Mutant Yarrowia Strain Capable of Degrading Galactose

Abstract

The invention relates to a method for obtaining a mutant Yarrowia yeast strain capable of growing on D-galactose as sole carbon source, comprising over expressing in said strain a galactokinase, a galactose-1-phosphate uridyl transferase, an UDP-glucose-4 epimerase and a galactose mutarotase. The invention also relates to a mutant Yarrowia strain obtained by said method.

Claims

1. A method for obtaining a Yarrowia strain capable of growing on D-galactose as sole carbon source, wherein said method comprises overexpressing in said strain a galactokinase (E.C 2.7.1.6) having at least 75% identity with the polypeptide of sequence SEQ ID NO: 2, a galactose-1-phosphate uridyl transferase (E.C 2.7.7.12) having at least 65% identity with the polypeptide of sequence SEQ ID NO: 4, an UDP-glucose-4 epimerase (E.C5.1.3.2) having at least 85% identity with the polypeptide of sequence SEQ ID NO: 6 and a galactose mutarotase (E.C5.1.3.3) having at least 45% identity with the polypeptide of sequence SEQ ID NO: 8.

2. The method according to claim 1, wherein 1, 2, 3 or 4 of said enzymes galactokinase, galactose-1-phosphate uridyl transferase, UDP-glucose-4 epimerase and galactose mutarotase, are from a Yarrowia strain.

3. The method according to claim 1, wherein said galactokinase has the consensus amino acid sequence SEQ ID NO: 9.

4. The method according to claim 1, wherein said galactokinase is selected from the group consisting of SEQ ID NO: 2, 10, 11, 12 and 13.

5. The method according to claim 1, wherein said galactose-1-phosphate uridyl transferase has the consensus amino acid sequence SEQ ID NO: 14.

6. The method according to claim 1, wherein said galactose-1-phosphate uridyl transferase is selected from the group consisting of SEQ ID NO: 4, 15, 16, 17 and 18.

7. The method according to claim 1, wherein said UDP-glucose-4 epimerase has the consensus amino acid sequence SEQ ID NO: 19.

8. The method according to claim 1, wherein said UDP-glucose-4 epimerase is selected from the group consisting of SEQ ID NO: 6, 20, 21, 22 and 23.

9. The method according to claim 1, wherein the amino acid sequence of said galactose mutarotase comprises, from the N-terminus to the C-terminus, the polypeptide fragments of SEQ ID NO: 24, 25 and 26.

10. The method according to claim 1, wherein said galactose mutarotase is selected from the group consisting of SEQ ID NO: 8, 27, 28 and 29.

11. The method according to claim 1, wherein said Yarrowia strain capable of growing on D-galactose as sole carbon source is a Y. lipolytica strain.

12. The method of claim 1, wherein it comprises transforming a Yarrowia cell with 1, 2, 3 or 4 recombinant DNA constructs for expressing the 4 enzymes as defined in claim 1.

13. A mutant Yarrowia strain, wherein a galactokinase having at least 75% identity with the polypeptide of sequence SEQ ID NO: 2, a galactose-1-phosphate uridyl transferase having at least 65% identity with the polypeptide of sequence SEQ ID NO: 4, an UDP-glucose-4 epimerase having at least 85% identity with the polypeptide of sequence SEQ ID NO: 6 and a galactose mutarotase having at least 45% identity with the polypeptide of sequence SEQ ID NO: 8 are overexpressed and wherein it is obtainable by the method of claim 1.

14. (canceled)

15. A method of producing lipids or citric acid, comprising a step of growing a mutant oleaginous yeast strain as defined in claim 13 on a medium comprising D-galactose.

16. An isolated mutant enzyme selected from the group consisting of: a galactokinase (E.C 2.7.1.6) of SEQ ID NO: 10, 11, 12 or 13, a galactose-1-phosphate uridyl transferase (E.C 2.7.7.12) of SEQ ID NO: 15, 16 or 17, an UDP-glucose-4 epimerase (E.C 5.1.3.2) of SEQ ID NO: 20, 21, 22 or 23, and a galactose mutarotase (E.C 5.1.3.3) of SEQ ID NO: 27, 28 or 29.

Description

[0085] The present invention will be understood more clearly from the further description which follows, which refers to non-limitative examples illustrating the overexpression of Gal11, Gal7, Gal10E and Gal10M in Y. lipoytica, as well as to the appended figures.

[0086] FIG. 1: Construction of Y. lipolytica strains overexpressing ylGAL genes. The auxotrophic PO1d strain was used as the acceptor strain. The genes were inserted one by one to create strains that overexpressed different combinations of the ylGAL genes; URA3ex and LEU2ex were used as selection markers. To recover prototrophy in some of the Y. lipolytica strains (gray squares), cassettes containing the URA3 excisable marker or the purified SalI fragment of a pINA62 plasmid that contained the LEU2 gene were inserted into the transformants' genomes (Gaillardin and Ribet, 1987). In turn, to recover URA3 and LEU2 auxotrophy, which was necessary to continue the transformation process, a JME547 plasmid containing Cre-Lox recombinase was used (Fickers et al., 2003).

[0087] FIG. 2: Construction of the Y. lipolytica strains in which the scGAL genes were overexpressed. The auxotrophic PO1d strain was used as the acceptor strain. The genes were inserted one by one to create strains that overexpressed different combination of the scGAL genes; URA3ex and LEU2ex were used as selection markers. To recover auxotrophies necessary to continuing the transformation process, a JME547 plasmid containing Cre-Lox recombinase was used to transform Y. lipolytica Y3683, thus generating strain Y3686 (Fickers et al., 2003). In turn, to recover prototrophy in the Y. lipolytica Y3687 strain, a purified SalI fragment of the pINA62 plasmid that contained the LEU2 gene was introduced (Gaillardin and Ribet, 1987).

[0088] FIG. 3: Expression profiles of ylGAL genes in Y. lipolytica W29. Cells were incubated for 3 hours in YNB medium containing 0.1% or 1.0% glucose, mannose, or galactose (A). Kinetics of ylGAL gene expression in Y. lipolytica W29 grown in YNB medium containing 1% glucose (B) or 1% galactose (C). Gene expression levels were normalized based on the expression levels of the actin gene (CT). Abbreviation: Ininoculum.

[0089] FIG. 4: Complementation of GAL gene deletion in S. cerevisiae using GAL homologs found in Y. lipolytica. EVstrains complemented for uracil deletion using a pRS426TEF empty vector.

[0090] FIG. 5: Y. lipolytica W29 growth and sugar consumption over time in YNB medium containing glucose and galactose. (A) YNB medium containing only 0.1% glucose or 0.1% galactose; (B) YNB medium containing a mixture of 0.1% glucose and 0.1% galactose; (C) YNB medium containing only 1% glucose or 1% galactose; (D) YNB medium containing a mixture of 1% glucose and 1% galactose. Symbols: glucose (.diamond-solid.), galactose (.square-solid.), and optical density of cells growing in medium containing glucose (.box-tangle-solidup.), galactose (.circle-solid.), or a mixture of glucose and galactose ().

