METHOD FOR PRODUCING LYSOPHOSPHATIDYLETHANOLAMINE 18:1 FROM MICROORGANISM OF PSEUDOMONAS SP.

20180105849 ยท 2018-04-19

    Inventors

    Cpc classification

    International classification

    Abstract

    A method for producing lysophosphatidylethanolamine 18:1 includes treating phospholipids extracted from a microorganisms of Pseudomonas sp. with phospholipase A.sub.2. The lysophosphatidylethanolamine 18:1 can be used as a plant vaccine material for preventing the plants from injuries caused by pathogen infections and/or environmental stresses and accelerating the recovery of plants injured by pathogen infections and/or environmental stresses, and can also be used as a composition for enhancing fruit ripening (color and sweetness) and storage properties, and as it can be used for an application in plant tissues, food products, pharmaceuticals, cosmetics, and agricultural use, it would be very advantageously used in related industries.

    Claims

    1. A method for production of lysophosphatidylethanolamine comprising: performing culture of a microorganism of Pseudomonas sp. followed by harvesting the microorganism and extracting phospholipids from the microorganism; treating the extracted phospholipids with phospholipase A.sub.2 to produce lysophosphatidylethanolamine, and separating and purifying produced the lysophosphatidylethanolamine.

    2. The method of claim 1, wherein the lysophosphatidylethanolamine has lysophosphatidylethanolamine 18:1 as a main component.

    3. The method of claim 1, wherein the microorganism of Pseudomonas sp. is Pseudomonas caeni, Pseudomonas fluorescens, Pseudomonas putida, or Pseudomonas syringae.

    4. The method of claim 1, wherein the phospholipid is phosphatidylethanolamine.

    5. The method of claim 4, wherein the phosphatidylethanolamine has a 18:1 acyl chain at the first position.

    6. The method of claim 1, wherein the phospholipase A.sub.2 originates from an animal, a microorganism, or a plant.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0013] FIGS. 1A to 1F show the result illustrating damaged local immunity in pla2 mutant plant. FIGS. 1A and 1B are the photographic images in which, unlike the wild type plant, symptoms of the disease are exhibited beyond the hypersensitive response area in the whole plant (A) and leaf (B) of pla2 (knock out) and pla2-II (knock down) mutant plant 6 days after Pst-avrRpm1 infiltration. FIG. 1C is a result illustrating the ion leakage 15 hours after the infiltration of Pst-avrRpm1 (avrRpm1), Pst-avrRpt2 (avrRpt2), Pst-avrRps4 (avrRps4) and virulent Pst (Pst) in the leaf of the wild type plant and pla2 mutant plantNT: control group with no treatment. FIG. 1D is a result illustrating the gene expression levels of PR1 and PDF1.2 in the plant 24 hours after Pst-avrRpm1 infiltration (*P<0.05). FIG. 1E is a result illustrating the result of bacterial growth assay with Pst-avrRpm1 and Pst in pla2 mutant plant and also in pla2 mutant plant (PLA.sub.2/pla2) which has been complemented with native-promoter::PLA.sub.2 (*P<0.05, **P<0.01). FIG. 1F is a result illustrating the result of bacterial growth assay with Pst-avrRpt2 and Pst-avrRps4 in the wild plant and pla2 mutant plant (**P<0.01).

    [0014] FIGS. 2A to 2H show the result illustrating the expression of native PLA.sub.2 and occurrence lipid metabolites like LPE. Specifically, FIG. 2A shows the result illustrating the expression of PLA.sub.2 in the wild type plant inoculated with Pst-avrRpm1 (avrRpm1), FIG. 2B is a photographic image showing the analyzed GUS activity in Arabidopsis plant which has been transformed with PLA.sub.2 promoter::GUS, 1.5 hours after the infiltration with Pst-avrRpm1 and Pst, FIG. 2C is a graph showing the result of analyzing the lipid metabolites which have been produced in the wild type plant, 3 hours after pathogen inoculation, FIG. 2D is a graph showing the result of analyzing the lipid metabolites in pla2 mutant plant after pathogen inoculation, or pathogen inoculation followed by infiltration with recombinant PLA.sub.2 protein, FIG. 2E is a graph showing the result of levels of each LPE species in the wild type leaf treated with mock or Pst-avrRpm1, 3 hours after treatment., FIG. 2F is a graph showing the result of analyzing the LPE species that are released by recombinant PLA.sub.2 protein from a mixture suspension when rPLA.sub.2 protein was mixed with live Pst-avrRpm1, bacterial lipid extract or leaf tissues, and FIG. 2G is a graph showing the antibacterial activity of recombinant PLA.sub.2 protein in which, to the culture media of Pst, M represents a mock treatment, P represents a treatment with PLA.sub.2 protein, PM represents a treatment with a mixture of PLA.sub.2 protein and manoalide, and PMM represents a treatment with a mixture of PLA.sub.2 protein and manoalide buffer (ethanol) (*P<0.05, **P<0.01). Furthermore, FIG. 2H is a graph showing the result of determining the radiolabeled LPE levels released from invading bacteria, 3 hours after inoculation of radiolabeled Pst-avrRpm1 to a leaf of the wild type plant.

