METHOD FOR PRODUCING LYSOPHOSPHATIDYLETHANOLAMINE 18:1 FROM MICROORGANISM OF PSEUDOMONAS SP.
20180105849 ยท 2018-04-19
Inventors
- Beung Tae Ryu (Daejeon, KR)
- Young Pyo Lee (Daejeon, KR)
- Ji Hye JUNG (Daejeon, KR)
- Sung Hee Jung (Daejeon, KR)
Cpc classification
C12P9/00
CHEMISTRY; METALLURGY
International classification
Abstract
A method for producing lysophosphatidylethanolamine 18:1 includes treating phospholipids extracted from a microorganisms of Pseudomonas sp. with phospholipase A.sub.2. The lysophosphatidylethanolamine 18:1 can be used as a plant vaccine material for preventing the plants from injuries caused by pathogen infections and/or environmental stresses and accelerating the recovery of plants injured by pathogen infections and/or environmental stresses, and can also be used as a composition for enhancing fruit ripening (color and sweetness) and storage properties, and as it can be used for an application in plant tissues, food products, pharmaceuticals, cosmetics, and agricultural use, it would be very advantageously used in related industries.
Claims
1. A method for production of lysophosphatidylethanolamine comprising: performing culture of a microorganism of Pseudomonas sp. followed by harvesting the microorganism and extracting phospholipids from the microorganism; treating the extracted phospholipids with phospholipase A.sub.2 to produce lysophosphatidylethanolamine, and separating and purifying produced the lysophosphatidylethanolamine.
2. The method of claim 1, wherein the lysophosphatidylethanolamine has lysophosphatidylethanolamine 18:1 as a main component.
3. The method of claim 1, wherein the microorganism of Pseudomonas sp. is Pseudomonas caeni, Pseudomonas fluorescens, Pseudomonas putida, or Pseudomonas syringae.
4. The method of claim 1, wherein the phospholipid is phosphatidylethanolamine.
5. The method of claim 4, wherein the phosphatidylethanolamine has a 18:1 acyl chain at the first position.
6. The method of claim 1, wherein the phospholipase A.sub.2 originates from an animal, a microorganism, or a plant.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
DETAILED DESCRIPTION
[0029] In order to achieve the purpose of the present invention, the present invention provides a method for large scale production of lysophosphatidylethanolamine comprising: [0030] (a) performing large scale culture of a microorganism of Pseudomonas sp. followed by harvesting the microorganism and extracting phospholipids from the microorganism; [0031] (b) treating the phospholipids extracted in the step (a) with phospholipase A.sub.2 to produce lysophosphatidylethanolamine, and [0032] (c) separating and purifying the lysophosphatidylethanolamine produced in the step (b).
[0033] For the method according to one embodiment of the present invention, the lysophosphatidylethanolamine (hereinbelow, described as LPE) is produced by phospholipase A.sub.2 protein from phospholipids of a cell membrane of pathogen which invades a plant, and LPE can be LPE 16:0, LPE 16:1, LPE 18:0, LPE18:1, LPE 18:2, or LPE 18:3. LPE can be preferably LPE 16:0, LPE 16:1, or LPE18:1, and more preferably LPE18:1, but not limited thereto.
[0034] Furthermore, for the method of the present invention, the microorganism may be a microorganism of Pseudomonas sp. It is preferably Pseudomonas caeni, Pseudomonas fluorescens, Pseudomonas putida, or Pseudomonas syringae. It is more preferably Pseudomonas caeni or Pseudomonas fluorescens, but not limited thereto.
[0035] Furthermore, for the method of the present invention, the phospholipids may be phosphatidylcholine, phosphatidylserine, or phosphatidylethanolamine, preferably phosphatidylethanolamine, and more preferably phosphatidylethanolamine in which the acyl chain at the first position is 18:1, but not limited thereto.
