Methods For Enriching Gene-Targeted Cells

20180100167 ยท 2018-04-12

    Inventors

    Cpc classification

    International classification

    Abstract

    A gene of interest and the gene encoding hypoxanthine-aminopterin-thymidine (HPRT) can be co-targeted for Casp9 nuclease-mediated editing or alteration in a cell. Based on whether the HPRT gene is altered to encode a non-functional protein, or is not so-altered, the co-targeted cells can be selected and counter-selected. HPRT co-targeting can be used to sequentially disrupt as many genes of interest as cell viability permits.

    Claims

    1. A plasmid comprising the nucleic acid sequence of SEQ ID NO:20, SEQ ID NO:21, or SEQ ID NO:22.

    2. A cell transfected with the plasmid of claim 1.

    3. A kit comprising two or more plasmids according to claim 1, and optionally further comprising a gRNA comprising the nucleic acid sequence of SEQ ID NO:25, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

    4. A nucleic acid comprising the nucleic acid sequence of SEQ ID NO:23 or the complement thereof, or SEQ ID NO:24 or the complement thereof or a nucleic acid comprising the nucleic acid sequence of SEQ ID NO:25, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4, or the complement thereof.

    5. A vector comprising the nucleic acid according to claim 4, wherein the vector comprises the nucleic acid sequence of SEQ ID NO:23, SEQ ID NO:24, or SEQ ID NO:25.

    6. A cell transfected with the vector of claim 5.

    7. A kit comprising two or more of the vectors of claim 5.

    8. A method comprising: a) providing a Cas9-competent cell comprising a hypoxanthine guanine phosphoribosyl transferase (HPRT) gene comprising an alteration; b) co-transfecting the cell with a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a target gene, a first gRNA that hybridizes to the HPRT gene upstream of the alteration, a second gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene, and then culturing the cell in a medium comprising hypoxanthine-aminopterin-thymidine (HAT); c) transfecting the cell with a third gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; and d) co-transfecting the cell with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then culturing the cell in a medium comprising HAT; or e) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then culturing the cell in a medium comprising HAT.

    9. The method according to claim 8, further comprising repeating step c), and thereafter repeating steps b) through d) a plurality of times, wherein the target gene in step b) is a different gene each time step b) is repeated and wherein the subsequent target gene in step d) is both different from the target gene in step b) and is a different gene each time step d) is repeated.

    10. The method according to claim 8, wherein the Cas9-competent cell comprises Cas9 integrated into its genome or wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    11. The method according to claim 8, wherein the first donor plasmid comprises the nucleic acid sequence of SEQ ID NO:21 or wherein the second donor plasmid comprises the nucleic acid sequence of SEQ ID NO:22.

    12. The method according to claim 8, wherein the HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene comprises the nucleic acid sequence of SEQ ID NO:23.

    13. The method according to claim 8, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:24.

    14. A method comprising: a) co-transfecting a Cas9-competent cell with a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a target gene and a first gRNA that hybridizes to a nucleic acid sequence of the HPRT gene, thereby introducing an alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; b) co-transfecting the cell with a second gRNA that hybridizes to the HPRT gene upstream of the alteration, a third gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration but lacks a sequence complementary to the sequence of second and third gRNA, and optionally, a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising HAT; c) co-transfecting the cell with the first gRNA, thereby re-introducing the alteration to the HPRT gene, and a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising 6-thioguanine; and d) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a HPRT nucleic acid sequence comprising a wild type HPRT nucleic acid sequence that corrects the alteration, and optionally a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising HAT.

    15. The method according to claim 14, further comprising e) repeating step c) and thereafter repeating steps b) through d) and, optionally, repeating step e) a plurality of additional times.

    16. The method according to claim 15, wherein the subsequent target gene in step c) is a different gene each time step c) is repeated and wherein each subsequent target gene in step c) is different from the target gene in step a).

    17. The method according to claim 14, wherein the Cas9-competent cell comprises Cas9 integrated into its genome or wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    18. The method according to claim 14, wherein the first donor plasmid comprises the nucleic acid sequence of SEQ ID NO:21 or wherein the second donor plasmid comprises the nucleic acid sequence of SEQ ID NO:22.

    19. The method according to claim 14, wherein the HPRT nucleic acid sequence that corrects the alteration but lacks a sequence complementary to the sequence of second and third gRNA comprises the nucleic acid sequence of SEQ ID NO:23.

    20. The method according to claim 14, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:24.

    21. A method comprising: a) providing a Cas9-competent cell comprising a hypoxanthine guanine phosphoribosyl transferase (HPRT) gene comprising an alteration; b) co-transfecting the cell with a first guide RNA (gRNA) that hybridizes upstream of a nucleic acid sequence of a target gene, a second gRNA that hybridizes downstream of the nucleic acid sequence of the target gene, a first donor plasmid comprising a nucleic acid sequence that alters the nucleic acid sequence of the target gene, a first gRNA that hybridizes to the HPRT gene upstream of the alteration, a second gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene, and then culturing the cell in a medium comprising hypoxanthine-aminopterin-thymidine (HAT); c) transfecting the cell with a third gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; and d) co-transfecting the cell with a first gRNA that hybridizes upstream of a nucleic acid sequence of a subsequent target gene, a second gRNA that hybridizes downstream of the nucleic acid sequence of the subsequent target gene, and a first donor plasmid comprising a nucleic acid sequence that alters the nucleic acid sequence of the subsequent target gene, a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then culturing the cell in a medium comprising HAT; or e) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then culturing the cell in a medium comprising HAT.

    22. The method according to claim 21, further comprising repeating step c), and thereafter repeating steps b) through d) a plurality of times, wherein the target gene in step b) is a different gene each time step b) is repeated and wherein the subsequent target gene in step d) is both different from the target gene in step b) and is a different gene each time step d) is repeated.

    23. The method according to claim 21, wherein the Cas9-competent cell comprises Cas9 integrated into its genome or wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    24. The method according to claim 21, wherein the first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration comprises the nucleic acid sequence of SEQ ID NO:21.

    25. The method according to claim 21, wherein the second donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration comprises the nucleic acid sequence of SEQ ID NO:22.

    26. The method according to claim 21, wherein the HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene comprises the nucleic acid sequence of SEQ ID NO:23.

    27. The method according to claim 21, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:24.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0024] FIG. 1 (panels a through e) show the correction of the mutant HPRT gene by CRISPR-induced gene editing. FIG. 1 (panel a) shows the design for the editing gRNAs and the donor sequence. The donor (HPRT-hr) lacks the target sequences for the two editing gRNAs and contains some silent mutations in exon 8. Wild type sequences and mutated sequences are shown. FIG. 1 (panel b) shows crystal violet staining of colonies formed after HAT selection of the transfected cells. The Cas9 gene was integrated in the genome and induced by doxycycline. The amount of each plasmid is: 0.3 g for HPRT gRNA3, 0.3 g for HPRT gRNA4, and 0.2 g for the donor HPRT-hr. FIG. 1 (panel c) shows a sequence chromatogram of the exon 8 region disrupted by Cas9 and HPRT gRNA2 in pooled 6-TG resistant cells. Underlined are the sequences corresponding to the silent mutations and the gRNA2 target in the donor. FIG. 1 (panel d) shows a sequence chromatogram of the edited HPRT gene in the pooled HAT resistant cells. Underlined are the mutated targets of editing gRNAs 3 and 4, the silent mutations in exon 8, and the corrected target of gRNA2. FIG. 1 (panel e) shows a sequence alignment of the wild type HPRT gene, the donor, and the corrected HPRT gene.

    [0025] FIG. 2 (panels a and b) show co-targeting of Exo1 and Trex1 genes during HPRT gene editing. FIG. 2 (panel a) shows crystal violet staining of colonies formed after HAT selection of cells transfected with the indicated DNA. The amount of each plasmid is: 0.3 g for HPRT gRNA3-gRNA4 (same plasmid), 0.3 g for Exo1 or Trex1 gRNA, and 0.2 g for the donor HPRT-hr. FIG. 2 (panel b) shows sequence chromatograms of the Exo1 target region and Trex1 target region in the pooled HAT resistant cells.