    [0015] FIGS. 3A to 3F show the result illustrating the recovery of the local immune response in pla2 mutant plant by supplementation of exogenous LPE18:1, in which FIG. 3A is a photographic image for showing the recovery of phenotypic defect of pla2 mutant plant by treatment of LPE18:1 but not by treatment of LPC (lysophosphatidylcholine) or LPG (lysophosphatidylglycerol), FIG. 3B is a graph of bacterial growth assay illustrating that the impaired local immunity of pla2 mutant plants is complemented by LPE but only a little by LPG., FIG. 3C shows a result of analyzing the gene expression levels of PR1 gene and other wound-related genes in the wild type leaf which has been treated with mock treatment or LPE, FIG. 3D shows the result illustrating the acquirement of local immunity in the wild type plant and pla2 mutant plant by a treatment with only LPE, FIG. 3E is a photographic image illustrating the enhanced disease resistance against virulent Pst, which explains the acquirement of local immunity caused by LPE, and FIG. 3F is a graph showing the result of an in vitro analysis which has been carried out to see whether or not LPE itself has an antibacterial activity against Pst (*P<0.05, **P<0.01).

    [0016] FIGS. 4A to 4E show the result of confirming ICS1-dependent biosynthesis of salicylic acid and NPR1 activation caused by LPE, in which FIGS. 4A and 4C show the result illustrating the gene expression levels, and FIGS. 4B and 4D show the result of analyzing salicylic acid levels. FIG. 4E is an image showing location change of NPR1 from cytoplasm to nucleus after treatment of a transgenic plant carrying 35S::NPR1-eGFP with mock, LPE, or salicylic acid.

    [0017] FIGS. 5A to 5F shows the result of confirming ethylene-dependent expression of PDF1.2 that is mediated by PLA.sub.2 protein and LPE, in which FIGS. 5A and 5D show a change in gene expression levels, FIGS. 5B and 5E show the synthesis levels of ethylene, and FIGS. 5C and 5F show the result of analyzing the synthesis levels of jasmonic acid (*P<0.05, **P<0.01).

    [0018] FIGS. 6A to 6F show the result illustrating that a defect in pla2 mutant plant is dependent on leaf growth stage and photoperiod. FIGS. 6A and 6B show the result illustrating the bacterial growth after inoculation of Pst-avrRpm1 in which the result is shown for different growth conditions (SD, short-day condition with 9 hours of light period: LD, long-day condition with 16 hours of light period) and maturity levels of leaves (*P<0.05, **P<0.01). FIG. 6C shows the result for confirming the gene expression of ICS1 and PR1 after infiltration of a buffer, Dsbc, or PLA.sub.2 protein into pla2 mutant plant. FIG. 6D shows the result of analyzing the PR1 gene expression in a group with mock treatment, or a treatment with PLA.sub.2 protein, or a treatment with PLA.sub.2 protein together with an inhibitor (Mano). FIG. 6E shows the result of analyzing bacterial growth in the wild type plant and pla2 mutant plant after pretreatment with PLA.sub.2 inhibitor followed by inoculation of Pst-avrRpm1. FIG. 6F shows the result of analyzing bacterial growth in which the analysis is made after transforming pla2 mutant plant with a vector having a structure of PLA.sub.2 (no S.P. PLA.sub.2/PLA.sub.2), which remains in the cytoplasm as it cannot secrete apoplast due to lack of a signal peptide, followed by inoculation of Pst-avrRpm1.

    [0019] FIG. 7 is a schematic drawing showing the roles played by PLA.sub.2 protein and LPE of the present invention in plant immune response to the bacteria attack.

    [0020] FIG. 8 is a drawing illustrating the principle for producing lysophosphatidylethanolamine (LPE) from phosphatidylethanolamine (PE) when PE as one type of phospholipids is treated with phospholipase A.sub.2.

    [0021] FIG. 9 shows the result of confirming LPE production according to a treatment of the phospholipid extract of Pseudomonas with phospholipase A.sub.2. Decomposition of PE and production of LPE before (top) and after (bottom) the treatment of phospholipid extract of Pseudomonas with phospholipase A2 were confirmed by HPLC-ELSD analysis.

    [0022] FIG. 10 shows the result of MS/MS analysis illustrating that LPE produced by a treatment of phospholipid extract of Pseudomonas with phospholipase A.sub.2 is mainly composed of LPE 16:0 and LPE18:1.

    [0023] FIG. 11 shows a result of extracting phospholipids to see whether or not PE as an original source material of LPE can be obtained from different types belonging to Pseudomonas sp. other than Pseudomonas syringae, in which phospholipids are extracted from Pseudomonas caeni, Pseudomonas fluorescens, and Pseudomonas putida. As a result, it was found that content of PE containing the 1.sup.st acyl chain of 18:1 is quite high in all types of Pseudomonas.

    [0024] FIG. 12 shows the result of MS/MS analysis illustrating that LPE produced by a treatment of phospholipid extract of Pseudomonas caeni with phospholipase A.sub.2 is mainly composed of LPE18:1 and LPE 16:0.

    [0025] FIG. 13 shows the result of MS/MS analysis illustrating that LPE produced by a treatment of phospholipid extract of Pseudomonas fluorescens with phospholipase A.sub.2 is mainly composed of LPE 16:0 and LPE18:1.

    [0026] FIG. 14 shows the result of MS/MS analysis illustrating that LPE produced by a treatment of phospholipid extract of Pseudomonas putida with phospholipase A.sub.2 is mainly composed of LPE 16:0 and LPE18:1.

