Modified algae strain and method of triacylglycerol accumulation using said strain
09938545 ยท 2018-04-10
Assignee
- Fermentalg (Libourne, FR)
- CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE(C.N.R.S) (Paris, FR)
- Commissariat A L'energie Atomique Et Aux Energies Alternatives (Paris, FR)
Inventors
Cpc classification
C12P7/6463
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
C12Y203/01051
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a genetically engineered algae strain in which the expression of the CGI-58 gene or homologous gene thereof is silenced. The present invention further relates to a method of triacylglycerol accumulation using said genetically engineered diatom and/or diatom strain.
Claims
1. A genetically engineered strain of Phaeodactylum tricornutum, in which the activity of the comparative gene identification 58 (CGI-58) protein has been modified in order to permit the accumulation of oil in the strain, advantageously accumulation of triacylglycerol, wherein the activity of the CGI-58 is modified by silencing or attenuating the expression of the CGI-58 gene.
2. A genetically engineered strain according to claim 1, which accumulates or contains at least 1.5-fold the triacylglycerol content of the corresponding wild type strain.
3. A genetically engineered strain according to claim 2, which accumulates or contains at least 4 fold the triacylglycerol content of the corresponding wild type strain.
4. A method of preparation of a genetically engineered strain of Phaeodactylum tricornutum as described in claim 1, comprising transforming said strain with a vector expressing RNAi construction designed to target the expression of the CGI-58 gene.
5. The method according to claim 4, wherein the vector is introduced in the strain by particle bombardment or electroporation.
6. A method for increasing accumulation of triacylglycerol in a strain of Phaeodactylum tricornutum, comprising the step of altering or silencing the expression of the CGI-58 gene in said organism.
Description
(1) More details and specificities of the invention would appear in the following examples and figures.
(2)
(3)
(4) pH4: H4 promoter;
(5) AS: antisense fragment corresponding to CGI-58;
(6) Ter: Terminator sequence.
(7)
(8) WT: P. tricornutum wild type.
(9) (+N): nitrogen-rich culture medium
(10) (N): nitrogen starved culture medium.
(11)
(12)
(13)
EXAMPLE 1: TRANSFORMATION OF P. TRICORNUTUM BY SILENCING THE CGI-58 GENE EXPRESSION AND ACCUMULATION OF OIL
(14) 1. Material and Methods
(15) Phaeodactylum tricornutum Strain and Growth Conditions.
(16) Phaeodactylum tricornutum (Pt1) Bohlin Strain 8.6 CCMP2561 (Culture Collection of Marine Phytoplankton, now known as NCMA: National Center for Marine Algae and Microbiota) was used in all experiments (Berges J A et al., 2001, J Phycol 37:1138-1145), Pt1 was grown at 20 C. in 250 mL flask using enriched artificial seawater (ESAW) medium. Cells were grown on a 12:12 light (450 E.sup.1 sec.sup.1)/dark cycle. Cells were sub-cultured every week by inoculate fresh media with 1/5 of previous culture. Nitrogen-starved N() medium contained no source of nitrogen. Nitrogen-replete N(+), medium contained 0.05 g/L NaNO.sub.3.
(17) Genetic Construction for CGI-58 Silencing.
(18) Genomic DNA was extracted from Phaeodactylum tricornutum Pt1 strain using the following procedure: 100 mg fresh Pt cells were flash frozen in liquid nitrogen and homogenized in 400 l of extraction buffer (Tris-HCl 200 mM, pH 7.5; NaCl 250 mM; EDTA 25 mM; SDS 0.5%, w/v). After a 5 minutes centrifugation at 10,000g, the supernatant was transferred to the same volume of isopropanol to precipitate DNA. After an additional 15 minutes centrifugation at 10,000g, the pellet was washed with ethanol 70%, dried and solubilized in water. DNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific), and quality was checked by electrophoresis on agarose gel. Using genomic DNA as matrix, a 436-pb sequence was amplified by polymerase chain reaction (PCR) with the following primers designed from XM_002183547 (Pt CGI.58 homolog), and carrying respectively EcoRI and XbaI restriction sites (underlined sequence): Pt.CGI-58.AS.F TCGAATTCTTGCAGGGTCGTCTGATGTA (SEQ ID NO:1), Pt.CGI-58.AS.R CTAGATCTAGATGGCCCGACTTACTCACT (SEQ ID NO:2). PCR was performed with a S1000 Thermal Cycler (Bio-rad laboratory inc.) using Phusion High Fidelity polymerase (Thermo Scientific) according to the manufacturer's instructions. PCR product was digested by EcoR I and Xba I, purified and cloned in the linearized expression vector.
