Process for extracellular secretion of Brazzein
11613757 · 2023-03-28
Assignee
Inventors
Cpc classification
C07K14/43
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a process for the secretion of brazzein in improved yield.
Claims
1. A process of secreting a Brazzein peptide into a nutrient broth, the process comprising: culturing an E. coli cell comprising a recombinant nucleic acid in the nutrient broth comprising dextrose to generate an E. coli culture, wherein the recombinant nucleic acid comprises: (i) a nucleic acid sequence encoding the Brazzein peptide, (ii) a nucleic acid sequence encoding a signal leader amino acid sequence, wherein the signal leader amino acid sequence is fused at a 5′ end of the Brazzein peptide, and wherein the signal leader amino acid sequence is operable to direct extracellular secretion of the Brazzein peptide, and (iii) an expression control sequence operable to direct expression of the nucleic acid sequence encoding the signal leader amino acid sequence and the nucleic acid sequence encoding the Brazzein peptide; and activating the expression control sequence to generate an extracellularly secreted Brazzein peptide, the activating comprising adding an inducing agent to the nutrient broth and wherein: (a) the expression control sequence is lactose inducible, (b) the inducing agent is selected from the group consisting of: Lactose, isopropylthiogalactoside (IPTG) and a Lactose analogue, (c) activating the expression control sequence directs expression of the nucleic sequence encoding the signal leader amino acid sequence and the nucleic acid sequence encoding the Brazzein peptide, and (d) the signal leader amino acid sequence directs the extracellular secretion of the Brazzein peptide into the nutrient broth.
2. The process according to claim 1, further comprising: periodically measuring an optical density (OD 600) of the E. coli culture, and adding the inducing agent to the nutrient broth when the E. coli culture has an optical density (OD 600) of 0.4.
3. The process according to claim 1, wherein the Brazzein peptide has an amino acid sequence selected from the group consisting of: amino acids 23-75 of SEQ ID NO: 8 and amino acids 23-75 of SEQ ID NO: 2.
4. The process according to claim 1, wherein the signal leader sequence is selected from the group consisting of pelB, ompA, Bla, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB, MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB, and LutA.
5. The process according to claim 4, wherein the signal leader sequence is pelB.
6. The process according to claim 1, wherein the nutrient broth comprises 0.1% (w/v) dextrose.
7. The process according to claim 1, wherein the nutrient broth is TB.
8. The process according to claim 1, wherein the nutrient broth is TB, wherein the nutrient broth comprises 0.1% (w/v) dextrose, and wherein the inducing agent is Lactose.
9. The process according to claim 8, wherein the inducing agent is at a concentration of 5 mM.
10. A process for isolating a Brazzein peptide from a nutrient broth comprising dextrose, the process comprising: culturing an E. coli cell comprising a recombinant nucleic acid in the nutrient broth to generate an E. coli culture, wherein the recombinant nucleic acid comprises: (i) a nucleic acid sequence encoding a Brazzein peptide, (ii) a nucleic acid sequence encoding a signal leader amino acid sequence fused to a 5′ end of the nucleic acid sequence encoding the Brazzein peptide, wherein cellular translation generates the Brazzein peptide having the signal leader amino acid sequence located at a 5′ end, wherein the signal leader amino acid sequence is operable to direct extracellular secretion of the Brazzein peptide, and (iii) an expression control sequence operable to direct expression of the nucleic acid sequence encoding the signal leader amino acid sequence and the nucleic acid sequence encoding the Brazzein peptide; activating the expression control sequence to generate an extracellulary secreted Brazzein peptide, the activating comprising adding an inducing agent to the nutrient broth, and wherein: (a) the expression control sequence is lactose inducible, (b) the inducing agent is selected from the group consisting of: Lactose, isopropylthiogalactoside (IPTG) and a Lactose analogue, (c) activating the expression control sequence directs expression of the nucleic sequence encoding the signal leader amino acid sequence and the nucleic acid sequence encoding the Brazzein peptide, and (d) the signal leader amino acid sequence directs the extracellular secretion of the Brazzein peptide into the nutrient broth; and separating the E. coli culture to form a cell pellet and a supernatant, wherein the supernatant comprises the Brazzein peptide.