    [0027] FIG. 15 shows a result of extracting phospholipids to see whether or not PE as an original source material of LPE18:1 can be obtained from a microorganism other than Pseudomonas, in which phospholipids are extracted from Bacillus subtilis and Arthrobacter citres as Gram positive bacteria, Escherichia coli as Gram negative bacteria, Saccharomyces cerevisiae as yeast, and Chlorella vulgaris as algae. As a result, compared to Pseudomonas syringae, PE was detected at a certain level from Escherichia coli but at very low levels in other microorganisms.

    [0028] FIG. 16 shows the result of MS/MS analysis illustrating that LPE produced by a treatment of phospholipid extract of Escherichia coli with phospholipase A.sub.2 is mainly composed of LPE 16:0 without any LPE18:1.

    DETAILED DESCRIPTION

    [0029] In order to achieve the purpose of the present invention, the present invention provides a method for large scale production of lysophosphatidylethanolamine comprising: [0030] (a) performing large scale culture of a microorganism of Pseudomonas sp. followed by harvesting the microorganism and extracting phospholipids from the microorganism; [0031] (b) treating the phospholipids extracted in the step (a) with phospholipase A.sub.2 to produce lysophosphatidylethanolamine, and [0032] (c) separating and purifying the lysophosphatidylethanolamine produced in the step (b).

    [0033] For the method according to one embodiment of the present invention, the lysophosphatidylethanolamine (hereinbelow, described as LPE) is produced by phospholipase A.sub.2 protein from phospholipids of a cell membrane of pathogen which invades a plant, and LPE can be LPE 16:0, LPE 16:1, LPE 18:0, LPE18:1, LPE 18:2, or LPE 18:3. LPE can be preferably LPE 16:0, LPE 16:1, or LPE18:1, and more preferably LPE18:1, but not limited thereto.

    [0034] Furthermore, for the method of the present invention, the microorganism may be a microorganism of Pseudomonas sp. It is preferably Pseudomonas caeni, Pseudomonas fluorescens, Pseudomonas putida, or Pseudomonas syringae. It is more preferably Pseudomonas caeni or Pseudomonas fluorescens, but not limited thereto.

    [0035] Furthermore, for the method of the present invention, the phospholipids may be phosphatidylcholine, phosphatidylserine, or phosphatidylethanolamine, preferably phosphatidylethanolamine, and more preferably phosphatidylethanolamine in which the acyl chain at the first position is 18:1, but not limited thereto.

    [0036] For the method according to one embodiment of the present invention, the phospholipase A.sub.2 is an enzyme which hydrolyzes the ester bond at sn-2 position of glycerol phospholipid as a main component of a biological membrane to release lysophospholipids and fatty acids. Phospholipase A.sub.2 may be an enzyme originating from an animal like snake toxin, honey bee toxin, or pig pancreatic juice, or from a microorganism or a plant. It can be also a recombinant protein, but not limited thereto.

    [0037] Furthermore, for the method of the present invention, any method well known in the pertinent art can be used as a method for extracting phospholipids from harvested bacteria and a method for separating and purifying lysophosphatidylethanolamine.

    [0038] The present invention further provides lysophosphatidylethanolamine produced by the aforementioned method. Lysophosphatidylethanolamine produced by the method of the present invention is preferably lysophosphatidylethanolamine 18:1, but not limited thereto.

    [0039] Hereinbelow, the present invention is explained in greater detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and by no means the present invention is limited to the following Examples.

    Materials and Methods

    Plant Materials and Chemical Reagents

    [0040] Arabidopsis plant was cultivated at temperature of 22 C. and relative humidity of 60% with conditions including 16 hours of light period and 120 moles m.sup.2s.sup.1 of photon flux density. Because the plant defense response is age-dependent, fully mature leaves of the 4 week old plant were used for various analyses. Arabidopsis (Arabidopsis thaliana) mutants including pla2, pla2-II, sid2, npr1-5, rps2 and ein2 (Salk_099415, CS857021, Salk_042603, CS3724, Salk_087581, CS3071 and CS8072, respectively) were purchased from Arabidopsis Biological Resource Center, USA. Arabidopsis mutants eds1 and pad4-5 were obtained from S. A. Whitham (Iowa State University, USA) and J. E. Parker (Max Planck Institute for Plant Breeding Research, Germany), respectively. The transgenic event expressing NPR1-eGFP and NahG were obtained from X. Dong (Duke University, USA) and O. M. Park (Korea University, South Korea), respectively.

    [0041] Complementarity test of pla2 mutant carrying native-promoter:PLA.sub.2 and generation of PLA.sub.2 overexpressing transgenic event

    [0042] For complementation, pla2 mutant plant was transfected by a floral dip method by using pCAMBIA1300 clone, which is a binary vector for plant transfection including PLA.sub.2 genomic DNA having native promoter part (i.e., from 1175 to +922) at BamHI site. In order to have an artificial deformation for intracellular translocation of PLA.sub.2 (i.e., not allowing secretion to apoplast), pCAMBIA1300 carrying pPLA.sub.2::PLA.sub.2 with no signal peptide was prepared, and introduced to pla2 plant by using Agrobacterium. To generate PLA.sub.2-overexpressing transgenic event, pBIG binary vector carrying p35S::PLA.sub.2 was introduced to the wild type plant.