[0091] FIG. 6: Comparison of Y. lipolytica W29 growth and sugar consumption over time in YNB medium containing 1% galactose and different concentrations of glucose: 0.1% (A); 0.2% (B); 0.4% (C); 0.6% (D); 0.8% (E); 1.0% (F). Symbols: glucose (.diamond-solid.), galactose (.square-solid.), and OD.sub.600 (.box-tangle-solidup.).

[0092] FIG. 7: Functional analysis of Leloir pathway overexpression in Y. lipolytica and fold change in the expression of the ylGAL genes. Growth of different Y. lipolytica transformants overexpressing ylGAL and scGAL genes on plates of YNB medium containing glucose or galactose (A). Fold change in the expression of ylGAL genes in the quadruple mutant, Y4588 (in which all the Leloir genes were overexpressed), relative to Y. lipolytica W29 (the wild-type strain) (B); yeast were incubated for 3 hours in YNB medium containing 0.1% or 1.0% galactose. Gene expression levels were normalized based on the expression of the actin gene.

[0093] FIG. 8: Overexpression of scGAL and ylGAL genes in Y. lipolytica. Growth of Y. lipolytica transformants containing scGAL genes (scGAL1,7,10) on YNB medium containing 1% galactose (A); yeast were incubated for 1 week at 28 C. Growth of Y. lipolytica transformants overexpressing different combinations of ylGAL genes on YNB medium containing 1% galactose (B); yeast were incubated for 2 weeks at 28 C.

[0094] FIG. 9: Y. lipolytica Y4588 growth and sugar consumption over 48 h in YNB medium containing only 1% glucose, only 1% galactose (A), or a mixture of both 1% glucose and 1% galactose (B). Symbols: glucose (.diamond-solid.), galactose (.square-solid.), OD.sub.600 in glucose (.box-tangle-solidup.), OD.sub.600 in galactose (.circle-solid.), and OD.sub.600 in the mixture of both sugars ().

[0095] FIG. 10: Sugar consumption by S. cerevisiae null mutants expressing Y. lipolytica hexose transporters after 72 h of growth in YNB medium containing 1% glucose (grey square .square-solid.) or 1% galactose (black square .square-solid.) (A). Expression profiles of Y. lipolytica genes encoding hexose transporters in the W29 and Y4588 strains (B). Yeast were incubated for 3 hours in YNB medium containing 1.0% glucose or 1.0% galactose. The amplification of the PCR fragment in the genomic DNA served as a control for the primers' efficiency. Abbreviation: Ininoculum.

EXAMPLE: ACTIVATION OF EFFICIENT GALACTOSE UTILIZATION BY YARROWIA LIPOLYTICA

[0096] 1. Materials and Methods

[0097] 1.1. Yeast Strains and Plasmids

[0098] The strains and plasmids used in this example are listed in Table 1 below.

TABLE-US-00001 TABLE 1 Bacteria and yeast strains used in the present example. Name Relevant genotype Reference E. coli strains JME547 pUB4-CRE 1 Fickers et al. (2003) JME2110 JMP62pTEF-scGAL1-URA3ex This study JME2111 JMP62pTEF-scGAL1-LEU2ex This study JME2114 JMP62pTEF-scGAL7-URA3ex This study JME2115 JMP62pTEF-scGAL7-LEU2ex This study JME2116 JMP62pTEF-scGAL10-URA3ex This study JME2117 JMP62pTEF-scGAL10-LEU2ex This study JME2542 JMP62pTEF-ylGAL1-URA3ex This study JME2543 JMP62pTEF-ylGAL7-URA3ex This study JME2544 JMP62pTEF-ylGAL10E-URA3ex This study JME2545 JMP62pTEF-ylGAL10M-URA3ex This study JME2546 JMP62pTEF-ylGAL1-LEU2ex This study JME2547 JMP62pTEF-ylGAL7-LEU2ex This study JME2548 JMP62pTEF-ylGAL10E-LEU2ex This study JME2549 JMP62pTEF-ylGAL10M-LEU2ex This study JME2735 pRS426URA3-ylGAL1 This study JME2736 pRS426URA3-ylGAL7 This study JME2738 pRS426URA3-ylGAL10E This study JME2739 pRS426URA3-ylGAL10M This study Y. lipolytica strains PO1d W29 ura3-302 leu2-270 xpr2-322 + pXPR2-SUC2 Barth and Gaillardin (1996) W29 MATa ura3-302 leu2-270 xpr2-322 URA3ex LEU2 Barth and Gaillardin (1996) Y3671 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1-LEU2ex This study Y3681 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL7-URA3ex This study Y3682 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL10-URA3ex This study Y3683 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1-LEU2ex pTEF-scGAL7-URA3ex This study Y3684 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1-LEU2ex pTEF-scGAL10-URA3ex This study Y3685 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL7-URA3ex pTEF-scGAL10-LEU2ex This study Y3686 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1 pTEF-scGAL7 This study Y3687 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1 pTEF-scGAL7 pTEF-scGAL10-URA3ex This study Y4571 MATa ura3-302 Leu2-270 xpr2-322 pTEF-scGAL1 pTEF-scGAL7 pTEF-scGAL10-URA3ex LEU2 clone1 This study Y4572 MATa ura3-302 leu2-270 xpr2-322 pTEF-scGAL1 pTEF-scGAL7 pTEF-scGAL10-URA3ex LEU2 clone5 This study Y4573 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1-URA3ex This study Y4574 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL7-URA3ex This study Y4575 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL10E-URA3ex This study Y4576 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL10M-URA3ex This study Y4577 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1-URA3ex pTEF-ylGAL7-LEU2ex This study Y4578 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1-URA3ex pTEF-ylGAL10E-LEU2ex This study Y4579 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1-URA3ex pTEF-ylGAL10M-LEU2ex This study Y4580 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL7-URA3ex pTEF-ylGAL10E-LEU2ex This study Y4581 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL7-URA3ex pTEF-ylGAL10M-LEU2ex This study Y4582 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL10a-URA3ex pTEF-ylGAL10M-LEU2ex This study Y4583 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 This study Y4584 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL10E This study Y4585 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 pTEF-ylGALl10E-LEU2ex This study Y4586 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 pTEF-ylGAL10M-LEU2ex This study Y4587 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL10a pTEF-ylGAL10M-LEU2ex This study Y4588 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 pTEF-ylGALl10E-LEU2ex pTEF-ylGAL10M-URA3ex This study Y4629 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1-URA3ex LEU2 This study Y4630 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL7-URA3ex LEU2 This study Y4631 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL10E-URA3ex LEU2 This study Y4632 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL10M-URA3ex LEU2 This study Y4633 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 pTEF-ylGALl10E-LEU2ex URA3ex This study Y4634 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL7 pTEF-ylGAL10M-LEU2ex URA3ex This study Y4635 MATa ura3-302 leu2-270 xpr2-322 pTEF-ylGAL1 pTEF-ylGAL10a pTEF-ylGAL10M-LEU2ex URA3ex This study S. cerevisiae strains Y4473 Mat a; his31; leu20; met150; ura30; YBR018c::kanMX4 (Gal7) Euroscarf (Y13155) Y4474 Mat a; his31; leu20; lys20; ura30; YBR019::kanMX4 (Gal10) Euroscarf (Y13156) Y4475 Mat a; his31; leu20; lys20; ura30; YBR020w::kanMX4 (Gal1) Euroscarf (Y13157) Y4846 Mat a; his31; leu20; lys20; ura30; YDR009w::kanMX4 (Gal3) Euroscarf (Y13949) Y4591 Mat a; his31; leu20; lys20; ura30; YBR020w::kanMX4 URA3-EV(pRS426TEF) This study Y4592 Mat a; his31; leu20; lys20; ura30; YPL248c::kanMX4 URA3-EV(pRS426TEF) This study Y4593 Mat a; his31; leu20; met150; ura30; YBR018c::kanMX4 URA3-EV(pRS426TEF) This study Y4594 Mat a; his31; leu20; lys20; ura30; YBR019c::kanMX4 URA3-EV(pRS426TEF) This study Y4595 Mat a; his31; leu20; lys20; ura30; YBR020w::kanMX4 pTEF-ylGAL1-URA3 This study Y4596 Mat a; his31; leu20; met150; ura30; YBR018c::kanMX4 pTEF-ylGAL7-URA3 This study Y4597 Mat a; his31; leu20; lys20; ura30; YBR019c::kanMX4 pTEF-ylGAL10E-URA3 This study Y4690 Mat a; his31; leu20; lys20; ura30; YBR019c::kanMX4 pTEF-ylGAL10M-URA3 This study Y4874 Mat a; his31; leu20; lys20; ura30; YDR009w::kanMX4 URA3-EV(pRS426TEF) This study Y4875 Mat a; his31; leu20; lys20; ura30; YDR009w::kanMX4 URA3-ylGAL1(Gal3) This study B01342 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0B01342 in preparation B06391 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0B06391 in preparation C06424 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., (YHT1) hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0C06424 in preparation C08943 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., (YHT2) hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0C08943 in preparation E23287 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., (YHT4) hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0E23287 in preparation F19184 leu2-3,112 ura3-52 trp1-289 his31 MAL2-8C SUC2 hxt17 hxt13 hxt15 hxt16 hxt14 hxt12 hxt9 hxt11 hxt10 hxt8 hxt5-1-4 Lazar et al., (YHT3) hxt2 hxt367 gal2 slt1 agt1 ydl247 yjr160c URA3-YALI0F19184 in preparation