11. The process according to claim 10, further comprising purifying the supernatant to yield a purified Brazzein peptide.
12. The process according to claim 10, wherein the Brazzein peptide has an amino acid sequence selected from the group consisting of: amino acids 23-75 of SEQ ID NO: 8 and amino acids 23-75 of SEQ ID NO: 2.
13. The process according to claim 10, wherein the nutrient broth comprises 0.1% (w/v) dextrose).
14. The process according to claim 10, wherein the nutrient broth is TB.
15. The process according to claim 10, wherein the nutrient broth is TB, wherein the nutrient broth comprises 0.1% (w/v) dextrose, and wherein the inducing agent is Lactose.
16. The process according to claim 15, wherein the inducing agent is at a concentration of 5 mM.
17. The process according to claim 10, further comprising: periodically measuring an optical density (OD 600) of the E. coli culture, and adding the inducing agent to the nutrient broth when the E. coli culture has an optical density (OD 600) of 0.4.
18. The process according to claim 10, wherein the signal leader sequence is selected from the group consisting of pelB, ompA, Bla, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB, MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB, and LutA.
19. The process according to claim 18, wherein the signal leader sequence is pelB.
Description
DETAILED DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
DETAILED DESCRIPTION OF THE INVENTION
(12) The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.
(13) In a preferred embodiment, the present invention provides a process for the extracellular secretion of recombinant brazzein with improved yield comprising: (a) ligating a nucleotide sequence encoding a signal leader sequence conjugated to Brazzein in a recombinant vector to obtain a recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; (b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 4 hrs to 72 hrs to obtain secretion of Brazzein in the culture medium, and (c) separating culture medium from cells and purifying Brazzein from the clarified medium
(14) Accordingly, nucleotide sequence encoding the signal leader sequence conjugated to the Brazzein is amplified with primers. The signal sequence-Brazzein amplified gene is ligated in an expression vector to obtain a recombinant vector construct which is transformed in BL21(DE3) E. coli cells. The transformed cells of E. coli carrying the recombinant construct is cultivated in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 4 hrs to 72 hrs, to obtain the extracellular secretion of brazzein. The cells are separated from the culture medium post induction and the culture medium also termed as the extracellular fraction is subjected to heating at temperatures as high as 90° C. to obtain Brazzein having >90% purity and in increased yield. As a result of heating, most of the endogenous E. coli proteins present in the cell free supernatant are precipitated, leaving >90% pure Brazzein in solution.
(15) In an embodiment, the signal leader sequence to be conjugated to Brazzein is selected from the group consisting of the pelB s ompA, Bla, PhoA, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB, MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB and LutA signal sequences.
(16) In another embodiment, the present invention provides induction of signal leader-Brazzein expression in E. coli cells by addition of lactose ranging from 2.5 mM to 5 mM in the culture medium.
(17) In yet another embodiment, the present invention provides induction of signal leader-Brazzein expression in E. coli cells by IPTG addition ranging from 0.25 mM to 0.5 mM in the culture medium.
(18) Accordingly, extra-cellular secretion of brazzein at varying concentration of IPTG i.e. 0.25 mM and 0.5 mM at durations ranging from 24 hrs to 72 hrs is depicted in
(19) In another preferred embodiment, the present invention provides a process for extracellular synthesis of recombinant Brazzein with improved yield comprising: a) ligating a pET vector with a nucleotide sequence encoding a pelB signal leader sequence conjugated to Brazzein to obtain a recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 2 hrs to 72 hrs, and c) separating culture medium from cells 4-72 hours post induction and purifying Brazzein from the clarified medium.
(20) Accordingly, the process for extracellular synthesis of recombinant Brazzein conjugated to the pelB signal leader sequence comprises (a) inserting the pelB-Brazzein coding sequence in a vector, wherein the said coding sequence is amplified by employing primers selected from sequences represented by Seq Id No. 3 and Seq Id No. 4; (b) ligating pelB-Brazzein coding sequence in a pET vector to obtain a recombinant construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; (c) culturing the transformed cells of step (b) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose, (d) separating culture medium from cells post induction and purifying Brazzein from the clarified medium.