    Bacterial Inoculation to Plant

    [0043] Pseudomonas syringae pv. tomato DC3000 (hereinbelow, Pst) and Pst-avrRpm1, which is avrRpm1-containing bacterial strain with no virulency, were obtained from Y. J. Kim (Korea University, South Korea). Pst-avrRpt2, which is avrRpt2-containing bacterial strain with no virulency, was obtained from J. M. Park (KRIBB, South Korea) and Pst-avrRps4, which is avrRps4-containing bacterial strain with no virulency, was obtained from R. Innes (Indiana University, USA). The bacterial strains were cultured and treated according to the method of Katagiri, et al. (Arabidopsis Book, 2002, 1:e0039).

    Gene Expression Analysis

    [0044] Total RNA was extracted by using RNA isolator (Gibco, USA) from a sample which has been frozen with liquid nitrogen (i.e., 2 leaves per sample). Reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative polymerase chain reaction (real-time qPCR) were carried out by using gene-specific primers. For the analysis of a real-time quantitative polymerase chain reaction, Applied Biosystems 7900 Real-Time PCR SYSTEM was used. 2X SYBR Green qPCR master mix was used for PCT amplification. The analyzed data were normalized first against the amount of ACTIN1 gene, and the fold increase of gene expression according to treatment was determined in comparison with a mock or non-treatment plant (1.0 fold). Reference gene as an alternative (AT1G13320) was obtained from the previous study (Hong et al., 2010, Plant Cell Physiol. 51:1694-1706). The gene-specific primers that are used in the present invention are as described in Table 1 and Table 2 below.

    TABLE-US-00001 TABLE1 PrimersforRT-PCR Gene Forwarddirection Reversedirection name (5.fwdarw.3)(SEQIDNO:) (5.fwdarw.3)(SEQIDNO:) ACTIN1 GGCGATGAAGCTCAATCCAAACG GGTCACGACCAGCAAGATCAAGAC (SEQIDNO1) (SEQIDNO2) ICS1 GGGGATAAGGGGTTCTCACA CTGCCCTAGTTACAACCCGA (SEQIDNO3) (SEQIDNO4) JMT GGCCAAAGAGGGTATCATCG GCTCGACCACAGCTCTTATGG (SEQIDNO5) (SEQIDNO6) PAL1 AAAGAACATGGTGATCAACGC AGTTGAGATCGCAGCCACTT (SEQIDNO7) (SEQIDNO8) PDF1.2 CACCCTTATCTTCGCTGCTC GTTGCATGATCCATGTTTGG (SEQIDNO9) (SEQIDNO10) PLA2 CTTAACGTCGGTGTTCAGCTC GGGTTTCTTGAGGACTTTGCC (SEQIDNO11) (SEQIDNO12) PLA2 TCGCACTTCATTGATGCG TCATAGCTCTGTTTTCATATCATTACCT (SEQIDNO13) (SEQIDNO14) PLA2 GTCACGTGTTGCTTTCGG AACGTTTGAACTGCTTGTG (SEQIDNO15) (SEQIDNO16) PLA2 GCTTTAGGCTTAACCGTCTT AGAAGGAGAAGGGTTCATC (SEQIDNO17) (SEQIDNO18) PR1 GTGCTCTTGTTCTTCCCTCG AAGGCCCACCAGAGTGTATG (SEQIDNO19) (SEQIDNO20) VSP1 CTCATACTCAAGCCAAACGGATC GCCATGAAGATAGATGCTTAATT (SEQIDNO21) (SEQIDNO22)

    TABLE-US-00002 TABLE2 PrimersforReal-TimeqRT-PCR Gene Forwarddirection Reversedirection name (5.fwdarw.3)(SEQIDNO:) (5.fwdarw.3)(SEQIDNO:) ACS2 ACCTCTTCTCCGAGCATGAA GCCGTCAAAAACAACCCTAA (SEQIDNO23) (SEQIDNO24) ACS6 CCATAAGACGATGGAGACAGC ACCGCCTCGTGTCACTAAAG (SEQIDNO25) (SEQIDNO26) ACTIN1 CGTACTACCGGTATTGTGCTCGACT GACAATTTCACGCTCTGCTGTGG (SEQIDNO27) (SEQIDNO28) AT1G13320 GCGGTTGTGGAGAACATGATACG GAACCAAACACAATTCGTTGCTG (SEQIDNO29) (SEQIDNO30) ICS1 CTAACCAGTCCGAAAGACGACCTC CTTCCTTCGTAAGTCTCCCTGCC (SEQIDNO31) (SEQIDNO32) JMT GGCCAAAGAGGGTATCATCGAG CCTCACTGATACTCCCACCTTCC (SEQIDNO33) (SEQIDNO34) LOX2 CACCATGGAAATCAACGCTCG CTCAGCCAACCCCCTTTTGATG (SEQIDNO35) (SEQIDNO36) PAL1 GAACTTATTAGATTCCTTAACGCCGG GGAAACTGGTAATTGCTTCGAGAATC (SEQIDNO37) (SEQIDNO38) PDF1.2 GCTTTCGACGCACCGGC CGTAACAGATACACTTGTGTGCTGGG (SEQIDNO39) (SEQIDNO40) PLA.sub.2 TCCATTTCCTTGACTAAAGAATG AGATAATCATTATTCTTGGATTGG (SEQIDNO41) (SEQIDNO42) PR1 CATGTGGGTTAGCGAGAAGGCTA CTCACTTTGGCACATCCGAGTCT (SEQIDNO43) (SEQIDNO44) VSP1 CCTCGAATCGAACACCATCT GGCACCGTGTCGAAGTTTAT (SEQIDNO45) (SEQIDNO46)

