Method for enrichment of circulating tumor DNA and reagent for enrichment of circulating tumor DNA
09944993 ยท 2018-04-17
Assignee
Inventors
Cpc classification
C12Q2565/119
CHEMISTRY; METALLURGY
C12Q2563/159
CHEMISTRY; METALLURGY
C12Q2565/119
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2563/159
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention provides a method and a reagent for enrichment of circulating tumor DNA, the method comprising the steps of mixing a water phase and an oil phase and shaking the mixture to prepare an emulsion PCR reaction system, and performing emulsion PCR amplification, wherein the water phase comprises peripheral blood plasma DNA as template DNA, a forward primer and a reverse primer, dNTPs, a PCR buffer and a DNA polymerase, the peripheral blood plasma DNA having adapter sequences connected to both ends thereof, and the forward primer and the reverse primer being complementary to the adapter sequences at the two ends respectively; separating the water phase from the oil phase following the emulsion PCR amplification to obtain a PCR amplification product in the water phase; and capturing circulating tumor DNA in the PCR amplification product in the water phase by using a probe sequence that specifically binds to the circulating tumor DNA. The method of the present invention is capable of performing single-molecule high-fidelity ultramicro parallel amplification and effectively capturing peripheral blood plasma ctDNA to provide adequate amount of ctDNA to be used for subsequent sequencing detection.
Claims
1. A method for enrichment of circulating tumor DNA, wherein the method comprises the steps of: single-molecule parallel amplification: mixing a water phase and an oil phase and shaking the mixture to prepare an emulsion PCR reaction system, and performing emulsion PCR amplification, wherein the water phase comprises peripheral blood plasma DNA as template DNA, a forward primer and a reverse primer, dNTPs, a PCR buffer and a DNA polymerase, the peripheral blood plasma DNA having adapter sequences connected to both ends thereof, and the forward primer and the reverse primer being complementary to the adapter sequences at the two ends respectively; wherein the water phase of the emulsion PCR amplification component further comprises dUTP; and the dUTP and the dNTPs are in a molar ratio of from 1:1000 to 1:10; separation of the water phase and the oil phase: separating the water phase from the oil phase following the emulsion PCR amplification to obtain a PCR amplification product in the water phase; and capture of circulating tumor DNA: capturing circulating tumor DNA in the PCR amplification product in the water phase by using a probe sequence that specifically binds to the circulating tumor DNA.
2. The method for enrichment of circulating tumor DNA of claim 1, wherein the adapter sequences are sequencing adapter sequences used in a sequencer.
3. The method for enrichment of circulating tumor DNA of claim 1, wherein the water phase and the oil phase is in a volume ratio of from 1:10 to 1:1.
4. The method for enrichment of circulating tumor DNA of claim 1, wherein the DNA polymerase is a high-fidelity DNA polymerase.
5. The method for enrichment of circulating tumor DNA of claim 1, wherein in the water phase, the peripheral blood plasma DNA is in a total amount of from 1 to 100 ng, the forward primer and the reverse primers are in a final concentration of from 0.1 to 1 M, the dNTPs are in a final concentration of from 0.5 to 2 mM, the PCR buffer is in a final concentration of 1, and the DNA polymerase is in a final concentration of from 0.1 to 1 U.
6. The method for enrichment of circulating tumor DNA of claim 1, wherein the probe sequence used in the step of capture of circulating tumor DNA that specifically binds to the circulating tumor DNA comprises biotin modification; after the probe sequence specifically binds to the circulating tumor DNA, the circulating tumor DNA is captured through specific binding of streptavidin magnetic beads with the biotin.
7. The method for enrichment of circulating tumor DNA of claim 1, wherein the step of capture of circulating tumor DNA is particularly achieved by performing PCR amplification using the probe sequence that specifically binds to the circulating tumor DNA as a primer, wherein the probe sequence as a primer is a sequence that specifically binds to the circulating tumor DNA.
8. A reagent for enrichment of circulating tumor DNA, wherein the reagent comprises the following components: component for emulsion PCR amplification, which comprises a water phase and an oil phase, wherein the water phase comprises a forward primer and a reverse primer, dNTPs, a PCR buffer and a DNA polymerase, the forward primer and the reverse primer being respectively complementary to adapter sequences connected to both ends of peripheral blood plasma DNA; wherein the water phase of the emulsion PCR amplification component further comprises dUTP; and the dUTP and the dNTPs are in a molar ratio of from 1:1000 to 1:10; and component for capture of circulating tumor DNA, which comprises a probe sequence that specifically binds to the circulating tumor DNA, useful for capturing the circulating tumor DNA in the PCR amplification product in the water phase.
9. The reagent for enrichment of circulating tumor DNA of claim 8, wherein the probe sequence comprises biotin modification, and the reagent further comprises streptavidin magnetic beads, which is used to bind with the biotin to capture the circulating tumor DNA after the probe sequence specifically binds to the circulating tumor DNA.