(21) Accordingly, the pET recombinant vector employed to carry the pelB-Brazzein nucleotide sequence is depicted in
(22) The molecular weight of the pelB signal leader sequence conjugated to Brazzein is 8.5 kD. However, after cleavage of the signal peptide, the molecular weight of mature Brazzein is 6.3 kD. The major band corresponding to expression of mature brazzein is indicated by arrow in
(23) In another preferred embodiment, the present invention provides a process for extracellular secretion of recombinant Brazzein with improved yield comprising: a) ligating a pET vector with a nucleotide sequence encoding an ompA signal leader sequence conjugated to brazzein to obtain recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; b) culturing transformed cells of step (a) carrying the recombinant construct in a culture medium in presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 2 hrs to 72 hrs, and c) separating culture medium from cells post induction and purifying Brazzein from the clarified medium.
(24) Accordingly, the process for extracellular synthesis of recombinant brazzein conjugated to ompA signal leader sequence comprises (a) inserting ompA Brazzein nucleotide coding sequence in a vector, wherein the said coding sequence is amplified by employing primers selected from sequences represented by Seq Id No. 4 and Seq Id No. 9; (b) ligating ompA-Brazzein coding sequence in a pET vector to obtain a recombinant construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; (c) culturing the transformed cells of step (b) carrying the recombinant construct in a culture medium in presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose to obtain secretion of Brazzein into the culture medium, and
(25) (d) separating culture medium from cells post 4-72 hours post induction and purifying Brazzein from the clarified medium.
(26) In yet another preferred embodiment, the present invention provides Brazzein expressed in the culture medium is selected from wild-type functional type III brazzein, a variant or multi-variant of the type III form comprising a substitution at the 28.sup.th position of the type III brazzein from Aspartate to Alanine D28A.
(27) Accordingly, the present invention provides the production of extracellular wild-type functional type III Brazzein represented by Seq Id No. 8, which is encoded by Seq Id No. 7. Post synthesis amino acids 1 to 22 of Seq Id No. 8 representing the pelB signal sequence are cleaved by post translational processes, to yield a mature wild-type functional type III Brazzein protein.
(28) In one preferred embodiment, the present invention provides a process for extracellular synthesis of Brazzein in enhanced yield, wherein the yield of brazzein ranging between 0.5 g/l to 5 g/l.
(29) Accordingly, the present process for extracellular synthesis of Brazzein is performed in a −1 or 10 litre scale fermenter.
(30) Brazzein synthesized is found to be stable at temperatures ranging from 4° C. to 90° C.
(31) The following examples, which include preferred embodiments, will serve to illustrate the practice of this invention, it being understood that the particulars shown are by way of example and for purpose of illustrative discussion of preferred embodiments of the invention.
EXAMPLES
(32) Source of Expression Host:
(33) E. coli BL21(DE3) cells were commercially obtained from BioBharati Life Sciences, Kolkata, India
(34) Source of Expression Vector:
(35) pET-28a vector was commercially obtained from Novagen.
Example 1: Codon Optimization and Gene Synthesis
(36) The amino acid sequence of the Type III form of Brazzein was retrieved from Accession source P56552 (Ming D et al, FEBS Lett. 355:106-108(1994)). This amino acid sequence was back translated into a nucleotide sequence that was codon optimized for E. coli. The codon optimized gene also included an Aspartate 28 to an Alanine mutation. This variant was previously shown to exhibit a greater sweet profile in comparison to wildtype Type III Brazzein (Assadi-Porter F M, et al J L.; Arch Biochem Biophys. 2000 Apr. 15; 376(2): 259-65).
(37) The codon optimized gene was fused at the N-terminus with a sequence encoding for the pelB leader sequence and at the C-terminus with three tandem stop codons. The final codon optimized nucleotide sequence of pelB-Brazzein is shown in SeqID 1 and the corresponding amino acid translation in SeqID 2.
(38) pelB-Brazzein gene was synthesized by Genscript (New Jersey, USA) and cloned into pUC57 cloning vector to generate the plasmid Final PELBRAZ.
