710

[0303] Chou, H. H., Marx, C. J., 2012. Optimization of gene expression through divergent mutational paths. Cell reports. 1, 133-40.

[0304] Entian, K.-D., Koetter, P., 1998. Yeast mutant and plasmid collections. In: Brown, A. J. P., Tuite, M. F., Eds.). Academic Press Ltd., San Diego, pp. 431-449.

[0305] Ignea, C., F. A. Trikka, K. Nikolaidis, P. Georgantea, E. Ioannou, S. Loupassaki, P. Kefals, A. K. Kanellis, V. Roussis, A. M. Makris & S. C. Kampranis (2015) Efficient 10 diterpene production in yeast by engineering Erg20p into a geranylgeranyl diphosphate synthase. Metabolic Engineering, 27, 65-75.

[0306] Jones, C. G., J. Moniodis, K. G. Zulak, A. Scaffidi, J. A. Plummer, E. L. Ghisalberti, E. L. Barbour & J. Bohlmann (2011) Sandalwood Fragrance Biosynthesis Involves Sesquiterpene Synthases of Both the Terpene Synthase (TPS)-a and TPS-b Subfamilies, including Santalene Synthases. Journal of Biological Chemistry, 286, 17445-17454.

[0307] Kaczmarczyk, A., Vorholt, J. A., Francez-Charlot, A., 2013. Cumate-inducible gene expression system for sphingomonads and other Alphaproteobacteria. Appl. Environ. Microbiol. 79, 6795-802.

[0308] Kiefer, P., Buchhaupt, M., Christen, P., Kaup, B., Schrader, J., Vorholt, J. A., 2009. Metabolite Profiling Uncovers Plasmid-Induced Cobalt Limitation under Methylotrophic Growth Conditions. PLoS ONE. 4, e7831.

[0309] Martin, V. J., Pitera, D. J., Withers, S. T., Newman, J. D., Keasling, J. D., 2003. Engineering a mevalonate pathway in Escherichia coli for production of terpenoids. Nature biotechnology. 21, 796-802;

[0310] Marx, C. J., Lidstrom, M. E., 2001. Development of improved versatile broad-host-range vectors for use in methylotrophs and other Gram-negative bacteria. Microbiology. 147, 2065-2075.

[0311] Mi, J., Becher, D., Lubuta, P., Dany, S., Tusch, K., Schewe, H., Buchhaupt, M., Schrader, J., 2014. De novo production of the monoterpenoid geranic acid by metabolically engineered Pseudomonas putida. Microbial cell factories. 13, 170.

[0312] Peel, D. & J. R. Quayle (1961) Microbial growth on C1 compounds. I. Isolation and characterization of Pseudomonas AM 1. Biochem J, 81, 465-9.

[0313] Peralta-Yahya, P. P., Keasling, J. D., 2010. Advanced biofuel production in microbes. Biotechnol J. 5, 147-62;

[0314] Puigbo, P., Bravo, I., Garcia-Valive, S., 2008. E-CAI: a novel server to estimate an expected value of Codon Adaptation Index (eCAI). BMC Bioinformatics. 9, 65.

[0315] Salis, H. M. 2011. Chapter twoThe Ribosome Binding Site Calculator. In Methods in Enzymology, ed. V. Christopher, 19-42. Academic Press.

[0316] Sallaud, C., C. Giacalone, R. Topfer, S. Goepfert, N. Bakaher, S. Rosti & A. Tissier (2012) Characterization of two genes for the biosynthesis of the labdane diterpene Z-abienol in tobacco (Nicotiana tabacum) glandular trichomes. Plant J, 72, 1-17.

[0317] Sarria, S., Wong, B., Martin, H., Keasling, J. D., Peralta-Yahya, P., 2014. Microbial synthesis of Pinene. ACS Synthetic Biology 3 (7), 466-475

[0318] Scalcinati, G., C. Knuf, S. Partow, Y. Chen, J. Maury, M. Schalk, L. Daviet, J. Nielsen & V. Siewers (2012) Dynamic control of gene expression in Saccharomyces cerevisiae engineered for the production of plant sesquiterpene -santalene in a fed batch mode. Metabolic Engineering, 14, 91-103.

[0319] Scalcinati, G., S. Partow, V. Siewers, M. Schalk, L. Daviet & J. Nielsen (2012) Combined metabolic engineering of precursor and co-factor supply to increase alpha-santalene production by Saccharomyces cerevisiae. Microb Cell Fact, 11, 117.

[0320] Sonntag, F., C. Kroner, P. Lubuta, R. Peyraud, A. Horst, M. Buchhaupt & J. Schrader (2015) Engineering Methylobacterium extorquens for de novo synthesis of the sesquiterpenoid alpha-humulene from methanol. Metab Eng, 32, 82-94.

[0321] Toyama, H., Anthony, C., Lidstrom, M. E., 1998. Construction of insertion and deletion mxa mutants of Methylobacterium extorquens AM1 by electroporation. FEMS Microbiol. Lett. 166, 1-7.

