Immunogenic tumor associated stromal cell antigen peptides and methods of their use
09937250 · 2018-04-10
Assignee
Inventors
- Walter J. Storkus (Pittsburgh, PA)
- Anamika Bose (Kolkata, IN)
- Jennifer Lynn Taylor (McDonald, PA)
- Xi Zhao (Pittsburgh, PA)
- Devin B. Lowe (Pittsburgh, PA)
Cpc classification
A61K45/06
HUMAN NECESSITIES
C12N5/0638
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K31/506
HUMAN NECESSITIES
A61K2239/38
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
Abstract
Immunogenic peptides from tumor associated stromal cell antigens, including combinations of such peptides, are disclosed herein. In some examples the peptides are useful for methods of eliciting an immune response. In additional examples the peptides are useful for methods of treating cancer. Methods for decreasing vascularization of a tumor using a Protein Delta Homolog 1 (DLK1) protein or a nucleic acid encoding the protein are also disclosed.
Claims
1. A method for eliciting an immune response to a tumor in a subject, comprising administering to a subject a therapeutically effective amount of a composition comprising a plurality of polypeptides, wherein each polypeptide in the plurality is at most twelve amino acids in length, wherein the plurality of polypeptides comprises: (a) a Protein Delta Homolog 1 (DLK1) polypeptide comprising the amino acid sequence set forth as ILGVLTSLV (SEQ ID NO: 2) (b) a Neuropilin 1 (NRP1) polypeptide comprising the amino acid sequence set forth as GX.sub.4LGMVSGL (SEQ ID NO: 7), wherein X.sub.4 is a leucine (L) or a methionine (M); (c) a Tumor Endothelial Marker 1 (TEM1) polypeptide comprising the amino acid sequence set forth as LLVPTCVFXSV (SEQ ID NO: 9), wherein X.sub.5 is a leucine (L) or a valine (V); (d) an Ephrin Type A receptor 2 (EphA2) polypeptide comprising the amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10); (e) a Hemogolobin Subunit B (HBB) polypeptide comprising the amino acid sequence set forth as RLLVVYPWX.sub.3 (SEQ ID NO: 4), wherein X.sub.3 is a threonine (T) or a valine (V); and (f) a Regulator of G-Protein Signaling 5 (RGS5) polypeptide comprising the amino acid sequence set forth as LX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is a leucine (L) or an alanine (A), thereby eliciting the immune response to the tumor in the subject, wherein the tumor expresses DLK1, NRP, TEM1, EphA2, HBB, and RGS5.
2. The method of claim 1, further comprising administering to the subject a therapeutically effective amount of dasatinib, bevacizumab, sunitinib, axitinib, an HSP90 inhibitor, or gemcitabine/fludarabine.
3. The method of claim 1, wherein the immune response decreases growth of the tumor in the subject.
4. The method of claim 1, wherein the immune response decreases vascularization of the tumor.
5. The method of claim 1, wherein the tumor is a melanoma.
6. The method of claim 5, wherein the melanoma is a superficial spreading melanoma, a nodular melanoma, an acral lentiginous melanoma, a lentigo maligna, a clear cell sarcoma, a mucosal melanoma or a uveal melanoma.
7. The method of claim 5, wherein the plurality of polypeptides comprises: (a) a Protein Delta Homolog 1 (DLK1) polypeptide comprising the amino acid sequence set forth as ILGVLTSLV (SEQ ID NO: 2) (b) a Neuropilin 1 (NRP1) polypeptide comprising the amino acid sequence set forth as GX.sub.4LGMVSGL (SEQ ID NO: 7), wherein X.sub.4 is a methionine (M); and (c) a Tumor Endothelial Marker 1 (TEM1) polypeptide comprising the amino acid sequence set forth as LLVPTCVFX.sub.5V (SEQ ID NO: 9), wherein X.sub.5 is a leucine (L); (d) an Ephrin Type A receptor 2 (EphA2) polypeptide comprising the amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10); (e) a Hemoglobin Subunit B (HBB) polypeptide comprising the amino acid sequence set forth as RLLVVYPWX.sub.3 (SEQ ID NO: 4), wherein X.sub.3 is a threonine (T); and (f) a Regulator of G-Protein Signaling 5 (RGS5) polypeptide comprising the amino acid sequence set forth as aLX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is an alanine (A).
8. The method of claim 7, further comprising administering to the subject a therapeutically effective amount of dasatinib.
9. The method of claim 1, wherein the tumor is a colorectal cancer.
10. The method of claim 1, wherein the plurality of polypeptides comprises: (a) a Protein Delta Homolog 1 (DLK1) polypeptide comprising the amino acid sequence set forth as ILGVLTSLV (SEQ ID NO: 2); (b) a Neuropilin 1 (NRP1) polypeptide comprising the amino acid sequence set forth as GX.sub.4LGMVSGL (SEQ ID NO: 7), wherein X.sub.4 is a methionine (M); (c) a Tumor Endothelial Marker 1 (TEM1) polypeptide comprising the amino acid sequence set forth as LLVPTCVFX.sub.5V (SEQ ID NO: 9), wherein X.sub.5 is a leucine (L); (d) an Ephrin Type A receptor 2 (EphA2) polypeptide comprising the amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10); (e) a Hemogolobin Subunit B (HBB) polypeptide comprising the amino acid sequence set forth as RLLVVYPWX.sub.3 (SEQ ID NO: 4), wherein X.sub.3 is a threonine (T); and (f) a Regulator of G-Protein Signaling 5 (RGS5) polypeptide comprising the amino acid sequence set forth as aLX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is an alanine (A).
11. The method of claim 10, wherein the tumor is a melanoma, and wherein the method further comprises administering to the subject a therapeutically effective amount of dasatinib.
12. The method of claim 1, wherein the tumor is a melanoma, lung cancer or a breast cancer.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
SEQUENCE LISTING
(25) The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file in the form of the file named 8123-87855-04_Sequence_Listing.txt (106 kb), which was created on Apr. 19, 2016, which is incorporated by reference herein. In the accompanying sequence listing:
(26) SEQ ID NO: 1 is an exemplary amino acid sequence of an immunogenic DLK1 polypeptide.
(27) SEQ ID NO: 2 is an exemplary amino acid sequence of an immunogenic DLK1 polypeptide.
(28) SEQ ID NO: 3 is an exemplary amino acid sequence of an immunogenic DLK1 polypeptide.
(29) SEQ ID NO: 4 is an exemplary amino acid sequence of an immunogenic HBB polypeptide.
(30) SEQ ID NO: 5 is an exemplary amino acid sequence of an immunogenic HBB polypeptide.
(31) SEQ ID NO: 6 is an exemplary amino acid sequence of an immunogenic NRP1 polypeptide.
(32) SEQ ID NO: 7 is an exemplary amino acid sequence of an immunogenic NRP1 polypeptide.
(33) SEQ ID NO: 8 is an exemplary amino acid sequence of an immunogenic NRP1 polypeptide.
(34) SEQ ID NO: 9 is an exemplary amino acid sequence of an immunogenic TEM1 polypeptide.
(35) SEQ ID NO: 10 is an exemplary amino acid sequence of an immunogenic EphA2 polypeptide.
(36) SEQ ID NO: 11 is an exemplary amino acid sequence of an immunogenic RGS5 polypeptide.
(37) SEQ ID NO: 12 is an exemplary amino acid sequence of an immunogenic PDGFR? polypeptide.
(38) SEQ ID NO: 13 is an exemplary amino acid sequence of an immunogenic NG2 polypeptide.
(39) SEQ ID NO: 14 is an exemplary amino acid sequence of an immunogenic NG2 polypeptide.
(40) SEQ ID NO: 15 is an exemplary amino acid sequence of an immunogenic NRP2 polypeptide.
(41) SEQ ID NO: 16 is an exemplary amino acid sequence of an immunogenic NRP2 polypeptide.
(42) SEQ ID NO: 17 is an exemplary amino acid sequence of an immunogenic NRP2 polypeptide.
(43) SEQ ID NO: 18 is an exemplary amino acid sequence of an immunogenic PSMA polypeptide.
(44) SEQ ID NO: 19 is an exemplary amino acid sequence of an immunogenic VEGFR1 polypeptide.
(45) SEQ ID NO: 20 is an exemplary amino acid sequence of an immunogenic VEGFR2 polypeptide.
(46) SEQ ID NO: 21 is an exemplary amino acid sequence of DLK1.
(47) SEQ ID NO: 22 is an exemplary amino acid sequence of HBB.
(48) SEQ ID NO: 23 is an exemplary amino acid sequence of NRP1.
(49) SEQ ID NO: 24 is an exemplary amino acid sequence of TEM1.
(50) SEQ ID NO: 25 is an exemplary amino acid sequence of EphA2.
(51) SEQ ID NO: 26 is an exemplary amino acid sequence of RGS5.
(52) SEQ ID NO: 27 is an exemplary amino acid sequence of PDGFR?.
(53) SEQ ID NO: 28 is an exemplary amino acid sequence of NG2.
(54) SEQ ID NO: 29 is an exemplary amino acid sequence of NRP2.
(55) SEQ ID NO: 30 is an exemplary amino acid sequence of PSMA.
(56) SEQ ID NO: 31 is an exemplary amino acid sequence of VEGFR1.
(57) SEQ ID NO: 32 is an exemplary amino acid sequence of VEGFR2.
(58) SEQ ID NO: 33-64 are the nucleic acid sequences of primers.
(59) SEQ ID NO: 65 is the amino acid sequence of DLK1.sub.158-166.
(60) SEQ ID NO: 66 is the amino acid sequence of DLK1.sub.161-169.
(61) SEQ ID NO: 67 is the amino acid sequence of DLK1.sub.259-270 and DLK1.sub.262-270.
(62) SEQ ID NOs: 68-83 are peptide sequences.
DETAILED DESCRIPTION
Terms
(63) Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
(64) In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided, along with particular examples:
(65) Adjuvant: A vehicle used to enhance antigenicity. Adjuvants include a suspension of minerals (alum, aluminum hydroxide, or phosphate) on which antigen is adsorbed; or water-in-oil emulsion in which antigen solution is emulsified in mineral oil (Freund incomplete adjuvant), sometimes with the inclusion of killed mycobacteria (Freund's complete adjuvant) to further enhance antigenicity (inhibits degradation of antigen and/or causes influx of macrophages). Immunstimulatory oligonucleotides (such as those including a CpG motif) can also be used as adjuvants (for example see U.S. Pat. No. 6,194,388; U.S. Pat. No. 6,207,646; U.S. Pat. No. 6,214,806; U.S. Pat. No. 6,218,371; U.S. Pat. No. 6,239,116; U.S. Pat. No. 6,339,068; U.S. Pat. No. 6,406,705; and U.S. Pat. No. 6,429,199). Adjuvants include biological molecules (a biological adjuvant), such as costimulatory molecules.
(66) Administration: To provide or give a subject an agent, for example, a composition that includes a immunogenic TASA peptide, by any effective route. Exemplary routes of administration include, but are not limited to, oral, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous) and transdermal (e.g., topical).
(67) Agent: Any substance or any combination of substances that is useful for achieving an end or result; for example, a substance or combination of substances useful for decreasing or reducing a tumor in a subject. In some embodiments, the agent is a chemotherapeutic agent, toxin or anti-angiogenic agent. The skilled artisan will understand that particular agents may be useful to achieve more than one result.
(68) Angiogenesis: A biological process leading to the generation of new blood vessels through sprouting or growth from pre-existing blood vessels. The process involves the migration and proliferation of endothelial cells from preexisting vessels. Angiogenesis occurs during pre- and post-natal development, and in the adult. Angiogenesis occurs during the normal cycle of the female reproductive system, wound healing, and during pathological processes such as cancer, where it is essential for the growth of solid tumors (for review, see Battegay, J. Molec. Med., 73(7): 333-346, 1995; Shchors and Evan, Cancer Res., 67:1630-1633. 2007).
(69) Anti-angiogenic agent: A molecule that decreases or reduces angiogenesis, for example, a molecule that decreases pathological angiogenesis. Additional anti-angiogenic agents include, but are not limited to, vascular endothelial growth factor receptor 2 (VEGFR2) antibodies such as bevacizumab, as well as small molecule tyrosine kinase inhibitors, such as sunitinib. See also, Liu et al., Seminars in Oncology, 29(11): 96-103, 2002; Shepherd et al., Lung Cancer 34:S81-S89, 2001).
(70) Antigen: A compound, composition, or substance that can stimulate the production of antibodies or a T cell response in an animal, including compositions that are injected or absorbed into an animal. An antigen reacts with the products of specific humoral or cellular immunity, including those induced by heterologous immunogens. The term antigen includes all related antigenic epitopes. Epitope or antigenic determinant refers to a site on an antigen to which B and/or T cells respond. In one embodiment, T cells respond to the epitope, when the epitope is presented in conjunction with an MHC molecule. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, at least 5, at least 9, at least 10, at least 11, at least 12, or about 9-12 amino acids in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance.
(71) An antigen can be a tissue-specific antigen, or a disease-specific antigen. These terms are not exclusive, as a tissue-specific antigen can also be a disease specific antigen. A tissue-specific antigen is expressed in a limited number of tissues, such as a single tissue. Specific, non-limiting examples of a tissue specific antigen are a prostate specific antigen, a uterine specific antigen, and/or a testes specific antigen. A tissue specific antigen may be expressed by more than one tissue, such as, but not limited to, an antigen that is expressed in more than one reproductive tissue, such as in both prostate and uterine tissue. A disease-specific antigen is expressed coincidentally with a disease process. Specific non-limiting examples of a disease-specific antigen are an antigen whose expression correlates with, or is predictive of, tumor formation, such as prostate cancer and/or uterine cancer and/or testicular cancer. A disease-specific antigen can be an antigen recognized by T cells or B cells.
(72) Cancer, Tumor or Neoplasia: A neoplasm is an abnormal growth of tissue or cells that results from excessive cell division. Neoplastic growth can produce a tumor. The amount of a tumor in an individual is the tumor burden which can be measured as the number, volume, or weight of the tumor. A tumor that does not metastasize is referred to as benign. A tumor that invades the surrounding tissue and/or can metastasize is referred to as malignant.
(73) Tumors of the same tissue type are primary tumors originating in a particular organ (such as colon or skin). Tumors of the same tissue type may be divided into tumors of different sub-types.
(74) Examples of solid tumors, such as sarcomas (connective tissue cancer) and carcinomas (epithelial cell cancer), include fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colorectal carcinoma, lymphoid malignancy, pancreatic cancer, breast cancer, lung cancers, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytomas sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder carcinoma, and CNS tumors (such as a glioma, astrocytoma, medulloblastoma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma and retinoblastoma).
(75) cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences that determine transcription. cDNA is synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.
(76) CD4: Cluster of differentiation factor 4, a T cell surface protein that mediates interaction with the MHC Class II molecule. CD4 also serves as the primary receptor site for HIV on T cells during HIV infection. Cells that express CD4 are often helper T cells.
(77) CD8: Cluster of differentiation factor 8, a T cell surface protein that mediates interaction with the MHC Class I molecule. Cells that express CD8 are often cytotoxic T cells.
(78) Chemotherapeutic agent: Any chemical agent with therapeutic usefulness in the treatment of diseases characterized by abnormal cell growth. For example, chemotherapeutic agents are useful for the treatment of cancer, including colorectal and skin cancer. In one embodiment, a chemotherapeutic agent is a radioactive compound. In particular examples, such chemotherapeutic agents are administered in combination with a treatment that decreases or reduces a tumor or angiogenesis (for example before, during or after administration of a therapeutically effective amount of one or more immunogenic TASA peptides or a composition including a plurality of immunogenic polypeptides). One of skill in the art can readily identify a chemotherapeutic agent of use (see for example, Slapak and Kufe, Principles of Cancer Therapy, Chapter 86 in Harrison's Principles of Internal Medicine, 14th edition; Perry et al., Chemotherapy, Ch. 17 in Abeloff, Clinical Oncology 2.sup.nd ed., ? 2000 Churchill Livingstone, Inc; Baltzer, L., Berkery, R. (eds): Oncology Pocket Guide to Chemotherapy, 2nd ed. St. Louis, Mosby-Year Book, 1995; Fischer, D. S., Knobf, M. F., Durivage, H. J. (eds): The Cancer Chemotherapy Handbook, 4th ed. St. Louis, Mosby-Year Book, 1993; Chabner and Longo, Cancer Chemotherapy and Biotherapy: Principles and Practice (4th ed.). Philadelphia: Lippincott Willians & Wilkins, 2005; Skeel, Handbook of Cancer Chemotherapy (6th ed.). Lippincott Williams & Wilkins, 2003). Combination chemotherapy is the administration of more than one agent to treat cancer.