    [0026] FIG. 3 (panels a, b, and c) show re-disruption and re-editing of the HPRT gene. FIG. 3 (panel a) shows re-disruption of the corrected HPRT gene. Left: Crystal violet staining of colonies formed after 6-TG selection of the corrected cells transfected with HPRT gRNA2. Right: the sequence chromatogram of the HPRT target region in the pooled 6-TG resistant cells. Underlined are the mutated targets of editing gRNA3-hr and gRNA4-hr, the silent mutations in exon 8, and the mutated target of gRNA2. 0.8 g for HPRT gRNA2 was used for transfection. FIG. 3 (panel b) shows re-correction of the re-disrupted HPRT gene. Left: Crystal violet staining of colonies formed after HAT selection of the re-disrupted cells transfected with new editing gRNAs and completely wild type HPRT donor. Right: the sequence chromatogram of the HPRT target region in the pooled HAT resistant cells. Underlined are the wild type targets of editing gRNA3 and gRNA4, the wild type signature in exon 8, and the wild type target of gRNA2. FIG. 3 (panel c) shows a sequence alignment of the first HR-donor corrected HPRT gene, the re-corrected HPRT gene, and the wild type HPRT donor. The amount of each plasmid is: 0.4 g for HPRT gRNA3-gRNA4, and 0.4 g for the donor HPRT-wt.

    [0027] FIG. 4 (panels a, b, and c) show iterative disruption of multiple genes by co-targeting the HPRT gene in a cyclic way. FIG. 4 (panel a) shows a 4-step cycle of HPRT gene disruption and correction. FIG. 4 (panel b) shows co-targeting of Trex1 during step 3. Left: Crystal violet staining of colonies formed after 6-TG selection of the Exo1 mutant cells from step 2 co-targeting transfected with the Trex1 and HPRT gRNAs. Right: sequence chromatograms of the Trex1 target region in the pooled 6-TG resistant cells. The amount of each plasmid is: 0.4 g for HPRT gRNA2 and 0.4 g for Trex1 gRNA. FIG. 4 (panel c) shows co-targeting of AAVS1 during step 4. Left: Crystal violet staining of colonies formed after HAT selection of the Exo1/Trex1 mutant cells from step 3 co-targeting transfected with the AAVS1 and HPRT gRNAs. Right: sequence chromatograms of the AAVS1 target region in the pooled HAT resistant cells. The amount of each plasmid is: 0.4 g for HPRT gRNA3-gRNA4 (same plasmid), 0.2 g for AAVS1 gRNA, and 0.2 g for the donor HPRT-wt.

    [0028] FIG. 5 shows enrichment of cells with PolQ gene editing by co-editing the HPRT gene.

    DESCRIPTION OF EMBODIMENTS

    [0029] Various terms relating to embodiments of the present disclosure are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein.

    [0030] As used herein, the singular forms a, an, and the include plural referents unless expressly stated otherwise.

    [0031] It was hypothesized that HPRT mutations generated by gene co-targeting can be corrected by CRISPR-induced gene editing via homologous recombinational repair. If a gRNA against another gene of interest is co-expressed during HPRT gene editing, the corrected cells are enriched for mutations in the second gene. In accordance with the present disclosure, this hypothesis was tested and confirmed in human HCT116 cells. Furthermore, it was observed that with the proper gRNAs and homologous donors, the selection and counter-selection could be repeated indefinitely. Thus, HPRT co-targeting can be used to sequentially disrupt or edit as many genes as cell viability permits.

    [0032] Compared to other enrichment methods, the various HPRT co-targeting methods in the present disclosure have several advantages including, for example: 1) They are highly efficient. For non-essential genes, it was observed that 80-100% of the 6-TG or HAT resistant cells have the gene of interest disrupted. 2) They only use basic tissue culture setup and standard transfection reagents. No sophisticated equipment, expensive reagents, or complicated protocols are required. 3) They are easy to scale up simply by increasing the number of transfections. 4) They do not involve viruses. Viruses can be difficult to prepare with consistent quality and take extra time to characterize. Viruses also raise concerns about biosafety in the laboratory and oncogenic effects of viral DNA integration into chromosomes if applied in the clinic. 5) They provide internal controls that allow a determination if a gene is essential or if two genes are synthetically lethal. 6) They provide internal controls that allow one to determine if a guide RNA is effective. 7) They leave no genetic imprint other than in the HPRT gene and the gene of interest. Guide RNAs (and Cas9) can be transiently expressed from plasmid DNA. The probability of plasmid DNA integration is low and can be easily excluded by checking for drug resistance conferred by the plasmids. 8) They allow disruption in an iterative and essentially scar-free way as many genes as cell viability permits. 9) They allow enrichment of cells that have been successfully edited to a pre-designed sequence.

    [0033] The present disclosure provides methods for altering or editing one or more genes in a cell, and enriching cultures of the cell that comprise the altered or edited genes. The methods utilize CRISPR, along with CRISPR associated protein 9 (Cas9), which is an RNA-guided DNA endonuclease enzyme. The methods take advantage of the capacity to alter and restore the HPRT gene via Cas9-facilitated gene editing, and the capacity to use Cas9 nuclease to co-target a gene of interest along with HPRT. In some embodiments, the methods are carried out in vitro or ex vivo.

    [0034] In some embodiments, the methods are carried out using Cas9-competent cells. This means that the cell expresses a functional Cas9 enzyme. The gene encoding the Cas9 enzyme may be integrated, including stably integrated, into the genome of the cell. In some embodiments, the gene encoding the Cas9 enzyme is provided to the cell, for example, by transfecting the cell with a gene encoding Cas9. The cell may be transfected, for example, with a plasmid encoding the Cas9 gene. The plasmid may further comprise a gRNA, for example, a gRNA that is to be used during targeting of HPRT or a gRNA that is to be used during targeting of a gene of interest. Thus, a gRNA-encoding plasmid may also comprise a gene encoding Cas9. The Cas9 gene in the plasmid may be operably linked to a constitutive promoter or operably linked to an inducible promoter, with the latter providing for control over Cas9 expression.

    [0035] The methods may comprise first providing a Cas9-competent cell that comprises an altered HPRT. Alternately, the methods may comprise preparing a Cas9-competent cell by transfecting a cell with a gene encoding the Cas9 enzyme, e.g., on a plasmid.

    [0036] Once a Cas9-competent cell is prepared or provided, the methods comprise altering or editing a target gene. In some embodiments, altering the target gene comprises utilizing a gRNA to direct the Cas9 nuclease to introduce a DSB in the target gene. The cell's natural, but error-prone DNA repair system will repair the ds break, but introduces an insertion or deletion or other alteration at the repair site, resulting in an altered target gene. In this case, the type of alteration is not controlled.

    [0037] In order to control the alteration, the target gene may be edited. Thus, in some embodiments, the target gene is edited. Editing the target gene comprises utilizing a gRNA that hybridizes to a sequence of the target gene upstream of the intended site for editing, a gRNA that hybridizes to a sequence of the target gene downstream of the intended site for editing, and a nucleic acid comprising a donor sequence, with the donor sequence comprising one or more alterations of target gene that revise (edit) the target gene sequence in a controlled manner. In this way, the donor sequence may introduce one or more particular mutations in the target gene, including mutations that revise or correct one or more defects in the target gene.

    [0038] The alteration or editing of the target gene is carried out in conjunction with parallel and concomitant Cas9-mediated altering and editing of the hypoxanthine guanine phosphoribosyl transferase (HPRT) gene. In this way, the state of the HPRT gene (e.g., altered, restored) can be used to select and counter-select cells. Cells comprising an altered HPRT gene (e.g., an alteration that causes the HPRT protein to not be expressed or that renders the HPRT protein non-functional) can be selected with 6-TG. Cells comprising a restored or wild type HPRT gene (e.g., HPRT protein is expressed and functional) can be selected with HAT. With the co-targeting of the target gene HPRT, the HPRT-selected cells comprise an altered or edited form of the HPRT gene, as well as an altered or edited form of the target gene. The cycle of altering and editing the HPRT gene along with a target gene of interest can be repeated as long as the cells will tolerate the target gene alterations.