[0322] Van Dien, S. J., Marx, C. J., O'Brien, B. N., Lidstrom, M. E., 2003. Genetic characterization of the carotenoid biosynthetic pathway in Methylobacterium extorquens AM1 and isolation of a colorless mutant. Appl. Environ. Microbiol. 69, 7563-6.

[0323] Yoon, S.-H., Lee, S.-H., Das, A., Ryu, H.-K., Jang, H.-J., Kim, J.-Y., Oh, D.-K., Keasling, J. D., Kim, S.-W., 2009. Combinatorial expression of bacterial whole mevalonate pathway for the production of -carotene in E. coli. Journal of Biotechnology. 140, 218-226;

[0324] Yu, F., Okamto, S., Nakasone, K., Adachi, K., Matsuda, S., Harada, H., Misawa, N., Utsumi, R., 2008. Molecular cloning and functional characterization of alpha-humulene synthase, a possible key enzyme of zerum bone biosynthesis in shampoo ginger (Zingiber zerumbet Smith). Planta. 227, 1291-9.

[0325] Zerbe, P., A. Chiang, M. Yuen, B. Hamberger, B. Hamberger, J. A. Draper, R. Britton & J. Bohlmann (2012) Bifunctional cis-abienol synthase from Abies balsamea discovered by transcriptome sequencing and its implications for diterpenoid fragrance production. J Biol Chem, 287, 12121-31.