(79) Colorectal cancer: A neoplastic tumor of colon, rectum or anus tissue that is or has the potential to be malignant. The main types of colorectal cancer include colorectal carcinomas such as adenocarcinoma and squamous cell carcinoma. Infiltrating (malignant) carcinoma of the colon can be divided into stages (I, II, III and IV). See, e.g., Blake et al. (eds.), Gastrointestinal Oncology: A practical Guide, Berlin: Springer-Verlag, 2011.
(80) Consists Of: With regard to a polypeptide, a polypeptide that consists of a specified amino acid sequence does not include any additional amino acid residues, nor does it include additional non-peptide components, such as lipids, sugars or labels.
(81) Conservative variants: Conservative amino acid substitutions are those substitutions that do not substantially affect or decrease an activity or antigenicity of an antigenic epitope of DLK1. Specific, non-limiting examples of a conservative substitution include the following examples:
(82) TABLE-US-00001 Original Residue Conservative Substitutions Al Ser Arg Lys Asn Gln, His Asp Glu Cys Ser Gln Asn Glu Asp His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln; Glu Met Leu; Ile Phe Met; Leu; Tyr Ser Thr Thr Ser Trp Tyr Tyr Trp; Phe Val Ile; Leu
The term conservative variant also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid, provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide, and/or that the substituted polypeptide retains the function of the unsubstituted polypeptide. Non-conservative substitutions are those that reduce an activity or antigenicity.
(83) Contacting: Placement in direct physical association, for example solid, liquid or gaseous forms. Contacting includes, for example, direct physical association of fully- and partially-solvated molecules.
(84) Costimulatory molecule: Although engagement of the T-cell receptor with peptide-MHC delivers one signal to the T cell, this signal alone can be insufficient to activate the T cell. Costimulatory molecules are molecules that, when bound to their ligand, deliver a second signal enhancing activation of the T cell. The most well-known costimulatory molecule on the T cell is CD28, which binds to either B7-1 (also called CD80) or B7-2 (also known as CD86). An additional costimulatory molecule is B7-3. Accessory molecules that also provide a second signal for the activation of T cells include intracellular adhesion molecule (ICAM-1 and ICAM-2), leukocyte function associated antigen (LFA-1, LFA-2 and LFA-3). Integrins and tumor necrosis factor (TNF) superfamily members can also serve as co-stimulatory molecules.
(85) Decrease or Reduce: To reduce the quality, amount, or strength of something; for example a reduction in tumor burden. In one example, a therapy reduces a tumor (such as the size of a tumor, the number of tumors, the metastasis of a tumor, or combinations thereof), or one or more symptoms associated with a tumor, for example as compared to the response in the absence of the therapy. In a particular example, a therapy decreases the size of a tumor, the number of tumors, the metastasis of a tumor, or combinations thereof, subsequent to the therapy, such as a decrease of at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Such decreases can be measured using the methods disclosed herein.
(86) Degenerate variant: A polynucleotide encoding a immunogenic TASA peptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in this disclosure as long as the amino acid sequence of the immunogenic TASA peptide encoded by the nucleotide sequence is unchanged.
(87) Dendritic cell (DC): Dendritic cells are the principle antigen presenting cells (APCs) involved in primary immune responses. Dendritic cells include plasmacytoid dendritic cells and myeloid dendritic cells. Their major function is to obtain antigen in tissues, migrate to lymphoid organs and present the antigen in order to activate T cells. Immature dendritic cells originate in the bone marrow and reside in the periphery as immature cells.
(88) Effective amount: The amount of an agent (such as a immunogenic TASA peptide or a composition comprising a plurality of immunogenic polypeptides) that alone, or together with one or more additional agents, induces the desired response, such as, for example induction of an immune response to a TASA.
(89) Epitope: An antigenic determinant. These are particular chemical groups or peptide sequences on a molecule that are antigenic (that elicit a specific immune response). An antibody specifically binds a particular antigenic epitope on a polypeptide. Epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5, about 9, or 8 to 10 amino acids in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, Glenn E. Morris, Ed (1996). In one embodiment, an epitope binds an MHC molecule, such an HLA molecule or a DR molecule. These molecules bind polypeptides having the correct anchor amino acids separated by about eight to about ten amino acids, such as nine amino acids.
(90) Host cells: Cells in which a vector can be propagated and its DNA expressed. The cell may be prokaryotic or eukaryotic. The cell can be mammalian, such as a human cell. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term host cell is used.
(91) Immune response: A response of a cell of the immune system, such as a B cell, T cell, or monocyte, to a stimulus. In one embodiment, the response is specific for a particular antigen (an antigen-specific response). In one embodiment, an immune response is a T cell response, such as a CD4+ response or a CD8+ response. In another embodiment, the response is a B cell response, and results in the production of specific antibodies.
(92) Immunogenic composition: A composition comprising an immunogenic TASA peptide or a plurality of immunogenic TASA peptides, or one or more polynucleotides encoding the immunogenic TASA peptide or plurality of immunogenic TASA peptides that induces a measurable CTL response against cells expressing the corresponding TASA, or induces a measurable B cell response (such as production of antibodies that specifically bind the corresponding TASA) against a TASA peptide. For in vitro use, the immunogenic composition can consist of the isolated nucleic acid, vector including the nucleic acid/or immunogenic peptide. For in vivo use, the immunogenic composition will typically comprise the nucleic acid, vector including the nucleic acid, and or immunogenic polypeptide, in pharmaceutically acceptable carriers, and/or other agents. An immunogenic composition can optionally include an adjuvant.
(93) Immunogenic TASA peptide: A peptide which comprises an allele-specific motif or other sequence of a tumor associated stromal cell antigen, such that the peptide will bind an MHC molecule and induce a cytotoxic T lymphocyte (CTL) response, or a B cell response (e.g. antibody production) against the antigen from which the immunogenic peptide is derived.
(94) In one example, an immunogenic TASA peptide is a series of contiguous amino acid residues from a TASA generally between 7 and 20 amino acids in length, such as about 8 to 11 residues in length. Specific immunogenic TASA peptides are disclosed herein that are 9 or 10 amino acid residues in length, or at most 12 amino acids in length, such as 8-15 amino acids in length. Generally, immunogenic TASA peptides can be used to induce an immune response in a subject, such as a B cell response or a T cell response. In one example, an immunogenic TASA peptide, when bound to a Major Histocompatibility Complex Class I molecule, activates cytotoxic T lymphocytes (CTLs) against cells expressing the corresponding wild-type TASA protein. Induction of CTLs using synthetic peptides and CTL cytotoxicity assays known in the art, see U.S. Pat. No. 5,662,907, which is incorporated herein by reference. In one example, an immunogenic peptide includes an allele-specific motif or other sequence such that the peptide will bind an MHC molecule and induce a cytotoxic T lymphocyte (CTL) response against the antigen from which the immunogenic peptide is derived.
(95) Isolated: A biological component (such as a nucleic acid, peptide, protein or protein complex) that has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Thus, isolated nucleic acids, peptides and proteins include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell, as well as, chemically synthesized nucleic acids. A isolated nucleic acid, peptide or protein, for example a polypeptide, can be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure. The epitopes of TASA disclosed herein can be isolated (and/or synthesized) by any means known in the art (see, e.g., Guide to Protein Purification, ed. Deutscher, Meth. Enzymol. 185, Academic Press, San Diego, 1990; and Scopes, Protein Purification: Principles and Practice, Springer Verlag, New York, 1982).
(96) Linker: The terms conjugating, joining, bonding, labeling or linking refer to making two molecules into one contiguous molecule; for example, linking two polypeptides into one contiguous polypeptide, or covalently attaching an effector molecule or detectable marker radionuclide or other molecule to a polypeptide. The linkage can be either by chemical or recombinant means. Chemical means refers to a reaction between the antibody moiety and the effector molecule such that there is a covalent bond formed between the two molecules to form one molecule.
(97) In some embodiments, a linker is an amino acid sequence that covalently links two polypeptide domains. For example, such linkers can be included in the between the immunogenic TASA epitopes disclosed herein to provide rotational freedom to the linked polypeptide domains and thereby to promote proper domain folding and presentation to a MHC. By way of example, in a recombinant polypeptide comprising two immunogenic TASA peptide domains, linker sequences can be provided between them, such as a polypeptide comprising immunogenic TASA peptide-linker-immunogenic TASA peptide. Linker sequences, which are generally between 2 and 25 amino acids in length, are well known in the art and include, but are not limited to, the glycine(4)-serine spacer (GGGGS?3) described by Chaudhary et al., Nature 339:394-397, 1989.
(98) Lymphocytes: A type of white blood cell that is involved in the immune defenses of the body. There are two main types of lymphocytes: B cells and T cells.
(99) Major Histocompatibility Complex (MHC): A generic designation meant to encompass the histocompatability antigen systems described in different species, including the human leukocyte antigens (HLA).
(100) Open reading frame (ORF): A series of nucleotide triplets (codons) coding for amino acids without any internal termination codons. These sequences are usually translatable into a peptide.
(101) Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence, such as a sequence that encodes an immunogenic TASA peptide. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
(102) Pathological angiogenesis: Angiogenesis that is medically undesired or harmful to a subject, such as angiogenesis associated with a tumor or the generation of blood vessels in or surrounding a tumor. Other examples of pathological angiogenesis include corneal or retinal angiogenesis (as in a corneal transplant or the retina of a subject with macular degeneration or diabetes).
(103) Peptide Modifications: Immunogenic TASA peptides include synthetic embodiments of peptides described herein. In addition, analogs (non-peptide organic molecules), derivatives (chemically functionalized peptide molecules obtained starting with the disclosed peptide sequences) and variants (homologs) of these peptides can be utilized in the methods described herein. Each peptide of this disclosure is comprised of a sequence of amino acids, which may be either L- and/or D-amino acids, naturally occurring and otherwise.
(104) Peptides can be modified by a variety of chemical techniques to produce derivatives having essentially the same activity as the unmodified peptides, and optionally having other desirable properties. For example, carboxylic acid groups of the protein, whether carboxyl-terminal or side chain, can be provided in the form of a salt of a pharmaceutically-acceptable cation or esterified to form a C.sub.1-C.sub.16 ester, or converted to an amide of formula NR.sub.1R.sub.2 wherein R.sub.1 and R.sub.2 are each independently H or C.sub.1-C.sub.16 alkyl, or combined to form a heterocyclic ring, such as a 5- or 6-membered ring. Amino groups of the peptide, whether amino-terminal or side chain, can be in the form of a pharmaceutically-acceptable acid addition salt, such as the HCl, HBr, acetic, benzoic, toluene sulfonic, maleic, tartaric and other organic salts, or can be modified to C.sub.1-C.sub.16 alkyl or dialkyl amino or further converted to an amide.
(105) Hydroxyl groups of the peptide side chains may be converted to C.sub.1-C.sub.16 alkoxy or to a C.sub.1-C.sub.16 ester using well-recognized techniques. Phenyl and phenolic rings of the peptide side chains may be substituted with one or more halogen atoms, such as fluorine, chlorine, bromine or iodine, or with C.sub.1-C.sub.16 alkyl, C.sub.1-C.sub.16 alkoxy, carboxylic acids and esters thereof, or amides of such carboxylic acids. Methylene groups of the peptide side chains can be extended to homologous C.sub.2-C.sub.4 alkylenes. Thiols can be protected with any one of a number of well-recognized protecting groups, such as acetamide groups. Those skilled in the art will also recognize methods for introducing cyclic structures into the peptides of this invention to select and provide conformational constraints to the structure that result in enhanced stability.
(106) Peptidomimetic and organomimetic embodiments are envisioned, whereby the three-dimensional arrangement of the chemical constituents of such peptido- and organomimetics mimic the three-dimensional arrangement of the peptide backbone and component amino acid side chains, resulting in such peptido- and organomimetics of an immunogenic TASA peptide having measurable or enhanced ability to generate an immune response. For computer modeling applications, a pharmacophore is an idealized three-dimensional definition of the structural requirements for biological activity. Peptido- and organomimetics can be designed to fit each pharmacophore with current computer modeling software (using computer assisted drug design or CADD). See Walters, Computer-Assisted Modeling of Drugs, in Klegerman & Groves, eds., 1993, Pharmaceutical Biotechnology, Interpharm Press: Buffalo Grove, Ill., pp. 165-174 and Principles of Pharmacology, Munson (ed.) 1995, Ch. 102, for descriptions of techniques used in CADD. Also included are mimetics prepared using such techniques.
(107) Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers provided herein are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed.
(108) In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually include injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
(109) Polynucleotide: The term polynucleotide or nucleic acid sequence refers to a polymeric form of nucleotide at least 10 bases in length. A recombinant polynucleotide includes a polynucleotide that is not immediately contiguous with both of the coding sequences with which it is immediately contiguous (one on the 5 end and one on the 3 end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences. The nucleotides can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. The term includes single- and double-stranded forms of DNA.
(110) Polypeptide or Peptide: A polymer in which the monomers are amino acid residues that are joined together through amide bonds. The amino acids included in a polypeptide may be subject to post-translational modification (e.g., glycosylation or phosphorylation). A polypeptide or peptide can be between 3 and 30 amino acids in length. In one embodiment, a polypeptide or peptide is from 8 to 12 amino acids in length. In several embodiments, a polypeptide or peptide is at most 12 amino acids in length, for example, 9, 10, 11 or 12 amino acids in length. In some embodiments, a protein is at least 100 amino acids in length, for example, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, or at least 500 amino acids in length.
(111) Plurality: Two or more of a molecule, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or more of a molecule.
(112) Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. In one embodiment, a promoter includes an enhancer. In another embodiment, a promoter includes a repressor element. In these embodiments, a chimeric promoter is created (a promoter/enhancer chimera or a promoter/repressor chimera, respectively). Enhancer and repressor elements can be located adjacent to, or distal to the promoter, and can be located as much as several thousand base pairs from the start site of transcription. Examples of promoters include, but are not limited to the SV40 promoter, the CMV enhancer-promoter, and the CMV enhancer/?-actin promoter. Both constitutive and inducible promoters are included (see e.g., Bitter et al., Methods in Enzymology 153:516-544, 1987). Also included are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5 or 3 regions of the gene. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide for transcription of the nucleic acid sequences.
(113) Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques.
(114) Sequence identity: The similarity between amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity is frequently measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs or variants of an immunogenic TASA peptide or DLK1 will possess a relatively high degree of sequence identity when aligned using standard methods.
(115) Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith and Waterman, Adv. Appl. Math. 2:482, 1981; Needleman and Wunsch, J. Mol. Biol. 48:443, 1970; Higgins and Sharp, Gene 73:237, 1988; Higgins and Sharp, CABIOS 5:151, 1989; Corpet et al., Nucleic Acids Research 16:10881, 1988; and Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988. Altschul et al., Nature Genet. 6:119, 1994, presents a detailed consideration of sequence alignment methods and homology calculations.
(116) The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, Md.) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
(117) Homologs and variants of an immunogenic TASA peptide or DLK1 are typically characterized by possession of at least 75%, for example at least 80%, sequence identity counted over the full length alignment with the amino acid sequence of the immunogenic TASA peptide using the NCBI Blast 2.0, gapped blastp set to default parameters. For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity. When less than the entire sequence is being compared for sequence identity, homologs and variants will typically possess at least 80% sequence identity over short windows of 10-20 amino acids, and can possess sequence identities of at least 85% or at least 90% or 95% depending on their similarity to the reference sequence. Methods for determining sequence identity over such short windows are available at the NCBI website on the internet. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is entirely possible that strongly significant homologs could be obtained that fall outside of the ranges provided.
(118) Skin cancer: A neoplastic tumor of skin tissue that is or has the potential to be malignant. Melanoma is a skin cancer of transformed melanocytes (cells that make the pigment melanin). Melanocytes are found primary in the skin, but are also present in the bowel and eye. Melanoma in the skin includes superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma, and lentigo maligna (melanoma). Any of the above types may produce melanin or can be amelanotic. Similarly, any subtype may show desmoplasia (dense fibrous reaction with neurotropism), which is a marker of aggressive behavior and a tendency for local recurrence. Other melanomas include clear cell sarcoma, mucosal melanoma and uveal melanoma. Melanoma is staged from I to IV. See, e.g., Thompson et al. (eds), Textbook of Melanoma: Pathology, Diagnosis and Management, London: Taylor & Francis, 2004.
(119) Stromal cells: Cells forming the connective tissue of any organ. Examples of stromal cells include fibroblasts (such as myofibroblasts), leukocytes, pericytes (such as vascular pericytes) and endothelial cells (such as vascular endothelial cells).