[0099] All the Y. lipolytica transformants were created by employing the genetic background of the W29 wild-type strain (Barth and Gaillardin, 1996). The auxotrophic strain PO1d (UraLeu) was derived from W29 and was also used in this study (Barth and Gaillardin 1996). Because many different strains overexpressing Y. lipolytica GAL genes were created, only the quadruple overexpressing strain, Y4588, which overexpressed all four of the ylGAL genes, is described in detail here. Construction of the other strains is depicted in FIG. 1. Plasmids containing ylGAL genes were constructed using URA3ex and LEU2ex selection markers. Strain Y4573, which overexpressed the Y. lipolytica ylGAL1 gene (YALI0C13090g), was obtained by introducing the overexpression cassette from JME2542 containing the URA3ex selection marker into PO1d. Subsequently, the cassette containing the ylGAL7 gene (YALI0F23947g) and a LEU2ex marker taken from JME2547 was introduced into the Y4573 strain, thus generating the prototrophic Y4577 strain. To excise both selection markers, Y4577 was transformed with JME547 plasmid containing Cre-Lox recombinase and hygromycin selection. This process generated the auxotrophic Y4583 strain (UraLeu). Immediately afterwards, the ylGAL10E gene (YALI0E26829g) overexpression cassette containing the LEU2ex marker from a JME2548 plasmid was introduced into the Y4583. Then, the cassette containing the ylGAL10M gene (YALI0C09570g) and the URA3ex marker taken from a JME2545 plasmid were introduced, generating Y4588, which overexpressed the entire Leloir pathway.

[0100] Y. lipolytica strains expressing S. cerevisiae GAL genes were constructed as depicted in FIG. 2. All the plasmids were prepared as described above.

[0101] Functional complementation analysis of the Y. lipolytica GAL genes was performed using S. cerevisiae strains from which the GAL genes had been deleted. The Y. lipolytica galactokinase (ylGAL1) gene was introduced into S. cerevisiae gal1 (Y4475) as well as into the gal3 (Y4846) strains using JME2735 plasmid, thus generating the Y4595 and Y4875 strains, respectively. To complement the gal7 strain, a JME2736 plasmid (ylGAL7) was introduced into Y4473, generating Y4596. Finally, gal10 was complemented separately by the ylGAL10E and ylGAL10M genes, which was accomplished by introducing JME2738 and JME2739 plasmids into the Y4474 strain, resulting in the creation of Y4597 and Y4690, respectively. All the S. cerevisiae deletion mutantsthe control strainswere also complemented for uracil auxotrophy by the insertion of an empty pRS426TEF vector.

[0102] All the genes introduced into Y. lipolytica and S. cerevisiae were under the control of the constitutive TEF promoter (Mumberg et al., 1995; Mller et al., 1998). Transformation of Y. lipolytica and S. cerevisiae was performed using the lithium acetate procedure (Xuan et al., 1990). Expression cassettes were integrated into the genome of Y. lipolytica (Mauersberger et al., 2001) or were in the replicative pRS426TEF vector in S. cerevisiae (Mumberg et al., 1995).

[0103] 1.2. General Genetic Techniques and Plasmid Construction

[0104] Standard molecular genetics techniques were used throughout this study (as per Sambrok and Russell, 2001). Restriction enzymes were obtained from New England Biolabs (Ipswich, England). Genomic DNA from the transformants was prepared as described in Querol et al. (1992). PCR amplification was performed using an Eppendorf 2720 thermal cycler; both Taq (Promega, Madison, Wis.) and Pfu (Stratagene, La Jolla, Calif.) DNA polymerases were employed. PCR fragments were then purified with a QIAgen Purification Kit (Qiagen, Hilden, Germany), and DNA fragments were recovered from the agarose gels using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). The Staden software package was used for gene sequence analysis (Dear and Staden, 1991). The GAL genes were amplified using the primers listed in Table 2 below.