    Histochemical Analysis of GUS Activity and Translocation of PLA.SUB.2. to Apoplast

    [0045] To have histochemical localization of GUS activity, transgenic Arabidopsis plant carrying PLA.sub.2-promoter::GUS structure was generated (Jung et al., 2012, Front Plant Sci. 3:126). To have clear expression of PLA.sub.2 in an infected area of a leaf tissue, 3 hours after switching to night condition by turning off the light, the pathogen was syringe-infiltrated to an abaxial surface of the PLA.sub.2-promoter:GUS transgenic Arabidopsis leaf. 1.5 Hours later, histochemical analysis of GUS was carried out according to the method by Jefferson (EMBO J. 1987, 6:3901-3907).

    Lipid Extraction From Leaves and Bacteria, and ESI-MS/MS Analysis

    [0046] According to the method described before (Ryu et al., 1996, Biochem Biophys Acta. 1303:243-250), total lipid was extracted from leaf and bacterial samples. Each phospholipid and free fatty acid (FFA) were quantified by Kansas Lipidomics Research Center based on ESI-MS/MS analysis.

    Treatment With Lipid, Salicylic Acid, and Recombinant PLA.SUB.2. Protein

    [0047] Every phospholipid was purchased from Avanti Polar Lipids Inc. (USA), and free fatty acids (16:0, 18:0 and 18:1) were purchased from Sigma Co. (USA). The solvent was dried under nitrogen gas stream, and the lipids were suspended therein according to ultrasonication so as to have final concentration of 100 nmol ml.sup.1 in 0.018% silwet L-77 (or 200 nmol ml.sup.1 in H.sub.2O). Among the LPE (lysophosphatidylethanolamine) species, LPE18:1 showed the biggest increase in Pst-avrRpm1 inoculation, and thus it is used for the present invention.

    [0048] The mature form of the recombinant PLA.sub.2 protein was produced in Escherichia coli which is fused with Dsbc protein. According to the method described before (Ryu et al., 2005, Biochem Biophys Acta. 1736:144-151), it was purified by affinity chromatography. The protein mixture in which PLA.sub.2 and Dsbc are separated from each other or Dsbc:PLA.sub.2 fusion protein (10 gml.sup.1) was treated on the leaf of pla2 mutant by syringe infiltration, each in an amount of 0.5 g. The enzyme activity of PLA.sub.2 was determined by in vitro analysis using substrate PE for a reaction mixture containing 10 mM Ca.sup.2+ and 0.05% Triton X-100 in 50 mM Tris.Math.HCl (pH 8.5). The mock-treated plant was infiltrated with a buffer (50 mM Tris.Math.HCl, pH 8.0) or Dsbc protein. For inactivation of the PLA.sub.2 activity, recombinant PLA.sub.2 was pre-treated for 30 minutes at 30 C. with 2 M manoalide as an irreversible inhibitor. Inactivation of the PLA.sub.2 activity caused by manoalide was confirmed by an in vitro analysis of PLA.sub.2 activity.

    Antibacterial Activity of PLA.SUB.2. and Release of Lipid Metabolites From Bacteria

    [0049] In order to determine the antibacterial activity of PLA.sub.2, 3 g of recombinant PLA.sub.2 in free and mature form, which has been prepared according to the method by Ryu et al. (Biochem Biophys Acta. 2005, 1736:144-151), was added to 100 l of a solution (Tris.Math.HCl (50 mM, pH 8.0), 10 mM calcium chloride (CaCl.sub.2)) in which virulent Pst (510.sup.5 CFU ml.sup.1) is suspended. The bacteria sample was cultured in a weak shaking state at 28 C. for 6 hours. Thereafter, only the survived bacteria were titrated. As a mock control group, a suspension in which the bacteria are suspended in a solution having no PLA.sub.2 was used.

    Quantification of Salicylic Acid, Ethylene, and Jasmonic Acid, and NPR1 Transition

    [0050] According to the method described before (Bowling et al., 1994, Plant Cell 6:1845-1857; Heck et al., 2003, Plant 1 36:342-352), salicylic acid, ethylene, and jasmonic acid were quantified from 0.5 g of a Arabidopsis leaf sample which has been sprayed with Pst-avrRpm1 suspension (110.sup.8 CFU ml.sup.1 in 0.018% Silwet L-77) or LPE (100 nmol ml.sup.1 in 0.018% Silwet L-77 or 200 nmol ml.sup.1 in H.sub.2O).

    [0051] NPR1 transition was determined by spraying LPE (100 nmol ml.sup.1 in 0.018% Silwet L-77), salicylic acid (0.3 mM in 0.018% Silwet L-77), or mock solution (0.018% Silwet L-77) to a transgenic plant carrying 35S::NPR1-eGFP, and observing, 6 hours later, the plant leaf with a laser scanning confocal microscope (Zeiss, Germany).

    Analysis of Ion Leakage

    [0052] Leaf tissue (i.e., 4 leaves for each sample) was collected, and after vacuum infiltration for 5 minutes with sterilized water, they were cultured at room temperature for 2 hours under shaking. Level of electrolyte leakage from the sample was measured by using a conductivity meter (Mettler Toledo, Switzerland). Data appeared to be the percentage of total electrolyte leakage was obtained by, after freezing, carrying out melting at room temperature under shaking for 6 hours.