(120) Subject: Any mammal, such as humans, non-human primates, pigs, sheep, cows, rodents and the like. In two non-limiting examples, a subject is a human subject or a murine subject. Thus, the term subject includes both human and veterinary subjects.
(121) T Cell: A white blood cell critical to the immune response. T cells include, but are not limited to, CD4.sup.+ T cells and CD8.sup.+ T cells. A CD4.sup.+ T lymphocyte is an immune cell that carries a marker on its surface known as cluster of differentiation 4 (CD4). These cells, also known as helper T cells, help orchestrate the immune response, including antibody responses as well as killer T cell responses. CD8.sup.+ T cells carry the cluster of differentiation 8 (CD8) marker. In one embodiment, a CD8 T cell is a cytotoxic T lymphocyte. In another embodiment, a CD8 cell is a suppressor T cell.
(122) Tumor Associated Microenvironment (TME): A tumor and the area immediately surrounding a tumor, including, for example, blood vessels intersecting or contacting the tumor.
(123) Tumor Associated Stromal Cell: A stromal cell included in a tumor or the tumor microenvironment. For example, vascular endothelial cells (VECs) and pericytes included in blood vessels intersecting or contacting tumor.
(124) Tumor Associated Stromal Cell Antigen (TASA): An antigenic molecule expressed by a tumor associated stromal cell. Examples of TASA include Protein Delta Homolog 1 (DLK1; SEQ ID NO: 21), Hemoglobin Subunit Beta (HBB; SEQ ID NO: 22), Neuropilin 1 (NRP1; SEQ ID NO: 23), Tumor Endothelial Marker 1 (TEM1; SEQ ID NO: 24), Ephrin Type A Receptor 2 (EphA2; SEQ ID NO: 25), Regulator of G-Protein Signaling 5 (RGS5; SEQ ID NO: 26), Platelet Derived Growth Factor Receptor ? (PDGFR?; SEQ ID NO: 27), melanoma chondroitin sulfate proteoglycan (NG2; SEQ ID NO: 28), Neuropilin 2 (NRP2; SEQ ID NO: 29), Glutamate Carboxypeptidase 2, (PSMA; SEQ ID NO: 30), Vascular Endothelial Growth Factor 1 (VEGFR1; SEQ ID NO: 31), Vascular Endothelial Growth Factor Receptor 2 (VEGFR2; SEQ ID NO: 32). (See, e.g., Komita et al., Cancer Res., 68: 8076-8084, 2008; Hatano et al., J. Transl. Med., 2: 40, 2004; Maciag et al., Cancer Res., 68: 8066-8075, 2008; Ishizaki et al., Clin. Cancer Res., 12: 5841-5849, 2006; Wada et al., Cancer Res., 65: 4939-4946, 2005; Kaplan et al., Vaccine, 24: 6994-7002, 2006; Liu et al., Cytokine, 32: 206-212, 2005; Silver et al., Clin. Cancer Res., 3: 81-85, 1997; Harada et al., Oncol. Rep., 12: 601-607, 2004; Bondjers et al., Am. J. Pathol., 162: 721-729, 2003; Boss et al., Clin. Cancer Res., 13: 3347-3355, 2007; Christian et al., Am. J. Pathol., 172: 486-494, 2008. Several embodiments include an immunogenic peptide from a TASA. In some embodiments, a plurality of immunogenic peptides from one or more TASA is provided in a composition.
(125) Tumor burden: The total volume, number, metastasis, or combinations thereof of tumor or tumors in a subject.
(126) Therapeutically effective amount: The amount of an agent (such as immunogenic TASA peptide, a DLK1 protein, a nucleic acid encoding the TASA peptide, a nucleic acid encoding DLK1 protein, or a composition including a plurality of immunogenic TASA peptides) that alone, or together with one or more additional agents, induces the desired response, such as, for example, induction of an immune response and/or treatment of a tumor in a subject. Ideally, a therapeutically effective amount provides a therapeutic effect without causing a substantial cytotoxic effect in the subject.
(127) In one example, a desired response is to decrease the size, volume, or number (such as metastases) of a tumor in a subject. For example, the agent or agents can decrease the size, volume, or number of tumors by a desired amount, for example by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 50%, at least 75%, at least 90%, or at least 95% as compared to a response in the absence of the agent.
(128) Several preparations disclosed herein are administered in therapeutically effective amounts. A therapeutically effective amount of an immunogenic TASA peptide, a DLK1 protein, a nucleic acid encoding the TASA peptide, a nucleic acid encoding DLK1 protein, or composition including a plurality of immunogenic TASA peptides that is administered to a human or veterinary subject will vary depending upon a number of factors associated with that subject, for example the overall health of the subject. A therapeutically effective amount of the immunogenic TASA peptide, a DLK1 protein, a nucleic acid encoding the TASA peptide, a nucleic acid encoding DLK1 protein, or composition including a plurality of immunogenic polypeptides can be determined by varying the dosage and measuring the resulting therapeutic response, such as the regression of a tumor. Therapeutically effective amounts also can be determined through various in vitro, in vivo or in situ immunoassays. The disclosed agents can be administered in a single dose, or in several doses, as needed to obtain the desired response. However, the therapeutically effective amount can be dependent on the source applied, the subject being treated, the severity and type of the condition being treated, and the manner of administration.
(129) Treating or Treatment: A therapeutic intervention (e.g., administration of a therapeutically effective amount of an immunogenic TASA peptide or composition including a plurality of immunogenic polypeptides) that ameliorates a sign or symptom of a disease or pathological condition related to a disease (such as a tumor). Treatment can also induce remission or cure of a condition, such as a tumor. In particular examples, treatment includes preventing a tumor, for example by inhibiting the full development of a tumor, such as preventing development of a metastasis or the development of a primary tumor. Prevention does not require a total absence of a tumor.
(130) Reducing a sign or symptom associated with a tumor can be evidenced, for example, by a delayed onset of clinical symptoms of the disease in a susceptible subject (such as a subject having a tumor which has not yet metastasized), a reduction in severity of some or all clinical symptoms of the disease, a slower progression of the disease (for example by prolonging the life of a subject having tumor), a reduction in the number of relapses of the disease, an improvement in the overall health or well-being of the subject, or by other parameters well known in the art that are specific to the particular tumor.
(131) Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector may also include one or more selectable marker gene and other genetic elements known in the art. Vectors include plasmid vectors, including plasmids for expression in gram negative and gram positive bacterial cell. Exemplary vectors include those for expression in E. coli. Vectors also include viral vectors, such as, but are not limited to, retroviral, pox, adenoviral, herpes virus, alpha virus, baculovirus, Sindbis virus, vaccinia virus and poliovirus vectors.
(132) Under conditions sufficient for: A phrase that is used to describe any environment that permits a desired activity. In one example the desired activity is formation of an immune complex. In particular examples the desired activity is treatment of a tumor.
(133) Vascularization: The amount and type of blood vessels in a tissue or a cancer. Vascularization can be measured by a variety of methods, including histological methods. Tumor blood vessels have perivascular detachment, vessel dilation, and irregular shape. It is believed tumor blood vessels are not smooth like normal tissues, and are not ordered sufficiently to give oxygen to all of the tissues. If vascularization is normalized it is returned to a form in a normal (wildtype, not affected by disease), so that it is more ordered and reduced.
(134) Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The term comprises means includes. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Immunogenic TASA Peptides
(135) Isolated polypeptides disclosed herein that include at most twelve amino acids from a tumor associated stromal cell antigen, such as Protein Delta Homolog 1 (DLK1; SEQ ID NO: 21), Hemoglobin Subunit Beta (HBB; SEQ ID NO: 22), Neuropilin 1 (NRP1; SEQ ID NO: 23), Tumor Endothelial Marker 1 (TEM1; SEQ ID NO: 24), Ephrin Type A Receptor 2 (EphA2; SEQ ID NO: 25), Regulator of G-Protein Signaling 5 (RGS5; SEQ ID NO: 26), Platelet Derived Growth Factor Receptor ? (PDGFR?; SEQ ID NO: 27), melanoma chondroitin sulfate proteoglycan (NG2; SEQ ID NO: 28), Neuropilin 2 (NRP2; SEQ ID NO: 29), Glutamate Carboxypeptidase 2, (PSMA; SEQ ID NO: 30), Vascular Endothelial Growth Factor 1 (VEGFR1; SEQ ID NO: 31), Vascular Endothelial Growth Factor Receptor 2 (VEGFR2; SEQ ID NO: 32). These polypeptides include an antigenic determinant from a TASA and are immunogenic, and thus can be used to induce an immune response in a subject.
(136) The isolated TASA peptides, can be chemically synthesized by standard methods. If desired, polypeptides can also be chemically synthesized by emerging technologies. One such process is described in W. Lu et al., Federation of European Biochemical Societies Letters. 429:31-35, 1998. Polypeptides can also be produced using molecular genetic techniques, such as by inserting a nucleic acid encoding a TASA peptide or an epitope thereof into an expression vector, introducing the expression vector into a host cell, and isolating the polypeptide (see below).
(137) The immunogenic TASA peptides include at most twelve amino acids, such as nine, ten, eleven or twelve consecutive amino acids of a TASA. For example, in some embodiments, the immunogenic TASA peptides includes at most twelve amino acids, at most eleven amino acids, at most ten amino acids or at most nine amino acids, wherein the polypeptide includes an amino acid sequence as shown in Table 1. In other embodiments, an immunogenic TASA peptide comprises or consists of DLK1.sub.158-166 (CPPGFSGNF, SEQ ID NO: 65), DLK1.sub.161-169 (GFSGNFCEI, SEQ ID NO: 66), or at least 9, 10, 11 or 12 amino acids of DLK1.sub.259-270 and/or DLK1.sub.262-270 (TILGVLTSLVVL, SEQ ID NO: 67 includes both of these epitopes). These immunogenic DLK1 peptides can be used individually. However, a combination of two or more of these DLK1 peptides can be utilized. In additional embodiments, the immunogenic TASA peptides includes at most twelve amino acids, at most eleven amino acids, at most ten amino acids or at most nine amino acids of an amino acid sequence as shown in Table 1. These TASA peptides can be used individually or in combination.
(138) In several embodiments, the amino acid at position 2 of the immunogenic TASA peptide is substituted for a valine residue. In additional embodiments, the amino acid at position 9 of the immunogenic TASA peptide is substituted for a leucine residue.
(139) TABLE-US-00002 TABLE1 ImmunogenicTASAPeptides. TASA Accession AA SEQID Protein No.* TASAPeptide Positions NO. DLK1 NP_003827.3 RLTPGVHEX.sub.1wherein 269-277 1 X.sub.1isaleucineor avaline ILGVLTSLV 310-318 2 FLNKCETWV 326-334 3 HBB CAG46711.1 RLLVVYPWX.sub.2wherein 31-39 4 X.sub.2isathreonine oravaline RLLGNVLVX.sub.3Vwherein 105-114 5 X.sub.3isacysteineor avaline NRP1 CAI16997.1 GLLRFVTAV 331-339 6 GX.sub.4LGMVSGLwherein 433-441 7 X.sub.4isaleucineor amethionine VLLGAVCGV 869-877 8 TEM1 AAG00867.1 LLVPTCVFX.sub.5Vwherein 691-700 9 X.sub.5isaleucineor avaline EphA2 NP_004422.2 TLADFDPRV 883-891 10 RGS5 AAB84001.1 LX.sub.6ALPHSCLwherein 5-13 11 X.sub.6isaleucineor analanine PDGFR? AAA60049.1 ILLWEIFTX.sub.7wherein 890-898 12 X.sub.7isLorV NG2 AAQ62842 X.sub.8LSNLSFPVwherein 770-778 13 X.sub.8isIorT LILPLLFYL 2238-2246 14 NRP2 NP_957718.1 DIWDGIPHV 214-222 15 YLQVDLRFL 328-336 16 NMLGMLSGL 436-444 17 PSMA NP_004467.1 LLQERGVAYI 441-450 18 VEGFR1 NP_002010.2 TLFWLLLTL 770-778 19 VEGFR2 NP_002244.1 VIAMFFWLL 773-781 20 *Accession No. NP_003827.3 incorporated by reference herein as of Sep. 11, 2011; Accession No. CAG46711.1 incorporated by reference herein as of Oct. 16, 2008; Accession No. CAI16997.1 incorporated by reference herein as of Jan. 13, 2009; Accession No. AAG00867.1 incorporated by reference herein as of Aug. 23, 2000; Accession No. NP_004422.2 incorporated by reference herein as of Aug. 13, 2011; Accession No. AAB84001.1 incorporated by reference herein as of Nov. 8, 1997; Accession No. AAA60049.1 incorporated by reference herein as of Jan. 7, 1995; Accession No. NP_957718.1 incorporated by reference herein as of Aug. 21, 2011; Accession No. NP_004467.1 incorporated by reference herein as of Sep. 24, 2011; Accession No. NP_002010.2 incorporated by reference herein as of Sep. 25, 2011; Accession No. NP_002244.1 incorporated by reference herein as of Sep. 25, 2011.
(140) Without being bound by theory, it is believed that the presentation of peptides by MHC Class I molecules involves binding to the cleft in an MHC Class I molecule through the anchor residues of the peptide and ultimate presentation on the cell surface. Depending upon the particular anchor residues, among other things, certain peptides can bind more tightly to particular HLA molecules than others. Peptides that bind well are usually dominant epitopes, while those that bind less well are often subdominant or cryptic epitopes. Dominant epitopes of either self proteins or foreign proteins evoke strong tolerance or immune responses. Subdominant or cryptic epitopes generate weak responses or no responses at all. Without being bound by theory, tighter binding by dominant epitopes to HLA molecules results in their denser presentation on the cell surface, greater opportunity to react with immune cells and greater likelihood of eliciting an immune response or tolerance. MHC Class I molecules present epitopes from endogenous proteins for presentation to CTL cells. HLA A, HLA B and HLA C molecules bind peptides of about eight to ten amino acids in length (such as nine amino acids in length) that have particular anchoring residues. The anchoring residues recognized by an HLA Class I molecule depend upon the particular allelic form of the HLA molecule. A CD8+ T cell bears T cell receptors that recognize a specific epitope when presented by a particular HLA molecule on a cell. When a CTL precursor that has been stimulated by an antigen presenting cell to become a cytotoxic T lymphocyte contacts a cell that bears such an HLA-peptide complex, the CTL forms a conjugate with the cell and destroys it. In several examples presented herein, the immunogenic TASA peptides that are disclosed bind and are presented by HLA-A2.
(141) Thus, in some examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from DLK1, wherein the polypeptide includes an amino acid sequence set forth as RLTPGVHEX.sub.1 (SEQ ID NO: 1) wherein X.sub.1 is a leucine (L) or a valine (V). In some embodiments amino acid X.sub.1 is a leucine (L). In other embodiments, amino acid X.sub.1 is a valine (V). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 1. Thus, in one example, the polypeptide consists of SEQ ID NO: 1, wherein amino acid X.sub.1 is a valine (V). In another example the polypeptide consists of SEQ ID NO: 1, wherein amino acid X.sub.1 is a leucine (L).
(142) In other examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from DLK1, wherein the polypeptide includes an amino acid sequence set forth as ILGVLTSLV (SEQ ID NO: 2). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 2.
(143) In additional examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from DLK1, wherein the polypeptide includes an amino acid sequence set forth as FLNKCETWV (SEQ ID NO: 3). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 3.
(144) In yet other examples, an isolated polypeptide that includes an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from DLK1, wherein the polypeptide includes one of SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67. In several examples, the polypeptide consists of the amino acid sequence set forth as one of SEQ ID NO: 65, SEQ ID NO: 66 or SEQ ID NO: 67.
(145) In further examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from HBB, wherein the polypeptide includes an amino acid sequence set forth as RLLVVYPWX.sub.2 (SEQ ID NO: 4) wherein X.sub.2 is a threonine (T) or a valine (V). In further embodiments amino acid X.sub.2 is a threonine (T). In other embodiments, amino acid X.sub.2 is a valine (V). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 4. Thus, in one example, the polypeptide consists of SEQ ID NO: 4, wherein amino acid X.sub.2 is a valine (V), and in another example the polypeptide consists of SEQ ID NO: 4, wherein amino acid X.sub.2 is a threonine (T).
(146) In still other examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from HBB, wherein the polypeptide includes an amino acid sequence set forth as RLLGNVLVX.sub.3V (SEQ ID NO: 5) wherein X.sub.3 is a cysteine (C) or a valine (V). In additional embodiments amino acid X.sub.3 is a cysteine (C). In other embodiments, amino acid X.sub.3 is a valine (V). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 5. Thus, in one example, the polypeptide consists of SEQ ID NO: 5, wherein amino acid X.sub.3 is a valine (V), and in another example the polypeptide consists of SEQ ID NO: 5, wherein amino acid X.sub.3 is a cysteine (C).