Example 2: Construction of pET-pelB-Brazzein
(39) The PCR reaction setup is provided in the Table 1 below:
(40) TABLE-US-00001 TABLE 1 Component Concentration Final PELBRAZ plasmid 50 ng primer PelBLun-FNcoNde (Seq Id No. 3) 10 picomoles primer Braz-Rbam (Seq ID No. 4) 10 picomoles Pfu-X reaction Buffer 5 μL dNTP mix 1 μM Pfu-X polymerase 0.5 μL (1 unit) Sterile water To make up the final volume to 50 μL
(41) TABLE-US-00002 TABLE 2 Stages of PCR Amplification: Duration Steps Temperature (Minutes) 1 95° C. 5 min 2 95° C. 1 min 3 55° C. 0.5 min 4 72° C. 1 min 5 Steps 2, 3 and 4 were — repeated 29 times 6 72° C. 10 mins 7 8° C. hold
(42) The PCR amplification reaction was analyzed on a 1.6% (w/v) Agarose gel. The approximate 250 bp PCR amplification product (
Example 3: Construction of pET-pelB-Brazzein (A28D)
(43) In order to create wild-type TypeIII Brazzein, amino acid residue number 50 of pelB-Brazzein was mutated from an Alanine to an Aspartate and is referred to as pelB-Brazzein(A28D).
(44) The first PCR reaction was setup with final PELBRAZ plasmid, primer PelBLun-FNcoNde (Seq Id No. 3), primer BRAZ-A28DRSOE (Seq Id No. 5), Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final PCR reaction solution volume to 50 μL. The specific concentrations of the said components are provided in Table 3.
(45) TABLE-US-00003 Seq Id No. 3: 5′-GCGCGCCCATGGCATATGAAATACCTGCTGCCGACCGC-3′ Seq Id No. 5: 5′-CACCGCTACGCGCATGTTTATCCAGTTTACAGTCGTAGTTACATTG GTTCGC-3′
(46) TABLE-US-00004 TABLE 3 PCR solution for the first reaction Components Concentration Final PELBRAZ plasmid 50 ng PelBLun-FNcoNde (Seq Id No. 3) 10 picomoles BRAZ-A28DRSOE (Seq Id No. 5) 10 picomoles Pfu-X reaction Buffer 5 μL dNTP mix 1 μM Pfu-X polymerase 0.5 μL (1 unit) Sterile water To make up the final volume to 50 μL
(47) TABLE-US-00005 TABLE 4 Reaction Conditions Stages of PCR Amplification: Duration Steps Temperature (Minutes) 1 95° C. 5 min 2 95° C. 1 min 3 55° C. 0.5 min 4 72° C. 1 min 5 Steps 2, 3 and 4 were — repeated 29 times 6 72° C. 10 mins 7 8° C. hold
(48) PCR amplification reaction was analyzed on a 1.6% (w/v) Agarose gel. The approx. 170 bp PCR amplification product was excised from the gel and purified using a commercially available gel extraction kit. This purified fragment was labelled as Frag 1.
(49) The second PCR reaction was setup with: Final PELBRAZ plasmid, primer BRAZ-A28DFSOE (Seq Id No. 6), primer Braz-Rbam (Seq Id No. 4), Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume of the second reaction solution to 50 uL.
(50) TABLE-US-00006 Seq Id No. 6: 5′-GATAAACATGCGCGTAGCGGTG-3′ Seq Id No. 4: 5′-GCGCGCGGATCCTCATTATTAATATTCACAGTAGTCAC AGATACATTGCAG-3′
(51) TABLE-US-00007 TABLE 5 PCR solution for the second reaction Components Concentration Final PELBRAZ plasmid 50 ng BRAZ-A28DFSOE (Seq Id No. 6), 10 picomoles Braz-Rbam (Seq Id No. 4), 10 picomoles Pfu-X reaction Buffer 5 μL dNTP mix 1 μM Pfu-X polymerase 0.5 μL (1 unit) Sterile water To make up the final volume to 50 μL
(52) PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 4. The PCR amplification reaction was analyzed on a 1.6% (w/v) agarose gel. The eighty base pair PCR amplification product was excised from the agarose gel and purified using a commercially available gel extraction kit. The final purified fragment was labelled as Frag 2.