TABLE-US-00002 TABLE2 Listofprimersusedinthepresentexample. SEQ Restriction Amplified ID Primer Sequence site gene NO: Gal1-BamHI-fwd gcgcggatccatgactaaatctcattcagaagaagtgattg BamHI scGAL1 30 Gal1-AvrII-rev gcgccctaggttataattcatatagacagctgcccaatgc AvrII 31 ScGal7-BamHI-fwd gcgcggatccatgactgctgaagaatttg BamHI scGAL7 32 Gal7-AvrII-rev gcgccctaggttacagtattgtagataatgaatc AvrIl 33 Gal10-BamHI-fwd gcgcggatccatgacagctcagttacaaag BamHI scGAL10 34 Gal10-AvrII-rev gcgccctaggtcaggaaaatctgtagacaatc AvrII 35 YLGal1Short-BamHI-fwd gtgaggatccatgtctatcagcaccctgcc BamHI ylGAL1 36 YlGal1-AvrII-rev gcgccctaggttacaaatcaacaatagcacatccc AvrII 37 YlGal7-BamHI-fwd gagaggatccatgactcttgtggcatccg BamHI ylGAL7 38 YlGal7-AvrII-rev gcgccctaggttacaaatcatacaaccgcttgg AvrII 39 YlGal10E-BglII-fwd gagaagatctatgacccaggagctgctgaac BglII ylGAL10E 40 YlGal10E-SpeI-rev gcgcactagtttacttgtcatgacggtcattttgtaacc SpeI 41 YlGal10M-BamHI-fwd gagaggatccatgaccttttgcaacacgggagcaac BamHI ylGAL10M 42 YlGal10M-AvrII-rev gcgccctaggtcactcccgctccaaaacatagataatcttagc AvrII 43 YLGal1Short-SpeI-fwd gcgcactagtatgtctatcagcaccctgcc SpeI ylGAL1 44 YlGal1-SmaI-rev gcgccccgggttacaaatcaacaatagcacatccctc SmaI 45 YlGa17-SpeI-fwd gagaactagtatgactcttgtggcatccg SpeI ylGAL7 46 YlGa17-SmaI-rev gcgacccgggttacaaatcatacaaccgcttggc SmaI 47 YlGa110E-SpeI-fwd gagaactagtatgacccaggctgctgag SpeI ylGAL10E 48 YlGall0E-SmaI-rev gagaccccggttacttgtcatgacggtcctttttg SmaI 49 YLGall0M-SpeI-fwd gcgcactagtatgaccttttgcaacacgggagcaac SpeI ylGAL10M 50 YLGal10M-EcoRI-rev gcgcgaattctcactcccgctccaaaacatagataatcttag EcoRI 51 PrimersusedforRT-PCRandqRT-PCR YlGal1-RT-F tcttcaactgctcctgtcct ylGAL1 52 YlGal1-RT-R ctatcgtaatcgacaccatcc 53 Y1Gal7-RT-F ccatcaaaaagagaccaag ylGAL7 54 YlGal7-RT-R atcgcagaagaggagggtag 55 YlGal10E-RT-F tggtgacgactacccctct ylGAL10E 56 YlGal10E-RT-R cggttcctaggttccattct 57 YlGal10M-RT-F tccatctccctcaatggaac ylGAL10M 58 YlGal10M-RT-R gccggtatagacctggaaac 59

[0105] The restriction sites in the primer sequences enabled the genes to be cloned into JME1128 plasmids that had been digested with BamHI-AvrII, as previously described elsewhere (Beopoulos et al., 2008; Dulermo et al., 2013). Auxotrophies were restored via excision using the Cre-lox recombinase system following transformation with the replicative plasmid pUB4-Cre1 (JME547) (Fickers et al., 2003).

[0106] To complement the S. cerevisiae strains whose GAL genes had been deleted, the corresponding genes were cloned in a pRS426 vector using the constitutive TEF promoter and the uracil selection marker. The corresponding ylGAL genes were amplified and digested, as described above, with the restriction enzymes listed in Table 2 above.

[0107] 1.3. Growth Media

[0108] Media and growth conditions for Escherichia coli were identical to those as described by Sambrook and Russell (2001), as were those of Y. lipolytica (Barth and Gaillardin, 1996). Rich (YPD) medium was prepared using 20 g.Math.L.sup.1 Bacto Peptone (Difco, Paris, France), 10 g.Math.L.sup.1 yeast extract (Difco), and 20 g.Math.L.sup.1 glucose (Merck, Fontenay-sous-Bois, France). Minimal (YNB) medium was prepared using 1.7 g.Math.L.sup.1 yeast nitrogen base (without amino acids and ammonium sulphate, Difco), 10 g.Math.L.sup.1 glucose (Merck), 5 g.Math.L.sup.1 NH.sub.4Cl, and 50 mM phosphate buffer (pH 6.8). To complement the auxotrophies, 0.1 g.Math.L.sup.1 uracil or leucine (Difco, Paris, France) were added as necessary.

[0109] However, the YNB media on which they were grown contained the following: 10.0 g.Math.L.sup.1 of either glucose or galactose; 6.5 g.Math.L.sup.1 of Yeast Nitrogen Base (without amino acids and ammonium sulphate, Difco); 10.0 g.Math.L.sup.1 of (NH.sub.4).sub.2SO.sub.4; 0.018 g.Math.L.sup.1 of leucin; 0.0115 g.Math.L.sup.1 of histidin; and 0.025 g.Math.L.sup.1 of lysin.

[0110] 1.4. Growth in Microtiter Plates

[0111] Precultures were obtained from frozen stock, inoculated into tubes containing 5 mL YPD medium, and cultured overnight (170 rpm, 28 C.). They were then washed with sterile distilled water; cell suspensions were adjusted to an OD.sub.600 of 0.1. Yeast strains were grown in 96-well plates in 200 l of minimal YNB medium containing 10 g.Math.L.sup.1 of either glucose or galactose. Culturing was repeated three times; 2-3 technical replicates were performed for each condition. Cultures were maintained at 28 C. under constant agitation using a Biotek Synergy MX microtiter plate reader (Biotek Instruments, Colmar, France); each culture's optical density at 600 nm was measured every 20 min for 72 h.

[0112] 1.5. Growth Conditions in the Experiments

[0113] Initial precultures were established by inoculating 50 mL of YPD medium in 250 mL Erlenmeyer flasks with the yeast strains; this was followed by an overnight shaking step at 28 C. and 170 rpm. The cell suspensions were washed three times with sterile distilled water and used to inoculate 50 mL of YNB medium to an OD.sub.600 of 0.25. The cultures were grown until all the available sugar had been consumed.

[0114] In the galactose utilization experiment, the YNB medium contained one of the following: 1.0 g.Math.L.sup.1 of glucose; 1.0 g.Math.L.sup.1 of galactose; 1.0 g.Math.L.sup.1 of both glucose and galactose; or 10.0 g.Math.L.sup.1 of both glucose and galactose. Additionally, galactose utilization was observed in YNB medium containing 10.0 g.Math.L.sup.1 of galactose and either 1.0; 2.0; 4.0; 6.0; 8.0; or 10.0 g.Math.L.sup.1 of glucose.

[0115] 1.6. Analysis of Growth on Galactose by Drop Test

[0116] To analyze the different strains' growth on galactose, a drop test was performed on cultures grown on YNB plates. The Y. lipolytica strains were grown in 5 mL of YPD medium for 24 h. The cell suspensions were then washed twice with water and re-suspended at an OD.sub.600 of 1. Successive 10-fold dilutions were performed (10.sup.0-10.sup.5), and 5 l of each dilution were spotted onto YNB plates containing 10.0 g.Math.L.sup.1 of glucose, 1.0 g.Math.L.sup.1 of galactose, or 10.0 g.Math.L.sup.1 of galactose. Pictures were taken after the cultures had been incubated at 28 C. for 48 h. The same protocol was used for the S. cerevisiae strains. However, the YNB media on which they were grown contained the following: 10.0 g.Math.L.sup.1 of either glucose or galactose; 6.5 g.Math.L.sup.1 of Yeast Nitrogen Base (without amino acids and ammonium sulphate, Difco); 10.0 g.Math.L.sup.1 of (NH.sub.4).sub.2SO.sub.4; 0.018 g.Math.L.sup.1 of leucin; 0.0115 g.Math.L.sup.1 of histidin; and 0.025 g.Math.L.sup.1 of lysin.