    [0039] In some embodiments, the methods comprise providing a Cas9-competent cell comprising an HPRT gene comprising an alteration. In some embodiments, the character of the alteration is such that the HPRT gene encodes a non-functional HPRT protein. The cell may then be co-transfected with a gRNA that hybridizes to a nucleic acid sequence of a target gene, thereby introducing an alteration to the target gene, a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a second gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of either gRNA that hybridizes to the HPRT gene (e.g., lacks a sequence complementary to the aforementioned upstream and the downstream HPRT gRNA), and then culturing the cell in a medium comprising HAT. The gRNA and the donor nucleic acid sequence may be provided on a plasmid.

    [0040] Following HAT selection, the cell may then be co-transfected with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, thereby introducing an alteration to the subsequent target gene, a gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then cultured in a medium comprising 6-TG. The re-introduced alteration is preferably the same alteration from the Cas9 competent cell initially provided, though in some embodiments, the alteration is different from the alteration in the Cas9 competent cell initially provided.

    [0041] Following 6-TG selection, the cell may then be co-transfected cell with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, thereby introducing an alteration to the subsequent target gene, a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor nucleic acid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then cultured in a medium comprising HAT. Alternately, the cell may be co-transfected with a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor nucleic acid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then cultured in a medium comprising HAT. In the former case, the cell will comprise multiple altered target genes, which, in some embodiments, are not the same gene, though it is possible to alter the same target gene in different locations (e.g., the target gene and the subsequent target gene are the same gene, which is edited at different locations). In the alternative case, the cell will comprise one fewer altered target gene. The gRNA and the donor nucleic acids may be provided on a plasmid.

    [0042] In some embodiments, the target gene is edited instead of altered. In such embodiments, the methods comprise providing a Cas9-competent cell comprising an HPRT gene comprising an alteration. In some embodiments, the character of the alteration is such that the HPRT gene encodes a non-functional HPRT protein. The cell may then be co-transfected with a gRNA that hybridizes to a target gene upstream of a nucleic acid sequence of the target gene that is to be edited, a gRNA that hybridizes to the target gene downstream of the nucleic acid sequence of the target gene that is to be edited, a donor plasmid comprising a nucleic acid sequence that alters/edits the nucleic acid sequence of the target gene, a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a second gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of each gRNA that hybridizes to the HPRT gene (e.g., lacks a sequence complementary to the aforementioned upstream and the downstream HPRT gRNA), then cultured in a medium comprising HAT. The gRNA and the donor nucleic acids may be provided on a plasmid.

    [0043] Following HAT selection, the cell may then be transfected with a gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then cultured in a medium comprising 6-TG. The re-introduced alteration is preferably the same alteration from the Cas9 competent cell initially provided, though in some embodiments, the alteration is different from the alteration in the Cas9 competent cell initially provided.

    [0044] Following 6-TG selection, the cell may be co-transfected cell with a gRNA that hybridizes to a subsequent target gene upstream of a nucleic acid sequence of the subsequent target gene that is to be edited, a gRNA that hybridizes to the subsequent target gene downstream of the nucleic acid sequence of the subsequent target gene that is to be edited, a donor plasmid comprising a nucleic acid sequence that alters/edits the nucleic acid sequence of the subsequent target gene, a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor nucleic acid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then cultured in a medium comprising HAT. Alternately, the cell may be transfected with a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor nucleic acid comprising a wild type HPRT nucleic acid sequence that corrects the silent alteration, thereby restoring the HPRT gene to its wild type form, and then cultured in a medium comprising HAT. In the former case, the cell will comprise multiple edited target genes, which, in some embodiments, are not the same gene, though it is possible to edit the same target gene in different locations (e.g., the target gene and the subsequent target gene are the same gene, which is edited at different locations). In the alternative case, the cell will comprise one fewer altered target gene. The gRNA and the donor nucleic acids may be provided on a plasmid.

    [0045] The method steps may be repeated any number of times, in order to alter or edit as many target genes or locations within a target gene or target genes as is desired or as the cell will tolerate. The number of repeats may be constrained, for example, by the type of genes being altered. The target gene (e.g., the first target gene and each subsequent target gene) is not critical, and can vary according to the needs or desires of the investigator. Repeating of the method may conclude when no further altering or editing of the target gene(s) is desired or possible. The method thus may be concluded by restoring HPRT to its wild type form, such as in the alternate steps described above, whereby the HPRT gene is edited to wild type form but without the concomitant editing or alteration of a target gene.

    [0046] In some embodiments, the methods comprise co-transfecting a Cas9-competent cell with a gRNA that hybridizes to a nucleic acid sequence of a target gene, thereby introducing an alteration in the target gene, and a gRNA that hybridizes to a nucleic acid sequence of the HPRT gene, thereby introducing an alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-TG.

    [0047] Following 6-TG selection, the cell may be co-transfected cell with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, thereby introducing an alteration in the subsequent target gene, and a gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, a gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and a donor nucleic acid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of gRNA that hybridize upstream and downstream of the alteration, and then cultured in a medium comprising HAT.

    [0048] Following HAT selection, the cell may be co-transfected with the gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration in the HPRT gene, and a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, thereby introducing an alteration in the subsequent target gene, and then cultured in a medium comprising 6-TG.

    [0049] Following the 6-TG selection, the cell may be co-transfected with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, thereby introducing an alteration in the subsequent target gene, and the gRNA that hybridizes to the HPRT gene upstream of the HPRT gene alteration, the gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration, and the donor nucleic acid comprising a HPRT nucleic acid sequence comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild type form, and then cultured in a medium comprising HAT.

    [0050] The cells may comprise a cell line. The cells may also comprise primary isolates. The primary isolates may be obtained from any animal, including farm animals, companion animals, lab animals, and non-human primates. In some embodiments, the primary isolates are from human beings. The primary isolates may be obtained from any tissue, organ, or system in the body. In some embodiments, the cells, having been edited according to the methods described or exemplified herein, may be placed back into the body of the animal from which they were obtained, in edited form.

    [0051] In accordance with the methods, the gRNA that hybridizes to the HPRT gene that introduces an alteration in the HPRT gene may comprise the nucleic acid sequence of SEQ ID NO:25. The gRNA that hybridizes to the HPRT gene upstream of the alteration may comprise the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3, and the gRNA that hybridizes to the HPRT gene downstream of the HPRT gene alteration may comprise the nucleic acid sequence of SEQ ID NO:2 or SEQ ID NO:4.

    [0052] In some embodiments, the donor plasmid comprising a wild type-restoring HPRT nucleic acid sequence may comprise the nucleic acid sequence of SEQ ID NO:22. In some embodiments, the donor plasmid comprising an altered nucleic acid sequence of the HPRT gene comprises the nucleic acid sequence of SEQ ID NO:21. In some embodiments, a plasmid comprising a gRNA for disrupting the HPRT gene comprises the nucleic acid sequence of SEQ ID NO:20.

    [0053] Plasmids for transfection of a cell to comprise an altered HPRT sequence are provided. The plasmids may comprise the nucleic acid sequence of SEQ ID NO:21. The plasmids may comprise the nucleic acid sequence of SEQ ID NO:20.

    [0054] Plasmids for transfection of a cell to comprise a wild type HPRT sequence or restored wild type HPRT sequence are provided. The plasmids may comprise the nucleic acid sequence of SEQ ID NO:24 or SEQ ID NO:25. The plasmids may comprise the nucleic acid sequence of SEQ ID NO:21 or SEQ ID NO:22.