(147) In some examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from NRP1, wherein the polypeptide includes an amino acid sequence set forth as GLLRFVTAV (SEQ ID NO: 6). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 6.
(148) In additional examples, an isolated polypeptide includes at 9, 10, 11 or 12 twelve amino acids from NRP1, wherein the polypeptide includes an amino acid sequence set forth as GX.sub.4LGMVSGL (SEQ ID NO: 7) wherein X.sub.4 is a leucine (L) or a methionine (M). In still other embodiments, amino acid X.sub.4 is a leucine (L). In other embodiments, amino acid X.sub.4 is a methionine (M). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 7. Thus, in one example, the polypeptide consists of SEQ ID NO: 7, wherein amino acid X.sub.4 is a methionine (M), and in another example the polypeptide consists of SEQ ID NO: 7, wherein amino acid X.sub.4 is a leucine (L).
(149) In further examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from NRP1, wherein the polypeptide includes an amino acid sequence set forth as VLLGAVCGV (SEQ ID NO: 8). In one example the polypeptide consists essentially of the amino acid sequence set forth as SEQ ID NO: 8. In additional examples, the polypeptide is eleven amino acids in length, ten amino acids in length or nine amino acids in length. In further examples, the isolated polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 8.
(150) In other examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from TEM1, wherein the polypeptide includes an amino acid sequence set forth as LLVPTCVFX.sub.5V (SEQ ID NO: 9) wherein X.sub.5 is a leucine (L) or a valine (V). In some embodiments, amino acid X.sub.5 is a leucine (L). In other embodiments, amino acid X.sub.5 is a valine (V). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 9. Thus, in one example, the polypeptide consists of SEQ ID NO: 9, wherein amino acid X.sub.5 is a valine (V), and in another example the polypeptide consists of SEQ ID NO: 9, wherein amino acid X.sub.5 is a leucine (L).
(151) In additional examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from EphA2, wherein the polypeptide includes an amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 10.
(152) In some examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from RGS5, wherein the polypeptide includes an amino acid sequence set forth as LX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is a leucine (L) or an alanine (A). In further embodiments, amino acid X.sub.6 is a leucine (L). In other embodiments, amino acid X.sub.6 is an alanine (A). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 11. Thus, in one example, the polypeptide consists of SEQ ID NO: 11, wherein amino acid X.sub.6 is an alanine (A), and in another example the polypeptide consists of SEQ ID NO: 11, wherein amino acid X.sub.6 is a leucine (L).
(153) In other examples, an isolated polypeptide includes at most 9, 10, 11 or 12 amino acids from PDGFR?, wherein the polypeptide includes an amino acid sequence set forth as ILLWEIFTX.sub.7 (SEQ ID NO: 12) wherein X.sub.7 is a leucine (L) or a valine (V). In some embodiments, amino acid X.sub.7 is a leucine (L). In other embodiments, amino acid X.sub.7 is a valine (V). In one example the polypeptide consists of the amino acid sequence set forth as SEQ ID NO: 12. Thus, in one example, the polypeptide consists of SEQ ID NO: 12, wherein amino acid X.sub.7 is a valine (V), and in another example the polypeptide consists of SEQ ID NO: 12, wherein amino acid X.sub.7 is a leucine (L).
(154) TABLE-US-00003 TABLEA Thefollowinglists certainTASApeptides: TASA TASA SEQ Protein Peptide IDNO DLK1 RLTPGVHEL 68 RLTPGVHEV 69 ILGVLTSLV 2 FLNKCETWV 3 HBB RLLVVYPWT 70 RLLVVYPWV 71 RLLGNVLVCV 72 RLLGNVLVVV 73 NRP1 GLLRFVTAV 6 GLLGMVSGL 74 GMLGMVSGL 75 VLLGAVCGV 8 TEM1 LLVPTCVFLV 76 LLVPTCVFVV 77 EphA2 TLADFDPRV 10 RGS5 LLALPHSCL 78 LAALPHSCL 79 PDGFR? ILLWEIFTV 80 ILLWEIFTL 81 NG2 ILSNLSFPV 82 TLSNLSFPV 83 LILPLLFYL 14 NRP2 DIWDGIPHV 15 YLQVDLRFL 16 NMLGMLSGL 17 PSMA LLQERGVAYI 18 VEGFR1 TLFWLLLTL 19 VEGFR2 VIAMFFWLL 20
(155) In several embodiments, an immunogenic TASA peptide is included in a fusion protein. For example, each of the immunogenic TASA peptides included in a composition including a plurality of immunogenic TASA peptides (described herein) can be in the form of a fusion protein. Thus, the fusion protein can include an immunogenic TASA peptide and a second heterologous moiety, such as a myc protein, an enzyme or a carrier (such as a hepatitis carrier protein or bovine serum albumin) covalently linked to the immunogenic TASA peptide. A second heterologous moiety can be covalently or non-covalently linked to the immunogenic TASA peptide.
(156) In additional embodiments, the immunogenic TASA peptides can be included in a fusion protein and can also include heterologous sequences. Thus, in several specific non-limiting examples, one or more of the immunogenic TASA peptides are included in a fusion polypeptide, for example a fusion of an immunogenic TASA peptide with six sequential histidine residues, a ?-galactosidase amino acid sequence, or an immunoglobulin amino acid sequence. The immunogenic TASA peptides can also be covalently linked to a carrier. Suitable carriers include, but are not limited to, a hepatitis B small envelope protein HBsAg. This protein has the capacity to self assemble into aggregates and can form viral-like particles. The preparation of HBsAg is well documented, see for example European Patent Application Publication No. EP-A-0 226 846, European Patent Application Publication No. EP-A-0 299 108 and PCT Publication No. WO 01/117554, and the amino acid sequence disclosed, for example, in Tiollais et al., Nature, 317: 489, 1985, and European Patent Publication No. EP-A-0 278 940, and PCT Publication No. WO 91/14703, all of which are incorporated herein by reference.
(157) The fusion polypeptide can optionally include repetitions of one or more of any of the immunogenic TASA peptides disclosed herein. In one specific, non-limiting example, the fusion polypeptide includes two, three, four, five, or up to ten repetitions of an immunogenic TASA peptide. In another example, the fusion polypeptide can optionally include two or more different immunogenic TASA peptides disclosed herein, for example an immunogenic DLK1 peptide and an immunogenic TEM1 peptide. In one specific, non-limiting example, the fusion polypeptide includes two, three, four, five, or up to ten different immunogenic TASA peptides. A linker sequence can optionally be included between the immunogenic TASA peptides. In all of these examples, the polypeptide does not include the full-length TASA amino acid sequence.
(158) In some embodiments, two or more different immunogenic TASA peptides can be included on a polypeptide, such as an immunogenic molecule. For example, 2-20 or more different immunogenic TASA peptides can be included in the polypeptide, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more different immunogenic TASA peptides. The different immunogenic TASA peptides can be separated by peptide linkers. In some examples, several copies of the same immunogenic TASA peptide can be included in a polypeptide, such as an immunogenic molecule. For example a repeat of a immunogenic TASA peptide in series. In some examples, two, three, four, five or more copies of the same immunogenic TASA peptide are included in an polypeptide. In examples wherein two or more immunogenic TASA peptide are included on a polypeptide, the immunogenic TASA peptides can be separated by peptide linkers.
(159) In additional embodiments, a plurality of the immunogenic TASA peptides described above is included in a composition. In one embodiment, the composition includes a plurality of immunogenic TASA peptides, wherein each immunogenic TASA peptide in the plurality is at most twelve amino acids in length, wherein the plurality of peptides includes at least two different immunogenic TASA peptides. Thus the composition can include 2, 3, 4, 5, 6, 7, 8, 9, 10 or more of the immunogenic TASA peptides disclosed in Table 1. In some embodiments, the composition includes 2, 3, 4, 5, 6 or 7 immunogenic peptides each from a different TASA. In other embodiments, the composition includes 2, 3, 4, 5, 6, 7, 8, 9 or 10 immunogenic peptides from 2, 3, 4, 5 or 6 different TASAs.
(160) Compositions including a plurality of immunogenic TASA peptides described herein can include varying concentrations of different concentrations of each immunogenic TASA peptide in the plurality of immunogenic TASA peptides. For example, in some embodiments, the composition includes two, three, for, five, six, or seven different types of immunogenic TASA peptide in an equimolar ratio. In other examples, the composition includes two, three, for, five, six, or seven different types of immunogenic TASA peptide in a non-equimolar ratio.
(161) In some embodiments, the composition includes immunogenic peptides from DLK1, HBB, NRP1 and TEM1. In other embodiments, the composition includes immunogenic peptides from DLK1, HBB, NRP1, TEM1, EphA2 and RGS5. In still other embodiments, the composition includes immunogenic peptides from DLK1, HBB, NRP1, TEM1, EphA2, RGS5 and PDGFR?.
(162) In some embodiments, a composition is provided including a plurality of immunogenic TASA peptides, wherein each immunogenic TASA peptide in the plurality is at most twelve amino acids in length, wherein the plurality of immunogenic TASA peptides includes at least one polypeptide including an amino acid sequence as shown for one of the DLK1 peptides listed in Table 1, at least one polypeptide including an amino acid sequence as shown for one of the HBB peptides listed in Table 1, at least one polypeptide including an amino acid sequence as shown for one of the NRP1 peptides listed in Table 1, and at least one polypeptide including an amino acid sequence as shown for one of the TEM1 peptides listed in Table 1. In some such embodiments, the plurality of polypeptides further includes at least one polypeptide including an amino acid sequence as shown for the EphA2 peptide listed in Table 1, and at least one polypeptide including an amino acid sequence as shown for one of the RGS5 peptides listed in Table 1. In still more embodiments, the plurality of polypeptides further includes at least one polypeptide including an amino acid sequence as shown for the EphA2 peptide listed in Table 1, at least one polypeptide including an amino acid sequence as shown for one of the RGS5 peptides listed in Table 1, and at least one polypeptide including an amino acid sequence as shown for one of the PDGFR? peptides listed in Table 1. In some such embodiments, each polypeptide in the plurality of polypeptides is nine, ten, eleven or twelve amino acids in length.
(163) In some embodiments, a composition is provided including a plurality of immunogenic TASA peptides including a polypeptide consisting of an amino acid sequence as shown for one of the DLK1 peptides listed in Table 1, a polypeptide consisting of an amino acid sequence as shown for one of the HBB peptides listed in Table 1, a polypeptide consisting of an amino acid sequence as shown for one of the NRP1 peptides listed in Table 1, and a polypeptide consisting of an amino acid sequence as shown for one of the TEM1 peptides listed in Table 1. In some embodiments, the composition further includes a polypeptide consisting of an amino acid sequence as shown for the EphA2 peptide listed in Table 1, and a polypeptide consisting of an amino acid sequence as shown for one of the RGS5 peptides listed in Table 1. In still more embodiments, the composition further includes a polypeptide consisting of an amino acid sequence as shown for the EphA2 peptide listed in Table 1, a polypeptide consisting of an amino acid sequence as shown for one of the RGS5 peptides listed in Table 1, and a polypeptide consisting of an amino acid sequence as shown for one of the PDGFR? polypeptides listed in Table 1. In some such embodiments, each polypeptide in the plurality of polypeptides is nine, ten, eleven or twelve amino acids in length.
(164) In some embodiments, a composition is provided including a plurality of immunogenic TASA peptides including a peptide comprising an amino acid sequence set forth as SEQ ID NO: 1, a peptide comprising an amino acid sequence set forth as SEQ ID NO: 2 and a peptide comprising an amino acid sequence set forth as SEQ ID NO:3. In other embodiments, a composition is provided including a plurality of immunogenic TASA peptides including a peptide comprising an amino acid sequence set forth as SEQ ID NO: 4 and a peptide comprising an amino acid sequence set forth as SEQ ID NO: 5. In still other embodiments, a composition is provided including a plurality of immunogenic TASA peptides including a peptide comprising an amino acid sequence set forth as SEQ ID NO: 6, a peptide comprising an amino acid sequence set forth as SEQ ID NO: 7 and a peptide comprising an amino acid sequence set forth as SEQ ID NO: 8. In some such embodiments, each polypeptide in the plurality of polypeptides is nine, ten, eleven or twelve amino acids in length.
(165) In some embodiments, a composition is provided including a plurality of immunogenic TASA peptides including a DLK1 polypeptide comprising an amino acid sequence set forth as FLNKCETWV (SEQ ID NO: 3), a HBB polypeptide comprising an amino acid sequence set forth as RLLVVYPWX.sub.2 (SEQ ID NO: 4) wherein X.sub.2 is a threonine (T), a NRP1 polypeptide comprising an amino acid sequence set forth as VLLGAVCGV (SEQ ID NO: 8), a TEM1 polypeptide comprising an amino acid sequence set forth as LLVPTCVFX.sub.5V (SEQ ID NO: 9) wherein X.sub.5 is a leucine (L), an EphA2 polypeptide comprising an amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10), a RGS5 polypeptide comprising an amino acid sequence set forth as LX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is an alanine (A), a PDGFR? polypeptide comprising an amino acid sequence set forth as ILLWEIFTX.sub.7 (SEQ ID NO: 12) wherein X.sub.7 is a leucine (L). In some such embodiments, each polypeptide in the plurality of polypeptides is at least nine, at least ten, at least eleven or at least twelve amino acids in length.
(166) In some embodiments, a composition is provided including a plurality of immunogenic TASA peptides, wherein the plurality of immunogenic TASA peptides includes a DLK1 polypeptide consisting of an amino acid sequence set forth as FLNKCETWV (SEQ ID NO: 3), a HBB polypeptide consisting of an amino acid sequence set forth as RLLVVYPWX.sub.2 (SEQ ID NO: 4) wherein X.sub.2 is a threonine (T), a NRP1 polypeptide consisting of an amino acid sequence set forth as VLLGAVCGV (SEQ ID NO: 8) and a TEM1 polypeptide consisting of an amino acid sequence set forth as LLVPTCVFX.sub.5V (SEQ ID NO: 9) wherein X.sub.5 is a leucine (L). In some embodiments, the composition further includes an EphA2 polypeptide consisting of an amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10) and a RGS5 polypeptide consisting of an amino acid sequence set forth as LX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is an alanine (A). In some embodiments, the composition further includes an EphA2 polypeptide consisting of an amino acid sequence set forth as TLADFDPRV (SEQ ID NO: 10), a RGS5 polypeptide consisting of an amino acid sequence set forth as LX.sub.6ALPHSCL (SEQ ID NO: 11) wherein X.sub.6 is an alanine (A) and a PDGFR? polypeptide consisting of an amino acid sequence set forth as ILLWEIFTX.sub.7 (SEQ ID NO: 12) wherein X.sub.7 is a leucine (L). In some such embodiments, each polypeptide in the plurality of polypeptides is at least nine, at least ten, at least eleven or at least twelve amino acids in length.
(167) The immunogenic TASA peptides can be covalently linked to a carrier, which is an immunogenic macromolecule to which an antigenic molecule can be bound. When bound to a carrier, the bound polypeptide becomes more immunogenic. Carriers are chosen to increase the immunogenicity of the bound molecule and/or to elicit higher titers of antibodies against the carrier which are diagnostically, analytically, and/or therapeutically beneficial. Covalent linking of a molecule to a carrier can confer enhanced immunogenicity and T cell dependence (see Pozsgay et al., PNAS 96:5194-97, 1999; Lee et al., J. Immunol. 116:1711-18, 1976; Dintzis et al., PNAS 73:3671-75, 1976). Useful carriers include polymeric carriers, which can be natural (for example, polysaccharides, polypeptides or proteins from bacteria or viruses), semi-synthetic or synthetic materials containing one or more functional groups to which a reactant moiety can be attached. Bacterial products and viral proteins (such as hepatitis B surface antigen and core antigen) can also be used as carriers, as well as proteins from higher organisms such as keyhole limpet hemocyanin, horseshoe crab hemocyanin, edestin, mammalian serum albumins, and mammalian immunoglobulins. Additional bacterial products for use as carriers include bacterial wall proteins and other products (for example, streptococcal or staphylococcal cell walls and lipopolysaccharide (LPS)).