[0036] For the method according to one embodiment of the present invention, the phospholipase A.sub.2 is an enzyme which hydrolyzes the ester bond at sn-2 position of glycerol phospholipid as a main component of a biological membrane to release lysophospholipids and fatty acids. Phospholipase A.sub.2 may be an enzyme originating from an animal like snake toxin, honey bee toxin, or pig pancreatic juice, or from a microorganism or a plant. It can be also a recombinant protein, but not limited thereto.
[0037] Furthermore, for the method of the present invention, any method well known in the pertinent art can be used as a method for extracting phospholipids from harvested bacteria and a method for separating and purifying lysophosphatidylethanolamine.
[0038] The present invention further provides lysophosphatidylethanolamine produced by the aforementioned method. Lysophosphatidylethanolamine produced by the method of the present invention is preferably lysophosphatidylethanolamine 18:1, but not limited thereto.
[0039] Hereinbelow, the present invention is explained in greater detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and by no means the present invention is limited to the following Examples.
Materials and Methods
Plant Materials and Chemical Reagents
[0040] Arabidopsis plant was cultivated at temperature of 22 C. and relative humidity of 60% with conditions including 16 hours of light period and 120 moles m.sup.2s.sup.1 of photon flux density. Because the plant defense response is age-dependent, fully mature leaves of the 4 week old plant were used for various analyses. Arabidopsis (Arabidopsis thaliana) mutants including pla2, pla2-II, sid2, npr1-5, rps2 and ein2 (Salk_099415, CS857021, Salk_042603, CS3724, Salk_087581, CS3071 and CS8072, respectively) were purchased from Arabidopsis Biological Resource Center, USA. Arabidopsis mutants eds1 and pad4-5 were obtained from S. A. Whitham (Iowa State University, USA) and J. E. Parker (Max Planck Institute for Plant Breeding Research, Germany), respectively. The transgenic event expressing NPR1-eGFP and NahG were obtained from X. Dong (Duke University, USA) and O. M. Park (Korea University, South Korea), respectively.
[0041] Complementarity test of pla2 mutant carrying native-promoter:PLA.sub.2 and generation of PLA.sub.2 overexpressing transgenic event
[0042] For complementation, pla2 mutant plant was transfected by a floral dip method by using pCAMBIA1300 clone, which is a binary vector for plant transfection including PLA.sub.2 genomic DNA having native promoter part (i.e., from 1175 to +922) at BamHI site. In order to have an artificial deformation for intracellular translocation of PLA.sub.2 (i.e., not allowing secretion to apoplast), pCAMBIA1300 carrying pPLA.sub.2::PLA.sub.2 with no signal peptide was prepared, and introduced to pla2 plant by using Agrobacterium. To generate PLA.sub.2-overexpressing transgenic event, pBIG binary vector carrying p35S::PLA.sub.2 was introduced to the wild type plant.
Bacterial Inoculation to Plant
[0043] Pseudomonas syringae pv. tomato DC3000 (hereinbelow, Pst) and Pst-avrRpm1, which is avrRpm1-containing bacterial strain with no virulency, were obtained from Y. J. Kim (Korea University, South Korea). Pst-avrRpt2, which is avrRpt2-containing bacterial strain with no virulency, was obtained from J. M. Park (KRIBB, South Korea) and Pst-avrRps4, which is avrRps4-containing bacterial strain with no virulency, was obtained from R. Innes (Indiana University, USA). The bacterial strains were cultured and treated according to the method of Katagiri, et al. (Arabidopsis Book, 2002, 1:e0039).
Gene Expression Analysis
[0044] Total RNA was extracted by using RNA isolator (Gibco, USA) from a sample which has been frozen with liquid nitrogen (i.e., 2 leaves per sample). Reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative polymerase chain reaction (real-time qPCR) were carried out by using gene-specific primers. For the analysis of a real-time quantitative polymerase chain reaction, Applied Biosystems 7900 Real-Time PCR SYSTEM was used. 2X SYBR Green qPCR master mix was used for PCT amplification. The analyzed data were normalized first against the amount of ACTIN1 gene, and the fold increase of gene expression according to treatment was determined in comparison with a mock or non-treatment plant (1.0 fold). Reference gene as an alternative (AT1G13320) was obtained from the previous study (Hong et al., 2010, Plant Cell Physiol. 51:1694-1706). The gene-specific primers that are used in the present invention are as described in Table 1 and Table 2 below.