10. The method for enrichment of circulating tumor DNA of claim 2, wherein the forward primer and the reverse primer to which the sequencing adapter sequences correspond are 5-TCCCTACACGACGCTCTTCCGATCT-3 (SEQ ID NO: 1) and 5-TGAACCTGAACCGCTCTTCCGATCT-3 (SEQ ID NO: 2) respectively; or the forward primer and the reverse primer to which the sequencing adapter sequences correspond are TABLE-US-00016 (SEQIDNO:3) 5-CCATCTCATCCCTGCGTGTCTCCGA-3 and (SEQIDNO:4) 5-CCGCTTTCCTCTCTATGGGCAGTCG-3 respectively.
11. The method for enrichment of circulating tumor DNA of claim 3, wherein the water phase and the oil phase is in a volume ratio of from 1:5 to 1:2.
12. The method for enrichment of circulating tumor DNA of claim 5, wherein in the water phase, the peripheral blood plasma DNA is in a total amount of from 1 to 10 ng, the forward primer and the reverse primers are in a final concentration of 0.5 M, the dNTPs are in a final concentration of 1 mM, and the DNA polymerase is in a final concentration of 0.25 U.
13. The method for enrichment of circulating tumor DNA of claim 5, wherein the procedure of the emulsion PCR amplification is as follows: 93-95 C. 1-3 min; 93-95 C. 5-20 s, 61-65 C. 10-20 s, 71-73 C. 5-20 s, 40-60 cycles; and 71-73 C. 4-10 min.
14. The method for enrichment of circulating tumor DNA of claim 13, wherein the procedure of the emulsion PCR amplification is as follows: 94 C. 2 min; 94 C. 10 s, 63 C. 15 s, 72 C. 10 s, 50 cycles; and 72 C. 5 min.
15. The method for enrichment of circulating tumor DNA of claim 6, wherein in capturing the circulating tumor DNA by using the probe sequence, the adapter sequences are blocked using blocking sequences, wherein the blocking sequences specifically bind to the adapter sequences at both ends of the peripheral blood plasma DNA.
16. The reagent for enrichment of circulating tumor DNA of claim 9, wherein the dUTP and the dNTPs are in a molar ratio of 1:100.
17. The reagent for enrichment of circulating tumor DNA of claim 16, wherein the DNA polymerase is a high-fidelity Klenow Fragment, or a KAPA HiFi family high-fidelity DNA polymerase, or a Phusion family high-fidelity DNA polymerase, or a Q5 family high-fidelity DNA polymerase.
18. The reagent for enrichment of circulating tumor DNA of claim 9, wherein the reagent further comprises blocking sequences that specifically bind to the adaptor sequences at both ends of the peripheral blood plasma DNA, useful for blocking the adaptor sequences when using the probe sequence to capture the circulating tumor DNA; and the probe sequence is a sequence that specifically binds to the circulating tumor DNA, useful for performing PCR amplification to obtain enriched circulating tumor DNA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
DETAILED DESCRIPTION OF THE INVENTION
(7) The present invention is described below in further detail by way of embodiments and examples. Unless particularly specified otherwise, the techniques used in the embodiments and examples hereinbelow are all conventional ones known to a person skilled in the art, and the equipments, devices and reagents used are all obtainable, for example commercially available, to a person skilled in the art through public channels.
(8) The present invention mainly addresses the following two problems.
(9) 1. The problem of parallel amplification of ctDNA and nDNA. As the ratio of ctDNA to nDNA is about 1:1000, therefore how to effectively achieve parallel amplification is key to the result of judgment. Conventional PCR amplification methods result in the proportion of nDNA becoming larger and larger while that of ctDNA becoming smaller and smaller as amplification proceeds. In the method according to the present invention, the DNA in peripheral blood plasma (including ctDNA and nDNA) is subjected to ultramicro parallel amplification such that the ratio of both DNAs is still 1:1000 after amplification.
(10) 2. The problem of capture of ctDNA. As the DNA obtained from the above-said parallel amplification include ctDNA and nDNA, it is necessary to capture the cancer gene fraction from the whole genome to obtain ctDNA. The method of the present invention successfully achieves capture and enrichment of ctDNA through a probe sequence that captures ctDNA.
(11) The method of the present invention can effectively perform single-molecule high-fidelity amplification and capture ctDNA, affording an adequate amount of ctDNA for subsequent detection. The method of the present invention mainly includes two parts, which respectively provide solutions to the two problems mentioned above.
(12) Part one involves a solution to the first problem: performing single-molecule parallel amplification of ctDNA and nDNA by using emulsion PCR (ePCR).
(13) The second part involves a solution to the second problem: capturing and isolating a cancer gene by hybridizing a biotin-labeled oligonucleotide (biotin-oligo) with the cancer gene followed by binding the hybrid to streptavidin magnetic beads; or by designing primers and amplifying ctDNA by PCR.
(14) The specific technical solutions of the present invention are described in two parts as follows.