(19) The expression vector used for silencing was generated from the anti-sense vector hla (name in the princeps publication of De Riso and collaborator: h stands for promoter H4, l for long fragment of this promoter and a for antisense developed previously (De Riso V et al, 2009, Nucleic Acids Res 37:e96), and harbouring a -Glucuronidase (GUS) reporter sequence.
(20) The GUS 250 pb fragment was excised from hla with EcoR I and Xba I. Ligation mixture of linear excised hla vector and 436 pb CGI-38 anti-sense fragment was then transformed into DH5 Escherichia coli. Positive colonies were identified by PCR, and products were subsequently sequenced.
(21) First Method for Transformation: Biolistic Transformation
(22) Vectors were introduced into P. tricornutum by micro-particle bombardment using a Biolistic PDS-1000/He Particle Delivery System (Bio-Rad, Hercules, Calif., USA), as previously described (Falciatore A et al., 1999, Mar Biotechnol (NY) 1:239-251), fitted with 1,550 psi rupture discs. Tungsten particles (M-17) were coated with 1 g of plasmid DNA, previously linearized by Pvu II, in the presence of CaCl.sub.2 and spermidine. One hour prior to bombardment, approximately 5.10.sup.7 cells were spread in the center of a plate containing 20 ml of solid culture medium (ESAW medium, agar 1%). The plates were positioned at the second level within the biolistic chamber for bombardment. Bombarded cells were then allowed to recover for 48 h before being suspended in 1 mL of ESAW medium. 500 l of this suspension were plated onto a solid medium containing 75 g/mL zeocin. After two to four weeks of incubation in white light (175 mol m.sup.2.Math.s.sup.1; 12 h photoperiod) at 20 C., individual resistant colonies were collected and streaked on fresh ESAW agar plates supplemented with zeocin 75 g.Math.mL.sup.1 and inoculated into liquid ESAW medium for further analyses. Presence of the transgene in Phaeodactylum tricornutum was eventually validated by PCR amplification using genomic DNA of resistant colonies.
(23) Second Method of Transformation: Electroporation
(24) Vectors were introduced into P. tricornutum by electroporation with multiple pulses, following the method described by Miyahara et al (2013) Biosci. Biotechnol. Biochem, 77:120936-1-3. Other electroporation methods with multiple pulses can be used.
(25) Nile Red Staining of Oil Droplets
(26) Accumulation of oil droplets was monitored by Nile Red (Sigma Aldrich) fluorescent staining (Excitation wavelength at 485 nm; emission at 525 nm) as previously described (Cooksey K E et al, 1987, J. Microbiol. Meth. 6:333-345). In brief, cells were diluted and adjusted to a cell density that was linearly correlated with Nile Red fluorescence. Nile Red solution (40 l of 2.5 g/mL stock concentration, in 100% DMSO) was added to 160 l cell suspension. Specific fluorescence was determined by dividing Nile Red fluorescence intensity by the number of cells. Oil bodies stained with Nile Red were then visualized using a Zeiss AxioScope.A1 microscope (FITC filter; Excitation wavelength at 488 nm; emission at 519 nm).
(27) Triacylglycerol (TAG) Extraction, Separation by Thin Layer Chromatography, Quantification and Analysis.
