Clone of xiamenmycin biosynthesis gene cluster and heterologous expression thereof

Abstract

The present invention involves the application of a gene cluster, and bacterial strains that used in the biosynthesis of Xiamenmycin. The nucleotide sequence of the gene cluster is showed as SEQ ID NO.1, with the whole length of 5189 base pairs. The present invention involves Streptomyces xiamenensis CGMCC No. 5670 and its mutant strain, and the method that how the mentioned bacterial strain produces Xiamenmycin. The present invention provides the strain sources by using Streptomyces xiamenensis, its mutant strains or genetically engineered microbial strains carrying the above-mentioned Xiamenmycin biosynthesis gene cluster for cultivation and produce benzopyran compound Xiamenmycin through biosynthesis. The mutant strains can be used in industrial production.

Claims

1. A method to produce Xiamenmycin, comprising steps of: selecting genetic engineered microbial strains caning the Xiamenmycin biosynthesis gene cluster with a nucleotide sequence showed as an entire full length of SEQ ID NO.1 and with a whole length of 5189 bp, then fermenting the genetic engineered microbial strains in a fermentation medium to produce the Xiamenmycin.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) Features, purposes and advantages of the present invention would be more distinctive through reading and referring to the below attached figures that explain the non-restrictive examples.

(2) FIG. 1A is the high performance liquid chromatography (HPLC) of wild strain's fermentation products;

(3) FIG. 1B is the HPLC profile of fermentation products of ximA mutant;

(4) FIG. 1C is the HPLC profile of fermentation products of ximB mutant;

(5) FIG. 1D is the HPLC profile of fermentation products of ximC mutant;

(6) FIG. 1E is the HPLC profile of fermentation products of the ximD mutant;

(7) FIG. 1F is the HPLC profile of fermentation products of ximE mutant strain;

(8) FIG. 1G is the structural formula of Xiamenmysin B.

(9) FIG. 2: the heterologous expression of Xiamenmycin biosynthesis gene cluster in Streptomyces lividans:

(10) in which: A is HPLC profile of fermentation products of wild-type Streptomyces lividans after introducing pLMO09404; B is HPLC profile of fermentation products of wild-type Streptomyces lividans.

(11) FIG. 3: insertion of 3 mutant rpsL genes into the expression vector pIB139 was confirmed by restriction enzyme digestion analysis.

(12) FIG. 4: HPLC profiles of the mutants generated by PCR site-directed mutagenesis shows increased Xiamenmycin production.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(13) Detailed explanation would be conducted with attached figures and preferred embodiments. The following preferred embodiments could help the technicians to further understand the present invention, but would not confine the present invention in any form. Indicated here that in the precondition that not breaking away from concept of the present invention, the technicians could do some adjustments and improvement. These all belong to the protection domain of the present invention. In the following examples, those with no indication of actual experiment conditions, shall be conducted with normal conditions and the suggestions by the manufacturer.

(14) The present invention relates to a method of cloning and obtaining benzopyran compound (Xiamenmycin) from Streptomyces xiamenensis, and through heterologous expression of xiamenmycin biosynthesis gene cluster to produce compound in other Streptomyces, and a method to improve a yield of the compound by introducing antibiotics-resistance to a producing strain.

(15) Specific explanation: according to a structure feature of a target compound and feeding of a hydroxybenzoic acid (4-HBA) indicated by C.sup.13, it is proved that 4-HBA is one of precursors of benzopyran compound's biosynthesis. According to existing of isopentenyl transferase in the biosynthesis of benzopyran compound, its candidate biosynthesis gene cluster is confirmed to exist in Streptomyces xiamenensis strain 318 by bioinformatic analysis. Design primers based on isopentenyl transferase gene cluster, amplify using PCR and screen from Streptomyces xiamenensis 318 genomic library, then obtain positive fosmid clone p9A11. Carry out gene disruption experiment base on a 5188 by DNA fragment on p9A11, and it is proved that deleting an isopentenyl transferase on the Streptomyces xiamenensis is able to block biosynthesis of the target benzopyran compound. The gene cluster was cloned into vector pSET152, then transformed into Streptomyces lividans for heterologous expression, then the Xiamenmycin is able to be detected in a host's fermentation supernate. Clone the gene rpsL of ribosomal S12 in Streptomyces xiamenensis to carry out external PCR site-directed mutagenesis and clone the mutant rpsL gene into Streptomycete integratative vector and transformed it into Streptomyces xiamenensis by E. coli-streptomycete conjugation and obtain increased yield of xiamenmycin in the mutant strain. The specific process, see as below.