(15) Part One: Emulsion PCR
(16) With reference to
(17) TABLE-US-00001 TABLE 1 Oil phase systems that can be preferably used in the present inventio Oil phase Formulation 1 545 L of light paraffin oil, 450 L of 10% Span80 (dissolved in light paraffin oil), 4 L of Tween80 and 0.5 L of TritonX-100 2 40% (W/W) silicone oil AR20, 30% (W/W) cyclomethylsiloxane (and) silicone polyol copolymer, and 30% (W/W) film-forming resin 749 FLUID 3 7% (W/V) emulsifier ABIL WE90, 20% (V/V) paraffin oil, and 73% (V/V) diethylhexyl carbonate (Tegosoft DEC) 4 7% (W/V) emulsifier ABIL WE90 (dissolved in paraffin oil)
(18) The water-phase reaction system comprises DNA template, dNTPs (including dATP, dTTP, dCTP and dGTP), PCR buffer, DNA polymerase and double distilled water (ddH.sub.2O). The DNA template is selected from peripheral blood plasma DNA, which includes double-stranded ctDNA and nDNA. Before performing ePCR, the DNA double strand is modified in three steps. In the first step, the ends of the double-stranded DNA are repaired; in the second step, A is added to the 3 end of the DNA fragment; and in the third step, specific adapters are added to the ends of the DNA, which are useful for subsequent sequencing. The choice of the adapters is dependent on the particular sequencer used (common sequencers are available from Illumina and Life Tech etc.).
(19) Research found that addition of a small amount of dUTP in the water-phase system facilitates the reaction, the molar ratio of dUTP to dNTPs preferably being 1:1000 to 1:10, more preferably 1:100.
(20) When an Illumina sequencer is used, part of the sequences of the primers for the adapters is as follows:
(21) TABLE-US-00002 (SEQIDNO:1) Forwardprimer(5-3):TCCCTACACGACGCTCTTCCGATCT; (SEQIDNO:2) reverseprimer(5-3):TGAACCTGAACCGCTCTTCCGATCT.
(22) When a Life Tech sequencer is used, part of the sequences of the primers for the adapters is as follows
(23) Ion_A (Red, 5-3): CCATCTCATCCCTGCGTGTCTCCGA (SEQ ID NO: 3); Ion_P1 (Blue, 5-3): CCGCTTTCCTCTCTATGGGCAGTCG (SEQ ID NO: 4). Besides, other components in the water-phase reaction system such as dNTPs, dUTP, buffer and DNA polymerase can be prepared into a Master Mix in advance (see Table 2), which is then dispensed in portions and stored at 20 C. for later use.
(24) TABLE-US-00003 TABLE 2 Proportions of Components for Preparing a Master Mix (total volume 200 L) Reagent Quantity Final conc. (/L) 10 buffer (containing Mg.sup.2+) 20 L 1x phi29 polymerase (10 U/L) 5 L 0.25 U dNTPs (10 mM) 20 L 1.0 mM dUTP (0.1 mM) 20 L .sup.10 M ddH.sub.2O 135 L
(25) In ePCR, the water phase and the oil phase can be selected in different ratios, for example, 75 L:400 L, 240 L:960 L, 200 L:400 L, and 300 L:400 L etc. Taking a ratio of 200 L:400 L of the water phase to the oil phase as an example, formulation 2 is selected as the oil phase, and the 400 L of the oil phase includes 160 L of silicone oil AR20, 120 L of cyclomethylsiloxane (and) silicone polyol copolymer (5225C Formulation Aid) and 120 L of 749 Fluid The water-phase ePCR system and the PCR cycle parameters are as shown in Table 3 and Table 4.
(26) TABLE-US-00004 TABLE 3 Proportions of components of the PCR system Reagent Quantity Master Mix 199 L DNA template 1 L (1 ng) ddH.sub.2O Making up to 200 L
(27) TABLE-US-00005 TABLE 4 PCR cycle parameters Step Temperature Duration Cycle times Pre-denaturation 94 C. 2 min 1 Denaturation 94 C. 10 sec 50 Primer annealing 63 C. 15 sec Elongation 72 C. 10 sec Final Elongation 72 C. 5 min 1 Cooling 4 C. Holding 1
(28) The water phase and the oil phase are sequentially added into a 1.5 mL non-stick reaction tube. After mixing the two phases, the reaction tube containing the reaction system is placed in a tissue lyser (Qiagen Tissue Lyser II) and shaken for 90 seconds at a parameter setting of 13 Hz. The reaction tube is removed, and the oil/water system is dispensed into PCR reaction tubes to perform PCR reaction according to the parameters set forth in Table 4.