TABLE-US-00001 TABLE1 PrimersforRT-PCR Gene Forwarddirection Reversedirection name (5.fwdarw.3)(SEQIDNO:) (5.fwdarw.3)(SEQIDNO:) ACTIN1 GGCGATGAAGCTCAATCCAAACG GGTCACGACCAGCAAGATCAAGAC (SEQIDNO1) (SEQIDNO2) ICS1 GGGGATAAGGGGTTCTCACA CTGCCCTAGTTACAACCCGA (SEQIDNO3) (SEQIDNO4) JMT GGCCAAAGAGGGTATCATCG GCTCGACCACAGCTCTTATGG (SEQIDNO5) (SEQIDNO6) PAL1 AAAGAACATGGTGATCAACGC AGTTGAGATCGCAGCCACTT (SEQIDNO7) (SEQIDNO8) PDF1.2 CACCCTTATCTTCGCTGCTC GTTGCATGATCCATGTTTGG (SEQIDNO9) (SEQIDNO10) PLA2 CTTAACGTCGGTGTTCAGCTC GGGTTTCTTGAGGACTTTGCC (SEQIDNO11) (SEQIDNO12) PLA2 TCGCACTTCATTGATGCG TCATAGCTCTGTTTTCATATCATTACCT (SEQIDNO13) (SEQIDNO14) PLA2 GTCACGTGTTGCTTTCGG AACGTTTGAACTGCTTGTG (SEQIDNO15) (SEQIDNO16) PLA2 GCTTTAGGCTTAACCGTCTT AGAAGGAGAAGGGTTCATC (SEQIDNO17) (SEQIDNO18) PR1 GTGCTCTTGTTCTTCCCTCG AAGGCCCACCAGAGTGTATG (SEQIDNO19) (SEQIDNO20) VSP1 CTCATACTCAAGCCAAACGGATC GCCATGAAGATAGATGCTTAATT (SEQIDNO21) (SEQIDNO22)
TABLE-US-00002 TABLE2 PrimersforReal-TimeqRT-PCR Gene Forwarddirection Reversedirection name (5.fwdarw.3)(SEQIDNO:) (5.fwdarw.3)(SEQIDNO:) ACS2 ACCTCTTCTCCGAGCATGAA GCCGTCAAAAACAACCCTAA (SEQIDNO23) (SEQIDNO24) ACS6 CCATAAGACGATGGAGACAGC ACCGCCTCGTGTCACTAAAG (SEQIDNO25) (SEQIDNO26) ACTIN1 CGTACTACCGGTATTGTGCTCGACT GACAATTTCACGCTCTGCTGTGG (SEQIDNO27) (SEQIDNO28) AT1G13320 GCGGTTGTGGAGAACATGATACG GAACCAAACACAATTCGTTGCTG (SEQIDNO29) (SEQIDNO30) ICS1 CTAACCAGTCCGAAAGACGACCTC CTTCCTTCGTAAGTCTCCCTGCC (SEQIDNO31) (SEQIDNO32) JMT GGCCAAAGAGGGTATCATCGAG CCTCACTGATACTCCCACCTTCC (SEQIDNO33) (SEQIDNO34) LOX2 CACCATGGAAATCAACGCTCG CTCAGCCAACCCCCTTTTGATG (SEQIDNO35) (SEQIDNO36) PAL1 GAACTTATTAGATTCCTTAACGCCGG GGAAACTGGTAATTGCTTCGAGAATC (SEQIDNO37) (SEQIDNO38) PDF1.2 GCTTTCGACGCACCGGC CGTAACAGATACACTTGTGTGCTGGG (SEQIDNO39) (SEQIDNO40) PLA.sub.2 TCCATTTCCTTGACTAAAGAATG AGATAATCATTATTCTTGGATTGG (SEQIDNO41) (SEQIDNO42) PR1 CATGTGGGTTAGCGAGAAGGCTA CTCACTTTGGCACATCCGAGTCT (SEQIDNO43) (SEQIDNO44) VSP1 CCTCGAATCGAACACCATCT GGCACCGTGTCGAAGTTTAT (SEQIDNO45) (SEQIDNO46)
Histochemical Analysis of GUS Activity and Translocation of PLA.SUB.2. to Apoplast
[0045] To have histochemical localization of GUS activity, transgenic Arabidopsis plant carrying PLA.sub.2-promoter::GUS structure was generated (Jung et al., 2012, Front Plant Sci. 3:126). To have clear expression of PLA.sub.2 in an infected area of a leaf tissue, 3 hours after switching to night condition by turning off the light, the pathogen was syringe-infiltrated to an abaxial surface of the PLA.sub.2-promoter:GUS transgenic Arabidopsis leaf. 1.5 Hours later, histochemical analysis of GUS was carried out according to the method by Jefferson (EMBO J. 1987, 6:3901-3907).
Lipid Extraction From Leaves and Bacteria, and ESI-MS/MS Analysis