Example 1, Cloning and Heterologous Expression of the Xiamenmycin Biosynthesis Gene Cluster

(16) Firstly, extract DNA of Streptomyces xiamenensis (CGMCC No. 5670), and construct a fosmid library.

(17) Add 500 L lysozyme solution to suspend 5 mg mycelium and incubate in 37 C. till it turns to translucent;

(18) Add 20% SDS with 50% volume, mix until a viscosity of the solution decreases significantly, then add in neutral phenol/chloroform with a same volume, mix it well. And then centrifuged at 12000 rpm for 5 min, a supernatant is collected and a white interlayer is discarded;

(19) Repeat the procedure as mentioned above till the interlayer is hard to be seen. Finally, add 3 M acetate (natural pH, 0.1:1, v:v,) and isopropanol (1:1, v:v) respectively. Mix them upside-down till a white flocculent DNA appears. Use glass rod to pick out the DNA and use 70% ethyl alcohol to wash the DNA for 2 times. Discard all the supernate and add a TE buffer solution to dissolve the DNA after ethyl alcohol has been volatilized.

(20) Construct the fosmid library using a CopyControl Fosmid Library Production Kit (EPICENTRE Biotechnologie).

(21) Secondly, according to a genome mining result, design PCR primers that targeting prenyltransferase, use PCR amplification to screen a positive cloned p9A11.

(22) Use fosmid plasmid as a PCR template and use primer YY-318-5313 to select a positive clone that carring prenyltransferase:

(23) TABLE-US-00001 Forward: 5-TGGCTGGGGATGGTCTTCG-3; (SEQIDNO.2) Reverse: 5-CCTTGTCCTGGTGGGCGTA-3. (SEQIDNO.3)

(24) 20 L amplified reaction includes 9 L ddH2O, 2 L 10PCR Buffer, 1 L DMSO, each primer (20 M) 1 L, 4 L dNTP (each 2.5 mM), 1 L Taq enzyme (1 unit/L), 1 L DNA in total. PCR amplification conditions: initial 3 min denaturation at 95 C., then 1 min denaturation at 94 C., 1 min annealing at 55 C., 1 min extension at 72 C., 30 cycles in total, final 10 min extension at 72 C.

(25) After AGE (agarose gel electrophoresis) separation, a size of the PCR products was about 200 bp.

(26) Thirdly, a 7.5 kb fragment was amplified from fosmid p9A11 and cloned into pJTU1278 to generate plasmid pLMO09403 harboring a complete xiamenmycin gene cluster;

(27) Using p9A11 as a template for primer design:

(28) TABLE-US-00002 Forwardprimer: (SEQIDNO.4) 5-GCTCTAGACGGCTGGAGTGTAGCGAGTCTGGAATG-3, Reverseprimer: (SEQIDNO.5) 5-GGAATTCCCCGGACGTGGGAGCGATAGGG-3.

(29) A PCR product is about 7.5 kb, covering the whole gene cluster. Use high success ratio PCR enzyme KOD FX.

(30) PCR system: 2PCR Buffer 25 L; 2 mM dNTP 10 L; primer 10 pmol/L, each for 1.5 L; template 150 ng/L 1 L; KOD FX 1 L; water 10 L.

(31) The circulation condition of PCR: Initial 2 min denaturation at 94 C., then 10 sec denaturation at 98 C., 8 min extension at 68 C., 40 circulations in total; final heat preservation at 4 C.

(32) 7.5-kb DNA fragment was recovered after 1% Agarose Gel Electrophoresis of PCR products and this fragment was ligated to a vector pMD18-T. Ligation conditions: insert fragment 2 L (158 ng/L), vector 3 L (50 ng/L), solution-I 5 L, 16 C., 15 h.