(29) Then, after PCR ends, the water phase and the oil phase in the PCR reaction tube are separated. Three processes of separation can be used in the present invention. In the first process, the oil phase in the upper part of the reaction tube is discarded, and 400 L of paraffin oil is added into the reaction tube. The solution in the tube is vortexed or repeatedly pipetted until the emulsion spheres of the water phase are disrupted and the water phase and the oil phase are sufficiently mixed. The liquid mixed to homogeneity is transferred from the PCR reaction tube to a new non-stick reaction tube. The PCR reaction tube is rinsed with 400 L of silicone oil, and the rinsed solution is added to the water phase/oil phase mixed solution. The resulting mixture is sufficiently vortexed and centrifuged at 15,000 rpm for 2 minutes, and the upper oil phase is discardedNext, the mixed solution needs to be rinsed with silicone oil for three times. Five hundred (500) L of silicone oil is added, the resulting mixture is sufficiently vortexed and centrifuged at 15,000 rpm for 1 minutes, and the upper oil phase is discarded. The same procedure is repeated twice to obtain the PCR reaction product in the water phase. In the second process, the water phase and the oil phase in the reaction tube are collected and centrifuged at 9,000 g for 5 minutes. The oil phase is discarded, with the water phase being settled at the bottom of the reaction tube in the form of emulsion spheres. Four hundred (400) L (2 volume) of saturated ethyl ether is added, the mixture is sufficiently vortexed and centrifuged at 15,000 rpm for 2 minutes, and the upper ethyl ether is discarded. This rinsing with ethyl ether is repeated once to obtain the PCR reaction product in the water phase. In the third process, the water phase and the oil phase in the reaction tube are collected and centrifuged at 15,000 rpm for 10 minutes, and the upper oil phase is discarded. Four hundred 400 L (2 volume) of phenol/trichloromethane is added, the mixture is sufficiently vortexed and centrifuged at 15,000 rpm for 2 minutes, and the upper phenol/trichloromethane is discarded. This rinsing with phenol/trichloromethane is repeated once to obtain the PCR reaction product in the water phase.
(30) As the PCR polymerase, generally selected are high-fidelity Klenow Fragment (DNA Polymerase I), KAPA HiFi family DNA polymerase, high-fidelity Phusion family DNA polymerase and high-fidelity Q5 family DNA polymerase, among others. It is to be noted that the DNA product obtained is a single-stranded DNA containing adapters at both ends. In order to avoid the incorporation of nDNA due to complementarity to the adapters on DNA ends during capture of the ctDNA, in subsequent experiments, oligonucleotide sequences complementary to the adapters are added to the ePCR product obtained. That is, the DNA single strand finally obtained is in the form of double-stranded adapters at its ends. Moreover, since there are DNA polymerase and corresponding buffer in the system, therefore in further experiments, it is to be considered whether the enzyme needs to be inactivated (generally at 65-70 C. for 10 minutes, the particular temperature being dependent on the enzyme used).
(31) Part Two:
(32) Single-stranded DNA is obtained in the first part. The second part involves two protocols for capturing ctDNA, as follows.
(33) Protocol I:
(34) With reference to
(35) The biotin-labeled oligonucleotide comprises two portions: a gene complementary pairing portion and a biotin-labeled portion. The biotin can specifically adsorb to the surface of streptavidin magnetic beads. The ctDNA can be isolated by separating the magnetic beads, washing to remove other components, and eluting. The gene complementary pairing portion binds to the ctDNA through base complementary pairing during capture of the ctDNA.
(36) In order to increase the efficiency of capturing the ctDNA, the length of the gene complementary pairing portion can be adjusted according to specific circumstances, and is generally around 50 bp.
(37) Into the DNA product from the ultramicro parallel amplification, a designed biotin-labeled oligonucleotide is added. The mixture is stood at 98 C. for 5 minutes, shaken at 60 C. for 2 hours, and then cooled to room temperature. Streptavidin magnetic beads having been mixed to homogeneity and washed clean are added and shaken at room temperature for 30 minutes. The magnetic beads must be below the liquid surface to ensure sufficient binding of the beads with the ctDNA-Biotin-oligo complex containing the biotin label. Afterwards, the magnetic beads are subjected to elution. First, the reaction tube is placed on a magnetic rack for 2 minutes such that the beads are attached to the wall of the tube, and the liquid is discarded. This procedure is repeated twice such that the liquid is totally removed. Next, 300 L of 1B&W buffer is added to wash the beads with rapid vortexing. The tube is placed on the magnetic rack for 2 minutes such that the beads are attached to the wall of the tube, and the liquid is discarded. This procedure is repeated once. Then, 300 L of 1TE buffer is added to wash the beads with rapid vortexing. The tube is placed on the magnetic rack for 2 minutes such that the beads are attached to the wall of the tube, and the liquid is discarded. This procedure is repeated once. Finally, 300 L of 0.125 M NaOH solution is added. The beads are vortexed for 1 second, then stood at room temperature for 10 minutes followed by being sufficiently vortexed. The tube is placed on the magnetic rack for 2 minutes such that the beads are attached to the wall of the tube. The supernatant is removed to obtain the captured ctDNA.