    Statistics

    [0053] Student's t-test was employed to determine the statistical significance among groups. The data of bacterial growth analysis and ion leakage analysis were expressed in terms of mean standard deviation, and the significant value was as follows: *P<0.05; **P<0.01. All data other than those were expressed in terms of meanstandard error in which *P<0.05; **P<0.01.

    Production of LPE18:1 by rPLA.SUB.2 .Protein From Pseudomonas Lipid Extract

    [0054] Pseudomonas cell culture was freeze-dried, and total lipids were extracted from the bacteria according to the method described before (Ryu et al., 1996, Biochem Biophys Acta. 1303:243-250). Thereafter, commercially available phospholipase A.sub.2 (powder form) was dissolved in water and 20 l was collected. A mixture of the Pseudomonas lipid extract (20 l), phospholipase A.sub.2 enzyme (20 l), and the reaction buffer (50 mM Tris-HCl, 10 mM CaCl.sub.2, 0.05% Triton X-100) (160 l) was allowed to react for 30 minutes at 30 C. Thereafter, 750 l of Chl:MeOH (1:2) was added thereto to terminate the reaction. By adding 200 l of chloroform and 200 l of KCl (2 M) thereto followed by centrifugation and removal of supernatant, LPE18:1 was obtained.

    EXAMPLE 1

    Local Resistance Gene-Induced Immune Responses are Impaired in pla.SUB.2. Mutants

    [0055] In order to identify the cellular function(s) of secretory PLA.sub.2 in plant defense responses, the pla2 mutants, pla2 (knockout) and pla2-II (knockdown), were obtained from TAIR. Under normal growth conditions, the pla2 mutants did not differ phenotypically from wild-type plants. However, the local immune responses of the pla2 mutants to Pst-avrRpm1 were impaired (FIGS. 1A, 1B, 1D and 1E). Basal resistance of the mutant to virulent Pst was also impaired (FIG. 1E). Although pla2 mutants exhibited an apparently normal hypersensitive response (HR) to the avirulent bacteria (FIG. 1C), they failed to adequately restrict bacterial growth compared to wild type plants (FIGS. 1B and 1E). qRT-PCR analysis also showed that the pla2 mutant plants had much lower Pst-avrRpm1-induced expression of defense genes such as PR1 and PDF1.2 than wild type plants (FIG. 1D). When the pla.sub.2 mutant was complemented with the native-promoter::PLA.sub.2 construct, however, its ability to restrict Pst-avrRpm1 growth and to express defense genes was restored (FIGS. 1E). The pla2 mutant was also unable to mount a local immune response when inoculated with Pst-avrRpt2 or Pst-avrRps4 (FIG. 1F). These results suggest that PLA.sub.2 is involved in the immune responses induced by both CC-NB-LRR and TIR-NB-LRR type R genes.

    EXAMPLE 2

    Resistance Gene-Mediated Expression of PLA.SUB.2. is Followed by an Increase of LPE Levels

    [0056] In Col-0 wild type plants, PLA.sub.2 is expressed at low levels. PLA.sub.2 expression is rapidly and moderately induced upon inoculation with Pst-avrRpm1, but weakly in response to virulent Pst inoculation (FIG. 2A), which suggests that its expression is R gene-mediated. Similar results were also observed with pPLA.sub.2:: GUS assay in which PLA.sub.2 promoter was activated in response to the inoculation of Pst-avrRpm1 but not to that of virulent Pst (FIG. 2B). PLA.sub.2 is then secreted to the apoplast, where it may generate lysophospholipids and free fatty acids from membrane phospholipids. As expected, significant increases in the lipid products of PLA.sub.2, such as LPE, were detected by 3 h post-inoculation of Pst-avrRpm1 in Col-0 wild type plants as compared to mock-inoculated plants (FIG. 2C). Slight increases in lysophosphatidylglycerol (LPG) and lysophosphatidylcholine (LPC) were also detected. When virulent Pst was inoculated, there was no increase in LPE, but slight increases only in LPC and LPG were detected (FIG. 2C). These results indicate that enhanced production of LPE is a specific response to inoculation with avirulent Pst. In contrast, the pla2 mutant failed to show elevated LPE production in response to Pst-avrRpm1 inoculation (FIG. 2D). The LPE species increased in Pst-avrRpm1-infected wild type plant leaves were LPE16:0, LPE18:1, LPE18:2, LPE18:3, and LPE16:1, as compared to mock-treatment (FIG. 2E). However, only LPE18:1 and LPE16:1 were significantly increased in Pst-avrRpm1-treated leaves and they were detected at low amounts in mock-treated ones (FIG. 2E). LPE18:1 and LPE16:1 are known to be rare lipid species in Arabidopsis leaf tissues (Devaiah et al., 2006, Phytochemistry 67:1907-1924). Therefore, we examined if these lipid products originate from the membranes of invading bacteria (FIG. 2F). Recombinant PLA.sub.2 (rPLA.sub.2) showed antimicrobial activity by attacking bacteria (FIG. 2G). When the Pst-avrRpm1 suspension or the lipid extracts of Pst-avrRpm1 were incubated with rPLA.sub.2 protein, LPE18:1, LPE16:0, and LPE16:1 were indeed released from the bacteria or bacterial lipid extracts (FIG. 2F). In order to obtain more direct evidence that some of the LPE species are derived from invading pathogens, Pst-avrRpm1 bacteria were radio-labeled with [.sup.14C]-ethanolamine and were inoculated into wild type plant leaves. The leaves were harvested 3 h post-inoculation, and the lipid extracts of the infected leaves were separated by TLC. In the control (0 h), which was harvested right after bacterial inoculation, most of the radioactivity was detected in the phosphatidylethanolamine (PE) spot zone but not in the LPE spot zone (0.6%). However, about 9% of the total radioactivity was detected in the LPE spot zone 3 h after bacterial inoculation (FIG. 2H), while less radioactive LPE was found (-3%) in pla2 mutant. These results indicate that some LPEs are generated from the membranes of invading pathogens. We also investigated what kinds of LPE species would be released from the host cells by PLA.sub.2 enzymatic activity. When rPLA.sub.2 proteins were infiltrated into wild type plant leaves, LPE16:0 and lower amounts of LPE18:1, LPE18:2 and LPE18:3 were detected 3 h post-treatment (FIG. 2F). These results suggest that LPE18:1, a major species of LPE increased in response to Pst-avrRpm1 infection, can also be released from the membranes of host cells. FFAs, which are other lipid products of PLA.sub.2, increased slightly in response to Pst-avrRpm1 inoculation, but increased significantly only following supplementation with rPLA.sub.2. The major FFA species detected were stearic acid (18:0) and palmitic acid (16:0).