(53) The third PCR reaction comprised splicing by overlap extension PCR reaction, the said reaction setup comprising Frag1, Frag2, primer PelBLun-FNcoNde (Seq Id No. 3), primer Braz-Rbam (Seq Id No. 4), Pfu-X reaction Buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 μL.
(54) TABLE-US-00008 TABLE 6 PCR solution for the third reaction Component Concentration Frag1 5 μL Frag2 5 μL primer PelBLun-FNcoNde (Seq Id No. 3) 10 picomoles primer Braz-Rbam (Seq ID No. 4) 10 picomoles Pfu-X reaction Buffer 5 μL dNTP mix 1 μM Pfu-X polymerase 0.5 μL (1 unit) Sterile water To make up the final volume to 50 μL
(55) PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 4.
(56) The PCR amplification reaction was analyzed on a 1.6% (w/v) Agarose gel. The approximate 250 bp PCR amplification product corresponding to pelB-Brazzein(A28D) was excised from the gel and purified using a commercially available kit. The purified product was digested with NdeI and BamHI for 4 hours at 37° C. and purified using a PCR spin column kit. This was ligated with pET-28a vector that was previously digested with NdeI and BamHI and gel purified. The ligation mixture was transformed into DH5 alpha competent cells. The transformed cells were plated out on LB plates containing 50 μg/mL Kanamycin and incubated overnight at 37° C. Single colonies were picked from the plate into 5 mL LB broth containing 50 μg/mL Kanamycin and grown for 16 hrs in an orbital shaker at 37° C. and 210 rpm. Plasmid DNA was isolated from the cultures and analysed by DNA sequencing. A plasmid clone containing the desired pelB-Brazzein(A28D) insert was identified and labelled as pET-pelB-Brazzein(A28D) and used for protein expression studies.
(57) The final nucleotide sequence of pelB-Brazzein(A28D) is shown in Seq Id No. 7 and the corresponding amino acid translation in Seq Id No. 8.
Example 4: Construction of pET-ompA-Brazzein(A28D)
(58) The ompA-Brazzein(A28D) nucleotide sequence was PCR amplified using following primers: The PCR reaction was setup with pET-pelB-Brazzein(A28D) plasmid, primer ompANde, primer Braz-Rbam, Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 μL. ompANde (Seq Id No. 9):
(59) TABLE-US-00009 5′GCGCGCCCATGGCAATGAAAAAAACGGCAATTGCGATAGCGGTTGC GCTAGCTGGTTTTGCCACGGTGGCGCAGGCTGACAAATGTAAAAAGG- 3′
(60) Braz-Rbam (Seq Id No. 4):
(61) TABLE-US-00010 5′GCGCGCGGATCCTCATTATTAATATTCACAGTAGTCACAGATACAT TGCAG-3′
(62) The PCR reaction was setup with pET-pelB-Brazzein(A28D) plasmid, primer ompANde, primer Braz-Rbam, Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 μL.
(63) TABLE-US-00011 TABLE 5 PCR solution Component Concentration pET-pelB-Brazzein(A28D) plasmid 50 ng ompANde (Seq Id No. 9) 10 picomoles Braz-Rbam (Seq Id No. 4) 10 picomoles Pfu-X reaction Buffer 5 μL dNTP mix 1 μM Pfu-X polymerase 0.5 μL (1 unit) Sterile water To make up the final volume to 50 μL
(64) PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 2.
(65) PCR amplification reaction was analyzed on a 1.6% (w/v) agarose gel. The approx. 250 bp PCR amplification product corresponding to ompA-Brazzein(A28D) was excised from the gel and purified using a commercially available gel extraction kit. The purified product was digested with NdeI and BamHI for 4 hours at 37° C. and purified using a PCR spin column kit. This was ligated with pET-28a vector that was previously digested with NdeI and BamHI and gel purified. The ligation mixture was transformed into DH5alpha competent cells. The transformed cells were plated out on LB plates containing 50 μg/mL Kanamycin and incubated overnight at 37° C. Single colonies were picked from the plate into 5 mL LB containing 50 ug/mL Kanamycin and grown for 16 hrs in an orbital shaker at 37° C. and 210 rpm. Plasmid DNA was isolated from the cultures and submitted for DNA sequencing. A plasmid clone containing the desired ompA-BRAZ insert was identified and labeled as pET-ompA-Brazzein(A28D) and used for protein expression studies.