(38) The magnetic beads can be recycled after being washed with 1TE buffer for three times as detailed below. In the first washing, 300 L of 1TE buffer is added, and the beads are vortexed followed by rapid centrifugation. The tube is placed on a magnetic rack for 30 seconds such that the beads are attached to the wall of the tube, and the supernatant is discarded. In the second washing, 300 L of 1TE buffer (containing 0.01% Trition) is added, and the beads are vortexed followed by rapid centrifugation. The tube is placed on the magnetic rack for 30 seconds such that the beads are attached to the wall of the tube, and the supernatant is discarded. In the third washing, 300 L of 1TE buffer (containing 0.01% Trition) is added, and the beads are vortexed followed by rapid centrifugation. The tube is placed on the magnetic rack for 30 seconds such that the beads are attached to the wall of the tube, and the supernatant is discarded. Finally, the beads are suspended in 50 L of 1TE buffer (containing 0.01% Trition) for later use.
EXAMPLE 1
(39) Blood sample of a lung cancer patient was stored in a coagulation-promoting blood-sampling tube. One (1) mL of supernatant was transferred to a 1.5 mL EP tube and centrifuged at 13,000 rpm for 1 minute. The pellet was discarded and the supernatant was saved for later use.
(40) Four hundred (400) L of serum was removed from the supernatant to extract DNA. The extraction was conducted using a column recovery kit (serum/plasma free DNA extraction kit available from TIANGEN). The specific procedure was as follows: (1) 40 L of Proteinase K solution was added, and the mixture was sufficiently vortexed to homogeneity; (2) 400 L of GB buffer and 2 L of carrier RNA (1 ng/L) were added, and the mixture was mixed to homogeneity and incubated at 58 C. for 10 minutes; (3) 400 L of ethyl alcohol was added, and the mixture was stood at room temperature for 10 minutes; (4) a CR2 column was placed in a 2 mL centrifuge tube, the resulting solution was transferred to the CR2 column and centrifuged at 12,000 rpm for 30 seconds, and the waste liquid in the tube was discarded; (5) 1,000 L of GD buffer was added, the mixture was centrifuged at 12,000 rpm for 30 seconds, and the waste liquid is discarded; (6) 1,200 L of GD buffer was added, the mixture was centrifuged at 12,000 rpm for 30 seconds, and the waste liquid is discarded; (7) step (6) was repeated; (8) the CR2 was placed in a centrifuge and centrifuged at 12,000 rpm for 2 minutes, and then stood at room temperature for 5 minutes; and (8) the CR2 was eluted with 40 L of TB buffer, stood at room temperature for 5 minutes, and then centrifuged at 12,000 rpm for 2 minutes. The last step could be repeated once for sufficient elution.
(41) The extracted serum/plasma DNA was detected to have a concentration of 6.74 ng/L.
(42) The extracted serum/plasma DNA was subjected to ePCR, the ratio of the water phase to the oil phase being 20 L:400 L. The oil phase was prepared according to Formulation 3 in Table 1. One (1) mL of the oil phase comprised 700 L of emulsifier ABIL WE90, 200 L of paraffin oil and 730 L of diethylhexyl carbonate.
(43) The components dNTPs, dUTP, buffer, DNA polymerase in the water phase system were formulated into a Master Mix according to Table 2, which comprised 20 L of 10 buffer, 5 L of phi29 DNA polymerase (10 U/L), 20 L of dNTPs (10 mM), 20 L of dUTP (0.1 mM) and 134 L of sterilized ddH.sub.2O, totaling 199 L. One (1)L of DNA template was added, and therefore the water phase totaled 200 L.
(44) Two hundred (200) L of the water phase and 400 L of the oil phase were sequentially added into a 1.5 mL non-stick reaction tube. The two phases were mixed, and the reaction tube was placed in a tissue lyser (Qiagen Tissue Lyser II) and shaken for 90 seconds at a parameter setting of 13 Hz. Then the 600 L of reaction system was dispensed into 6 reaction tubes, 100 L/tube, for conducting ePCR.
(45) The PCR parameter settings involved a three-step procedure: the first step: pre-denaturation, 94 C., 2 min; the second step of cycling operation: denaturation 94 C., 10 sec, primer annealing, 63 C., 15 sec, elongation 72 C., 10 sec, for a total of 35 cycles; and the third step: final elongation, 72 C., 5 min. The ePCR reaction product obtained was stored at 4 C. for later use.
(46) The ePCR reaction product obtained was subjected to post-treatment to separate the water phase from the oil phase. The specific procedure was as follows. (1) The oil phase in the upper part of the reaction tube was discarded, and 400 L of paraffin oil was added into the reaction tube. The solution in the tube was vortexed or repeatedly pipetted until the emulsion spheres of the water phase were disrupted and the water phase and the oiled phase were sufficiently mixed. (2) The liquid mixed to homogeneity was transferred from the PCR reaction tube to a new non-stick reaction tube. The PCR reaction tube was rinsed with 400 L of silicone oil, and the rinsed solution was added to the water phase/oil phase mixed solution. The resulting mixture was sufficiently vortexed and centrifuged at 15,000 rpm for 2 minutes, and the upper oil phase was discarded. (3) The water phase/oil phase mixed solution was rinsed using silicone oil for three times. Five hundred (500) L of silicone oil was added, the resulting mixture was sufficiently vortexed and centrifuged at 15,000 rpm for 1 minutes, and the upper oil phase was discarded. The same procedure was repeated twice The liquid in the water phase was gently aspirated using a pipetting gun and transferred into a new EP tube, obtaining 200 L of the PCR reaction product in the water phase.