    [0055] Cells transfected with a plasmid comprising the nucleic acid sequence of SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24 are provided. The cells may be further transfected with a plasmid encoding a gRNA. The cells may be further transfected with a plasmid encoding Cas9. The cells may be Cas9 competent cells.

    [0056] Kits comprising one or more plasmids are provided. In some embodiments, a kit comprises three plasmids, one comprising the nucleic acid sequence of SEQ ID NO:20, one comprising the nucleic acid sequence of SEQ ID NO:21, and one comprising the nucleic acid sequence of SEQ ID NO:22. The kits may further comprise instructions for using the plasmid(s) in a method for editing one or more genes in a cell, and/or enriching cultures of the cell that comprise the edited genes. The kits may further comprise HAT or a media comprising HAT. The kits may further comprise 6GT or a media comprising 6GT.

    [0057] The following representative embodiments are presented:

    Embodiment 1

    [0058] A plasmid, comprising the nucleic acid sequence of SEQ ID NO: 20.

    Embodiment 2

    [0059] A plasmid, comprising the nucleic acid sequence of SEQ ID NO: 21.

    Embodiment 3

    [0060] A plasmid, comprising the nucleic acid sequence of SEQ ID NO: 22.

    Embodiment 4

    [0061] A cell transfected with the plasmid of any one of embodiments 1 to 3.

    Embodiment 5

    [0062] A kit, comprising two or more of a plasmid having the nucleic acid sequence of SEQ ID NO: 20, a plasmid having the nucleic acid sequence of SEQ ID NO: 21, and a plasmid having the nucleic acid sequence of SEQ ID NO: 22, and optionally further comprising a gRNA comprising the nucleic acid sequence of SEQ ID NO: 25, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

    Embodiment 6

    [0063] A nucleic acid, comprising the nucleic acid sequence of SEQ ID NO: 23 or the complement thereof.

    Embodiment 7

    [0064] A nucleic acid, comprising the nucleic acid sequence of SEQ ID NO: 24 or the complement thereof.

    Embodiment 8

    [0065] A nucleic acid, comprising the nucleic acid sequence of SEQ ID NO: 25, SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, or the complement thereof.

    Embodiment 9

    [0066] A method, comprising: (a) providing a Cas9-competent cell comprising a hypoxanthine guanine phosphoribosyl transferase (HPRT) gene comprising an alteration; (b) co-transfecting the cell with a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a target gene, a first gRNA that hybridizes to the HPRT gene upstream of the alteration, a second gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene, and then culturing the cell in a medium comprising hypoxanthine-aminopterin-thymidine (HAT); (c) transfecting the cell with a third gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; and (d) co-transfecting the cell with a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild-type form, and then culturing the cell in a medium comprising HAT; or (e) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild-type form, and then culturing the cell in a medium comprising HAT.

    Embodiment 10

    [0067] The method according to embodiment 9, further comprising repeating step (c), and thereafter repeating steps (b) through (d) a plurality of times, wherein the target gene in step (b) is a different gene each time step (b) is repeated and wherein the subsequent target gene in step (d) is both different from the target gene in step (b) and is a different gene each time step (d) is repeated.

    Embodiment 11

    [0068] The method according to embodiment 9 or 10, wherein the Cas9-competent cell comprises Cas9 integrated into its genome.

    Embodiment 12

    [0069] The method according to embodiment 9 or 10, wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    Embodiment 13

    [0070] The method according to any one of embodiments 9 to 12, wherein the first donor plasmid comprises the nucleic acid sequence of SEQ ID NO: 21.

    Embodiment 14

    [0071] The method according to any one of embodiments 9 to 13, wherein the second donor plasmid comprises the nucleic acid sequence of SEQ ID NO: 22.

    Embodiment 15

    [0072] The method according to any one of embodiments 9 to 14, wherein the HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene comprises the nucleic acid sequence of SEQ ID NO: 23.

    Embodiment 16

    [0073] The method according to any one of embodiments 9 to 15, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 24.

    Embodiment 17

    [0074] The method according to any one of embodiments 9, 10, or 12 to 16, wherein the Cas9-competent cell is a cell isolated from a non-human mammal.

    Embodiment 18

    [0075] The method according to any one of embodiments 9, 10, or 12 to 16, wherein the Cas9-competent cell is a cell isolated from a human being.

    Embodiment 19

    [0076] The method according to embodiment 12, wherein the plasmid encoding Cas9 comprises an inducible promoter operably linked to Cas9.

    Embodiment 20

    [0077] A method, comprising: (a) co-transfecting a Cas9-competent cell with a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a target gene and a first gRNA that hybridizes to a nucleic acid sequence of the HPRT gene, thereby introducing an alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; (b) co-transfecting the cell with a second gRNA that hybridizes to the HPRT gene upstream of the alteration, a third gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration but lacks a sequence complementary to the sequence of second and third gRNA, and optionally, a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising HAT; (c) co-transfecting the cell with the first gRNA, thereby re-introducing the alteration to the HPRT gene, and a gRNA that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising 6-thioguanine; and (d) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a HPRT nucleic acid sequence comprising a wild type HPRT nucleic acid sequence that corrects the alteration, and optionally a guide RNA (gRNA) that hybridizes to a nucleic acid sequence of a subsequent target gene, and then culturing the cell in a medium comprising HAT.

    Embodiment 21

    [0078] The method according to embodiment 20, further comprising (e) repeating step (c) and thereafter repeating steps (b) through (d) and, optionally, repeating step (e) a plurality of additional times.

    Embodiment 22

    [0079] The method according to embodiment 21, wherein the subsequent target gene in step (c) is a different gene each time step (c) is repeated and wherein each subsequent target gene in step (c) is different from the target gene in step (a).

    Embodiment 23

    [0080] The method according to any one of embodiment 20-22, wherein the Cas9-competent cell comprises Cas9 integrated into its genome.

    Embodiment 24

    [0081] The method according to any one of embodiments 20-22, wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    Embodiment 25

    [0082] The method according to any one of embodiments 20-24, wherein the first donor plasmid comprises the nucleic acid sequence of SEQ ID NO: 21.

    Embodiment 26

    [0083] The method according to any one of embodiments 20-25, wherein the second donor plasmid comprises the nucleic acid sequence of SEQ ID NO: 22.

    Embodiment 27

    [0084] The method according to any one of embodiments 20-26, wherein the HPRT nucleic acid sequence that corrects the alteration but lacks a sequence complementary to the sequence of second and third gRNA comprises the nucleic acid sequence of SEQ ID NO: 23.

    Embodiment 28

    [0085] The method according to any one of embodiments 20-27, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 24.

    Embodiment 29

    [0086] The method according to any one of embodiments 20-22, or 24 to 28, wherein the Cas9-competent cell is a cell isolated from a non-human mammal.

    Embodiment 30

    [0087] The method according to any one of embodiments 20-22, or 24 to 28, wherein the Cas9-competent cell is a cell isolated from a human being.

    Embodiment 31

    [0088] The method according to embodiment 24, wherein the plasmid encoding Cas9 comprises an inducible promoter operably linked to Cas9.

    Embodiment 32

    [0089] A method, comprising: (a) providing a Cas9-competent cell comprising a hypoxanthine guanine phosphoribosyl transferase (HPRT) gene comprising an alteration; (b) co-transfecting the cell with a first guide RNA (gRNA) that hybridizes upstream of a nucleic acid sequence of a target gene, a second gRNA that hybridizes downstream of the nucleic acid sequence of the target gene, a first donor plasmid comprising a nucleic acid sequence that alters the nucleic acid sequence of the target gene, a first gRNA that hybridizes to the HPRT gene upstream of the alteration, a second gRNA that hybridizes to the HPRT gene downstream of the alteration, and a first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene, and then culturing the cell in a medium comprising hypoxanthine-aminopterin-thymidine (HAT); (c) transfecting the cell with a third gRNA that hybridizes to the HPRT gene, thereby re-introducing the alteration to the HPRT gene, and then culturing the cell in a medium comprising 6-thioguanine; and (d) co-transfecting the cell with a first gRNA that hybridizes upstream of a nucleic acid sequence of a subsequent target gene, a second gRNA that hybridizes downstream of the nucleic acid sequence of the subsequent target gene, and a first donor plasmid comprising a nucleic acid sequence that alters the nucleic acid sequence of the subsequent target gene, a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild-type form, and then culturing the cell in a medium comprising HAT; or (e) co-transfecting the cell with a fourth gRNA that hybridizes to the HPRT gene upstream of the alteration, a fifth gRNA that hybridizes to the HPRT gene downstream of the alteration, and a second donor plasmid comprising a wild type HPRT nucleic acid sequence that corrects the alteration, thereby restoring the HPRT gene to its wild-type form, and then culturing the cell in a medium comprising HAT.