[0046] According to the method described before (Ryu et al., 1996, Biochem Biophys Acta. 1303:243-250), total lipid was extracted from leaf and bacterial samples. Each phospholipid and free fatty acid (FFA) were quantified by Kansas Lipidomics Research Center based on ESI-MS/MS analysis.
Treatment With Lipid, Salicylic Acid, and Recombinant PLA.SUB.2. Protein
[0047] Every phospholipid was purchased from Avanti Polar Lipids Inc. (USA), and free fatty acids (16:0, 18:0 and 18:1) were purchased from Sigma Co. (USA). The solvent was dried under nitrogen gas stream, and the lipids were suspended therein according to ultrasonication so as to have final concentration of 100 nmol ml.sup.1 in 0.018% silwet L-77 (or 200 nmol ml.sup.1 in H.sub.2O). Among the LPE (lysophosphatidylethanolamine) species, LPE18:1 showed the biggest increase in Pst-avrRpm1 inoculation, and thus it is used for the present invention.
[0048] The mature form of the recombinant PLA.sub.2 protein was produced in Escherichia coli which is fused with Dsbc protein. According to the method described before (Ryu et al., 2005, Biochem Biophys Acta. 1736:144-151), it was purified by affinity chromatography. The protein mixture in which PLA.sub.2 and Dsbc are separated from each other or Dsbc:PLA.sub.2 fusion protein (10 gml.sup.1) was treated on the leaf of pla2 mutant by syringe infiltration, each in an amount of 0.5 g. The enzyme activity of PLA.sub.2 was determined by in vitro analysis using substrate PE for a reaction mixture containing 10 mM Ca.sup.2+ and 0.05% Triton X-100 in 50 mM Tris.Math.HCl (pH 8.5). The mock-treated plant was infiltrated with a buffer (50 mM Tris.Math.HCl, pH 8.0) or Dsbc protein. For inactivation of the PLA.sub.2 activity, recombinant PLA.sub.2 was pre-treated for 30 minutes at 30 C. with 2 M manoalide as an irreversible inhibitor. Inactivation of the PLA.sub.2 activity caused by manoalide was confirmed by an in vitro analysis of PLA.sub.2 activity.
Antibacterial Activity of PLA.SUB.2. and Release of Lipid Metabolites From Bacteria
[0049] In order to determine the antibacterial activity of PLA.sub.2, 3 g of recombinant PLA.sub.2 in free and mature form, which has been prepared according to the method by Ryu et al. (Biochem Biophys Acta. 2005, 1736:144-151), was added to 100 l of a solution (Tris.Math.HCl (50 mM, pH 8.0), 10 mM calcium chloride (CaCl.sub.2)) in which virulent Pst (510.sup.5 CFU ml.sup.1) is suspended. The bacteria sample was cultured in a weak shaking state at 28 C. for 6 hours. Thereafter, only the survived bacteria were titrated. As a mock control group, a suspension in which the bacteria are suspended in a solution having no PLA.sub.2 was used.