[0117] 1. 7. Analysis of Galactose Uptake by Y. lipolytica Hexose Transporters

[0118] To analyze galactose uptake, Y. lipolytica hexose transporters were expressed one at a time in the S. cerevisiae hxt null mutant strain EBY.VW4000 (kindly provided by E. Boles, Goethe University, Frankfurt am Main, Germany) using a replicative pRS426 vector containing the TEF promoter. The cells were grown in 5 mL of YNB medium composed of 6.5 g.Math.L.sup.1 of Yeast Nitrogen Base (without amino acids and ammonium sulpha.sub.te, Difco); 10.0 g.Math.L.sup.1 of (NH4).sub.2SO.sub.4 as well as leucin, histidin and tryptophan to complement auxotrophies and containing 20 g.Math.L.sup.1 of maltose; the medium was refreshed 3 times per 24 h period to increase 2 plasmid copy number. The cell suspensions were washed three times with sterile distilled water and used to inoculate 50 mL of YNB medium that contained either 10.0 g.Math.L.sup.1 of glucose or 10.0 g.Math.L.sup.1 of galactose. The culture conditions were as described above (paragraph 1.5). OD.sub.600 and sugar concentration were analyzed.

[0119] 1.8. Conditions and Media Used for Lipid Biosynthesis from Galactose in Flasks and Bioreactors

[0120] The precultures were prepared as described above (1.5). The main culture was grown on 50 mL of YNB medium (C/N 60) containing the following: galactose 60.0 g; YNB 1.7 g; NH.sub.4Cl 1.5 g; 0.7 g KH.sub.2PO.sub.4, and 1.0 g MgSO.sub.47H.sub.2O in 1 L. The pH was kept at 6.8 using 0.05 M phosphate buffer. Tap water was used as a source of microelements. To increase the C/N ratio of the medium to 100, 1.25 g.Math.L.sup.1 of NH.sub.4Cl was used. Culture conditions were as described above (2.5.1).

[0121] Lipid biosynthesis was also evaluated using batch cultures (BC) that were kept in 5-L stirred-tank BIO-STAT B-PLUS bioreactors (Sartorius, Frankfurt, Germany) for 96 h under the following conditions: 2-L working volume, 28 C., 800 rpm of agitation, and 3.5-L min.sup.1 aeration rate. The production medium was prepared as described above. The pH was kept at 6.8 using a 40% (w/v) NaOH solution. The cultures were grown in 0.2 L of YPD medium in 0.5-L flasks at 170 rpm, at 28 C. for 48 h. The volume of the inocula added to the bioreactor cultures was equal to 10% of the total working volume.

[0122] 1.9. Analysis of ylGAL Gene and Hexose Transporter Expression

[0123] For the expression experiments, the wild-type strain (W29) and the quadruple mutant (Y4588) were grown in YNB medium that had been supplemented with 10 g.Math.L.sup.1 glucose; they were kept at 28 C. for 16 h. Immediately afterwards, the cell suspensions were washed twice with distilled water and transferred into fresh YNB medium that contained either 1.0 or 10.0 g.Math.L.sup.1 of glucose, galactose, or mannose. Samples were harvested at 3 h post inoculation; three replicates were obtained. For the kinetics experiments, the same protocol was followed, except that samples were harvested at 3, 6, 9, and 24 h post inoculation. All the samples were frozen in liquid nitrogen and stored at 80 C.

[0124] Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany), and 1.5 g of each sample was treated with DNase (Ambion, Life Technologies). cDNA was synthesized using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (Thermo Scientific). PCR reactions were performed using specific primers that targeted the 3 end of the genes (Table 2). For the semi-quantitative RT-PCR analyses, PCR was performed using the GoTaq DNA Polymerase Kit (Promega). For the quantitative RT-PCR analyses, gDNA dilutions were first tested for primer efficiency and then retained if their efficiency rating was higher than 90%. Amplifications were carried out using the SsoAdvanced Universal SYBR Green Supermix Kit (BIO-RAD). The following program was used: 98 C. for 3 min, followed by 40 cycles of 98 C. for 15 sec, 58 C. for 30 sec, and 72 C. for 30 sec. Finally, melting curves were generated to confirm amplification specificity. Both CT and CT methods were used to calculate relative expression levels; a constitutive gene, actin, was utilized as the reference control (Schmittgen and Livak, 2008).

[0125] 1.10. Analytical Techniques Used in this Study

[0126] Lipid bodies were stained with BodiPy Lipid Probe (2.5 mg.Math.mL.sup.1 in ethanol; Invitrogen). Cell suspension samples (OD.sub.600=5) were incubated for 10 min at room temperature. Images were obtained using a Zeiss Axio Imager M2 microscope (Zeiss, Le Pecq, France) equipped with a 100 objective lens and Zeiss filter sets 45 and 46 for fluorescence microscopy. Axiovision 4.8 software (Zeiss, Le Pecq, France) was used for image acquisition.

[0127] The fatty acids occurring in 15-mg aliquots of freeze-dried cells were converted into methyl esters using the method described in Browse et al. (1986). They were then analyzed using a gas chromatograph (GC). GC analysis of the methyl esters was performed using a Varian 3900 instrument equipped with a flame ionization detector and a Varian FactorFour vf-23ms column, for which bleed specification at 260 C. was 3 pA (30 m, 0.25 mm, 0.25 m). Fatty acids were identified by comparing the GC patterns of their methyl esters to those of commercial methyl ester standards (FAME32; Supelco); the amounts present were quantified using the internal standard method, which involved the addition of 50 g of commercial C17:0 (Sigma).

[0128] Citric acid, glucose, fructose, and sucrose were identified and quantified by HPLC (UltiMate 3000, Dionex-Thermo Fisher Scientific, UK) using an Aminex HPX87H column coupled with UV (210 nm) and RI detectors. The column was eluted with 0.01 N H.sub.2SO.sub.4 at a flow rate of 0.6 mL.Math.min.sup.1 at room temperature. Compounds were identified and quantified via comparisons to standards. Before undergoing HPLC analysis, the samples were filtered on membranes with a pore size of 0.45 m.

[0129] To determine dry biomass, cell pellets from the 15-mL culture samples were washed twice with distilled water, filtered on the above membranes, and dried at 105 C. using a WPS 110S weight dryer (Radwag, Pozna, Poland) until a constant mass was reached.

[0130] 2. Results

[0131] 2.1. Y. lipolytica Has All the Structural Leloir Pathway Genes

[0132] Although Y. lipolytica does not normally grow on galactose, its genome contains all the genes of the Leloir pathway (Slot and Rokas, 2010).

[0133] In Y. lipolytica, UDP-glucose-4-epimerase and galactose mutarotase are encoded by two different genes, which gave rise to the following four structural genes: ylGAL1 (YALI0C13090g, galactokinase), ylGAL7 (YALI0F23947g, galactose-1-phosphate uridyl transferase), ylGAL10E (YALI0E26829g, UDP-glucose-4 Epimerase), and ylGAL10M (YALI0C09570g, galactose Mutarotase) (Table 3).