SEQUENCE PROTOCOLFREE TEXT

[0326] SEQ ID No. 1: Hydroxymethylglutaryl-CoA synthase, Myxococcus Xanthus [0327] SEQ ID No. 2: Hydroxymethylglutaryl-CoA reductase, Myxococcus Xanthus [0328] SEQ ID No, 3: Mevalonate kinase, Myxococcus Xanthus [0329] SEQ ID No. 4; Phosphomevalonate kinase, Myxococcus Xanthus [0330] SEQ ID No. 5: Pyrophosphomevalonate decarboxylase, Myxococcus Xanthus [0331] SEQ ID No. 6: Isopentenyl pyrophosphate isomerase, Myxococcus Xanthus [0332] SEQ ID No. 7: hmgs gene from Myxococcus xanthus with removed EcoRI restriction site with insertion of a silent mutation (gaattc to gagttc) [0333] SEQ ID No. 8: hmgr gene from Myxococcus xanthus [0334] SEQ ID No. 9; mvaK1 gene from Myxococcus xanthus [0335] SEQ ID No, 10: mvaK2 gene from Myxococcus xanthus [0336] SEQ ID No. 11; mvaD gene from Myxococcus xanthus [0337] SEQ ID No. 12. fni gene from Myxococcus xanthus [0338] SEQ ID No. 13: FPP synthase ERG20 from Saccharomyces cerevisiae, PRT [0339] SEQ ID No. 14; FPP synthase ERG20 from Saccharomyces cerevisiae, DNA [0340] SEQ ID No. 15: Sesquiterpene synthase from Zingiber zerumbet [0341] SEQ ID No, 16: DNA sequence of the alph-humulene synthase zssl from Zingiber zerumbet codon-optimized for Methylobacterium extorquens AM1 [0342] SEQ ID No. 17 Primer HMGS-fw [0343] SEQ ID No. 18 Primer HMGS-rev [0344] SEQ ID No. 19 Primer HMGS-over-fw [0345] SEQ ID No. 20 Primer HMGS-over-rev [0346] SEQ ID No. 21 Primer MVA1_fw [0347] SEQ ID No, 22 Primer MVA-SaclA-rev [0348] SEQ ID No. 23 Primer MVA-SaclA-fw [0349] SEQ ID No. 24 Primer MVA-SaclB-rev [0350] SEQ ID No. 25 Primer MVA-SaclB_fw [0351] SEQ ID No. 26 Primer MVA2_rev [0352] SEQ ID No. 27 Primer pQF_MCS-fw [0353] SEQ ID No. 28 Primer pQF_MCS-rev [0354] SEQ ID No. 29 Primer ZSSI-fw [0355] SEQ ID No. 30 Primer ZSSI-RBS-fw [0356] SEQ ID No. 31 Primer ZSSI-rev [0357] SEQ ID No. 32 Primer ERG20_fw [0358] SEQ ID No. 33 Primer ERG20-RB S(35k)-fw [0359] SEQ ID No. 34 Primer ERG20-RB S(20k)-fw [0360] SEQ ID No. 35 Primer ERG20 rev [0361] SEQ ID No. 36 Primer ERG20 rev-2 [0362] SEQ ID No. 37 Primer fni-RBSopt-fw [0363] SEQ ID No. 38 Primer fni-RBSopt-rev [0364] SEQ ID No. 39 optimized RBS of ERG20 with a TIR of 22,000 [0365] SEQ ID No. 40 optimized RBS of ERG20 with a TIR of 36,800 [0366] SEQ ID No. 41 optimized RBS of zssl with a TIR of 221,625 [0367] SEQ ID No. 42: GGPP synthase from S. cerevisiae [0368] SEQ ID No. 43: GGPP synthase from Pantoea agglomerans [0369] SEQ ID No. 44: GGPP synthase from Taxus canadensis [0370] SEQ ID No. 45 Sesquiterpene synthase from Santalum album [0371] SEQ ID No. 46: Sesquiterpene synthase Santalum spicatum [0372] SEQ ID No. 47: Diterpene synthase from Abies balsamea [0373] SEQ ID No. 48 optimized RBS of fni with a TIR of 65,000 [0374] SEQ ID No. 49 optimized RBS of hmgs with a TIR of 6,345 [0375] SEQ ID No, 50 DNA sequence of the cis-abienol synthase AbCAS from Abies balsamea codon-optimized for Methylobacterium extorquens AM1 [0376] SEQ ID No. 51 optimized RBS of AbCAS with a TIR of 233,000 [0377] SEQ ID No. 52 DNA sequence of the GGPP synthase ERG20F96C from Saccharomyces cerevisiae [0378] SEQ ID No. 53 optimized RBS of ERG20F96C with a TIR of 10,000 in plasmid ppjo16 [0379] SEQ ID No. 54 DNA sequence of the LPP synthase NtLPPS gene from Abies balsamea codon-optimized for Methylobacterium extorquens AM1 [0380] SEQ ID No. 55 DNA sequence of the cis-abienol synthase NtABS gene from Abies balsamea codon-optimized for Methylobacterium extorquens AM1 [0381] SEQ ID No. 56 optimized RBS of NtLPPS with a TIR of 145,000 in plasmid ppjo16 [0382] SEQ ID No. 57 optimized RBS of NtABS with a TIR of 130,000 in plasmid ppjo16 [0383] SEQ ID No. 58 optimized RBS of ERG20F96C with a TIR of 9,500 in plasmid ppjo17 [0384] SEQ ID No. 59: Promoter region of plasmid ppjo16 including RBS AbCAS, beginning directly after CymR* [0385] SEQ ID No. 60:. Promoter region of plasmid ppjo16 from clone 16s6 including RBS AbCAS, beginning directly after CymR* [0386] SEQ ID No. 61: DNA sequence of the santalene synthase SspiSSY from Santalum spicatum codon-optimized for Methylobacterium extorquens AM1 [0387] SEQ ID No. 62: optimized RBS of SSpiSSY with a TIR of 44,000 in plasmid ppjo01 and ppjo01_woMVA [0388] SEQ ID No. 63; optimized RBS of ERG20 with a TIR of 20,000 in plasmid ppjo01 and ppjo01_woMVA [0389] SEQ ID No. 64 DNA sequence of the santalene synthase SanSyn from Clausena lansium codon-optimized for Methylobacterium extorquens AM1 [0390] SEQ ID No. 65: optimized RBS of SanSyn with a TIR of 233,000 in plasmid ppjo03 [0391] SEQ ID No. 66: optimized RBS of ERG20 with a TIR of 22,000 in plasmid ppjo03 [0392] SEQ ID No. 67: optimized RBS of ERG20 with a TIR of 53,000 in plasmid ppjo04 and ppjo04_woMVA [0393] SEQ ID No. 68: optimized RBS of SSpiSSY with a TIR of 402,000 in plasmids ppjo05 and ppjo06 [0394] SEQ ID No. 69: optimized RBS of ERG20 with a TIR of 1,344,000 in plasmid ppjo06 [0395] SEQ ID No. 70 Primer pj05 [0396] SEQ ID No. 71 Primer pj10 [0397] SEQ ID No. 72 Primer pj16 [0398] SEQ ID No. 73 Primer pj17 [0399] SEQ ID No. 74 Primer pj25 [0400] SEQ ID No. 75 Primer pj26 [0401] SEQ ID No. 76 Primer pj27 [0402] SEQ ID No. 77 Primer pj28 [0403] SEQ ID No. 78 Primer pj29 [0404] SEQ ID No. 79 Primer pj30 [0405] SEQ ID No. 80 Primer SspiSSY_RBSopt_fw [0406] SEQ ID No. 81 Primer SspiSSY_rev [0407] SEQ ID No. 82 Primer pj01 [0408] SEQ ID No. 83 Primer pj06 [0409] SEQ ID No. 84 Primer ERG20-fus_fw [0410] SEQ ID No. 85 Primer ERG20-fus_rev [0411] SEQ ID No. 86 Primer pj08 [0412] SEQ ID No. 87 Primer pj09 [0413] SEQ ID No. 88 Primer pj77 [0414] SEQ ID No. 89 Primer pj78 [0415] SEQ ID No. 90 optimized RBS of hmgs with a TIR of 189