(66) The final nucleotide sequence of ompA-Brazzein is shown in Seq Id No. 10 and the corresponding protein expressed in Seq Id No. 11.
Example 5: Protein Expression
(67) (i) Expression of pelB-Brazzein with IPTG in LB Medium
(68) The pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 μg/mL Kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. The culture was diluted into two 250 mL baffled flasks containing 25 mL of LB supplemented with 50 μg/mL kanamycin, 0.1% dextrose and growth was continued at 30° C. and 210 rpm. When optical density (OD600) of the cultures reached 0.4, protein expression was induced by adding IPTG to a final concentration of 0.25 mM and 0.5 mM and growth continued 30° C. and 210 rpm. Samples were harvested at 24, 48 and 72 hrs post-induction by spinning down 100 μL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(69) (ii) Expression of pelB-Brazzein with Lactose in LB medium:
(70) pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 μg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. The culture was diluted into two 250 mL baffled flasks containing 25 mL of LB supplemented with 50 ug/mL kanamycin and growth was continued at 30° C. and 210 rpm. When optical density (OD600) of the cultures reached 0.4, protein expression was induced by adding Lactose to a final concentration of 2.5 mM and 5 mM and growth was continued 30° C. and 210 rpm. Samples were harvested at 24, 48 and 72 hrs post-induction by spinning down 100 μL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(71) (iii) Expression of pelB-Brazzein with Lactose in TB Medium:
(72) pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 ug/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50 μg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30° C. and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued at 30° C. and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 μL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(73) (iv) Expression of pelB-Brazzein(A28D) with Lactose in TB Medium:
(74) pET-pelB-Brazzein(A28D) plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 ug/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50 μg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30° C. and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued 30° C. and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 μL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(75) (v) Expression of ompA-Brazzein(A28D) with Lactose in TB Medium:
(76) pET-ompA-Brazzein(A28D) plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 μg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50 μg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30° C. and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued 30° C. and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 μL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(77) (vi) Expression of pelB-Brazzein(A28D) in Fermentor by Fed-Batch Cultivation
(78) Fermentor based expression of pelB-Brazzein(A28D) was carried out in a 5 l fermentor by fed-batch cultivation. pET-pelB-Brazzein(A28D) plasmid was transformed in E. coli BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 μg/mL Kanamycin and incubated at 30° C. overnight. A single colony was picked from the plate in 5 mL LB containing 50 μg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C. and 180 rpm. A 1.5 mL aliquot of the overnight culture was diluted into a baffled flask containing 150 mL of LB supplemented with 50 μg/mL kanamycin, 1% (w/v) Dextrose and growth was continued for 12 hours at 30° C. and 210 rpm. 4.2 L of sterile TB medium in the fermentor were inoculated with 100 ml of this culture and supplemented with 0.1% (w/v) Dextrose and 50 μg/mL Kanamycin. During the fermentation, the temperature and pH were maintained at 30° C. and 7.0, respectively. The dissolved oxygen level was maintained at 30-40% by using air or pure oxygen and the speed was maintained at 600 rpm. After the optical density (OD600) reached 10, a final concentration of 5 mM Lactose was added to induce the expression of pelB-Brazzein(A28D). Samples of the culture were harvested at 4, 12, 18 and 24 hours post induction by spinning down 5 mL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at −20° C. and the supernatants at 4° C. till further analysis by SDS-PAGE (see
(79) (vii) Purification of Brazzein(A28D)