(33) The positive clone that harbored prenyltransferase was found in the transformed E. coli DH5 using colony PCR and restriction enzyme digestion. The plasmid was digested by XbaI and HindIII and was further purified and separated using 1% AGE. The 7.5 kb XbaI-HindIII DNA fragment was recovered and ligated with a vector pJTU1278, which also digested by corresponding restriction enzyme digestion. Ligation conditions: insert fragment 3 L (134 ng/L), vector 2 (114 ng/L), solution-I 5 L, 16 C., 15 h.

(34) After the positive clone that carried prenyltransferase was found in the transformants of E. coli DH5, colony PCR colony and the restriction enzyme digestion were used in further verification. In XbaI and HindIII double digestion, the vector and insert fragments shall also conform to a theoretical size.

(35) Fourthly, use a PCR-Targeting technology to knock out ximA, ximB, ximC, ximD, ximE of the gene cluster and introduce a mutant plasmid into the Streptomyces strains, knockout corresponding genes.

(36) Transformed pLMO09403 plasmid into the E. coli BW25113 with a chemical transformation method;

(37) Design primer to replace a corresponding open-reading-frame.

(38) Gene replacement of the ximA,

(39) TABLE-US-00003 Forwardprimer(SEQIDNO.6): 5- ATGAGACAGGAGCATCGGGTGGACATACCCGAGAACTTGTGGTTCATGTG CAGCTCCATC-3, Reverseprimer(SEQIDNO.7) 5- TCACGTTCGAGGCGCATTCGACGCCGGATAGTGACGATGTGAGCTCAGCC AATCGACTG-3,

(40) Gene replacement of the ximB,

(41) TABLE-US-00004 Forwardprimer(SEQIDNO.8): 5- GTGATCGATATTTCCGCTCAACCCTCGCAGCAGAGCACGTGGTTCATGTG CAGCTCCATC-3, Reverseprimer(SEQIDNO.9): 5- TCAAAAGACTCTCCCCGCAACGATGGCGACGAGCACGAGTGAGCTCAGCC AATCGACTG-3,

(42) Gene replacement of the ximC,

(43) TABLE-US-00005 Forwardprimer(SEQIDNO.10): 5- GTGCGCACGGAGTCGCGCAGCCTGGCCCAGTTCGTGGCGTGGTTCATGTG CAGCTCCATC-3, Reverseprimer(SEQIDNO.11): 5- TCATGCGTCGTGGACGGCGTCTCGATCGAGGAGACACGGTGAGCTCAGCC AATCGACTG-3,

(44) Gene replacement of the ximD,

(45) TABLE-US-00006 Forwardprimer(SEQIDNO.12): 5- TCATGCGTCGTGGACGGCGTCTCGATCGAGGAGACACGGTGAGCTCAGCC AATCGACTG-3, Reverseprimer(SEQIDNO.13): 5- TCACGTCGTCTCCATCATCGTGTACTCCTGCCGGATCCGTGAGCTCAGCC AATCGACTG-3,

(46) Gene replacement of the ximE,

(47) TABLE-US-00007 Forwardprimer(SEQIDNO.14): 5- ATGGGCCAGACGACGCACACAGCACTCGACCGCTACATGTGGTTCATGTG CAGCTCCATC-3, Reverseprimer(SEQIDNO.15): 5- TCAGCCCGGCGTACGGGTGTACCGGTTGCGCAGGTTCGTTGAGCTCAGCC AATCGACTG-3

(48) Use a vector pSET152 as a template. 20 L amplified reaction includes 9 L ddH.sub.2O, 2 L 10PCR Buffer, 1 L DMSO, each primer (20 M) 1 L, 4 L dNTP (each 2.5 mM), 1 L Taq enzyme, and 1 L pSET152.

(49) PCR amplification conditions: initial 3 min denaturation at 95 C., then 1 min denaturation at 94 C., 1 min annealing at 55 C., 1 min extension at 72 C., 30 cycles in total.