    Embodiment 33

    [0090] The method according to embodiment 32, further comprising repeating step (c), and thereafter repeating steps (b) through (d) a plurality of times, wherein the target gene in step (b) is a different gene each time step (b) is repeated and wherein the subsequent target gene in step (d) is both different from the target gene in step (b) and is a different gene each time step (d) is repeated.

    Embodiment 34

    [0091] The method according to embodiment 32 or 33, wherein the Cas9-competent cell comprises Cas9 integrated into its genome.

    Embodiment 35

    [0092] The method according to embodiment 32 or 33, wherein the Cas9-competent cell has been transfected with a plasmid encoding Cas9.

    Embodiment 36

    [0093] The method according to any one of embodiments 32 to 35, wherein the first donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration comprises the nucleic acid sequence of SEQ ID NO: 21.

    Embodiment 37

    [0094] The method according to any one of embodiments 32 to 36, wherein the second donor plasmid comprising a HPRT nucleic acid sequence that corrects the alteration comprises the nucleic acid sequence of SEQ ID NO: 22.

    Embodiment 38

    [0095] The method according to any one of embodiments 32 to 37, wherein the HPRT nucleic acid sequence that corrects the alteration and that lacks a sequence complementary to the sequence of first and second gRNA that hybridizes to the HPRT gene comprises the nucleic acid sequence of SEQ ID NO: 23.

    Embodiment 39

    [0096] The method according to any one of embodiments 32 to 38, wherein the wild type HPRT nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 24.

    Embodiment 40

    [0097] The method according to any one of embodiments 32, 33, or 35 to 49, wherein the Cas9-competent cell is a cell isolated from a non-human mammal.

    Embodiment 41

    [0098] The method according to any one of embodiments 32, 33, or 35 to 49, wherein the Cas9-competent cell is a cell isolated from a human being.

    Embodiment 42

    [0099] The method according to embodiment 35, wherein the plasmid encoding Cas9 comprises an inducible promoter operably linked to Cas9.

    Embodiment 43

    [0100] A vector, comprising the nucleic acid sequence of SEQ ID NO: 23.

    Embodiment 44

    [0101] A vector, comprising the nucleic acid sequence of SEQ ID NO: 24.

    Embodiment 45

    [0102] A vector, comprising the nucleic acid sequence of SEQ ID NO: 25.

    Embodiment 46

    [0103] A cell transfected with the vector of any one of embodiments 43 to 45.

    Embodiment 47

    [0104] A kit, comprising two or more of the vector of any one of embodiments 43 to 45.

    [0105] The following examples are provided to describe the embodiments in greater detail. They are intended to illustrate, not to limit, the present disclosure.

    EXAMPLES

    Example 1: General Experimental Methods

    [0106] Cell culture and reagents. The human HCT116 cells, Dulbecco's Modified Eagle Medium (DMEM), penicillin/streptomycin (P/S), L-glutamine, non-essential amino acids (NEAA), and G418 were obtained from an in-house Tissue Culture Facility. Cas9-expressing HCT116 cells were constructed. Cells were grown in DMEM supplemented with 10% FBS, 2 mM L-glutamine, NEAA, and P/S at 37 C. under a 5% CO.sub.2 humidified atmosphere.

    [0107] Doxycycline and doxycycline-free fetal bovine serum were purchased from Clonetech (Takara-Clonetech, CA). HAT media, HT media, 6-thioguanine, Crystal violet were purchased from Sigma-Aldrich (MO).

    [0108] Construction of Plasmids Expressing Guide RNAs.

    [0109] The 19 nt gRNA sequences used in this study have been described in Liao et al., Nucleic Acids Res., 2015, 43, e134, except the following (5-(N)19NGG-3 strand):

    TABLE-US-00001 (HPRTg3) (SEQIDNO:1) AACATACAGAGAGACTACA, (HPRTg4) (SEQIDNO:2) TTAGAGAATATTTGTAGAG, (HPRTg3-hr) (SEQIDNO:3) ACAAAATGTGACATATACA, and (HPRTg4-hr) (SEQIDNO:4) AATGGCTTATAATTGCGAG.
    Primers for PCR amplification of genomic DNA are (5->3):

    TABLE-US-00002 HPRT: (SEQIDNO:5) TGGGCAACAGAGCGAGATTC, and (SEQIDNO:6) ATCAAAGTGGGAGGCCAGTG, Exo1: (SEQIDNO:7) TCCAGTTCCAGCTGCCTAGA, and (SEQIDNO:8) GTCTGCACATTCCTAGCCGA, AAVS1: (SEQIDNO:9) ACAGGAGGTGGGGGTTAGAC, and (SEQIDNO:10) TATATTCCCAGGGCCGGTTA, and Trex1: (SEQIDNO:11) GCAGACCCTCATCTTTTTCG.

    [0110] The donor sequences are: HPRT-wt (chromosome X: 134,497,859-134,499,210) and HPRT-hr (chromosome X: 134,497,915-134,499,152 with the indicated modifications). The gRNA oligonucleotides were subcloned into a vector carrying the U6 promoter. The donor sequences were subcloned into a modified pUC19 vector.

    [0111] Guide RNA Targeting in Cells.

    [0112] Plasmids were introduced into HCT116-Cas9 cells (in 24-well, 95-99% confluency) by transfection with lipofectamine 2000 (Invitrogen, CA) following the manufacturer's protocol. 10% of the cells were re-seeded 14 hours post transfection with or without doxycycline (1 g/ml). After 3-4 days of growth, they were reseeded in DMEM media in 6-well plates at various densities with or without HAT (lx) or 6-TG (1 g/ml). For HAT selection, the media were changed to HT (lx) media after four days and then to regular DMEM after three more days. Cells were grown for a total of 10 days and then passaged or stained with Crystal Violet. The HAT-selected cells were subject to another round of HAT/HT treatment to remove the residual 6-TG resistant cells.

    [0113] Amplification of the Targeted Regions.

    [0114] Genomic DNA was extracted from cells as previously described in Liao et al., Nucleic Acids Res., 2015, 43, e134. The targeted regions were amplified from genomic DNA with Hot Start Taq DNA polymerase (NEB, MA) with the following primers (5->3):

    TABLE-US-00003 HRPT: (SEQIDNO:12) GATGCTCACCTCTCCCACAC, and (SEQIDNO:13) ACATCCATGGGACTTCTGCC; AAVS1: (SEQIDNO:14) ACAGGAGGTGGGGGTTAGAC, and (SEQIDNO:15) TATATTCCCAGGGCCGGTTA; Trex1: (SEQIDNO:16) GCAGACCCTCATCTTTTTCG, and (SEQIDNO:17) TACTGGGCTCAGATAGTTGAC, Exo1: (SEQIDNO:18) TCCAGTTCCAGCTGCCTAGA, and (SEQIDNO:19) GTCTGCACATTCCTAGCCGA.
    All oligonucleotides were synthesized by Integrated DNA technologies (IA).