TABLE-US-00003 TABLE 3 Comparison of GAL genes among Y. lipolytica, S. cerevisiae, and H. jecorina. Y. lipolytica S. cerevisiae Protein Protein length length Identity Enzyme name Abbreviation Gene (aa) Abbreviation Gene (aa) (%) Galactokinase ylGAL1 YALI0C13090g 476 scGAL1 YBR020w 528 40 Galactose-1- ylGAL7 YALI0F23947g 352 scGAL7 YBR018c 366 49 phosphate uridyl transferase UDP-glucose-4- ylGAL10E YALI0E26829g 369 scGAL10* YBR019c 699 62 epimerase Galactose ylGAL10M YALI0C09570g 327 26 mutarotase Hypocrea jecorina Protein Similarity length Identity Similarity Enzyme name (%) Abbreviation Locus (aa) (%) (%) Galactokinase 55 Gal1 XP_006961307 526 40 56 Galactose-1- 63 Gal7 XP_006968597 382 49 61 phosphate uridyl transferase UDP-glucose-4- 76 Gal10E AF439323_1 370 59 69 epimerase Galactose 42 Gal10M XP_006964994 342 29 36 mutarotase *in S. cerevisiae, the GAL10 gene contains the two domains epimerase and mutarotase.

[0134] Although all the structural genes necessary for galactose utilization are present in Y. lipolytica's genome, the genes known to encode regulatory proteins in S. cerevisiae (i.e., scGAL3, scGAL4, and scGAL80) are not. This genetic difference accounts for the differences observed between the two species in the galactose utilization pathway. In addition, GAL4 binding sites are not present in the promoter regions of ylGAL genes (data not shown), which is also the case for H. jecorina (Seiboth et al., 2002). Despite this fact, H. jecorina is able to grow well on galactose.

[0135] 2.2 Y. lipolytica GAL Genes Are Expressed

[0136] To examine ylGAL gene expression, Y. lipolytica was grown on a suite of media containing two different concentrations (0.1% and 1.0%) of three different monosaccharides (galactose, glucose, and mannose), and transcription analyses were performed (FIG. 3A). Galactose was the target compound, glucose was a potential repressor, and mannose was a neutral sugar in catabolite repression. The three main ylGAL genes (ylGAL1, ylGAL7, ylGAL10E) were expressed under all of the conditions, but ylGAL10M, the least important gene in galactose utilization, showed very weak expression (FIG. 3A).

[0137] Since the ylGAL genes were not repressed by glucose, a kinetics analysis of their quantitative expression on glucose and galactose was conducted (FIGS. 3B, C). The gene profiles show that, on glucose, expression of the UDP-glucose-4-epimerase gene (ylGAL10E) was constant, whereas expression of galactokinase (ylGAL1) and galactose-1-phosphate uridyl transferase (ylGAL7) genes increased over time (FIG. 3B). Once again, the galactose mutarotase gene (ylGAL10M) had the lowest expression levels. On galactose, there was a slight increase in expression over time: it reached between 2.7 and 4.6 after 24 h (FIG. 3C). Therefore, the ylGAL genes were upregulated in the presence of galactose.

[0138] 2.3 Y. lipolytica GAL Genes Are Functional

[0139] To investigate the activity of the proteins encoded by the Y. lipolytica GAL genes, a functional complementation test was performed using S. cerevisiae. The ylGAL genes were amplified and cloned into a multicopy pRS426 vector under the control of the scTEF promoter. The S. cerevisiae transformants obtained were subsequently tested to determine if they could grow when galactose was the sole carbon source (FIG. 4). The three cloned ylGAL genes, ylGAL1, ylGAL7, and ylGAL10E, complemented their corresponding S. cerevisiae GAL-deletion mutants and restored growth on galactose. This result shows that the ylGAL genes encode functional Leloir proteins. In addition, the ylGAL1p gene, which complemented the S. cerevisiae gal1 mutant, was not able to restore normal growth on galactose for the S. cerevisiae gal3 mutant (FIG. 4).

[0140] 2.4 Validation of Leloir Pathway Functionality in Y. lipolytica

[0141] Galactose utilization by Y. lipolytica was investigated. Results are shown in FIG. 5. The ylGAL genes were expressed when the yeast was grown on glucose, but galactose alone did not allow growth. As a result, growth and sugar consumption by Y. lipolytica W29 (the wild-type strain) in YNB medium containing a mixture of glucose and galactose (0.1% or 1.0%) were analyzed. First, a control experiment was conducted in which growth and sugar consumption on glucose versus galactose were examined. As expected, when galactose was the sole carbon source, it was not consumed, whereas 0.1% and 1.0% glucose were depleted within 12 and 32 h, respectively (FIGS. 5A, C). Surprisingly, when the same strain was grown in medium containing both 0.1% glucose and 0.1% galactose, it was able to use both sugars (FIG. 5B). The glucose utilization rate was the same as for the glucose-only culture (0.083 g.Math.L.sup.1.Math.h.sup.1). In contrast, galactose was initially used at a very low rate (0.009 g.Math.L.sup.1.Math.h.sup.1); however, after the glucose was completely consumed, the galactose utilization rate increased (0.032 g.Math.L.sup.1.Math.h.sup.1). Additionally, sugar consumption was also tested using cultures containing higher concentrations of both monosaccharides (1%) to eliminate the influence of any putative sugar sensors, which could change carbon metabolism (FIG. 5D). As in the previous experiment, Y. lipolytica W29 used both glucose and galactose from the beginning, but the glucose consumption rate was much higher than the galactose consumption rate (0.313 g.Math.L.sup.1.Math.h.sup.1 versus 0.083 g.Math.L.sup.1.Math.h.sup.1, respectively). Once all the glucose had been consumed, the galactose utilization rate climbed significantly (0.250 g.Math.L.sup.1.Math.h.sup.1). It is worth noting that, not only was galactose consumed by the cells, but it was also partially used for biomass production (FIGS. 5B, D).

[0142] The concentration of glucose that Y. lipolytica requires to be able to use galactose was determined. Y. lipolytica W29 was therefore grown in a suite of media containing 1.0% galactose and a range of glucose, from 0.1 to 1.0%. At a glucose concentration of 0.1%, growth was very weak and galactose was not consumed (FIG. 6A). At higher glucose concentrations (0.2-0.4%), a small amount of galactose was also utilized; however, after the glucose was used up, galactose consumption stopped (FIGS. 6B, C). At even higher glucose concentrations, Y. lipolytica consumed galactose more efficiently, following a short delay (FIGS. 6D-F). Galactose consumption increased once the glucose had been drained from the medium, which is also when the cells enter into the stationary phase (FIGS. 6D-F).