(50) After 1.5% agarose gel electrophoresis, separation of PCR products is of about 1000 bp.

(51) Recover the 5 PCR products and transformed into E. coli BW25113/pJTU318-3 via electrotransformation. Inoculate into LB plate and grow for 12 h-16 h. Use colony-PCR and restriction enzyme digestion to verify the positive clone.

(52) Transform the obtained replacement vector into E. coli ET12567, and conjugation with a wild Streptomyces xiamenensis spore.

(53) After non-selective growth, apramycin-resistant exconjugates that were sensitive to thiostrepton, putatively resulting from double-crossover events, were selected, and their genotype was then confirmed by PCR with the appropriate primers.

(54) Fifthly, after HPLC analysis, in a supernatant of a culture broth of each mutant strains of the ximB, ximC, ximD, and ximE, this benzopyran compound disappeared. An intermediate derivative compound (Xiamenmycin B) appears in the culture broth of the mutant ximA. Therefore, it is proved that this gene cluster is responsible for the biosynthesis of this benzopyran compound.

(55) Ferment the wild and mutant strains in a shake flask with a fermentation medium. Spore suspension is inoculated respectively in the 50 ml TSB medium at 30 C., 220 rpm, for 48 h.

(56) In the third day, inoculate them in an ISP2 medium with 100 ml and culture at 30 C., 220 rpm, for 5 days.

(57) In the sixth day, after centrifugation, collect a supernate and then dried under water bath at 70 C. After that a residual is dissolved in 1 mL methyl alcohol and filtrated with 0.45 mm cellulose membrane. And then, samples are analyzed by HPLC with an RP-18 column (Agilent Eclipse XDB-C18; 4.6*250 mm; 5 m).

(58) Mobile phase composition: acetonitrile and 0.1% formic acid by gradient elution. Linear gradient elution is the concentration of acetonitrile shall be increased from 15% to 40% over 8 min, 40% to 55% over 11 min, 55% to 85% over 7 min. Then, after 4 minutes, the concentration shall be decreased to 15% and keep this balance for 3 minutes. Flow rate: 0.5 mL/min, Uv single-wave: 254 nm, wavelength scanning: 190400 nm, interval: 2 nm, sample size: 10 L.

(59) FIG. 1 shows HPLC detection of fermentation products for the wild strain, the ximA mutant strain, the ximB mutant strain, the ximC mutant strain, the ximD mutant strain, the ximE mutant strain, and the Streptomyces lividans with the integration plasmid carring the xim gene cluster, and wild Streptomyces lividans, as seen in FIG. 1. FIG. 1 (A) is the HPLC for wild strain, peak A is Xiamenmycin, FIG. 1 (B) is the HPLC for the ximA mutant strain, peak B is Xiamenmycin B, FIG. 1 (C) is the HPLC for the ximB mutant strain, peak A (Xiamenmycin) disappears, FIG. 1 (D) is the HPLC for the ximC mutant strain, peak A (Xiamenmycin) disappears, FIG. 1 (E) is the HPLC for the ximD mutant strain, peak A (Xiamenmycin) disappears, FIG. 1 (F) is the HPLC for the ximE mutant strain, peak A (Xiamenmycin) disappears.

(60) Sixthly, isolation and structural identification of Xiamenmycin B from the fermentation broth of the mutant strain of the ximA by preparative HPLC.

(61) Ferment the mutant strains in the shake flask with the fermentation medium. Spore suspension is inoculated respectively in the 50 ml TSB medium at 30 C., 220 rpm, for 48 h. In the third day, inoculate seed culture to 200 flasks containing 100 ml ISP2 medium and culture at 30 C., 220 rpm, for 5 days. In the sixth day, after centrifugation, collect the supernate, then dried under water bath at 70 C. After that the residual is dissolved in 1 mL methyl alcohol and filtrated with 0.45 mm cellulose membrane. And then, the samples are analyzed by the HPLC with the RP-18 column (Agilent Eclipse XDB-C18; 4.6*250 mm; 5 m). Mobile phase composition: acetonitrile and 0.1% formic acid by gradient elution. Linear gradient elution is the concentration of acetonitrile shall be increased from 15% to 40% over 8 min, 40% to 55% over 11 min, 55% to 85% over 7 min. Then, after 4 minutes, the concentration shall be decreased to 15% and keep this balance for 3 minutes. Flow rate: 0.5 mL/min, Uv single-wave: 254 nm, wavelength scanning: 190-400 nm, interval: 2 nm, sample size: 5 L.