    Example 2: Results

    [0115] HPRT mutations can be corrected by CRISPR-induced homologous recombination repair. It was first tested if the mutations in exon 8 of the HPRT gene in the co-targeted cells could be corrected by CRISPR-induced gene editing. Two gRNAs were designed to direct Cas9 to clip out the mutant exon 8 of the HPRT gene in the genome (see, FIG. 1, panel a). The homologous donor (HPRT-hr) is a modified 1 kb fragment of the HPRT genomic DNA that lacks the targets for the two editing gRNAs but contains the wild type open reading frame with a few silent mutations for tracking (see, FIG. 1, panel a).

    [0116] Co-transfection of the plasmids for the two editing gRNAs and the HPRT-hr donor plasmid into HPRT.sup. HCT116 cells that express Cas9 from a doxycycline-inducible promoter generated many HAT resistant cells (see, FIG. 1, panel b). No cells survived if the guide RNA plasmids or doxycycline were omitted. The genomic DNA of the HAT resistant cells was then isolated and the region containing exon 8 was amplified with a pair of primers outside the donor sequence. As shown in FIG. 1 (panels c through e), the mutant HPRT region was indeed edited into a sequence identical to that of the donor. These observations demonstrated that the mutant HPRT gene could be corrected by CRISPR-induced gene editing.

    [0117] HPRT gene editing can be used for the co-targeting of another gene. The HAT resistant cells were competent for CRISPR, so it was tested if co-expressing a gRNA targeting another gene might lead to the enrichment of cells that had also disrupted this other gene. Cas9-expressing HPRT.sup. cells were co-transfected with the HPRT-hr donor plasmid and plasmids that express respectively the two editing gRNAs and a gRNA targeting the Exo1 gene or Trex1 gene. Genomic DNA was isolated from the HAT resistant cells and the Exo1 region was amplified by PCR. As shown in FIG. 2 (panels a through c), the Exo1 and Trex1 target regions were heavily mutated. In contrast, cells that were transfected with the Exo1 gRNA or Trex1 gRNA plasmids but not selected by HAT showed no detectable mutations. These data demonstrate that HPRT gene editing can be used as an effective enrichment method for the co-targeting of another gene.

    [0118] CRISPR-induced disruption and correction of the HPRT gene can be repeated indefinitely. The corrected cells had restored the target for the original gRNA used to disrupt the HPRT gene. Therefore they could be made into HPRT-mutant cells again with the same gRNA, giving rise to 6-TG resistant cells (see, FIG. 3, panel a). However, the targets for the two editing gRNAs were no longer intact, with only PAM and the adjacent 3 nucleotides before the Cas9 cleavage site still remaining. As such, the re-disrupted HPRT gene could no longer be corrected with the same two editing gRNAs.

    [0119] Two new editing gRNAs were designed, with each incorporating the same PAM, the 3 nucleotides before the cleavage site, and the new 16 nucleotides after the cleavage site. The predicted positions of Cas9 cleavage were exactly the same as those of the original editing gRNAs. Accordingly, the original wild type HPRT sequence, which lacks the targets for the new editing gRNAs, was used as the new donor (HPRT-wt). With the new editing gRNAs and donor, HAT resistant cells were readily obtained from the re-disrupted HPRT gene (see, FIG. 3, panel b). Analysis of the genomic DNA isolated from these cells showed that the HPRT target region was corrected to the original wild type sequence (see, FIG. 3, panel c). Therefore, the four-step cycle of HPRT disruption and correction can be repeatedly indefinitely.

    [0120] The 4-step cycle of HPRT disruption and correction can be used for iterative gene targeting. Both step 1 (disruption) and step 2 (correction) could be used for the enrichment of the co-targeted genes (see, FIG. 2, panels a through c). If step 3 (re-disruption) and step 4 (re-correction) were also used for co-targeting, one should be able to disrupt in an iterative way as many genes as cell viability permits (see, FIG. 4, panel a). To test this idea, the Exo1-cells obtained from the step 2 were transfected, co-targeting with plasmids expressing the HPRT gRNA2 and a gRNA against the Trex1 gene. The resulting 6-TG resistant cells were highly enriched for Trex1 mutations (see, FIG. 4, panel b).

    [0121] These Exo 1-/Trex1-cells were then transfected with the HPRT-wt donor plasmid and the plasmids expressing the new editing gRNAs and a gRNA against the AAVS1 locus. The resulting HAT resistant cells were now highly enriched for mutations in the AAVS1 locus (see, FIG. 4, panel c).

    Example 3: Editing of the PolQ Gene by Co-Editing the HPRT Gene

    [0122] A gRNA targeting the PolQ gene and a homologous donor were designed. These two plasmids were co-transfected with a plasmid that carries the two editing gRNAs and the donor sequence for the HPRT gene into the HPRT mutant HCT116 cells. A significant fraction of the resulting HAT resistant cells was found to carry the PolQ donor sequence, suggesting that co-editing the HPRT gene and PolQ gene occurred (see, FIG. 5). Referring to FIG. 5, a gRNA targeting the PolQ gene and a homologous PolQ donor were designed and subcloned into separate plasmids. The PolQ donor carries a 148 bp insertion at the gRNA target site (thus, can no longer by cut by Cas9). The PolQ gRNA and donor plasmids were co-transfected with the pHPRTg3g4 wt-HPRThr plasmid into Cas9-expressing HPRT mutant HCT116 cells. Four days later, cells were selected with HAT for 10 days. Genomic DNA was isolated from HAT resistant cells and the PolQ target region was amplified by PCR with two primers (outside of the donor) and analyzed by agarose gel electrophoresis. The slower migrating (longer) product (lane 1; indicated by arrow) is the expected size if the PolQ target is converted to the donor with the 148 bp insertion. This result shows that a significant fraction of the HPRT edited cells (HAT resistant) are also edited at the PolQ target region.

    Example 4: Summary

    [0123] These Examples describe an efficient enrichment method for iterative gene targeting. It is based on the principle that the HPRT gene can be both selected and counter-selected. The wild type HPRT gene is first disrupted by CRISPR-induced gene targeting and the resulting mutant cells are selected with 6-TG. The mutant HPRT gene is then corrected by CRISPR-induced gene editing and the resulting cells are selected with HAT. Homologous donors and gRNA are so designed that after two rounds of disruption/correction, the HPRT gene is edited back to the original wild type sequence, so the 4-step procedure can be repeated indefinitely. It was demonstrated that each step can be used to co-target another gene of interest, thus making it possible to sequentially disrupt as many genes as cell viability permits.

    [0124] In principle, one could express multiple gRNAs to simultaneously disrupt multiple genes (multiplex CRISPR). However, the effectiveness of gRNAs can vary greatly, especially when competing for the same limited amount of Cas9. The isolation of a multi-mutant is thus far more difficult than that of a single mutant. In addition, single mutants are usually the ones first isolated and characterized. The iterative HPRT co-targeting thus provides a method complementary and often superior to multiplex CRISPR for the construction of mutants defective in multiple genes.

    [0125] HPRT co-targeting uses an internal control for the competency of individual cells to execute CRISPR. 6-TG or HAT-resistant cells usually achieve 80-100% efficiency in co-targeting the gene of interest. It can also be used to evaluate the effectiveness of gRNAs and the essentiality of a gene. If similar numbers of 6-TG or HAT resistant cells are obtained, but there is no mutation in the co-targeted gene, one can confidently conclude that the gRNA is ineffective. On the other hand, if there are no or very few 6-TG or HAT resistant cells, the co-targeted gene is most likely essential.

    [0126] The iterative HPRT co-targeting method uses only basic tissue culture setup and standard DNA transfection reagents. The method is demonstrated in HCT116 cells, but is expected to work in any cell that has a functional HPRT gene and can be selected by 6-TG and HAT.