Protein Delta Homolog 1 (DLK1)
(168) In some embodiments, the methods disclosed herein utilize DLK1 protein, or a nucleic acid encoding DLK1 protein. An exemplary DLK1 protein is set forth as SEQ ID NO: 21, see also GENBANK? Accession No. NP_003827.3, incorporated herein by reference, and GENBANK? Accession No. NM_003836.5 (Sep. 23, 2012), incorporated herein by reference. In some embodiments, the DLK1 protein is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identical to SEQ ID NO: 21. Human DLK1 has very high homology with DLK1 from other animal species and therefore, the sequences of DLK1 from other organisms can be utilized, particularly where these sequences are identical, substantially homologous, and elicit an effective immune response against the target antigen (e.g., native DLK1 expressed by a cell). Additional exemplary DLK1 proteins include at most 10, at most 9, at most 8, at most 7, at most 6, at most 5, at most 4, at most 3, at most 2 or at most 1 conservative amino acid substitutions in SEQ ID NO: 21. The methods disclosed herein can utilize protein fragments of DLK1 protein, such as 100, 150, 200, 250, 300, 350 or 380 amino acids of a DLK1 protein.
(169) In several embodiments, the isolated DLK1 protein or polypeptide is included in a fusion protein. Thus, the fusion protein can include the DLK1 protein or DLK1 polypeptide (see above) and a second heterologous moiety, such as a myc protein, an enzyme or a carrier (such as a hepatitis carrier protein or bovine serum albumin) covalently linked to the DLK1 protein or polypeptide. Thus, in several specific non-limiting examples, the fusion protein includes a DLK1 protein and six sequential histidine residues, a ?-galactosidase amino acid sequence, and/or an immunoglobulin amino acid sequence. However, in other embodiments, the DLK1 is not fused to a heterologous moiety.
(170) DLK1 proteins or polypeptides that are linked to a carrier are also of use in the disclosed methods. Generally, a carrier is an immunogenic macromolecule to which an antigenic molecule can be bound. When bound to a carrier, the bound DLK1 protein or DLK1 polypeptide becomes more immunogenic. Carriers are chosen to increase the immunogenicity of the bound molecule and/or to elicit higher titers of antibodies against the carrier which are diagnostically, analytically, and/or therapeutically beneficial. Covalent linking of a molecule to a carrier can confer enhanced immunogenicity and T cell dependence (see Pozsgay et al., PNAS 96:5194-97, 1999; Lee et al., J. Immunol. 116:1711-18, 1976; Dintzis et al., PNAS 73:3671-75, 1976). Useful carriers include polymeric carriers, which can be natural (for example, polysaccharides, polypeptides or proteins from bacteria or viruses), semi-synthetic or synthetic materials containing one or more functional groups to which a reactant moiety can be attached. Bacterial products and viral proteins (such as hepatitis B surface antigen and core antigen) can also be used as carriers, as well as proteins from higher organisms such as keyhole limpet hemocyanin, horseshoe crab hemocyanin, edestin, mammalian serum albumins, and mammalian immunoglobulins. Suitable carriers include, but are not limited to, a hepatitis B small envelope protein HBsAg. This protein has the capacity to self-assemble into aggregates and can form viral-like particles. The preparation of HBsAg is well documented, see for example European Patent Application Publication No. EP-A-0 226 846, European Patent Application Publication No. EP-A-0 299 108 and PCT Publication No. WO 01/117554, and the amino acid sequence disclosed, for example, in Tiollais et al., Nature, 317: 489, 1985, and European Patent Publication No. EP-A-0 278 940, and PCT Publication No. WO 91/14703, all of which are incorporated herein by reference.
(171) In other embodiments, only the DLK1 protein or polypeptide is utilized. Thus, a second heterologous moiety is non-covalently linked to the DLK1 protein or polypeptide.
Nucleotides, Expression Vectors and Host Cells
(172) Nucleic acids encoding one or more of the immunogenic TASA peptides, or encoding DLK1 protein, are provided. These polynucleotides include DNA, cDNA and RNA sequences which encode the polypeptide(s) of interest. Nucleic acid molecules encoding these peptides can readily be produced by one of skill in the art, using the amino acid sequences provided herein, and the genetic code. In addition, one of skill can readily construct a variety of clones containing functionally equivalent nucleic acids, such as nucleic acids which differ in sequence but which encode the same effector molecule, detectable marker or antibody sequence. An exemplary nucleic acid sequence encoding a DLK1 protein is provided in GENBANK? Accession No. NM_003836.5 (Sep. 23, 2012, incorporated herein by reference).
(173) Nucleic acid sequences encoding one or more of the immunogenic TASA peptides can be prepared by any suitable method including, for example, cloning of appropriate sequences or by direct chemical synthesis by methods such as the phosphotriester method of Narang et al., Meth. Enzymol. 68:90-99, 1979; the phosphodiester method of Brown et al., Meth. Enzymol. 68:109-151, 1979; the diethylphosphoramidite method of Beaucage et al., Tetra. Lett. 22:1859-1862, 1981; the solid phase phosphoramidite triester method described by Beaucage & Caruthers, Tetra. Letts. 22(20):1859-1862, 1981, for example, using an automated synthesizer as described in, for example, Needham-VanDevanter et al., Nucl. Acids Res. 12:6159-6168, 1984; and, the solid support method of U.S. Pat. No. 4,458,066. Chemical synthesis produces a single stranded oligonucleotide. This can be converted into double stranded DNA by hybridization with a complementary sequence, or by polymerization with a DNA polymerase using the single strand as a template.
(174) Exemplary nucleic acids including sequences encoding one or more of the immunogenic TASA peptides can be prepared by cloning techniques. Examples of appropriate cloning and sequencing techniques, and instructions sufficient to direct persons of skill through cloning are found in Sambrook et al., supra, Berger and Kimmel (eds.), supra, and Ausubel, supra. Product information from manufacturers of biological reagents and experimental equipment also provide useful information. Such manufacturers include the SIGMA Chemical Company (Saint Louis, Mo.), R&D Systems (Minneapolis, Minn.), Pharmacia Amersham (Piscataway, N.J.), CLONTECH Laboratories, Inc. (Palo Alto, Calif.), Chem Genes Corp., Aldrich Chemical Company (Milwaukee, Wis.), Glen Research, Inc., GIBCO BRL Life Technologies, Inc. (Gaithersburg, Md.), Fluka Chemica-Biochemika Analytika (Fluka Chemie AG, Buchs, Switzerland), Invitrogen (San Diego, Calif.), and Applied Biosystems (Foster City, Calif.), as well as many other commercial sources known to one of skill.
(175) Nucleic acids can also be prepared by amplification methods. Amplification methods include polymerase chain reaction (PCR), the ligase chain reaction (LCR), the transcription-based amplification system (TAS), the self-sustained sequence replication system (3SR). A wide variety of cloning methods, host cells, and in vitro amplification methodologies are well known to persons of skill.
(176) Once the nucleic acids encoding one or more of the immunogenic TASA peptides are isolated and cloned, the protein can be expressed in a recombinantly engineered cell such as bacteria, plant, yeast, insect and mammalian cells using a suitable expression vector. One or more DNA sequences encoding one or more immunogenic TASA peptide can be expressed in vitro by DNA transfer into a suitable host cell. The cell may be prokaryotic or eukaryotic. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. Methods of stable transfer, meaning that the foreign DNA is continuously maintained in the host, are known in the art.
(177) Polynucleotide sequences encoding one or more of the immunogenic TASA peptides, can be operatively linked to expression control sequences (e.g., a promoter). An expression control sequence operatively linked to a coding sequence is ligated such that expression of the coding sequence is achieved under conditions compatible with the expression control sequences. The expression control sequences include, but are not limited to appropriate promoters, enhancers, transcription terminators, a start codon (i.e., ATG) in front of a protein-encoding gene, splicing signal for introns, maintenance of the correct reading frame of that gene to permit proper translation of mRNA, and stop codons.
(178) The polynucleotide sequences encoding one or more of the immunogenic TASA peptides can be inserted into an expression vector including, but not limited to a plasmid, virus or other vehicle that can be manipulated to allow insertion or incorporation of sequences and can be expressed in either prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and mammalian organisms. Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art. Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art.
(179) Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl.sub.2 method using procedures well known in the art. Alternatively, MgCl.sub.2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell if desired, or by electroporation.
(180) When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate coprecipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or virus vectors may be used. Eukaryotic cells can also be cotransformed with polynucleotide sequences encoding one or more of the immunogenic TASA peptides, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the one or more of the immunogenic TASA peptides (see for example, Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982). One of skill in the art can readily use expression systems such as plasmids and vectors of use in producing proteins in cells including higher eukaryotic cells such as the COS, CHO, HeLa and myeloma cell lines.
(181) In some embodiments, one or more polynucleotides encoding one or more immunogenic TASA peptides are included in one or more viral vectors. Examples of suitable viral vectors include retrovirus vectors, pox vectors, adenoviral vectors, herpes virus vectors, alpha virus vectors, baculovirus vectors, Sindbis virus vectors, vaccinia virus vectors and poliovirus vectors. Basic techniques for preparing recombinant DNA viruses containing a heterologous DNA sequence are known in the art. Such techniques involve, for example, homologous recombination between the viral DNA sequences flanking the DNA sequence in a donor plasmid and homologous sequences present in the parental virus (Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79:7415-7419).
(182) Viral vectors can be prepared encoding one or more of the immunogenic TASA peptides. A number of viral vectors have been constructed, including polyoma, SV40 (Madzak et al., J. Gen. Virol., 73:15331536, 1992), adenovirus (Berkner, Cur. Top. Microbiol. Immunol., 158:39-6, 1992; Berliner et al., Bio Techniques, 6:616-629, 1988; Gorziglia et al., J. Virol., 66:4407-4412, 1992; Quantin et al., Proc. Nad. Acad. Sci. USA, 89:2581-2584, 1992; Rosenfeld et al., Cell, 68:143-155 1992; Wilkinson et al., Nucl. Acids Res., 20:2233-2239, 1992; Stratford-Perricaudet et al., Hum. Gene Ther., 1:241-256, 1990), vaccinia virus (Mackett et al., Biotechnology, 24:495-499, 1991), adeno-associated virus (Muzyczka, Curr. Top. Microbiol. Immunol., 158:91-123, 1992; On et al., Gene, 89:279-282, 1990), herpes viruses including HSV and EBV (Margolskee, Curr. Top. Microbiol. Immunol., 158:67-90, 1992; Johnson et al., J. Virol., 66:29522965, 1992; Fink et al., Hum. Gene Ther., 3:11-19, 1992; Breakfield et al., Mol. Neurobiol., 1:337-371, 1987; Fresse et al., Biochem. Pharmacol., 40:2189-2199, 1990), Sindbis viruses (Herweijer et al., Human Gene Therapy, 6:1161-1167, 1995; U.S. Pat. Nos. 5,091,309 and 5,2217,879), alphaviruses (Schlesinger, Trends Biotechnol., 11:18-22, 1993; Frolov et al., Proc. Natl. Acad. Sci. USA, 93:11371-11377, 1996) and retroviruses of avian (Brandyopadhyay et al., Mol. Cell Biol., 4:749-754, 1984; Petropouplos et al., J. Virol., 66:3391-3397, 1992), murine (Miller, Curr. Top. Microbiol. Immunol., 158:1-24, 1992; Miller et al., Mol. Cell Biol., 5:431-437, 1985; Sorge et al., Mol. Cell Biol., 4:1730-1737, 1984; Mann et al., J. Virol., 54:401-407, 1985), and human origin (Page et al., J. Virol., 64:5370-5276, 1990; Buchschalcher et al., J. Virol., 66:2731-2739, 1992). Baculovirus (Autographa californica multinuclear polyhedrosis virus; AcMNPV) vectors are also known in the art, and may be obtained from commercial sources (such as PharMingen, San Diego, Calif.; Protein Sciences Corp., Meriden, Conn.; Stratagene, La Jolla, Calif.).
(183) Viral vectors that encode one or more immunogenic TASA peptides typically include at least expression control element (e.g., a promoter) operationally linked to the nucleic acid sequence encoding the one or more immunogenic TASA peptides. The at least on expression control element is inserted in the poxviral vector to control and regulate the expression of the nucleic acid sequence. Examples of expression control elements of use in these vectors include, but are not limited to, lac system, operator and promoter regions of phage lambda, yeast promoters and promoters derived from polyoma, adenovirus, retrovirus or SV40. Additional operational elements include, but are not limited to, leader sequence, termination codons, polyadenylation signals and any other sequences necessary for the appropriate transcription and subsequent translation of the nucleic acid sequence encoding the one or more immunogenic TASA peptides in the host system. The expression vector can contain additional elements necessary for the transfer and subsequent replication of the expression vector containing the nucleic acid sequence in the host system. Examples of such elements include, but are not limited to, origins of replication and selectable markers. It will further be understood by one skilled in the art that such vectors are easily constructed using conventional methods (Ausubel et al., (1987) in Current Protocols in Molecular Biology, John Wiley and Sons, New York, N.Y.) and are commercially available.
(184) In one embodiment, a composition is provided that includes a recombinant virus comprising a vaccinia virus genome or portions thereof and a nucleic acid sequence encoding one or more immunogenic TASA peptides, and a recombinant virus comprising a nucleic acid sequence encoding an immunostimulatory molecule (for example, B 7-1 or B7-2). In such embodiments, any combination of encoding one or more immunogenic TASA peptides can be used, such as 2, 3, 4, 5, 6, 7 or more polynucleotides.
(185) Isolation and purification of recombinantly expressed polypeptide can be carried out by conventional means including preparative chromatography and immunological separations. Once expressed, the one or more of the immunogenic TASA peptides can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, and the like (see, generally, R. Scopes, Protein Purification, Springer-Verlag, N.Y., 1982). Substantially pure compositions of at least about 90 to 95% homogeneity are disclosed herein, and 98 to 99% or more homogeneity can be used for pharmaceutical purposes. Once purified, partially or to homogeneity as desired, if to be used therapeutically, the polypeptides should be substantially free of endotoxin.
Therapeutic Methods and Pharmaceutical Compositions
(186) The immunogenic TASA peptides disclosed herein (including a plurality of immunogenic peptides), or nucleic acids encoding the immunogenic TASA peptides (including a plurality of nucleic acids), polynucleotides encoding such peptides and vectors comprising the polynucleotides, can be used in methods of generating an immune response, treating a subject with cancer and decreasing the growth of a tumor associated stromal cell, as described below. In several examples, the subject has a tumor or tumor microenvironment (TME) that expresses one or more TASAs.
(187) In several embodiments, the methods include administering to a subject with a tumor a therapeutically effective amount of one or more of the immunogenic TASA peptides (for example, a plurality of immunogenic TASA peptides as described herein or one or more polynucleotides encoding these peptides), in order to generate an immune response.
(188) The methods can include selecting a subject in need of treatment, such as a subject with a tumor, for example a tumor that expresses a TASA, or a TME that expresses a TASA. In several examples, the methods include selecting a subject with colorectal cancer or melanoma.
(189) It is also disclosed herein that DLK1 protein, or a nucleic acid encoding DLK1 protein, can be used to treat a tumor and/or pathogenic angiogenesis. In several embodiments, the methods include administering to a subject with a tumor a therapeutically effective amount of one or more of the immunogenic DLK1 peptides (for example, a plurality of DLK1 peptides as described herein), one or more polynucleotides encoding these peptides, DLK1 protein, or a nucleic acid encoding DLK1, in order to generate an immune response. In some examples, the methods disclosed herein decrease pathological angiogenesis in the subject, to slow or inhibit the growth or metastasis of a tumor. In these applications, a therapeutically effective amount of a composition including the polypeptide, plurality of polypeptides, or polynucleotide is administered to a subject, thereby slowing or inhibiting the growth or the metastasis of a tumor, or other pathological angiogenesis, or to inhibit a sign or a symptom. Examples of suitable subjects include those diagnosed with or suspecting of having cancer (for example, a subject having a tumor), for example subjects having a carcinoma, such as a breast carcinoma, lung carcinoma, colorectal carcinoma, renal carcinoma, or melanoma. In additional examples, subject has a hematologic tumor, such as a hemangioma, lymphangioma, Kaposi sarcoma, or hemangioblastoma. In some examples, the tumor cells express DLK1. However, in some embodiments, the tumor cells do not express DLK1, but the pericytes in the blood vessels within the tumor express DLK1. In yet other examples, both the tumor cells and the pericytes in the blood vessels in the tumor express DLK1.
(190) In some embodiments, compositions are administered to a subject having a disease such as cancer (for example, renal cell cancer), in an amount sufficient to reduce vascularization. Administration inhibits blood vessel growth, and/or normalizes the vasculature. Amounts effective for this use will depend upon the vascularization of the cancer, the general state of the patient's health, and the robustness of the patient's immune system. In one example, a therapeutically effective amount of the composition is that which provides either subjective relief of a symptom(s) or an objectively identifiable improvement, such as a decrease in vascularization, as noted by the clinician or other qualified observer. In some embodiments, these methods include administering to the subject one or more DLK polypeptides or DLK1 protein as disclosed herein.