(62) The Xiamenmycin B is yellow powder. By analyzing H and C atlas, a structure formula is shown as FIG. 1G. NMR data are listed as in the following tables:

(63) .sup.1H NMR data of the Xiamenmycin B (in DMSO-d.sub.6)

(64) TABLE-US-00008 Site Xiamenmycin B 1 2 3 3.75, t.sup.b 4 2.68, dd (7.5, 7.5) 2.94, dd (5.5, 5.0) 4a 5 7.672, s 6 7 7.638, d (9.0) 8 6.777, d (8.0) 8a 9 1.60, m 10 2.08, m 11 5.098, dd (6.0, 7.5) 12 13 1.552, s 14 1.628, s 15 1.176, s .sup.1 2 3 4 5 6

(65) .sup.13C NMR data of the Xiamenmycin B

(66) TABLE-US-00009 Position Xiamenmycin B 1 2 79.61 3 65.70 4 30.60 4a 120.35 5 130.81 6 124.25 7 128.80 8 116.41 8a 156.87 9 37.45 10 21.12 11 122.25 12 131.69 13 17.41 14 25.41 15 18.40 1 167.08 2 3 4 5 6

Example 2, Functional Verification of the Whole Gene Cluster as Shown as in SEQ ID NO. 1

(67) This embodiment adopts a method that verification of the whole gene cluster's function via heterologous expression of the gene cluster in the Streptomyces lividans. By cloning the whole gene cluster as shown in SEQ ID NO. 1 into the vector pSET152, a new vector pLMO09404 is constructed. After the vector pLMO09404 was integrated into the Streptomyces lividans, existence of the Xiamenmycin B is able to be detected in the fermentation broth.

(68) Firstly, design primer using p9A11 as a template;

(69) TABLE-US-00010 Forwardprimer: (SEQIDNO.16) 5-GCTCTAGACGGCTGGAGTGTAGCGAGTCTGGAATG-3; Reverseprimer: (SEQIDNO.17) 5-GGAATTCCCCGGACGTGGGAGCGATAGGG-3.

(70) This PCR product is about 7.5 kb, covering the whole gene cluster. Use high success ratio PCR enzyme KOD FX.

(71) PCR system: 2PCR Buffer 25 L; 2 mM dNTP 10 L; primer 10 pmol/L, each for 1.5 L, template 150 ng/L 1 L, KOD FX 1 L, water 10 L.

(72) PCR amplification was carried out using the following procedure: denaturation at 94 C. for 2 min; 40 cycles of 98 C. for 10 sec, 68 C. for 8 min. Preserve the PCR product in 4 C.

(73) PCR production was separated by electrophoresis with the 1% agarose gel, and recovered 7.5 Kb DNA fragment, then ligated to pMD18-T.

(74) The ligation mix consisted of the follows: the insertion fragment 2 L (158 ng/L), the vector 3 L (50 ng/L), solution I 5 L, 16 C., 15 h.

(75) The ligation product was transformed to E. coli DH5. The positive clone was identified by colony PCR and restriction enzyme digestion. The inserted PCR fragment was cutted out as an XbaI and HindIII fragment. Recovery 7.5 Kb DNA fragment and cloned into pSET152 that already digested by the XbaI and the HindIII. Ligation mix consists of: insertion fragment 5 L (99 ng/L, vector 1 L (50 ng/L), solution I 6 L, 16 C., 15 h. After ligation, transform E. coli DH5. The positive clone was verified by colony-PCR and restriction enzyme digestion (XbaI and HindIII).

(76) Secondly, introduce the above-mentioned plasmid into E. coli ET12567, and conjugate with wild Streptomyces lividans spore. Screen exconjugates by using PCR to get the positive clone.