    Sequences:

    [0127]

    TABLE-US-00004 (HPRTg3) (SEQIDNO:1) AACATACAGAGAGACTACA (HPRTg4) (SEQIDNO:2) TTAGAGAATATTTGTAGAG (HPRTg3-hr) (SEQIDNO:3) ACAAAATGTGACATATACA (HPRTg4-hr) (SEQIDNO:4) AATGGCTTATAATTGCGAG (HPRT) (SEQIDNO:5) TGGGCAACAGAGCGAGATTC (HPRT) (SEQIDNO:6) ATCAAAGTGGGAGGCCAGTG (Exo1) (SEQIDNO:7) TCCAGTTCCAGCTGCCTAGA (Exo1) (SEQIDNO:8) GTCTGCACATTCCTAGCCGA (AAVS1) (SEQIDNO:9) ACAGGAGGTGGGGGTTAGAC (AAVS1) (SEQIDNO:10) TATATTCCCAGGGCCGGTTA (Trex1) (SEQIDNO:11) GCAGACCCTCATCTTTTTCG (forHPRT) (SEQIDNO:12) GATGCTCACCTCTCCCACAC (forHPRT) (SEQIDNO:13) ACATCCATGGGACTTCTGCC (forAAVS1) (SEQIDNO:14) ACAGGAGGTGGGGGTTAGAC (forAAVS1) (SEQIDNO:15) TATATTCCCAGGGCCGGTTA (forTrex1) (SEQIDNO:16) GCAGACCCTCATCTTTTTCG (forTrex1) (SEQIDNO:17) TACTGGGCTCAGATAGTTGAC (forExo1) (SEQIDNO:18) TCCAGTTCCAGCTGCCTAGA (forExo1) (SEQIDNO:19) GTCTGCACATTCCTAGCCGA pHPRTg2(SEQIDNO:20): AAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTA AATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTAT AAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGA ACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAA AACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCA AGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAG GGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAG AAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGT GTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGC CGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAAC CCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATG AGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTC CTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGA AAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCA ATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAG AAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCC CTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTC CGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGC CTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGC CTAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGC ATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGG AGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGA TGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTC AAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGC GGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGA CGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCG GGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCA TCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTG CCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGG ATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAGGAACATCAGG GGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGA CGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATC ATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGG GTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGC TGAGGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGT ATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACG AGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACG CCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAA GGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCA GCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTA ACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGG CAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAA ACGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGA CCCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACC CCCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGC AGGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTA AAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATA ATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTC AGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTG CGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGG TTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGG CTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAG TTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTC TGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCT TACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCG GGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCT ACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCT TCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGA ACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTT ATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTG ATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCC TTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTGTGCT AGCATTCGCGAATTCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATC GGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCT GCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTT GTAAAACGACGGCCAGTTAGAACTAGTTGTACAAAAAAGCAGGCTTTAA AGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGCAGGAAGA GGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCT GTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAG TACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGT TTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGA AAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACA CCGAAGTAATTCACTTACAGTCGTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC TTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTACAATTGGA TATCACGCGT pHPRTg3g4wt-HPRThr(SEQIDNO:21) AAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTA AATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTAT AAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGA ACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAA AACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCA AGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAG GGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAG AAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGT GTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGC CGCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAAC CCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATG AGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTC CTGAGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAA AGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAA TTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGA AGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCC TAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCC GCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCC TCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCC TAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCA TGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGA GAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGAT GCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCA AGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCG GCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGG GGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCAT CATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGC CCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGA TGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAGGAACATCAGGG GCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGAC GGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCA TGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGG TGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCT GAGGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTA TCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGA GTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGC CCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAG GTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAG CGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAA CTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAA CGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGAC CCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCC CCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCA GGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAA AACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAA TCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGC GCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT TTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGC TTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGT TAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCT GCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTT ACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTA CACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTT CCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAA CAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGA TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCT TTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTGTGCTA GTTGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATC CGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCA TATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATT TGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTA ATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGAC TATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTAT ATATCTTGTGGAAAGGACGAAACACCGAACATACAGAGAGACTACAGTT TTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT GAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTG TACAAAGTTGGCATTACAATTCCATTCAGGCTGCGCAACTGTTGGGAAG GGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGG ATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCA CGACGTTGTAAAACGACGGCCAGTTAGAACTAGTTGTACAAAAAAGCAG GCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGC AGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATA CAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAG ATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGT TTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGT AACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGA CGAAACACCGTTAGAGAATATTTGTAGAGGTTTTAGAGCTAGAAATAGC AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG TCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTAC AATTGGATAATTCGAGCTCGGTACCCACATTTATCATCTGAAATAATAA TGCAACAATTATTGTATATTAAAGCTGTTCAACTATTTCAGCCAACAAG AAGTGTCACCCTAGCCTGGCCAGGTTCCAGTTCTAAGGACGTCTGTACT AGACTACAGCTTTATGTGACTAATGGGAACCATCAGTCTGTTCAAATTA TGAGGTGCTGGAAGGAGAAAACAATTCTCTTTCCTAAATTTTTATGCGT GTTTTGAAAAATGAGTGAGAAAAAGAAGCAATTACTTACATTCAAATCC CTGAAGTATTCATTATAGTCAAGGGCATATCCTACAACAAACTTGTCTG GAATTTCAAATCCAACAACTAAAAAGAATCATAATTCATCATTTAGATA AAGAAAACATCACTTTTAAATCTAATACTGGCAAATGTGCCTCTCGCAA TTATAAGCCATTTCACATAAAACTCTTTTAGGTTAAAGATGGTTAAATG ATTGACAAAAAAAGTAATTCACTTACAGTCTGGCTTATATCCAACAGAC CGCGGGGTCCTTTTCACCAGCAAGCTGTTAATTACAAAATGTGACATAT ACAGGGCATTACAAAAGAGAAGACTGACGTTTCTAAACACTGTTTCATT TCATCCGTGCTGAGTGTACCATGGTCACTTTTAACACACCCAAGGAAAG ACTATGAAATGGAGAGCTAAATTATGGGGATTACTAGGAAGGGGCAGCA ATGAGTTGACACTACAGACAAGGCACTTGGTTGATCACCTGGAACCTGA AGGACAGTTCTGAGACCTGCACCCTGACTACCCATGTGTCCATTGAAGG GGAGCTAATAAGGAGGATTAATGGGTACAGAGTGTCAATGAGCAAAGAT GAAAAGGGCTCTCAGTCTAGAAACCTTGGAAATACAATCCCTAAACTAT AAAAGGGTGTGGGAGAGGTGAGCATCACCTTTTATCACAACAGGGACCT GCAGCCATGCATGCCATGGCCACCACGCGT pHPRTg3g4hr-HPRTwt(SEQIDNO:22): AAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTA AATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTAT AAATCAAAAGAAAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAA CAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAA ACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAA GTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGG GAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGA AAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTG TAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCC GCTACAGGGCGCGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACC CCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGA GACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTCC TGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTAGGGTGTGGAA AGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAA TTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGA AGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCC TAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCC GCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCC TCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCC TAGGCTTTTGCAAAGATCGATCAAGAGACAGGATGAGGATCGTTTCGCA TGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGA GAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGAT GCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCA AGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCG GCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGAC GTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGG GGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCAT CATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGC CCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGA TGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAGGAACATCAGGG GCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGAC GGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCA TGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGG TGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCT GAGGAACTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTA TCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGA GTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGC CCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAG GTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAG CGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCTAGGGGGAGGCTAA CTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGC AATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTTGTTCATAAA CGCGGGGTTCGGTCCCAGGGCTGGCACTCTGTCGATACCCCACCGAGAC CCCATTGGGGCCAATACGCCCGCGTTTCTTCCTTTTCCCCACCCCACCC CCCAAGTTCGGGTGAAGGCCCAGGGCTCGCAGCCAACGTCGGGGCGGCA GGCCCTGCCATAGCCTCAGGTTACTCATATATACTTTAGATTGATTTAA AACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAA TCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCA GACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGC GCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGT TTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGC TTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGTAGT TAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCT GCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTT ACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGG GCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTA CACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTT CCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAA CAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTA TAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGA TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCT TTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTGTGCTA GTTGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATC CGGTACCAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCA TATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATT TGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTA ATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGAC TATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTAT ATATCTTGTGGAAAGGACGAAACACCGACAAAATGTGACATATACAGTT TTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT GAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCTAGACCCAGCTTTCTTG TACAAAGTTGGCATTACAATTCCATTCAGGCTGCGCAACTGTTGGGAAG GGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGG ATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCA CGACGTTGTAAAACGACGGCCAGTTAGAACTAGTTGTACAAAAAAGCAG GCTTTAAAGGAACCAATTCAGTCGACTGGATCCGGTACCAAGGTCGGGC AGGAAGAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATA CAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAG ATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGT TTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGT AACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGA CGAAACACCGAATGGCTTATAATTGCGAGGTTTTAGAGCTAGAAATAGC AAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAG TCGGTGCTTTTTTTCTAGACCCAGCTTTCTTGTACAAAGTTGGCATTAC AATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGATGCTCACCTCTC CCACACCCTTTTATAGTTTAGGGATTGTATTTCCAAGGTTTCTAGACTG AGAGCCCTTTTCATCTTTGCTCATTGACACTCTGTACCCATTAATCCTC CTTATTAGCTCCCCTTCAATGGACACATGGGTAGTCAGGGTGCAGGTCT CAGAACTGTCCTTCAGGTTCCAGGTGATCAACCAAGTGCCTTGTCTGTA GTGTCAACTCATTGCTGCCCCTTCCTAGTAATCCCCATAATTTAGCTCT CCATTTCATAGTCTTTCCTTGGGTGTGTTAAAAGTGACCATGGTACACT CAGCACGGATGAAATGAAACAGTGTTTAGAAACGTCAGTCTTCTCTTTT GTAATGCCCTGTAGTCTCTCTGTATGTTATATGTCACATTTTGTAATTA ACAGCTTGCTGGTGAAAAGGACCCCACGAAGTGTTGGATATAAGCCAGA CTGTAAGTGAATTACTTTTTTTGTCAATCATTTAACCATCTTTAACCTA AAAGAGTTTTATGTGAAATGGCTTATAATTGCTTAGAGAATATTTGTAG AGAGGCACATTTGCCAGTATTAGATTTAAAAGTGATGTTTTCTTTATCT AAATGATGAATTATGATTCTTTTTAGTTGTTGGATTTGAAATTCCAGAC AAGTTTGTTGTAGGATATGCCCTTGACTATAATGAATACTTCAGGGATT TGAATGTAAGTAATTGCTTCTTTTTCTCACTCATTTTTCAAAACACGCA TAAAAATTTAGGAAAGAGAATTGTTTTCTCCTTCCAGCACCTCATAATT TGAACAGACTGATGGTTCCCATTAGTCACATAAAGCTGTAGTCTAGTAC AGACGTCCTTAGAACTGGAACCTGGCCAGGCTAGGGTGACACTTCTTGT TGGCTGAAATAGTTGAACAGCTTTAATATACAATAATTGTTGCATTATT ATTTCAGATGATAAATGTGGTCATAAGTAAGAAATAAATGATCGAGTTT AGTCTTTTAATTCACTGTCCTTTGAATACCTGCCTCTTACTCTGGAGGC AGAAGTCCCATGGATGTGACCTGCAGCCATGCATGCCATGGCCACCACG CGT HPRT-hrtemplate(SEQIDNO:23): GGTACCCACATTTATCATCTGAAATAATAATGCAACAATTATTGTATAT TAAAGCTGTTCAACTATTTCAGCCAACAAGAAGTGTCACCCTAGCCTGG CCAGGTTCCAGTTCTAAGGACGTCTGTACTAGACTACAGCTTTATGTGA CTAATGGGAACCATCAGTCTGTTCAAATTATGAGGTGCTGGAAGGAGAA AACAATTCTCTTTCCTAAATTTTTATGCGTGTTTTGAAAAATGAGTGAG AAAAAGAAGCAATTACTTACATTCAAATCCCTGAAGTATTCATTATAGT CAAGGGCATATCCTACAACAAACTTGTCTGGAATTTCAAATCCAACAAC TAAAAAGAATCATAATTCATCATTTAGATAAAGAAAACATCACTTTTAA ATCTAATACTGGCAAATGTGCCTCTCGCAATTATAAGCCATTTCACATA AAACTCTTTTAGGTTAAAGATGGTTAAATGATTGACAAAAAAAGTAATT CACTTACAGTCTGGCTTATATCCAACAGACCGCGGGGTCCTTTTCACCA GCAAGCTGTTAATTACAAAATGTGACATATACAGGGCATTACAAAAGAG AAGACTGACGTTTCTAAACACTGTTTCATTTCATCCGTGCTGAGTGTAC CATGGTCACTTTTAACACACCCAAGGAAAGACTATGAAATGGAGAGCTA AATTATGGGGATTACTAGGAAGGGGCAGCAATGAGTTGACACTACAGAC AAGGCACTTGGTTGATCACCTGGAACCTGAAGGACAGTTCTGAGACCTG CACCCTGACTACCCATGTGTCCATTGAAGGGGAGCTAATAAGGAGGATT AATGGGTACAGAGTGTCAATGAGCAAAGATGAAAAGGGCTCTCAGTCTA GAAACCTTGGAAATACAATCCCTAAACTATAAAAGGGTGTGGGAGAGGT GAGCATCACCTTTTATCACAACAGG HPRT-wttemplate(SEQIDNO:24): GATGCTCACCTCTCCCACACCCTTTTATAGTTTAGGGATTGTATTTCCA AGGTTTCTAGACTGAGAGCCCTTTTCATCTTTGCTCATTGACACTCTGT ACCCATTAATCCTCCTTATTAGCTCCCCTTCAATGGACACATGGGTAGT CAGGGTGCAGGTCTCAGAACTGTCCTTCAGGTTCCAGGTGATCAACCAA GTGCCTTGTCTGTAGTGTCAACTCATTGCTGCCCCTTCCTAGTAATCCC CATAATTTAGCTCTCCATTTCATAGTCTTTCCTTGGGTGTGTTAAAAGT GACCATGGTACACTCAGCACGGATGAAATGAAACAGTGTTTAGAAACGT CAGTCTTCTCTTTTGTAATGCCCTGTAGTCTCTCTGTATGTTATATGTC ACATTTTGTAATTAACAGCTTGCTGGTGAAAAGGACCCCACGAAGTGTT GGATATAAGCCAGACTGTAAGTGAATTACTTTTTTTGTCAATCATTTAA CCATCTTTAACCTAAAAGAGTTTTATGTGAAATGGCTTATAATTGCTTA GAGAATATTTGTAGAGAGGCACATTTGCCAGTATTAGATTTAAAAGTGA TGTTTTCTTTATCTAAATGATGAATTATGATTCTTTTTAGTTGTTGGAT TTGAAATTCCAGACAAGTTTGTTGTAGGATATGCCCTTGACTATAATGA ATACTTCAGGGATTTGAATGTAAGTAATTGCTTCTTTTTCTCACTCATT TTTCAAAACACGCATAAAAATTTAGGAAAGAGAATTGTTTTCTCCTTCC AGCACCTCATAATTTGAACAGACTGATGGTTCCCATTAGTCACATAAAG CTGTAGTCTAGTACAGACGTCCTTAGAACTGGAACCTGGCCAGGCTAGG GTGACACTTCTTGTTGGCTGAAATAGTTGAACAGCTTTAATATACAATA ATTGTTGCATTATTATTTCAGATGATAAATGTGGTCATAAGTAAGAAAT AAATGATCGAGTTTAGTCTTTTAATTCACTGTCCTTTGAATACCTGCCT CTTACTCTGGAGGCAGAAGTCCCATGGATGT HPRTgRNAg2(SEQIDNO:25): AAGTAATTCACTTACAGTC

    [0128] The present disclosure is not limited to the embodiments described and exemplified above, but is capable of variation and modification within the scope of the appended claims.