(191) In exemplary applications, compositions are administered to a subject having a disease, such as cancer (for example, colorectal cancer or melanoma), in an amount sufficient to raise an immune response to TASA-expressing cells. Administration induces a sufficient immune response to slow the proliferation of such cells or to inhibit their growth, or to reduce a sign or a symptom of the tumor. Amounts effective for this use will depend upon the severity of the disease, the general state of the patient's health, and the robustness of the patient's immune system. In one example, a therapeutically effective amount of the compound is that which provides either subjective relief of a symptom(s) or an objectively identifiable improvement as noted by the clinician or other qualified observer.
(192) One or more immunogenic TASA peptides or one or more polynucleotides encoding these peptides, DLK1 protein, or a polynucleotide encoding DLK1 protein can be administered by any means known to one of skill in the art (see Banga, A., Parenteral Controlled Delivery of Therapeutic Peptides and Proteins, in Therapeutic Peptides and Proteins, Technomic Publishing Co., Inc., Lancaster, Pa., 1995) either locally or systemically, such as by intramuscular, subcutaneous, intraperitoneal or intravenous injection, but even oral, nasal, transdermal or anal administration is contemplated. In one embodiment, administration is by subcutaneous or intramuscular injection. To extend the time during which the peptide, protein or polynucleotide is available to stimulate a response, the peptide, protein or polynucleotide can be provided as an implant, an oily injection, or as a particulate system. The particulate system can be a microparticle, a microcapsule, a microsphere, a nanocapsule, or similar particle. (see, e.g., Banga, supra). A particulate carrier based on a synthetic polymer has been shown to act as an adjuvant to enhance the immune response, in addition to providing a controlled release. Aluminum salts can also be used as adjuvants to produce an immune response.
(193) Optionally, one or more cytokines, such as IL-2, IL-6, IL-12, RANTES, GM-CSF, TNF-?, or IFN-?, one or more growth factors, such as GM-CSF or G-CSF, one or more costimulatory molecules, such as ICAM-1, LFA-3, CD72, B7-1, B7-2, or other B7 related molecules; one or more molecules such as OX-40L or 41 BBL, or combinations of these molecules, can be used as biological adjuvants (see, for example, Salgaller et al., 1998, J. Surg. Oncol. 68(2):122-38; Lotze et al., 2000, Cancer J Sci. Am. 6(Suppl 1):S61-6; Cao et al., 1998, Stem Cells 16(Suppl 1):251-60; Kuiper et al., 2000, Adv. Exp. Med. Biol. 465:381-90). These molecules can be administered systemically (or locally) to the host. In several examples, IL-2, RANTES, GM-CSF, TNF-?, IFN-?, G-CSF, LFA-3, CD72, B7-1, B7-2, B7-1 B7-2, OX-40L, 41 BBL and ICAM-1 are administered.
(194) In one specific, non-limiting example, one or more immunogenic TASA peptides (for example, a plurality of such peptides as described herein), or DLK1 protein, is administered in a manner to direct the immune response to a cellular response (that is, a cytotoxic T lymphocyte (CTL) response), rather than a humoral (antibody) response.
(195) A number of means for inducing cellular responses, both in vitro and in vivo, are known. Lipids have been identified as agents capable of assisting in priming CTL in vivo against various antigens. For example, as described in U.S. Pat. No. 5,662,907, palmitic acid residues can be attached to the alpha and epsilon amino groups of a lysine residue and then linked (for example, via one or more linking residues, such as glycine, glycine-glycine, serine, serine-serine, or the like) to an immunogenic peptide. The lipidated peptide can then be injected directly in a micellar form, incorporated in a liposome, or emulsified in an adjuvant. As another example, E. coli lipoproteins, such as tripalmitoyl-S-glycerylcysteinlyseryl-serine can be used to prime tumor specific CTL when covalently attached to an appropriate peptide (see, Deres et al., Nature 342:561, 1989). Further, as the induction of neutralizing antibodies can also be primed with the same molecule conjugated to a peptide which displays an appropriate epitope, two compositions can be combined to elicit both humoral and cell-mediated responses where that is deemed desirable.
(196) In yet another embodiment, to induce a CTL response to one or more immunogenic TASA peptides, a MHC Class II-restricted T-helper epitope is added to the one or more immunogenic TASA peptides to induce T-helper cells to secrete cytokines in the microenvironment to activate CTL precursor cells. The technique further involves adding short lipid molecules to retain the construct at the site of the injection for several days to localize the antigen at the site of the injection and enhance its proximity to dendritic cells or other professional antigen presenting cells over a period of time (see Chesnut et al., Design and Testing of Peptide-Based Cytotoxic T-Cell-Mediated Immunotherapeutics to Treat Infectious Diseases and Cancer, in Powell et al., eds., Vaccine Design, the Subunit and Adjuvant Approach, Plenum Press, New York, 1995).
(197) A pharmaceutical composition including one or more immunogenic TASA peptides or DLK1 protein is provided. In some examples, the composition includes a plurality of immunogenic TASA peptides as described herein. These compositions are used to generate an immune response, such as for immunotherapy. In one embodiment, one or more immunogenic TASA peptides are mixed with an adjuvant containing two or more of a stabilizing detergent, a micelle-forming agent, and an oil. Suitable stabilizing detergents, micelle-forming agents, and oils are detailed in U.S. Pat. No. 5,585,103; U.S. Pat. No. 5,709,860; U.S. Pat. No. 5,270,202; and U.S. Pat. No. 5,695,770, all of which are incorporated by reference. A stabilizing detergent is any detergent that allows the components of the emulsion to remain as a stable emulsion. Such detergents include polysorbate, 80 (TWEEN) (Sorbitan-mono-9-octadecenoate-poly(oxy-1,2-ethanediyl; manufactured by ICI Americas, Wilmington, Del.), TWEEN 40?, TWEEN 20?, TWEEN 60?, Zwittergent? 3-12, TEEPOL HB7?, and SPAN 85?. These detergents are usually provided in an amount of approximately 0.05 to 0.5%, such as at about 0.2%. A micelle forming agent is an agent which is able to stabilize the emulsion formed with the other components such that a micelle-like structure is formed. Such agents generally cause some irritation at the site of injection in order to recruit macrophages to enhance the cellular response. Examples of such agents include polymer surfactants described by BASF Wyandotte publications, e.g., Schmolka, J. Am. Oil. Chem. Soc. 54:110, 1977, and Hunter et al., J. Immunol 129:1244, 1981, PLURONIC? L62LF, L101, and L64, PEG1000, and TETRONIC? 1501, 150R1, 701, 901, 1301, and 130R1. The chemical structures of such agents are well known in the art. In one embodiment, the agent is chosen to have a hydrophile-lipophile balance (HLB) of between 0 and 2, as defined by Hunter and Bennett, J. Immun. 133:3167, 1984. The agent can be provided in an effective amount, for example between 0.5 and 10%, or in an amount between 1.25 and 5%.
(198) The oil included in the composition is chosen to promote the retention of the antigen in oil-in-water emulsion, such as to provide a vehicle for the desired antigen, and preferably has a melting temperature of less than 65? C. such that emulsion is formed either at room temperature (about 20? C. to 25? C.), or once the temperature of the emulsion is brought down to room temperature. Examples of such oils include squalene, Squalane, EICOSANE?, tetratetracontane, glycerol, and peanut oil or other vegetable oils. In one specific, non-limiting example, the oil is provided in an amount between 1 and 10%, or between 2.5 and 5%. The oil should be both biodegradable and biocompatible so that the body can break down the oil over time, and so that no adverse effects, such as granulomas, are evident upon use of the oil.
(199) In one embodiment, the adjuvant is a mixture of stabilizing detergents, micelle-forming agent, and oil available under the name PROVAX? (IDEC Pharmaceuticals, San Diego, Calif.). An adjuvant can also be an immunostimulatory nucleic acid, such as a nucleic acid including a CpG motif, or a biological adjuvant (see above).
(200) Controlled release parenteral formulations can be made as implants, oily injections, or as particulate systems. For a broad overview of protein delivery systems, see Banga, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems, Technomic Publishing Company, Inc., Lancaster, Pa., 1995. Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles. Microcapsules contain the therapeutic protein as a central core. In microspheres, the therapeutic agent is dispersed throughout the particle. Particles, microspheres, and microcapsules smaller than about 1 ?m are generally referred to as nanoparticles, nanospheres, and nanocapsules, respectively. Capillaries have a diameter of approximately 5 ?m so that only nanoparticles are administered intravenously. Microparticles are typically around 100 ?m in diameter and are administered subcutaneously or intramuscularly (see Kreuter, Colloidal Drug Delivery Systems, J. Kreuter, ed., Marcel Dekker, Inc., New York, N.Y., pp. 219-342, 1994; Tice & Tabibi, Treatise on Controlled Drug Delivery, A. Kydonieus, ed., Marcel Dekker, Inc. New York, N.Y., pp. 315-339, 1992).
(201) Polymers can be used for ion-controlled release. Various degradable and nondegradable polymeric matrices for use in controlled drug delivery are known in the art (Langer, Accounts Chem. Res. 26:537, 1993). For example, the block copolymer, polaxamer 407 exists as a viscous yet mobile liquid at low temperatures but forms a semisolid gel at body temperature. It has shown to be an effective vehicle for formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res. 9:425, 1992; and Pec, J. Parent. Sci. Tech. 44(2):58, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for controlled release of proteins (Ijntema et al., Int. J. Pharm. 112:215, 1994). In yet another aspect, liposomes are used for controlled release as well as drug targeting of the lipid-capsulated drug (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, Pa., 1993). Numerous additional systems for controlled delivery of therapeutic proteins are known (e.g., U.S. Pat. No. 5,055,303; U.S. Pat. No. 5,188,837; U.S. Pat. No. 4,235,871; U.S. Pat. No. 4,501,728; U.S. Pat. No. 4,837,028; U.S. Pat. No. 4,957,735; and U.S. Pat. No. 5,019,369; U.S. Pat. No. 5,055,303; U.S. Pat. No. 5,514,670; U.S. Pat. No. 5,413,797; U.S. Pat. No. 5,268,164; U.S. Pat. No. 5,004,697; U.S. Pat. No. 4,902,505; U.S. Pat. No. 5,506,206; U.S. Pat. No. 5,271,961; U.S. Pat. No. 5,254,342; and U.S. Pat. No. 5,534,496).
(202) In another embodiment, a pharmaceutical composition including one or more polynucleotides encoding one or more immunogenic TASA peptides, or encoding DLK1 protein, is provided. For example the composition can include one or more polynucleotides encoding a plurality of immunogenic TASA peptides as described herein. A therapeutically effective amount of polynucleotide can be administered to a subject in order to generate an immune response. In one specific, non-limiting example, a therapeutically effective amount of the polynucleotide is administered to a subject to treat colorectal cancer, hepatocellular carcinoma or melanoma.
(203) Optionally, one or more cytokines, such as IL-2, IL-6, IL-12, RANTES, GM-CSF, TNF-?, or IFN-?, one or more growth factors, such as GM-CSF or G-CSF, one or more costimulatory molecules, such as ICAM-1, LFA-3, CD72, B7-1, B7-2, or other B7 related molecules; one or more molecules such as OX-40L or 41 BBL, or combinations of these molecules, can be used as biological adjuvants (see, for example, Salgaller et al., 1998, J. Surg. Oncol. 68(2):122-38; Lotze et al., 2000, Cancer J Sci. Am. 6(Suppl 1):561-6; Cao et al., 1998, Stem Cells 16(Suppl 1):251-60; Kuiper et al., 2000, Adv. Exp. Med. Biol. 465:381-90). These molecules can be administered systemically to the host. It should be noted that these molecules can be co-administered via insertion of a nucleic acid encoding the molecules into a vector, for example, a viral vector. In various embodiments, the nucleic acid encoding the biological adjuvant can be cloned into same vector as an immunogenic TASA peptide coding sequence, or the nucleic acid can be cloned into one or more separate vectors for co-administration. In addition, nonspecific immunomodulating factors such as Bacillus Cahnette-Guerin (BCG) and levamisole can be co-administered.
(204) One approach to administration of nucleic acids is direct immunization with plasmid DNA, such as with a mammalian expression plasmid. As described above, nucleotide sequence encoding immunogenic TASA peptides, or encoding DLK1 protein, can be placed under the control of a promoter to increase expression of the molecule.
(205) Immunization by nucleic acid constructs is well known in the art and taught, for example, in U.S. Pat. No. 5,643,578 (which describes methods of immunizing vertebrates by introducing DNA encoding a desired antigen to elicit a cell-mediated or a humoral response), and U.S. Pat. No. 5,593,972 and U.S. Pat. No. 5,817,637 (which describe operably linking a nucleic acid sequence encoding an antigen to regulatory sequences enabling expression). U.S. Pat. No. 5,880,103 describes several methods of delivery of nucleic acids encoding immunogenic peptides or other antigens to an organism. The methods include liposomal delivery of the nucleic acids (or of the synthetic peptides themselves), and immune-stimulating constructs, or ISCOMS?, negatively charged cage-like structures of 30-40 nm in size formed spontaneously on mixing cholesterol and Quil A? (saponin). Protective immunity has been generated in a variety of experimental models of infection, including toxoplasmosis and Epstein-Barr virus-induced tumors, using ISCOMS? as the delivery vehicle for antigens (Mowat and Donachie, Immunol. Today 12:383, 1991). Doses of antigen as low as 1 ?g encapsulated in ISCOMS? have been found to produce Class I mediated CTL responses (Takahashi et al., Nature 344:873, 1990).
(206) In another approach to using nucleic acids for immunization, one or more immunogenic TASA peptides, or DLK1 protein, can also be expressed by attenuated viral hosts or vectors or bacterial vectors. Recombinant vaccinia virus, poxvirus, adeno-associated virus (AAV), herpes virus, retrovirus, or other viral vectors can be used to express one or more TASA peptides, thereby eliciting a CTL response. For example, vaccinia vectors and methods useful in immunization protocols are described in U.S. Pat. No. 4,722,848. BCG (Bacillus Calmette Guerin) provides another vector for expression of the peptides (see Stover, Nature 351:456-460, 1991).
(207) A first recombinant virus, such as a poxvirus (for example, vaccinia virus) encoding one or more TASA immunogenic polypeptides can be used in conjunction with a second recombinant virus which has incorporated into a viral genome or infectable portion thereof one or more genes or DNA sequences encoding B7-1, B7-2, or B7-1 and B7-2, wherein the composition is able to coinfect a host cell resulting in coexpression of the polypeptide and the B7-1, B7-2, or B7-1 and B7-2 encoding genes or DNA sequences (see U.S. Pat. No. 6,893,869, and U.S. Pat. No. 6,045,908, which are incorporated by reference herein).
(208) When a viral vector is utilized, it is desirable to provide the recipient with a dosage of each recombinant virus in the composition in the range of from about 10.sup.5 to about 10.sup.10 plaque forming units/mg mammal, although a lower or higher dose can be administered. The composition of recombinant viral vectors can be introduced into a mammal either prior to any evidence of a cancer, or to mediate regression of the disease in a mammal afflicted with the cancer. Examples of methods for administering the composition into mammals include, but are not limited to, exposure of cells to the recombinant virus ex vivo, or injection of the composition into the affected tissue or intravenous, subcutaneous, intradermal or intramuscular administration of the virus. Alternatively the recombinant viral vector or combination of recombinant viral vectors may be administered locally by direct injection into the cancerous lesion in a pharmaceutically acceptable carrier. Generally, the quantity of recombinant viral vector, carrying the nucleic acid sequence of one or more immunogenic TASA peptides (or DLK1 protein) to be administered is based on the titer of virus particles. An exemplary range of the immunogen to be administered is 10.sup.5 to 10.sup.10 virus particles per mammal, such as a human.
(209) In one embodiment the recombinant viruses have been constructed to express cytokines (such as TNF-?, IL-6, GM-CSF, and IL-2), and co-stimulatory and accessory molecules (B7-1, B7-2) alone and in a variety of combinations. Simultaneous production of an immunostimulatory molecule and one or more immunogenic TASA peptides (or DLK1 protein) enhances the immune response. Without being bound by theory, dependent upon the specific immunostimulatory molecules, different mechanisms might be responsible for the enhanced immunogenicity: augmentation of help signal (IL-2), recruitment of professional APC (GM-CSF), increase in CTL frequency (IL-2), effect on antigen processing pathway and MHC expression (IFN? and TNF?) and the like. For example, IL-2, IL-6, interferon, tumor necrosis factor, or a nucleic acid encoding these molecules, can be administered in conjunction with one or more TASA immunogenic polypeptides, a nucleic acid encoding one or more immunogenic TASA peptides, DLK1 protein or a nucleic acid encoding DLK1 protein. The co-expression of one or more immunogenic TASA peptides, DLK1 protein or a nucleic acid encoding DLK1 protein, together with at least one immunostimulatory molecule can be effective in an animal model to show anti-tumor effects.