    [0057] Inoculation of wild type leaves with Pst-avrRpm1 increased LPE level by about 35% over the amounts present in mock-treated leaves (FIG. 2C). If we consider that LPE18:1, LPE16:0 and LPE16:1 are newly generated in apoplast, the 35% increase over total LPE amounts, including the amounts of homeostatic/cytosolic LPE16:0, LPE18:2, and LPE18:3, may represent a significant increase in LPE levels in the apoplast, where LPE is initially compartmented. Even when pla2 mutant plant leaves were infiltrated with rPLA.sub.2 2.5 h after bacterial inoculation, we observed only 100% increase in LPE levels after 30 min in the leaves (FIG. 2D).

    EXAMPLE 3

    Defects of pla2 Mutant in Immune Responses are Restored by Exogenous LPE

    [0058] Based on the analysis of pla2 mutant plants compared to wild type, we hypothesized that the defect in immune responses of the pla2 mutant may be due to the failure to generate the lipid products that mediate downstream immune responses. To test this hypothesis, we supplemented pla2 mutant with LPE18:1 1.5 h after inoculation of Pst-avrRpm1. Indeed, LPE restored the ability of the pla2 mutant to induce local immune responses and restricted the propagation of disease symptoms beyond the HR region (FIGS. 3A and 3B). Very importantly, LPE by itself renders local immunity in the absence of avirulent Pst (FIGS. 3C-3E). LPE induced the expression of the PR genes PR1 and PDF1.2, but not the wound-related genes VSP1 and JMT (FIG. 3C). The acquirement of local immunity by LPE in the absence of bacteria was evidenced by the result that LPE treatment suppressed the bacterial growth of virulent Pst in wild type plants as well as in pla2 mutant plants compared to mock treatment (FIG. 3D). In addition, disease symptoms were much reduced in LPE-sprayed leaves compared to mock-treated ones (FIG. 3E). However, LPE itself had no direct effect on bacterial growth in in vitro assays (FIG. 3F). These results support the hypothesis that the defect of the pla2 mutant is due to the failure to produce lipid mediators such as LPE, which trigger downstream immune responses.

    EXAMPLE 4

    ICS1/NPR1-Dependent Salicylic Acid Signaling is Mediated by PLA.SUB.2. and LPE

    [0059] ICS1 plays a role in host immune responses as a key enzyme in SA biosynthesis. When pla2 mutant plants were inoculated with Pst-avrRpm1, they reduced ICS1 expression by 59% compared to wild type plants (FIG. 4A). In contrast, PAL1 expression in infected pla2 plants was rather increased (FIG. 4A). Moreover, pla2 mutant plants inoculated with Pst-avrRpm1 produced 47% lower levels of free SA than wild type (FIG. 4B). Thus, we hypothesized that pla2 mutant with no generation of lipid products including LPE cannot express ICS1 in response to challenge of avirulent bacteria, and that this deficit leads to low SA levels, which in turn fail to induce the downstream signaling cascade leading to PR gene expression. To examine this hypothesis, we asked whether exogenous LPE treatment induces ICS1 expression. Arabidopsis leaves treated with LPE18:1 displayed ICS1 gene expression 6 h post-treatment (FIG. 4C). In contrast, LPE treatment did not elevate PAL1 expression. ICS1 gene expression was followed by a 2.5-fold increase in SA levels (FIG. 4D). These results suggest that LPE elevates SA levels primarily by inducing ICS1-mediated SA biosynthesis. The ICS1 dependency of LPE signaling was further confirmed by the observations that LPE failed to induce PR1 gene expression in the sid2 mutant plants , as did Pst-avrRpm1 inoculation.

    [0060] NPR1 is a key regulator of SA-mediated immune responses leading to PR1 gene expression. NPR1 activation requires its translocation from the cytoplasm to the nucleus due to SA-induced redox changes. Since NPR1 activation is mediated by SA, it is conceivable that the LPE-induced increase in SA may activate NPR1. Application of LPE to transgenic plants carrying 35S::NPR1-eGFP indeed activated NPR1 by inducing its translocation from the cytoplasm to the nucleus, as did SA treatment (FIG. 4E). These results support the hypothesis that LPE mediates and/or potentiates R gene-induced SA biosynthesis followed by NPR1 activation and PR1 gene expression.