Quantification of Salicylic Acid, Ethylene, and Jasmonic Acid, and NPR1 Transition
[0050] According to the method described before (Bowling et al., 1994, Plant Cell 6:1845-1857; Heck et al., 2003, Plant 1 36:342-352), salicylic acid, ethylene, and jasmonic acid were quantified from 0.5 g of a Arabidopsis leaf sample which has been sprayed with Pst-avrRpm1 suspension (110.sup.8 CFU ml.sup.1 in 0.018% Silwet L-77) or LPE (100 nmol ml.sup.1 in 0.018% Silwet L-77 or 200 nmol ml.sup.1 in H.sub.2O).
[0051] NPR1 transition was determined by spraying LPE (100 nmol ml.sup.1 in 0.018% Silwet L-77), salicylic acid (0.3 mM in 0.018% Silwet L-77), or mock solution (0.018% Silwet L-77) to a transgenic plant carrying 35S::NPR1-eGFP, and observing, 6 hours later, the plant leaf with a laser scanning confocal microscope (Zeiss, Germany).
Analysis of Ion Leakage
[0052] Leaf tissue (i.e., 4 leaves for each sample) was collected, and after vacuum infiltration for 5 minutes with sterilized water, they were cultured at room temperature for 2 hours under shaking. Level of electrolyte leakage from the sample was measured by using a conductivity meter (Mettler Toledo, Switzerland). Data appeared to be the percentage of total electrolyte leakage was obtained by, after freezing, carrying out melting at room temperature under shaking for 6 hours.
Statistics
[0053] Student's t-test was employed to determine the statistical significance among groups. The data of bacterial growth analysis and ion leakage analysis were expressed in terms of mean standard deviation, and the significant value was as follows: *P<0.05; **P<0.01. All data other than those were expressed in terms of meanstandard error in which *P<0.05; **P<0.01.
Production of LPE18:1 by rPLA.SUB.2 .Protein From Pseudomonas Lipid Extract
[0054] Pseudomonas cell culture was freeze-dried, and total lipids were extracted from the bacteria according to the method described before (Ryu et al., 1996, Biochem Biophys Acta. 1303:243-250). Thereafter, commercially available phospholipase A.sub.2 (powder form) was dissolved in water and 20 l was collected. A mixture of the Pseudomonas lipid extract (20 l), phospholipase A.sub.2 enzyme (20 l), and the reaction buffer (50 mM Tris-HCl, 10 mM CaCl.sub.2, 0.05% Triton X-100) (160 l) was allowed to react for 30 minutes at 30 C. Thereafter, 750 l of Chl:MeOH (1:2) was added thereto to terminate the reaction. By adding 200 l of chloroform and 200 l of KCl (2 M) thereto followed by centrifugation and removal of supernatant, LPE18:1 was obtained.