(210) In one embodiment, a nucleic acid encoding one or more immunogenic TASA peptides (or DLK1 protein) is introduced directly into cells. For example, the nucleic acid can be loaded onto gold microspheres by standard methods and introduced into the skin by a device such as Bio-Rad's HELIOS? Gene Gun. The nucleic acids can be naked, consisting of plasmids under control of a strong promoter. Typically, the DNA is injected into muscle, although it can also be injected directly into other sites, including tissues in proximity to metastases. Dosages for injection are usually around 0.5 ?g/kg to about 50 mg/kg, and typically are about 0.005 mg/kg to about 5 mg/kg (see, for example, U.S. Pat. No. 5,589,466).
(211) In one specific, non-limiting example, a pharmaceutical composition for intravenous administration would include about 0.1 ?g to 10 mg of one or more immunogenic TASA peptides (or DLK1 protein) per patient per day. Dosages from 0.1 up to about 100 mg per patient per day can be used, particularly if the agent is administered to a secluded site and not into the circulatory or lymph system, such as into a body cavity or into a lumen of an organ. Actual methods for preparing administrable compositions are known or apparent to those skilled in the art and are described in more detail in such publications as Remingtons Pharmaceutical Sciences, 19.sup.th Ed., Mack Publishing Company, Easton, Pa., 1995.
(212) Single or multiple administrations of the compositions are administered depending on the dosage and frequency as required and tolerated by the subject. In one embodiment, the dosage is administered once as a bolus, but in another embodiment can be applied periodically until a therapeutic result is achieved. Generally, the dose is sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the subject. Systemic or local administration can be utilized.
(213) In another method, antigen presenting cells (APCs), such as dendritic cells, are pulsed or co-incubated with peptides comprising one or more immunogenic TASA peptides, or with DLK1 protein, or a nucleic acid encoding the peptide(s) or protein, in vitro. In one specific, non-limiting example, the antigen presenting cells can be autologous cells. A therapeutically effective amount of the antigen presenting cells can then be administered to a subject.
(214) One or more immunogenic TASA peptides or DLK1 protein, or a nucleic acid encoding the peptide(s) or protein, can be delivered to the dendritic cells or to dendritic cell precursors via any method known in the art, including, but not limited to, pulsing dendritic cells directly with antigen, or utilizing a broad variety of antigen delivery vehicles, such as, for example, liposomes, or other vectors known to deliver antigen to cells. In one specific, non-limiting example an antigenic formulation includes about 0.1 ?g to about 1,000 ?g, or about 1 to about 100 ?g of one or more immunogenic TASA peptides. One or more immunogenic TASA peptides (or DLK1 protein), or a nucleic acid encoding the peptide(s) or protein, can also be administered with agents that promote dendritic cell maturation. Specific, non-limiting examples of agents of use are interleukin-4 (IL-4) and granulocyte/macrophage colony stimulating factor (GM-CSF), or flt-3 ligand (flt-3L). The preparation can also contain buffers, excipients, and preservatives, amongst other ingredients.
(215) In one embodiment, mature antigen presenting cells are generated to present one or more immunogenic TASA peptides, such as DLK1 peptides. These dendritic cells are then administered alone (or in combination with another agent) to a subject with a tumor, for example a tumor that expresses the corresponding TASA, such as a colorectal tumor or melanoma.
(216) Alternatively, the APCs are used to sensitize CD8 cells, such as tumor infiltrating lymphocytes (TILs) from tumors or peripheral blood lymphocytes (PBLs). The TILs or PBLs can be from the same subject (autologous) that is to be treated. Alternatively, the TILs or PBLs can be heterologous. However, they should at least be MHC Class-I restricted to the HLA types the subject possesses. An effective amount of the sensitized cells are then administered to the subject.
(217) Peripheral blood mononuclear cells (PBMCs) can be used as the responder cell source of CTL precursors. The appropriate antigen-presenting cells are incubated with peptide, after which the peptide-loaded antigen-presenting cells are then incubated with the responder cell population under optimized culture conditions. Positive CTL activation can be determined by assaying the culture for the presence of CTLs that kill radio-labeled target cells, both specific peptide-pulsed targets as well as target cells expressing endogenously processed forms of the antigen from which the peptide sequence was derived.
(218) The cells can be administered to a subject to inhibit the growth of TASA expressing cells in a tumor or TME. In these applications, a therapeutically effective amount of activated antigen presenting cells, or activated lymphocytes, are administered to a subject suffering from a disease, in an amount sufficient to raise an immune response to TASA expressing cells. The resulting immune response is sufficient to slow the proliferation of such cells or to inhibit their growth, or to reduce a sign or a symptom of the tumor.
(219) In a supplemental method, any of these immunotherapies is augmented by administering a cytokine, such as interleukin (IL)-2, IL-3, IL-6, IL-10, IL-12, IL-15, GM-CSF, or interferons.
(220) The methods of treating a subject with a tumor described herein can be accompanied by administration of anti-cancer or anti-angiogenesis agents or therapeutic treatments (such as surgical resection of a tumor or radiation therapy). For example, the subject can receive additional therapies (a) prior to, during, or following administration of a therapeutic amount of one or more immunogenic TASA peptides, or (b) prior to, during, or following administration of a therapeutic amount of DLK1 protein or a nucleic acid encoding DLK1 protein. In one example, the subject receives one or more treatments to remove or reduce the tumor prior to administration of a therapeutic amount of one or more agents for treatment of the tumor. For example, the additional agent may include, but is not limited to, a chemotherapeutic agent, an anti-angiogenic agent, or a combination thereof. In another example, at least part of the tumor is surgically or otherwise excised or reduced in size or volume prior to administering the therapeutically effective amount of the antibody or conjugate. In some embodiments, the chemotherapeutic agent reduces suppressor cells in the tumor microenvironment or fosters the recruitment of vaccine-induced T cells into the tumor site. In some examples, the agent is bevacizumab, sunitinib, axitinib, HSP90 inhibitors, or gencitabine/fludarabine.
(221) Particular examples of additional therapeutic agents that can be used include microtubule binding agents, DNA intercalators or cross-linkers, DNA synthesis inhibitors, DNA and/or RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, angiogenesis inhibitors. These agents (which are administered at a therapeutically effective amount) and treatments can be used alone or in combination. For example, any suitable anti-cancer or anti-angiogenic agent can be administered in combination with the immunogenic TASA peptides or DLK1 protein disclosed herein, or polynucleotides encoding such peptides or protein and viral vectors include these polynucleotides. Methods and therapeutic dosages of such agents are known to those skilled in the art, and can be determined by a skilled clinician.
(222) Microtubule binding agent refers to an agent that interacts with tubulin to stabilize or destabilize microtubule formation thereby inhibiting cell division. Examples of microtubule binding agents that can be used in conjunction with the disclosed therapy include, without limitation, paclitaxel, docetaxel, vinblastine, vindesine, vinorelbine (navelbine), the epothilones, colchicine, dolastatin 15, nocodazole, podophyllotoxin and rhizoxin. Analogs and derivatives of such compounds also can be used and are known to those of ordinary skill in the art. For example, suitable epothilones and epothilone analogs are described in International Publication No. WO 2004/018478. Taxoids, such as paclitaxel and docetaxel, as well as the analogs of paclitaxel taught by U.S. Pat. Nos. 6,610,860; 5,530,020; and 5,912,264 can be used.
(223) Suitable DNA and/or RNA transcription regulators, including, without limitation, actinomycin D, daunorubicin, doxorubicin and derivatives and analogs thereof also are suitable for use in combination with the disclosed therapies. DNA intercalators and cross-linking agents that can be administered to a subject include, without limitation, cisplatin, carboplatin, oxaliplatin, mitomycins, such as mitomycin C, bleomycin, chlorambucil, cyclophosphamide and derivatives and analogs thereof. DNA synthesis inhibitors suitable for use as therapeutic agents include, without limitation, methotrexate, 5-fluoro-5-deoxyuridine, 5-fluorouracil and analogs thereof. Examples of suitable enzyme inhibitors include, without limitation, camptothecin, etoposide, formestane, trichostatin and derivatives and analogs thereof. Suitable compounds that affect gene regulation include agents that result in increased or decreased expression of one or more genes, such as raloxifene, 5-azacytidine, 5-aza-2-deoxycytidine, tamoxifen, 4-hydroxytamoxifen, mifepristone and derivatives and analogs thereof.
(224) Examples of the commonly used chemotherapy drugs include Adriamycin, Alkeran, Ara-C, BiCNU, Busulfan, CCNU, Carboplatinum, Cisplatinum, Cytoxan, Daunorubicin, DTIC, 5-FU, Fludarabine, Hydrea, Idarubicin, Ifosfamide, Methotrexate, Mithramycin, Mitomycin, Mitoxantrone, Nitrogen Mustard, Taxol (or other taxanes, such as docetaxel), Velban, Vincristine, VP-16, while some more newer drugs include Gemcitabine (Gemzar), Herceptin, Irinotecan (Camptosar, CPT-11), Leustatin, Navelbine, Rituxan STI-571, Taxotere, Topotecan (Hycamtin), Xeloda (Capecitabine), Zevelin and calcitriol.
(225) Non-limiting examples of immunomodulators that can be used include AS-101 (Wyeth-Ayerst Labs.), bropirimine (Upjohn), gamma interferon (Genentech), GM-CSF (granulocyte macrophage colony stimulating factor; Genetics Institute), IL-2 (Cetus or Hoffman-LaRoche), human immune globulin (Cutter Biological), IMREG (from Imreg of New Orleans, La.), SK&F 106528, and TNF (tumor necrosis factor; Genentech).
(226) Non-limiting examples of anti-angiogenic agents include molecules, such as proteins, enzymes, polysaccharides, oligonucleotides, DNA, RNA, and recombinant vectors, and small molecules that function to reduce or even inhibit blood vessel growth. Examples of suitable angiogenesis inhibitors include, without limitation, angiostatin K1-3, staurosporine, genistein, fumagillin, medroxyprogesterone, suramin, interferon-alpha, metalloproteinase inhibitors, platelet factor 4, somatostatin, thromobospondin, endostatin, thalidomide, and derivatives and analogs thereof. For example, in some embodiments the anti-angiogenesis agent is an antibody that specifically binds to VEGF (e.g., Avastin, Roche) or a VEGF receptor (e.g., a VEGFR2 antibody). In one example the anti-angiogenic agent includes a VEGFR2 antibody, or DMXAA (also known as Vadimezan or ASA404; available commercially, e.g., from Sigma Corp., St. Louis, Mo.) or both. The anti-angiogenic agent can be bevacizumab, sunitinib, an anti-angiogenic tyrosine kinase inhibitors (TKI), such as sunitinib, xitinib and dasatinib. These can be used individually or in any combination.
(227) Exemplary kinase inhibitors include Gleevac, Iressa, and Tarceva, sunitinib, sorafenib, anitinib, and dasatinib that prevent phosphorylation and activation of growth factors. Antibodies that can be used include Herceptin and Avastin that block growth factors and the angiogenic pathway. These can be used individually or in combination.
(228) In some examples, the additional agent is a monoclonal antibody, for example, 3F8, Abagovomab, Adecatumumab, Afutuzumab, Alacizumab, Alemtuzumab, Altumomab pentetate, Anatumomab mafenatox, Apolizumab, Arcitumomab, Bavituximab, Bectumomab, Belimumab, Besilesomab, Bevacizumab, Bivatuzumab mertansine, Blinatumomab, Brentuximab vedotin, Cantuzumab mertansine, Capromab pendetide, Catumaxomab, CC49, Cetuximab, Citatuzumab bogatox, Cixutumumab, Clivatuzumab tetraxetan, Conatumumab, Dacetuzumab, Detumomab, Ecromeximab, Eculizumab, Edrecolomab, Epratuzumab, Ertumaxomab, Etaracizumab, Farletuzumab, Figitumumab, Galiximab, Gemtuzumab ozogamicin, Girentuximab, Glembatumumab vedotin, Ibritumomab tiuxetan, Igovomab, Imciromab, Intetumumab, Inotuzumab ozogamicin, Ipilimumab, Iratumumab, Labetuzumab, Lexatumumab, Lintuzumab, Lorvotuzumab mertansine, Lucatumumab, Lumiliximab, Mapatumumab, Matuzumab, Mepolizumab, Metelimumab, Milatuzumab, Mitumomab, Morolimumab, Nacolomab tafenatox, Naptumomab estafenatox, Necitumumab, Nimotuzumab, Nofetumomab merpentan, Ofatumumab, Olaratumab, Oportuzumab monatox, Oregovomab, Panitumumab, Pemtumomab, Pertuzumab, Pintumomab, Pritumumab, Ramucirumab, Rilotumumab, Rituximab, Robatumumab, Satumomab pendetide, Sibrotuzumab, Sonepcizumab, Tacatuzumab tetraxetan, Taplitumomab paptox, Tenatumomab, TGN1412, Ticilimumab (tremelimumab), Tigatuzumab, TNX-650, Trastuzumab, Tremelimumab, Tucotuzumab celmoleukin, Veltuzumab, Volociximab, Votumumab, Zalutumumab.
(229) Another common treatment for some types of cancer is surgical treatment, for example surgical resection of the cancer or a portion of it. Another example of a treatment is radiotherapy, for example administration of radioactive material or energy (such as external beam therapy) to the tumor site to help eradicate the tumor or shrink it prior to surgical resection.
(230) Other therapeutic agents, for example anti-tumor agents, that may or may not fall under one or more of the classifications above, also are suitable for administration in combination with the disclosed therapies. By way of example, such agents include adriamycin, apigenin, rapamycin, zebularine, cimetidine, and derivatives and analogs thereof. Further examples include one or more additional vaccines targeting tumor antigens or tumor stem cells (such as a tumor initiating cell). The skilled artisan is familiar with such vaccines.
Reagents for the Detection of CD8+ Cells that Specifically Bind TASAs
(231) Reagents are provided herein for the detection of CD8 expressing cells that specifically bind the TASAs described herein. These reagents are tetrameric MHC Class I/immunogenic TASA peptide complexes. These tetrameric complexes include an immunogenic TASA peptide that includes at most twelve consecutive amino acids, wherein the isolated polypeptide comprises the amino acid sequence as shown in Table 1. Specific examples of immunogenic TASA peptides that are nine or ten amino acids in length are disclosed above.
(232) Tetrameric MHC Class I/peptide complexes can be synthesized using methods well known in the art (Altmann et al., Science 274:94, 1996, which is herein incorporated by reference). In one specific non-limiting example, purified HLA heavy chain and ?2-microglobulin (?2m) can be synthesized by means of a prokaryotic expression system. One specific, non-limiting example of an expression system of use is the pET system (R&D Systems, Minneapolis, Minn.). The heavy chain is modified by deletion of the trans-membrane and cytosolic tail and COOH-terminal addition of a sequence containing the biotin protein ligase (Bir-A) enzymatic biotinylation site. Heavy chain, ?2m, and peptide are then refolded. The refolded product can be isolated by any means known in the art, and then biotinylated by Bir-A. A tetramer is then produced by contacting the biotinylated product with streptavidin.
(233) In one embodiment, the streptavidin is labeled. Suitable labels include, but are not limited to, enzymes, magnetic beads, colloidal magnetic beads, haptens, fluorochromes, metal compounds, radioactive compounds or drugs. The enzymes that can be conjugated to streptavidin include, but are not limited to, alkaline phosphatase, peroxidase, urease and ?-galactosidase. The fluorochromes that can be conjugated to the streptavidin include, but are not limited to, fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, phycoerythrin, allophycocyanins and Texas Red. For additional fluorochromes that can be conjugated to streptavidin, see Haugland, R. P., Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals (1992-1994). The metal compounds that can be conjugated to the streptavidin include, but are not limited to, ferritin, colloidal gold, and particularly, colloidal superparamagnetic beads. The haptens that can be conjugated to the streptavidin include, but are not limited to, biotin, digoxigenin, oxazalone, and nitrophenol. The radioactive compounds that can be conjugated to streptavidin are known to the art, and include but are not limited to technetium 99m (.sup.99Tc), .sup.125I and amino acids comprising any radionuclides, including, but not limited to, .sup.14C, .sup.3H and .sup.35S. Generally, streptavidin labeled with a fluorochrome is utilized in the methods disclosed herein.