(47) Since there was DNA polymerase in the DNA product from the ePCR amplification, therefore before doing further experiments, the enzyme needed to be inactivated by incubating the reaction tube at 65 C. for 10 minutes.
(48) In order to capture the ctDNA from the DNA product obtained from ePCR, a biotin-labeled oligonucleotide (Biotin-oligo) was designed. The 17.sup.th exon of the EGFR to be captured had the following sequence (5-3):
(49) TABLE-US-00006 (SEQIDNO:5) GCCTAAGATCCCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGC TGCTGGTGGTGGCCCTGGGGATCGGCCTCTTCATGCGAAGGCGCCACATC GTTCGGAAGCGCACGCTGCGGAGGCTGCTGCAGGAGAGGGAG.
(50) A gene complementary pairing portion (pairing with and binding to the portion underlined) was designed:
(51) 5-/Bio/GAGGCCGATCCCCAGGGCCACCACCAGCAGCAAGAGGAG GGCCCCCACCA-3(SEQ ID NO: 6), wherein the 5-end portion comprised the biotin label.
(52) The oligonucleotide comprising the biotin label at the 5-end portion was added into the DNA product from ePCR to capture the ctDNA. The specific procedure was as follows. (1) Into 200 L of the PCR reaction product in the water phase was added 20 L of the biotin-labeled oligonucleotide (oligonucleotide concentration 10 M, final concentration 1 M). The mixture was stood at 98 C. for 5 minutes, shaken at 60 C. for 2 hours, and then cooled to room temperature. (2) Fifty (50)L of streptavidin magnetic beads having been mixed to homogeneity and washed clean were added and shaken at room temperature for 30 minutes. The magnetic beads must be below the liquid surface to ensure sufficient binding of the beads with the ctDNA-Biotin-oligo complex containing the biotin label. (3) Adsorption of the magnetic beads. The reaction tube was placed on a magnetic rack for 2 minutes such that the beads were attached to the wall of the tube, and the liquid was discarded. This procedure was repeated twice such that the liquid was totally removed. (4) Elution of the magnetic beads. Three hundred (300 L) of 1B&W buffer was added to wash the beads with rapid vortexing. The tube was placed on the magnetic rack for 2 minutes such that the beads were attached to the wall of the tube, and the liquid was discarded. This procedure was repeated once. Then, 300 L of 1TE buffer was added to wash the beads with rapid vortexing. The tube was placed on the magnetic rack for 2 minutes such that the beads were attached to the wall of the tube, and the liquid was discarded. This procedure was repeated once. Afterwards, 300 L of 0.125 M NaOH solution was added. The beads were vortexed for 1 second, then stood at room temperature for 10 minutes followed by being sufficiently vortexed. The tube was placed on the magnetic rack for 2 minutes such that the beads were attached to the wall of the tube. The supernatant was removed to obtain the captured ctDNA.
(53) The captured DNA product had a size of 142 bp. One (1)L of 6 loading buffer was added to 5 L of the capture DNA solution and sufficiently mixed to homogeneity. The resulting mixture was loaded onto agarose gel to conduct electrophoresis detection. The DNA marker used was 100 bp plus (GENSTAR), and the amount of loading was 1 L. The agarose gel was formulated at a concentration of 2%. Two (2) g of agarose was added into 100 mL of 1TAE buffer and heated under microwave for 2 minutes until agarose completely dissolved. When the solution cooled to 50 to 60 C., 5 L of a nucleic acid dye (Gold View) was added, and the gel was poured.
(54) The result of electrophoresis detection is as shown in
(55) Protocol II:
(56) With reference to
(57) A PCR primers are designed, which comprise two portions: a gene complementary pairing portion and an adapter portion. The PCR primers do not need to be modified at their ends. The gene complementary pairing portion is at the 3 end, and is base paired with the single-stranded ctDNA during PCR amplification; while the adapter portion is at the 5 end and plays a role in subsequent gene sequencing.
(58) In order to increase the efficiency of capturing the ctDNA, the length of the gene complementary pairing portion can be adjusted according to specific circumstances, and is generally around 25 bp and no shorter than 20 bp. When designing the adapter portion, its sequence is selected according to the specific sequencer used, and its length is generally no shorter than 20 bp.
(59) As the PCR polymerase, generally selected are high-fidelity Klenow Fragment (DNA Polymerase I), KAPA HiFi family DNA polymerase, high-fidelity Phusion family DNA polymerase and high-fidelity Q5 family DNA polymerase, among others. Therefore, when designing the primer, the primer annealing temperature should be consistent with the temperature at which the polymerase selected is active.
EXAMPLE 2
(60) Since the DNA product from the ePCR amplification in Example 1 comprised DNA polymerase, therefore before doing further experiments, the enzyme needed to be inactivated by incubating the reaction tube at 65 C. for 10 minutes.