EXAMPLE 1
Local Resistance Gene-Induced Immune Responses are Impaired in pla.SUB.2. Mutants
[0055] In order to identify the cellular function(s) of secretory PLA.sub.2 in plant defense responses, the pla2 mutants, pla2 (knockout) and pla2-II (knockdown), were obtained from TAIR. Under normal growth conditions, the pla2 mutants did not differ phenotypically from wild-type plants. However, the local immune responses of the pla2 mutants to Pst-avrRpm1 were impaired (
EXAMPLE 2
Resistance Gene-Mediated Expression of PLA.SUB.2. is Followed by an Increase of LPE Levels
[0056] In Col-0 wild type plants, PLA.sub.2 is expressed at low levels. PLA.sub.2 expression is rapidly and moderately induced upon inoculation with Pst-avrRpm1, but weakly in response to virulent Pst inoculation (
[0057] Inoculation of wild type leaves with Pst-avrRpm1 increased LPE level by about 35% over the amounts present in mock-treated leaves (
EXAMPLE 3
Defects of pla2 Mutant in Immune Responses are Restored by Exogenous LPE
[0058] Based on the analysis of pla2 mutant plants compared to wild type, we hypothesized that the defect in immune responses of the pla2 mutant may be due to the failure to generate the lipid products that mediate downstream immune responses. To test this hypothesis, we supplemented pla2 mutant with LPE18:1 1.5 h after inoculation of Pst-avrRpm1. Indeed, LPE restored the ability of the pla2 mutant to induce local immune responses and restricted the propagation of disease symptoms beyond the HR region (
EXAMPLE 4
ICS1/NPR1-Dependent Salicylic Acid Signaling is Mediated by PLA.SUB.2. and LPE
[0059] ICS1 plays a role in host immune responses as a key enzyme in SA biosynthesis. When pla2 mutant plants were inoculated with Pst-avrRpm1, they reduced ICS1 expression by 59% compared to wild type plants (
[0060] NPR1 is a key regulator of SA-mediated immune responses leading to PR1 gene expression. NPR1 activation requires its translocation from the cytoplasm to the nucleus due to SA-induced redox changes. Since NPR1 activation is mediated by SA, it is conceivable that the LPE-induced increase in SA may activate NPR1. Application of LPE to transgenic plants carrying 35S::NPR1-eGFP indeed activated NPR1 by inducing its translocation from the cytoplasm to the nucleus, as did SA treatment (
EXAMPLE 5
Ethylene-Dependent Defense Signaling is Also Mediated by PLA.SUB.2. and LPE
[0061] The pla2 mutant is also defective in PDF1.2 expression in response to inoculation with Pst-avrRpm1 (
EXAMPLE 6
Lipid Signal Transduction Mechanism Originating from PLA.SUB.2. Which Occurs During Plant Immune Response
[0062] The aforementioned results consistently support the hypothesis that the defects of pla2 mutant plants in local host immune responses under long-day conditions are due to the failure of PLA.sub.2 to generate lipid products such as LPE, which mediate R gene-induced immune response. In support of this hypothesis, exogenous treatment of rPLA.sub.2 proteins to pla2 mutant leaves generated endogenous lipid products including LPE (
[0063] Based on our results, we propose that PLA.sub.2-derived lipid-based signaling operates under long-day conditions as follows. Upon inoculation with avirulent Pst, PLA.sub.2 is rapidly, moderately, and transiently expressed in an R gene-mediated manner. PLA.sub.2 is secreted into the extracellular spaces, where it generates its lipid products including LPE from the membranes of invading bacteria and host cells. The LPE then triggers R gene-induced downstream immune responses through both the ICS1/NPR1-dependent SA signaling leading to PR1 expression and the ACS-dependent ethylene signaling leading to PDF1.2 expression (
EXAMPLE 7
Confirmation of Production of LPE18:1 From Lipid Extract of Pseudomonas
[0064] Pseudomonas syringae was cultured in a large amount, and, after harvesting, lipids were extracted therefrom. The lipid extract was treated with phospholipase A.sub.2, and by using HPLC-ELSD analysis, decomposition of PE (phosphatidylethanolamine) and production of LPE (lysophosphatidylethanolamine) were determined (
EXAMPLE 8
Determination of Possibility of Producing PE in Microorganisms Other Than Pseudomonas
[0065] In order to see whether or not LPE18:1 can be produced from microorganisms other than Pseudomonas, phospholipids were isolated from Escherichia coli as Gram negative bacteria, Bacillus subtilis and Arthrobacter citres as Gram positive bacteria, Saccharomyces cerevisiae as yeast, and Chlorella vulgaris as algae. As a result of the analysis of phospholipids, it was found that PE as a raw material source of LPE is hardly detected from the microorganisms other than Pseudomonas (