[0143] 2.5. Overexpression of All Y. lipolytica GAL Genes Induces Efficient Growth on Galactose

[0144] All the ylGAL genes were placed under the control of the strong constitutive TEF promoter and introduced individually or in various combinations into the Y. lipolytica PO1d background. The resulting strains were then tested to see if they could grow on galactose alone. When the transformants were grown on glucose, they showed no morphological changes, suggesting that their physiology was not affected (FIG. 7A). Mutants in which ylGAL1, ylGAL7, and ylGAL10E were simultaneously overexpressed could grow on 0.1% and 1.0% galactose (FIG. 7A, line 12). Mutarotase activity, which is not required for galactose metabolism, nonetheless appeared to improve galactose utilization (FIG. 7A, line 15). Interestingly, the overexpression of all the S. cerevisiae Leloir genes in Y. lipolytica resulted in weak, delayed growth (FIG. 8A). The improper folding of scGAL10 may have been responsible; its counterpart in Y. lipolytica exists as two proteins. Additional analysis of growth patterns showed that the Y. lipolytica transformants, with the exception of Y4585 and Y4588, took a long time to adapt to using galactose. The Y4577 strain, in which ylGAL1 and ylGAL7 were overexpressed, began to grow after two weeks of incubation but revealed normal morphology on plates (FIG. 8B). Additionally, the Y4578 strain, in which ylGAL1 and ylGAL10E were overexpressed, also began to grow after two weeks of incubation, albeit much less efficiently than Y4577 (FIG. 8B). This finding underscores that ylGAL7 expression results in functional protein biosynthesis but not normal levels for galactose utilization.

[0145] The strong increase in gene expression in the quadruple mutant (Y4588) showed that, when galactose concentrations were low, each gene was overexpressed compared to the parental strain; for instance, expression was 400 times higher for ylGAL10M (FIG. 7B). Surprisingly, when galactose concentrations were high (1.0%), the change in gene expression levels was not so sharp, especially in the case of ylGAL10E. The parental strain expresses ylGAL10E at high levels when grown in 1% galactose (FIG. 7B). Overexpressing all four of the ylGAL genes efficiently activated the Leloir pathway and created a strain that can use galactose as its sole carbon source.

[0146] 2.6. Overexpression of ylGAL Genes Changed Sugar Utilization Kinetics in Y. lipolytica Without Changing Transporters Expression

[0147] Glucose must be present in the culture medium for the Y. lipolytica wild type (W29) strain to be able to utilize galactose. Overexpression of all the genes in the Leloir pathway allowed Y. lipolytica cells to grow on media whose sole carbon source was galactose. It was then determined if glucose had an effect on galactose utilization in the Y. lipolytica quadruple mutant (Y4588). To this end, its growth and sugar utilization in 1% glucose, 1% galactose, and a mixture of 1% glucose and 1% galactose were characterized. The kinetics of sugar consumption were the same when the strain was grown in the single sugar cultures, reaching 0.48-49 g.Math.L.sup.1.Math.h.sup.1; slightly more biomass was produced when the strain was grown on glucose alone (FIG. 9A). However, sugar utilization dynamics changed in the mixed medium (FIG. 9B). The galactose utilization rate maxed out at 0.11 g.Math.L.sup.1.Math.h.sup.1, while the glucose utilization rate declined to 0.39 g.Math.L.sup.1.Math.h.sup.1. This same pattern was also seen at lower concentrations of both sugars (0.1% and 0.5%; data not shown). After the lag phase, galactose utilization remained slow and constant, while glucose consumption decreased significantly when the cells reached the stationary phase (FIG. 9B). Overall, growth and sugar consumption were the same on the glucose-only and mixed-sugar media; for instance, at 18 h of incubation, consumption was around 5.5-6 g.Math.L.sup.1 for both (FIG. 9B). Even though the galactose utilization pathway had clearly been activated, glucose was obviously the preferred carbon source.

[0148] The transport of galactose inside the cell is the first step in the metabolic process. It may be modified in the quadruple mutant or may be affected by the presence of glucose. In Y. lipolytica, six genes have been identified as coding hexose transporters from a HXT-like family; they have been named in series, YHT1 to YHT6, and have been reported to transport of galactose (Lazar et al., in preparation; Young et al., 2011). The uptake efficiency of both galactose and glucose was compared in S. cerevisiae hxt null mutants transformed with each of these six genes (FIG. 10A). Four of the transporters, Yht1-Yht4, allowed significant galactose or glucose consumption; uptake efficiency, however, varied (FIG. 10A). Only two of these transporter genes, YHT1 and YHT4, were expressed at similarly high levels in Y. lipolytica W29 and Y4588 strains grown in either 1% glucose or 1% galactose (FIG. 10B). These findings suggest that this set of galactose transporters is affected neither by the genetic background (WT or Y4588) nor by the carbon source.

[0149] 2.7 Galactose is a Good Substrate for Industrial Processes Using Y. lipolytica

[0150] To confirm that galactose could be effectively used in industrial applications (e.g., the Y. lipolytica Y4588 strain could efficiently produce citric acid and lipids), batch cultures were raised in flasks and bioreactors. All the biomass, citric acid, and lipid production results are summarized in Table 4.

TABLE-US-00004 TABLE 4 Biomass, citric acid, and lipid production. Y. lipolytica W29 and Y4588 strains were grown for 96 h in YNB medium containing 6% glucose or 6% galactose in flasks and bioreactors. X Y.sub.X/S CA Y.sub.CA/S Y.sub.CA/X FA Y.sub.FA/S Y.sub.FA/X Parameter g .Math. L.sup.1 g .Math. g.sup.1 g .Math. L.sup.1 g .Math. g.sup.1 g .Math. g.sup.1 g .Math. L.sup.1 g .Math. g.sup.1 g .Math. g.sup.1 Flasks Glu 6% (C/N 60) W29 11.15 0.24 4.18 0.09 0.37 1.92 0.041 0.172 Gal 6% (C/N 60) Y4588 10.90 0.21 18.17 0.35 1.67 1.87 0.036 0.172 Gal 6% (C/N 100) 11.27 0.19 12.58 0.22 1.12 1.98 0.034 0,176 Bioreactors 8.45 0.17 16.96 0.35 2.01 1.79 0.037 0.212 Gal 6% (C/N 100) Y4588 19.4 0.34 29.2 0.51 1.51 3.22 0.056 0.166 Symbols: Xdry biomass; FAfatty acids; CAcitric acid; Y.sub.X/Syield of biomass from substrate consumed; Y.sub.CA/Syield of citric acid from substrate consumed; Y.sub.CA/Xyield of citric acid from dry biomass; Y.sub.FA/Syield of fatty acids from substrate consumed; and Y.sub.FA/Xyield of fatty acids from dry biomass. In this analysis, SD did not exceed 5%.

[0151] The Y. lipolytica wild-type (W29) and quadruple mutant (Y4588) strains produced similar amounts of biomass (11 g.Math.L.sup.1) when grown in both glucose and galactose media with C/N ratio of 60. Biomass yield ranged from 0.19 to 0.24 g.Math.g.sup.1. When the C/N ratio of the galactose medium was increased to 100, biomass yield decreased slightly (11%).

[0152] Interestingly, in glucose, citric acid biosynthesis and yield were around four times higher for Y4588 than for W29. Furthermore, Y4588 was able to produce three times more citric acid from galactose (C/N 60) than did W29 grown in glucose. Finally, when the C/N ratio was increased to 100, biomass and citric acid yield from galactose increased by 55% and 37%, respectively.

[0153] Galactose could also be used to efficiently produce lipids. In glucose with a C/N ratio of 60, W29 and Y4588 produced similar amounts of total lipids. Y4588 was able to produce comparable amounts of total lipids in galactose- and glucose-only media (Table 4). Lipid yields for W29 and Y4588 ranged between 0.034 and 0.041 g.Math.g.sup.1. Additionally, increasing the C/N ratio to 100 improved lipid accumulation by 20%; it reached 0.212 g.Math.g.sup.1. W29 had similar or lower yields when grown in glucose or fructose media with the same C/N ratio (Lazar et al., 2014).