(61) Two hundred (200)L of DNA product was obtained from the ePCR amplification, and the ctDNA was captured using primer PCR. PCR primers were designed. The 17.sup.th exon of the EGFR to be captured had the following sequence (5-3):
(62) TABLE-US-00007 (SEQIDNO:5) GCCTAAGATCCCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGC TGCTGGTGGTGGCCCTGGGGATCGGCCTCTTCATGCGAAGGCGCCACATC GTTCGGAAGCGCACGCTGCGGAGGCTGCTGCAGGAGAGGGAG.
(63) Gene complementary pairing portion (the portions underlined):
(64) Forward primer: (5-3)GCCTAAGATCCCGTCCATCGCCA (SEQ ID NO: 7);
(65) Reverse primer: (5-3)CTCCCTCTCCTGCAGCAGCCTC(SEQ ID NO: 8). Adapter portion (an Illumina sequencer is used):
(66) TABLE-US-00008 (SEQIDNO:1) Forwardprimer:(5-3)TCCCTACACGACGCTCTTCCGATCT; (SEQIDNO:2) Reverseprimer:(5-3)TGAACCTGAACCGCTCTTCCGATCT.
Therefore, primers were designed as follows, wherein Tm represents annealing temperature (the salt concentration being 50 mM):
(67) Forward Primer:
(68) TCCCTACACGACGCTCTTCCGATCTGCCTAAGATCCCGTCCATCGCCA (SEQ ID NO: 9, Tm: 69.7 C.); Reverse primer:
(69) TGAACCTGAACCGCTCTTCCGATCTCTCCCTCTCCTGCAGCAGCCTC (SEQ ID NO: 10, Tm: 68.5 C.). Two hundred (200)L of DNA product was obtained from ePCR and was determined to be at a concentration of 50 ng/L. One (1)L of the product was diluted 10 folds to obtain a DNA solution at a concentration of 5 ng/L. PCR amplification was conducted using the DNA solution at this concentration as the template.
(70) The PCR amplification system and cycling parameters were as shown in Table 4 and Table 5. The polymerase was KAPA 2G Robust HotStart.
(71) TABLE-US-00009 TABLE 4 Proportions of components of the PCR system Final Component concentration Volume 2 KAPA 2G Robust HotStart 1x 50 L ReadyMix Forward primer (10 M) 0.5 M 5 L Reverse primer (10 M) 0.5 M 5 L Template DNA 5 ng 1 L PCR grade water (ddH.sub.2O) Making up to 100 L
(72) TABLE-US-00010 TABLE 5 PCR cycling parameters Step Temperature Duration Cycling times Pre-denaturation 95 C. 3 min 1 Denaturation 95 C. 10 sec 35 Primer annealing 63 C. 15 sec Elongation 72 C. 10 sec Final elongation 72 C. 5 min 1 Cooling 4 C. Holding 1
(73) The PCR product has a size of 192 bp (including the adapters at both ends of the primers). One (1)L of 6 loading buffer was added to 5 L of the PCR reaction product and sufficiently mixed to homogeneity. The resulting mixture was loaded onto agarose gel to conduct electrophoresis detection. The DNA marker used was 100 bp plus (GENSTAR), and the amount of loading was 1 L. The agarose gel was formulated at a concentration of 2% in the same manner as in Example 1.
(74) The result of electrophoresis detection is as shown in
(75) Firstly, the system was expanded to perform nucleic acid gel electrophoresis, wherein the agarose gel was formulated at a concentration of 2%, and recovery from the gel was performed. The remaining 95 L of the PCR reaction product was sufficiently mixed with 19 L of 6 loading buffer to homogeneity. The resulting mixture was loaded onto agarose gel to conduct electrophoresis detection. The DNA marker used was 100 bp plus (GENSTAR), and the amount of loading was 6 L. The method of preparation of agarose gel was the same as above.
(76) Then, the above-said PCR product was recovered from the gel (OMEGA gel recovery kit). The specific procedure was as follows. (1) The nucleic acid gel comprising the target band EGFR gene exon17 was excised under ultraviolet light, and was weighed to be 0.50000 g (the weight of the blank EP tube was 1.04100 g, and that of the excised gel added was 1.54100 g). (2) 500 L of binding buffer XP2 was added, the mixture was incubated at 55 to 65 C. for 7 minutes until the nucleic acid gel completely dissolved, and the resulting solution was mixed to homogeneity. (3) The solution was transferred to a clean centrifuge column, the centrifuge column was placed in a new 2 mL centrifuge tube and centrifuged at 10,000 g for 1 minute, and the waste liquid was discarded. (4) The centrifuge column was added with 300 L of binding buffer XP2 and centrifuged at 10,000 g for 1 minute, and the waste liquid was discarded. (5) The centrifuge column was added with 700 L of wash buffer SPW and centrifuged at 13,000 g for 2 minute, and the waste liquid was discarded. (6) Step (5) was repeated. (7) The centrifuge column was placed back into the centrifuge tube and centrifuged at 13,000 g for 2 minute, and the waste liquid was discarded. (8) The centrifuge column was stood at room temperature for about 5 minutes until dry. (9) The centrifuge column was placed into a clean EP tube, and 30 L of sterilized ddH.sub.2O was added. The EP tube was stood at room temperature for 1 minute and centrifuged at 13,000 g for 1 minute. This step could be repeated once for sufficient rinsing
(77) Last, the recovered product (30 ng/L, 10 L) was submitted to Shenggong for first-generation sequencing and forward primer sequencing.