    EXAMPLE 5

    Ethylene-Dependent Defense Signaling is Also Mediated by PLA.SUB.2. and LPE

    [0061] The pla2 mutant is also defective in PDF1.2 expression in response to inoculation with Pst-avrRpm1 (FIG. 1D), which is known to be mediated by jasmonic acid (JA) and/or ethylene. The pla2 mutant plants have impaired expression of ACC synthase (ACS), ethylene biosynthesis genes, and reduced ethylene production in response to inoculation with Pst-avrRpm1 (FIGS. 5A and 5B). In contrast, the mutant showed unimpaired expression of LOX2 with no significant difference in JA levels as compared to wild type (FIGS. 5A and 5C). Arabidopsis leaves treated with LPE exhibited ACS gene expression and an increase in ethylene levels, but did not exhibit a significant increase in LOX2 gene expression or in JA levels (FIGS. 5D-5F). These results suggest that PDF1.2 expression in response to Pst-avrRpm1 infection is ethylene-dependent and is mediated by PLA.sub.2 and its lipid products.

    EXAMPLE 6

    Lipid Signal Transduction Mechanism Originating from PLA.SUB.2. Which Occurs During Plant Immune Response

    [0062] The aforementioned results consistently support the hypothesis that the defects of pla2 mutant plants in local host immune responses under long-day conditions are due to the failure of PLA.sub.2 to generate lipid products such as LPE, which mediate R gene-induced immune response. In support of this hypothesis, exogenous treatment of rPLA.sub.2 proteins to pla2 mutant leaves generated endogenous lipid products including LPE (FIG. 2D) and induced the in situ expression of ICS1 and PR1 genes (FIG. 6C), whereas treatment with rPLA.sub.2 proteins that were catalytically inactivated with a PLA.sub.2 inhibitor (manoalide) failed to induce PR1 gene expression (FIG. 6D).

    [0063] Based on our results, we propose that PLA.sub.2-derived lipid-based signaling operates under long-day conditions as follows. Upon inoculation with avirulent Pst, PLA.sub.2 is rapidly, moderately, and transiently expressed in an R gene-mediated manner. PLA.sub.2 is secreted into the extracellular spaces, where it generates its lipid products including LPE from the membranes of invading bacteria and host cells. The LPE then triggers R gene-induced downstream immune responses through both the ICS1/NPR1-dependent SA signaling leading to PR1 expression and the ACS-dependent ethylene signaling leading to PDF1.2 expression (FIG. 7).

    EXAMPLE 7

    Confirmation of Production of LPE18:1 From Lipid Extract of Pseudomonas

    [0064] Pseudomonas syringae was cultured in a large amount, and, after harvesting, lipids were extracted therefrom. The lipid extract was treated with phospholipase A.sub.2, and by using HPLC-ELSD analysis, decomposition of PE (phosphatidylethanolamine) and production of LPE (lysophosphatidylethanolamine) were determined (FIG. 9). According to the result, only the PE peak at the retention time of 9 minutes was shown and the LPE peak at the retention time of 12.5 minutes was weakly shown before the treatment with PLA.sub.2 (see, upper chromatogram of FIG. 9). However, after the treatment with PLA.sub.2, the PE peak at the retention time of 9 minutes has disappeared while appearance of a new LPE peak at the retention time of 12.5 minutes is marked with a box (see, lower chromatogram of FIG. 9). As such, it was found that the treatment of phospholipids isolated from Pseudomonas syringae with phospholipase A.sub.2 leads to production of LPE. Based on MS/MS analysis, it was possible to confirm that the main components of the LPE that are produced after treating Pseudomonas syringae with PLA.sub.2 are LPE18:1 and LPE 16:0 (FIG. 10). Furthermore, in order to see whether or not LPE18:1 can be produced from other microorganisms, phospholipids were extracted from Pseudomonas caeni, Pseudomonas fluorescens, Pseudomonas putida, and Pseudomonas syringae. As a result, it was found that the content of PE as a raw material source of LPE18:1 is very high in all types of the Pseudomonas that are tested (FIG. 11), and LPE18:1 is produced in a large amount in accordance with a treatment with PLA.sub.2 enzyme (FIG. 12 to FIG. 14).

    EXAMPLE 8

    Determination of Possibility of Producing PE in Microorganisms Other Than Pseudomonas

    [0065] In order to see whether or not LPE18:1 can be produced from microorganisms other than Pseudomonas, phospholipids were isolated from Escherichia coli as Gram negative bacteria, Bacillus subtilis and Arthrobacter citres as Gram positive bacteria, Saccharomyces cerevisiae as yeast, and Chlorella vulgaris as algae. As a result of the analysis of phospholipids, it was found that PE as a raw material source of LPE is hardly detected from the microorganisms other than Pseudomonas (FIG. 15). Although a certain amount of PE has been extracted from Escherichia coli, it was found that only LPE 16:0 is produced as a result of treatment with PLA.sub.2 (FIG. 16). As such, it was recognized that, from the microorganisms other than Pseudomonas, or at least from the microorganisms that are tested, it is difficult to obtain PE capable of producing LPE18:1.