[0154] To study Y4588's ability to produce citric acid and lipids in large quantities, the production was scaled up by using 2-L bioreactors. Overall, biomass, citric acid, and lipid production were dramatically improved (Table 4). Up to 19.4 g.Math.L.sup.1 of biomass was produced under these conditions, representing an increase of 100%. Citric acid production reached 29.2 g.Math.L.sup.1 and thus the conversion of substrate to citric acid was improved by 31%. Additionally, lipid production increased from 1.79 to 3.22 g.Math.L.sup.1, which signifies that 34% more galactose was converted into lipids. The construction of a Y. lipolytica strain that is able to produce citric acid and lipids from galactose is a very important step in increasing the range of carbohydrate substrates used by this yeast for industrial applications.

REFERENCES

[0155] Andr, A., et al., 2009. Eng. in Life Sci. 9:468-478. [0156] Barth G. and Gaillardin C., 1996 Yarrowia lipolytica, In Nonconventional yeasts in biotechnology, vol. 1, K. Wolf, K. D. Breunig, and G. Barth (ed.), Springer-Verlag, Berlin, Germany, 313-388 [0157] Beopoulos A., et al., 2008. Applied Environmental Microbiology. 74: 7779-7789. [0158] Beopoulos A., et al., 2012. Applied Microbiology and Biotechnology. 93: 1523-1537. [0159] Blazeck, J., 2011. Appl. Environ Microbiol. 77: 7905-7914. [0160] Blazeck, J., 2013. Appl. Microbiol Biotechnol. 97:3037-3052. [0161] Blazeck J, et al., 2014. Nature Communications. 5: 3131, DOI: 10.1038/ncomms4131. [0162] Bouffard G. G., et al., 1994. J Mol Biol. 162: 156-159. [0163] Browse, J., et al., 1986, Anal. Biochem. 152:141-145. [0164] Christensen U., et al., 2011. Appl Environ Microbiol. 77: 7084-7087. [0165] Coelho M. A. Z., et al., 2010. Yarrowia lipolytica: an industrial workhorse. In: Mndez-Villas A (ed). Current Research, Technology and Education Topics in Applied Microbiology and Microbial Biotechnology. Vol. 2. Formatex, Badajoz, p 930. [0166] Dear S., Staden R. 1991. Nucleic Acids Res. 19: 3907-3911. [0167] Dulermo T., et al., 2013. Biochimica and Biophysica Acta. 1831: 1486-1495. [0168] Fakas, S., et al., 2006, Appl Microbiol Biotechnol., 73:676-683. [0169] Fickers P., et al., 2003. Journal of Microbiological Methods. 55: 727-737. [0170] Frey P. A., 1996. The FASEB Journal. 10: 461-470. [0171] Gaillardin C., Ribet A M. 1987. Current Genetics. 11: 369-375. [0172] Gruben B. S., et al., 2012. FEBS Letters. 586: 3980-3985. [0173] Guo, X., et al., 2000, J. Appl. Microbiol. 89:107-115. [0174] Gysler, C., et al., 1990, Biotechn Techn. 4:285-290. [0175] Hartl L., et al., 2007. The Journal of Biological Chemistry. 282: 18654-18659. [0176] Hedfalk, K. 2012 Codon Optimisation for Heterologous Gene Expression in Yeast. In Springer Protocols: Methods in Molecular Biology. Recombinant protein production in yeast: methods and protocols. Volume 866 pp. 47-55. Springer Eds. [0177] Holden H. M., et al., 2003. The Journal of Biological Chemistry. 278: 43885-43888. [0178] Ito, H., et al., 1983, J Bacteriol. 153:163-168. [0179] Klebe, R. J., et al., 1983, Gene. 25:333-341. [0180] Koivistoinen O. M., et al., 2012. FEBS Letters. 586: 378-383. [0181] Lazar Z., et al., 2014. Metabolic Engineering. 26: 89-99. [0182] Le Dall, M. T., et al., 1994, Curr Genet. 26:38-44. [0183] Liu X., et al., 2014. Appl Biochem Biotechnol. DOI 10.1007/s12010-014-1430-0 [0184] Madzak C., et al., 2000, J Mol Microbiol Biotechnol. 2:207-216. [0185] Madzak, C., et al., 2004, J Biotechnol. 109:63-81. [0186] Majumdar S., et al., Eur. J. Biochem. 2004. 271: 753-759. [0187] Mauersberger S., et al., 2001. Journal of Bacteriology. 183: 5102-5109. [0188] Meyer J., et al., 1991. Mol Cell Biol. 11:5454-5461. [0189] Michely S., et al., 2013. PLOS one. 8: e63356 (1-10). [0190] Miroczuk A. M., et al., 2014. Journal of Industrial Microbiology and Biotechnology. 41: 57-64. [0191] Mojzita D., et al., 2012. J Biol Chem. 287: 26010-26018. [0192] Mller S., et al., 1998. Yeast. 14:1267-1283. [0193] Mumberg D., et al., 1995. Gene. 156: 119-122. [0194] Orr-Weaver, T. L., et al., 1981, Proc. Natl. Acad. Sci. USA, 78:6354-6358. [0195] Papanikolaou, S., et al., 2001, Antonie van Leeuwenhoek, 80:215-224. [0196] Papanikolaou, S., et al., 2002, J. Appl. Microbiol. 92:737-744. [0197] Papanikolaou, S., et al., 2008, Bioresour. Technol. 99:2419-2428. [0198] Querol A., et al., 1992. Applied and Environmental Microbiology, 58: 2948-2953. [0199] Sambrook J., Russell D W. 2001. Molecular Cloning: a Laboratory Manual (3rd ed.) Cold Spring Harbor Laboratory Press, New York [0200] Schdel C., et al., 2010. Plant Physiology and Biochemistry. 48: 1-8. [0201] Schmittgen T. D., Livak K. J., 2008. Nature Protocols. 3: 1101-1108. [0202] Segawa T. and Fukasawa T., 1979. J. Biol. Chem. 254: 10707-10709. [0203] Seiboth B., et al., 2002. Gene. 295: 143-149. [0204] Sellick C. A., et al., 2008. Int Rev Cell Mol Biol. 269: 111-50. [0205] Schell M. A. and Wilson D. B., 1977. J. Biol. Chem. 252: 1162-1166. [0206] Slot J. C., Rokas A., 2010. PNAS. 107: 10136-10141. [0207] Tai M., Stephanopoulos G. 2013. Metabolic engineering. 15: 1-9. [0208] Tatusova, T. A. and Madden, T. L., 1999. FEMS Microbiol. Lett. 174:247-250. [0209] van der Walt J. P., von Arx J A. 1980. Antonie van Leeuwenhoek. 46: 517-521. [0210] Wang W., et al., 2014. PLOS One, DOI: 10.1371/journal.pone.0111443 [0211] Wong T. Y., Yao X. T., 1994. Applied and environmental Microbiology, 60: 2065-2068. [0212] Xuan J. W., et al., 1990. Molecular and Cellular Biology. 10: 4795-4806. [0213] Young E., et al., 2011. Appl Environ Microbiol. 77: 3311-3319.