(80) The culture from the fermentor was spun at 5000 g and the clarified cell free supernatant was transferred to a fresh container. To this, powdered 1.2 kg ammonium sulfate was slowly added with gentle stirring. The mixture was incubated for 1 hour with gentle stirring at room temperature and subsequently spun at 5000 g for 30 mins. The supernatant obtained after the spin was discarded and pellet containing precipitated brazzein and other proteins was dissolved in 200 mL of deionized water. This solution was heated to 90° C. for 1 hour and subsequently spun at 5000 g for 30 mins. The supernatant was carefully decanted and transferred to a fresh vessel and it was found that Brazzein (A28D) constitutes a major fraction of the total protein in this supernatant. The supernatant was passed through a 10 kDa MW cut-off centrifugal concentrator at 3000 g. Majority Brazzein passes through the filter membrane and is collected in the flow-through fraction while remaining higher molecular weight proteins do not pass through the membrane and are retained as the retentate fraction in the concentrator. The flow-through fraction was transferred to a 2 kDa MW cut-off centrifugal concentrator and buffer exchanged to water by repeated concentration and dilution with deionized water. This was continued till the colour of the retentate fraction in the concentrator was colourless and the flow-through fraction did not have any salty taste. During this, it was found that Brazzein was completely retained by the membrane in the retentate fraction while low molecular weight molecules passed through into the flow-through fraction (see
(81) The retentate fraction containing Brazzein was harvested into a fresh vessel and stored at 4° C. for further analysis. Protein Quantitation of the sample gave a final yield of 4.4 grams of Brazzein per litre of culture. Purity of Brazzein in lane 2 of
(82) (viii) Sensory Analysis of Brazzein
(83) A portion of the purified Brazzein(A28D) was lyophilized and re-dissolved in deionized water to 1.0 mg/mL. From this, Brazzein(A28D) solutions with following concentrations were made: 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 μg/mL. A 1% (w/v) sucrose solution, the lowest concentration of sucrose detectable by humans, was used as a reference. The taste panel consisted of fifteen females and fifteen males with normal health and normal sense of taste. Two-hundred-microliter samples were applied to the anterior region of the tongue. After each test, the mouth was rinsed with tap water. The tasters sampled from the lower concentration samples to higher. Each taster chose the first sample that could be sensed for sweetness. Sweetness potencies were reported relative to sucrose on a weight basis. The purified Brazzein(A28D) was found to be 1660 times sweeter than sucrose on a weight basis.
(84) TABLE-US-00012 TABLE 6 Sensory Analysis of Purified Brazzzein Experimental Threshold Relative Sweetness Molecule % [g/100 mL] (by weight) Sucrose 1 1 Brazzein(A28D) 0.0006 1660
(ix) SDS-PAGE Analysis
(85) Protein expression was analyzed by SDS-PAGE on 15% Tris-Glycine gels. To analyze protein in the cell culture medium, 17 μL of cell free supernatant (corresponding to 0.07% of total culture volume) was mixed with 17 μL of 2× reducing sample buffer, heated for 5 mins in a PCR machine, briefly spun and loaded into the gel. The gel was run at a constant voltage of 125V till the dye front exited the gel. The gels were washed in Milli-Q water for 1 hour and stained with Coomassie Stain. To analyze protein in whole cells, frozen cell pellets were thawed, re-suspended in 50 μL of Milli-Q water. 17 μL of resuspended cells were mixed with 17 μL of 2× Reducing Sample Buffer, heated for 5 mins in a PCR machine, briefly spun and loaded into the gel. The gel was run at constant voltage of 125V till the dye front exited it. The gels were washed in Milli-Q water for 1 hour and stained with Coomassie Stain.
(86) (x) Thermal Stability and Protein Estimation
(87) Cell free supernatant from (i) was heated to 90° C. for 1 hour in a water bath and spun at 17,500 g for 30 mins. The supernatant was analyzed by SDS-PAGE. Protein quantitation was done using BCA assay kit. As a result of heating, most of the endogenous E. coli proteins present in the cell free supernatant precipitated, leaving >90% pure Brazzein in solution. Protein estimation of the supernatant from the heated and spun sample demonstrated a yield of 0.56 g/L of Brazzein (
(88) (xi) N-Terminal Sequencing
(89) Protein was separated on SDS-PAGE and transferred onto a 0.22 urn pore size PVDF membrane. The membrane was stained with Coommassie Blue till protein bands appeared. The membrane was transferred to Milli-Q water. The band corresponding to Brazzein was cut out with a clean scalpel and submitted for N-terminal sequencing of the first five amino acids. Results from the N-terminal sequencing matched the expected sequence of Type III Brazzein.