(77) Thirdly, after the fermentation of the above mentioned strains, the Xiamenmycin was detected by the HPLC. The heterologous expression of the Xiamenmycin biosynthesis gene cluster in the Streptomyces lividans is shown as in FIG. 2. FIG. 2 (A) is a HPLC profile after the vector pLMO09404 is inserted into the wild Streptomyces lividans, and the Peak A means the Xiamenmycin. FIG. 2 (B) is the HPLC profile of the wild strain of the Streptomyces lividans, and there is no peak of the Xiamenmycin detected. Therefore, biosynthesis of the Xiamenmycin using the whole gene cluster, as show in the SEQ ID NO.1, has been proved in this embodiment.

Example 3 Site-Directed Mutagenesis of rpsL Gene in the Streptomyces Xiamenensis is Able to Raise Production of the Xiamenmycin

(78) Step 1: Design primers based on a sequence of rpsL that encode ribosome S12 protein in Streptomyces xiamenensis genome. And the gene is subjected to the site-directed mutagenesis using PCR to generate point mutations in the rpsL gene, namely, K43R, K88E and L90K respectively.

(79) TABLE-US-00011 (SEQIDNO.18) K43R-F: CACCACCCCGAGGAAGCCGAACTC (SEQIDNO.19) K43R-R: GAGTTCGGCTTCCTCGGGGTGGTG (SEQIDNO.20) K88E-F: GGCCGTGTGGAGGACCTGCCGGGTG (SEQIDNO.21) K88E-R: CACCCGGCAGGTCCTCCACACGGCC (SEQIDNO.22) L90K-F: GTGTGAAGGACAAGCCGGGTGTCCG (SEQIDNO.23) L90K-R: CGGACACCCGGCTTGTCCTTCACAC

(80) Step 2, NdeI and EcoRI restriction sites are used to clone the mutant rpsL gene into the corresponding sites of pIB139. After PCR amplification, the mutation rpsL gene was obtained and cloned into vector pMD-18, to generate plasmid p820/K43R, p822/K88E, and p827/L90K.

(81) After restriction enzyme digestion with NdeI and EcoRV, recover the 391 by DNA fragment, then ligated with the fragment of 5.7 kb NdeI/EcoRV DNA fragment recovered from pIB139 to generate a plasmid 827/pIB139(L90K).

(82) Step 3, transform the mutant rpsL gene into E. coli ET12567::pUZ8002, and used two parental E. coli-Streptomyces conjugations, and then the mutant rpsL gene was transformed into Streptomyces xiamenensis. Enzyme digestion that used to confirm the integration was shown in FIG. 3. Results are in accordance with the expectation.

(83) These mutant strains, namely, 3 antibiotic-resistant mutant strains from the Streptomyces xiamenensis has been preserved in the China General Microbiological Culture Collection Center (CGMCC), in 29 Dec. 2011. Address: No. 3, No. 1 Yard, West Beicheng Road, Chaoyang District, Peking, Institute of Microbiology of Chinese academy of Sciences, Culture Preservation No.: CGMCC No. 5674, CGMCC No. 5675 and CGMCC No. 5676, respectively carring 3 mutant rpsL genes as, K88E, L90K and K43R.

(84) Step 4, after fermentation of these mutants, detect the Xiamenmycin by the HPLC. The Xiamenmycin production of the mutants is shown as in FIG. 4. The results show that the Xiamenmycin (peak A) production of mutants M5, M6, and M7 are greatly improved, and it is about 10-20 times of the wild type strain; besides a yield of other compound as peak B, C, D, E, and F are improved greatly as well.

(85) In conclusion, the present invention provides microbial strains that are able to be used in the biosynthesis of the benzopyran compounds by fermentation, which includes the Streptomyces xiamenensis, its mutants and the genetically modified strains that carring the Xiamenmycin biosynthesis gene cluster, and the mutants are able to be applied in the industrial production.

(86) The preferred embodiments of the invention are described above. We have to understand that the invention is not limited to the above specific methods of implementation and technicians in the same field can do all kinds of transformations or modifications within the claim which will not affect the essential points of the invention.