(78) The result of sequence alignment indicated that the sequence of the PCR product aligned correctly with that of exon 17 of EGFR gene. However, the base peak diagram for the sequencing result showed that the peaks for the 1 to 50 bp DNA bases overlapped. The DNA extracted from serum included nDNA and ctDNA in a ratio of about 1,000:1. Therefore the presence of overlapped peak indicated that said part of the DNA comprised nDNA and ctDNA, and the ctDNA sequence might harbour mutations.
EXAMPLE 3
(79) (A Life Tech Sequencer was Used):
(80) Since the DNA product from the ePCR amplification in Example 1 comprised DNA polymerase, therefore before doing further experiments, the enzyme needed to be inactivated by incubating the reaction tube at 65 C. for 10 minutes.
(81) DNA product was obtained from the ePCR amplification, and the ctDNA was captured using primer PCR. PCR primers were designed. The 17.sup.th exon of the EGFR to be captured had the following sequence (5-3):
(82) TABLE-US-00011 (SEQIDNO:5) GCCTAAGATCCCGTCCATCGCCACTGGGATGGTGGGGGCCCTCCTCTTGC TGCTGGTGGTGGCCCTGGGGATCGGCCTCTTCATGCGAAGGCGCCACATC GTTCGGAAGCGCACGCTGCGGAGGCTGCTGCAGGAGAGGGAG.
Gene complementary pairing portion (the portions underlined):
(83) Forward primer: (5-3)GCCTAAGATCCCGTCCATCGCCA (SEQ ID NO: 7); Reverse primer: (5-3)CTCCCTCTCCTGCAGCAGCCTC(SEQ ID NO: 8). Adapter portion (a Life Tech sequencer was used):
(84) TABLE-US-00012 (SEQIDNO:3) Ion_A(Red,5-3): CCATCTCATCCCTGCGTGTCTCCGA; (SEQIDNO:4) Ion_PI(Blue,5-3): CCGCTTTCCTCTCTATGGGCAGTCG.
(85) Therefore, primers were designed as follows:
(86) TABLE-US-00013 Forwardprimer(5-3): (SEQIDNO:11) CCATCTCATCCCTGCGTGTCTCCGACTCAGGCCTAAGATCCCGTCCATCG CCA; Reverseprimer(5-3): (SEQIDNO:12) CCGCTTTCCTCTCTATGGGCAGTCGGTGATCTCCCTCTCCTGCAGCAGCC TC.
(87) Two hundred (200)L of DNA product was obtained from ePCR and was determined to be at a concentration of 50 ng/L. One (1)L of the product was diluted 10 folds to obtain a DNA solution at a concentration of 5 ng/L. PCR amplification was conducted using the DNA solution at this concentration as the template.
(88) The PCR amplification system and cycling parameters were as shown in Table 6 and Table 7. The polymerase was Phusion DNA Polymerase.
(89) TABLE-US-00014 TABLE 6 Proportions of components of the PCR system Component Volumn/50 L volumn Final conc. 5 Phusion HF 10 L 1x Buffer 10 mM dNTPs 1 L 200 M each Forward primer 2.5 L 0.5 M Reverse primer 2.5 L 0.5 M Template DNA 1 L 6.74 ng DMSO 1.5 L 3% Phusion DNA 0.5 L 0.02 U/L Polymerase ddH.sub.2O Making up to 50 L
(90) TABLE-US-00015 TABLE 7 PCR cycling parameters Three-step procedure Step of cycling Temperature Duration Cycle Pre-denaturation 98 C. 30 s 1 Denaturation 98 C. 5-10 s 25-30 Annealing 63 C. 10-30 s Elongation 72 C. 15-30 s/1 kb Final elongation 72 C. 5-10 min 1 4 C. Holding
(91) The PCR product has a size of 192 bp (including the adapters at both ends of the primers). One (1) L of 6 loading buffer was added to 5 L of the PCR reaction product and sufficiently mixed to homogeneity. The resulting mixture was loaded onto agarose gel to conduct electrophoresis detection. The DNA marker used was 100 bp plus (GENSTAR), and the amount of loading was 1 L. The agarose gel was formulated at a concentration of 2% in the same manner as in Example 1.
(92) The result of electrophoresis detection is as shown in
(93) The foregoing is intended to describe the present invention in further detail by way of embodiments and examples, but should not be construed as limiting the particular practice of the present invention thereto. Simple variations or modifications can be made by a person of ordinary skill in the art to which the present invention belongs without departing from the concept of the present invention.