(28) Triacylglycerol were extracted from 200 mg of freeze-dried Phaeodactylum tricornutum cells, according to Domergue F et al., 2003, Plant Physiol 131:1648-1660, in order to prevent lipid degradation. Briefly, cells were frozen in liquid nitrogen immediately after harvest. The freeze-dried cell pellet was resuspended in 4 mL of boiling ethanol for 5 minutes followed by the addition of 2 mL of methanol and 8 mL of chloroform at room temperature. The mixture was then saturated with argon and stirred for 1 h at room temperature. After filtration through glass wool, cell remains were rinsed with 3 mL of chloroform/methanol 2:1, v/v. In order to initiate biphase formation, 5 mL of NaCl 1% was then added to the filtrate. The chloroform phase was dried under argon before re-solubilization of the lipid extract in pure chloroform. To isolate TAG, lipids were run on silica gel thin layer chromatography (TLC) plates (Merck) with hexane:diethylether:acetic acid (70:30:1, v/v). Lipids were then visualized under UV light after pulverization of 8-anilino-1-naphthalenesulfonic acid at 2% in methanol. They were then scraped off from the TLC plates for further analyses. For acyl profiling and quantification of TAG, fatty acids were methylated using 3 mL of 2.5% H.sub.2SO.sub.4 in methanol during 1 h at 100 C. (including standard amounts of 21:0). The reaction was stopped by the addition of 3 mL of water and 3 mL of hexane. The hexane phase was analyzed by gas liquid chromatography (Perkin Elmer) on a BPX70 (SGE) column. Methylated fatty acids were identified by comparison of their retention times with those of standards and quantified by surface peak method using 21:0 for calibration. Extraction and quantification were done at least 3 times.
(29) 2. Results
(30) Generation of Phaeodactylum Tricornutum Expressing a CGI-38 Anti-Sense Construction.
(31) Only one single gene coding for a CGI-58 homolog (genbank XM_002183547; Phatrdraft 54974) was predicted in the P. tricornutum genome by conventional BlastP similarity search (Altschul S F et al., 1990, Journal of Molecular Biology 215:403-410). To drive Phatrdraft 54974 silencing, a vector whose expression was under control of the H4 promoter was constructed (De Riso V et al, 2009, Nucleic Acids Res 37:e96). The expression vector used for silencing was generated from the anti-sense vector hla (name in the princeps publication of De Riso and collaborator: h stands for promoter H4, l for long fragment of this promoter and a for antisense developed previously (De Riso V et al, 2009, Nucleic Acids Res 37:e96). This hla vector has been modified so as to remove the antisense fragment it initially contained corresponding to a GUS fragment, and introduce an antisense fragment corresponding to CGI-58. The targeted region for silencing corresponded to the end portion of the Phatrdraft 54974/CGI-58 sequence (
(32) Following Phaeodactylum transformation using a particle gun or electroporation, transformed cells were selected under zeocine selection pressure and putative silenced clones were selected. The knockdown of the endogenous CGI-58 gene was then controlled by quantitative RT-PCR using primers corresponding to a full length transcription.
(33) In the absence of specific antibodies, the actual level of CGI-58 level could not be assessed. Nevertheless, a simple cell-based assay allows the functional analysis of CGI-58 in the catabolism of oil bodies. Transformed cells were thus screened using a Nile Red assay, directly monitoring the accumulation of oil within cells in nitrogen-rich (+N) or starved (N) media (
(34) Following P. tricornutum transformation with CGI-58 antisense construct, cells were grown for 5 days, and then freshly sub-cultured in a medium containing nitrogen or missing this nutrient. Cells were analyzed after 2 days growth in ESAW medium, with or without nitrogen. Nile Red (NR) fluorescence was measured using a fluorimeter, and was expressed per 10.sup.6 cells. The initial vector expressing a GUS anti-sense (hla) was used as a vector control and showed no difference with WT. WT, untransformed wild type cells.
(35) We compared the growth of untransformed and transformed cells, monitored in parallel in ESAW medium. As shown in
(36) We then analyzed the phenotype of cells and oil droplets in both untransformed and transformed cells. As shown in