(234) In one embodiment, suspension of cells including T cells that specifically recognize one or more TASAs is produced, and the cells are reacted with the tetramer in suspension. In one embodiment, these reagents are used to label cells, which are then analyzed by fluorescence activated cell sorting (FACS). A machine for FACS employs a plurality of color channels, low angle and obtuse light-scattering detection channels, and impedance channels, among other more sophisticated levels of detection, to separate or sort cells. Any FACS technique can be employed as long as it is not detrimental to the detection of the desired cells. (For exemplary methods of FACS see U.S. Pat. No. 5,061,620.)
EXAMPLES
(235) The following examples are provided to illustrate certain particular features and/or embodiments and should not be construed as limiting.
Example 1
Intratumoral Gene Therapy Induces Cross-Priming of T Cells Reactive Against Tumor-Associated Stromal Antigens
(236) This example illustrates that cross-priming of CD8.sup.+ T cells reactive against TASA is a general paradigm for effective immunotherapy. The results show that protective CD8.sup.+ T cells induced as a consequence of effective intratumoral DC.IL12 therapy recognize both tumor-associated stromal cells (i.e. flow-sorted pericytes and VEC) and naturally-processed and HLA-A2-presented peptides derived from TASA. These data illustrate the therapeutic targeting of TASA (via intratumoral cytokine gene therapy or specific vaccination) as a means to treat vascularized solid tumors.
(237) Materials and Methods
(238) Mice. HHD mice fail to express H-2.sup.b class I molecules, with their cells instead expressing an HLA-A*0201-h?2 microglobulin single-chain (HHD) gene product (Firat et al., Int Immunol., 14:925-934, 2002). Ag-specific CD8.sup.+ T cell responses in HHD mice recapitulate those observed in HLA-A2.sup.+ human donors (Firat et al., Int Immunol., 14:925-934, 2002). Female 6-8 week old mice were used in all experiments and were handled in accordance with an Institutional Animal Care and Use Committee (IACUC)-approved protocol. HLA-A2 expression on peripheral blood cells isolated from HHD mice via tail venipuncture was confirmed by coordinate positive staining as assessed by flow cytometry using two monoclonal antibodies (mAbs) MA2.1 (reactive against HLA-A2 and HLA-B17) and BB7.2 (reactive against HLA-A2 and HLA-Aw69) (both monoclonal antibodies from the American Type Culture collection; ATCC, Manassas, Va.).
(239) Cell Lines and Culture. B16 is an HLA-A2.sup.neg, mMART-1.sup.+, mgp100.sup.+ melanoma cell line (syngenic to the H-2.sup.b background of HHD mice) known in the art (Hatano et al., J Transl Med., 2:40, 2004). The T2 cell line is an HLA-A2.sup.+, TAP-deficient human T-cell/B-cell hybridoma (Tatsumi et al., Cancer Res.; 63:4481-4489, 2003). Cell lines were free of mycoplasma contamination and were maintained in CM (RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum, 100 U/ml penicillin, 100 ?g/ml streptomycin, and 10 mM L-glutamine (all reagents from Life Technologies, Inc., Grand Island, N.Y.)) in a humidified incubator at 5% CO.sub.2 and 37? C.
(240) RT-PCR. Reverse transcriptase-PCR (RT-PCR) was performed using the primer pairs shown in Table 2. Cycling times and temperatures were as follows: initial denaturation at 94? C. for 2 min (1 cycle), denaturation at 94? C. for 30 sec, annealing at 60? C. for 30 sec and elongation at 72? C. for 1 min (30 cycles), final extension at 72? C. for 5 min (1 cycle). PCR products were identified by image analysis software for gel documentation (LabWorks 4.6 Software; UVP, Upland, Calif.) following electrophoresis on 1.2% agarose gels and staining with ethidium bromide (Sigma-Aldrich).
(241) TABLE-US-00004 TABLE2 RT-PCRprimers. Product Target RT-PCRprimers (bp) CD31 Forward5-3: 337 AGCCCACCAGAGAC ATGGAA (SEQIDNO:33) Reverse5-3: CTGGCTCTGTTGGA GGCTGT (SEQIDNO:34) DLK1 Forward5-3: 202 CTGCACACCTGGGT TCTCTG (SEQIDNO:35) Reverse5-3: GCATGGGTTAGGGG TACAGC (SEQIDNO:36) EphA2 Forward5-3: 232 GGGGATGCCAACAG CTATAA (SEQIDNO:37) Reverse5-3: CTCCTGCCAGTACC AGAAGC (SEQIDNO:38) gp100 Forward5-3: 296 CATCAATGGGAGCC AGGTGT (SEQIDNO:39) Reverse5-3: TGAAGGTTGAACTG GCGTGA (SEQIDNO:40) HBB Forward5-3: 480 TCAGAAACAGACAT CATGGTGC (SEQIDNO:41) Reverse5-3: TAGACAATAGCAGA AAAGGGGC (SEQIDNO:42) NG2 Forward5-3: 399 ACAGACGCCTTTGT TCTGCT (SEQIDNO:43) Reverse5-3: TCGGAAGAAATGTC CAGGAG (SEQIDNO:44) NRP1 Forward5-3: 299 TCCAAGTGGACCTG GGAGAT (SEQIDNO:45) Reverse5-3: TTCACAGCCCAGTA GCTCCA (SEQIDNO:46) NRP2 Forward5-3: 394 CCGGAAGAGACCTG TGGTTG (SEQIDNO:47) Reverse5-3: CCGATCGTCCCTTC CCTATC (SEQIDNO:48) PDGFR? Forward5-3: 301 TGCTCCTGGAGAGG CTTCTG (SEQIDNO:49) Reverse5-3: GGAGGAAGTGTTGA CTTCATTC (SEQIDNO:50) PSMA Forward5-3: 300 CCTGCGGTGAAGTC CTATCC (SEQIDNO:51) Reverse5-3: GTTTCCAGCAAAGC CAGGTC (SEQIDNO:52) RGS5 Forward5-3: 203 AAGTTGGGAATTCT CCTCCAG (SEQIDNO:53) Reverse5-3: TTCCTCACTGAATT CAGACTTC (SEQIDNO:54) TEM1 Forward5-3: 645 TTCACCAACTGGGC CCAGC (SEQIDNO:55) Reverse5-3: GTTGACACACATCT GCTGGC (SEQIDNO:56) VEGFR1 Forward5-3: 318 CCAACTACCTCAAG AGCAAAC (SEQIDNO:57) Reverse5-3: CCAGGTCCCGATGA ATGCAC (SEQIDNO:58) VEGFR2 Forward5-3: 271 ACAGACAGTGGGAT GGTCC (SEQIDNO:59) Reverse5-3: AAACAGGAGGTGAG CGCAG (SEQIDNO:60) ?-actin Forward5-3: 615 GGCATCGTGATGGA CTCCG (SEQIDNO:61) Reverse5-3: GCTGGAAGGTGGAC AGCGA (SEQIDNO:62)
(242) Fluorescence Imaging of Tumor Sections. Tumor tissue samples were prepared and sectioned as previously described (Komita et al., Cancer Res., 68: 8076-8084, 2008). For analysis of T cell subsets, sections were incubated with rabbit anti-mouse NG2 (Millipore, Bedford, Mass.) along with alexa488-conjugated anti-CD4 or -CD8? antibodies or matching isotype controls (all from BD Biosciences, San Jose, Calif.) for 1 h. After washing with 0.5% BSA in PBS, sections were stained with donkey anti-rabbit Ig cy5 (Jackson ImmunoResearch, West Grove, Pa.) secondary antibody for one hour at room temperature. For analysis of CD31 vs. NG2, sections were first incubated with rat anti-mouse CD31 (BD Biosciences) and rabbit anti-mouse NG2 (Millipore) antibodies for one hour at room temperature and then washed. Sections were then treated with donkey anti-rat Ig cy3 and donkey anti-rabbit Ig cy5 (both from Jackson ImmunoResearch) antibodies for 1 hr and washed. For the analysis of target antigens in B16 tumor lesions, all sections received dilutions of rat anti-mouse CD31 (BD Biosciences) and guinea pig anti-mouse NG2 (Burg et al. Cancer Res., 59:2869-2874, 1999) antibodies. In addition, each slide received an antibody reactive against a given TASA: rabbit anti-mouse antibody for DLK1 (R&D Systems, Minneapolis, Minn.), EphA2 (Santa Cruz Biotech., San Diego, Calif.), PSMA (Thermo Fisher Scientific, Rockford, Ill.), RGS5 (Sigma-Aldrich), VEGFR1 (Thermo Fisher Scientific) or goat anti-mouse antibody for HBB (Santa Cruz), NRP1 (R&D Systems), NRP2 (R&D Systems), PDGFR? (R&D Systems), VEGFR2 (Abcam, Cambridge, Mass.). Sections were then again washed five times with 0.5% BSA (in PBS), before a one hour incubation with dilutions of a mixture of secondary antibodies: i.) donkey anti-rat cy5 antibody, ii.) donkey anti-guinea pig DyLight 488 antibody, and iii.) either donkey anti-rabbit cy3 antibody or donkey anti-goat cy3 antibody depending on the species of antibody directed against the TASA target (all secondary antibodies were purchased from Jackson ImmunoResearch). After secondary Ab staining, sections were then washed with 3 washes of PBS, coverslipped with gelvatol mounting media (made in-house) and stored at 4? C. until imaging using an Olympus Fluoview 500 Confocal microscope (Olympus America, Center Valley, Pa.).
(243) Synthetic Peptides. The peptides shown in Table 4 were synthesized by 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. Peptides were >96% pure based on high performance liquid chromatography profile and mass spectrometric analysis.
(244) Generation of HHD Bone Marrow (BM)-derived DCs and DC.IL12. DC were generated from BM precursors isolated from the tibias/femurs of mice using in vitro cultures containing 1000 U/ml recombinant murine granulocyte/macrophage colony-stimulating factor (rmGM-CSF) and 1000 U/ml rmIL-4 (both from Peprotech, Rocky Hill, N.J.), as previously described (Komita et al., Cancer Res, 68: 8076-8084, 2008). The Ad.mIL-12p70 and Ad.?5 (empty) recombinant adenoviral vectors were produced as reported previously (Komita et al., Cancer Res 68: 8076-8084, 2008; Tatsumi et al., Cancer Res., 63: 6378-6386, 2003). Five million (day 5 cultured) DCs were infected at an MOI=50 with Ad.mIL-12p70 or the control, empty vector Ad.?5. While control DC produced <62.5 pg IL-12p70/ml/48 h/10.sup.6 cells, DC.IL12 cells produced 1-10 ng IL-12p70/ml/48 h/10.sup.6 cells (Komita et al., Cancer Res.; 68:8076-8084, 2008; Tatsumi et al., Cancer Res., 63:6378-6386, 2003).
(245) Intratumoral (i.t.) DC.IL12 therapy. B16 melanoma cells (1?10.sup.5) were injected subcutaneously in the right flank of HHD mice and allowed to establish for 7 days. Mice were then randomized into cohorts of 5 animals, with each cohort exhibiting an approximate mean tumor size of 30-50 mm.sup.2. On days 7 and 14, tumor-bearing mice were untreated or treated with intratumoral injections of 1?10.sup.6 adenovirus-infected dendritic cells (DC.?5 or DC.IL12) in a total volume of 50 ?L PBS. Tumor size was then assessed every 3 to 4 days and recorded in mm.sup.2, determined as the product of orthogonal measurements taken using vernier calipers. In some experiments, as indicated, in vivo antibody depletions (on days 6, 13 and 20 post-tumor injection) of CD4.sup.+ T cells or CD8.sup.+ T cells were performed as previously described (13). Data were reported as mean tumor area?SD. On day 17-19 post-tumor inoculation, CD8.sup.+ splenocytes and TIL were MACS-isolated from 3 mice/cohort, with cells pooled and assessed for reactivity against peptide epitopes or cell targets (pericytes, VEC, tumor cells).
(246) Evaluation of murine CD8.sup.+ T cell responses in vitro. To analyze Ag-specific responses, spleens and TIL were harvested (from 2 mice/group) 3-5 days after the second intratumoral injection of control DC or DC.IL12 (i.e. day 17-19 after tumor inoculation). Splenic lymphocytes were restimulated in vitro for 5 days with irradiated (2.5 Gy) na?ve peptide-pulsed HHD splenocytes at a stimulator:responder cell ratio of 1:1. Responder CD8.sup.+ T cells were then isolated using magnetic bead cell sorting (MACS; Miltenyi Biotec) and analyzed for reactivity against unpulsed or peptide-pulsed T2 cells, as indicated. To analyze T cell response to stromal cell targets and tumor cells, untreated HHD mice bearing established day 17-19 B16 tumors were sacrificed and tumors and kidneys removed. Tissues were then minced manually and enzymatically digested as described by Crisan et al. (Crisan et al., Cell Stem Cell., 3:301-313, 2008) using collagenases IA, II, and IV (Sigma-Aldrich) and DNAse I (Sigma-Aldrich) for 30 min. at 37? C., with gentle shaking. Cells were then being passed through a 70 micron cell strainer (BD-Biosciences), washed with PBS, and single cell suspensions stained with anti-mouse CD31 FITC (BD-Biosciences), anti-mouse CD140b (PDGFR?) PE (eBioscience), and anti-mouse H2-K.sup.b APC (BD-Biosciences). After washing with PBS, cells were sorted into enriched populations containing pericytes (PDGFR?.sup.+CD31.sup.negH-2K.sup.b(neg)) or VEC (PDGFR?.sup.negCD31.sup.+H-2K.sup.b(neg)) using a multicolor fluorescence-activated cell sorter (FACSAria, BD-Biosciences). In all cases, cells were >95% pure for the stated phenotype. CD8.sup.+ T cells (10.sup.5) were then co-cultured with 10.sup.4 pericytes or VEC in U-bottom 96-well plates (Sigma-Aldrich). To verify HLA-A2 restricted recognition of target cells by CD8.sup.+ T cells, 10 ?g of anti-HLA-A2 mAb BB7.2 or control anti-HLA-class II mAb L243 (both from ATCC) were added to replicate co-culture wells. Forty-eight hours after initiating splenic CD8.sup.+ T cell co-cultures, cell-free supernatants were collected and analyzed for mIFN-? content using a commercial ELISA (BD-Biosciences) with a lower limit of detection of 31.3 pg/ml. Data were reported as the mean?SD of triplicate determinations. Alternatively, freshly-sorted CD8.sup.+ TIL were co-cultured with pericytes, VEC, T2 cells (+/?peptides) or B16 tumor cells at a T cell-to-target cell ratio of 3:2 for 4-5 h at 37? C. and analyzed for intracellular levels of IFN-? or cell-surface expression of CD107a/b using specific monoclonal antibodies (APC-labeled anti-mouse CD8? from eBioscience; PE-labeled rat anti-mouse IFN-? and FITC-labeled rat anti-mouse CD107a/b from BD Biosciences) and flow cytometry using the manufacturer's suggested protocol and ref. (Mittendorf et al., Breast Cancer Res Treat., 92:85-93, 2005), respectively.
(247) In vitro assessment of human CD8.sup.+ T cell responses against TASA- or TAA-derived peptides. Peripheral blood mononuclear cells (PBMC) were obtained by venipuncture or leukapheresis from HLA-A2.sup.+ normal donors or HLA-A2.sup.+ melanoma patients with written consent under IRB-approved protocols (Table 3). CD8.sup.+ T cells were then isolated by MACS (Miltenyi Biotec, Auburn, Calif.) and either not stimulated or stimulated with autologous, TASA peptide-pulsed DC as previously described (Tatsumi et al., Cancer Res., 63:4481-4489, 2003). Normal donor T cells were stimulated with TASA peptide-pulsed DC twice on a weekly schedule, with responder T cells harvested for analysis of their specificity 5 days after the booster stimulation (i.e. day 12 of T cell-DC co-culture). Melanoma patient CD8.sup.+ T cells were analyzed after a single round of stimulation with TASA peptide-pulsed, autologous DC (i.e. day 5 of T cell-DC co-culture) as indicated. For DC-based stimulations, DC were pulsed with an equimolar (1 ?M each) pool of the TASA peptides (Table 4) for 4 h at 37? C. at 5% CO.sub.2 tension. These antigen-loaded DC were then used to stimulate autologous CD8.sup.+ T cells at a T cell-to-DC ratio of 10:1 to generate a bulk population of responder T cells. T cells were maintained in IMDM media supplemented with 10% human AB serum, 100 U/ml penicillin, 100 mg/ml streptomycin, 10 mM L-glutamine and MEM non-essential amino acids (all reagents from Invitrogen, except human AB serum that was purchased from Sigma-Aldrich, St. Louis, Mo.). Responder CD8.sup.+ T cells were analyzed for reactivity against control (HLA-A2.sup.+) T2 cells or T2 cells pulsed with individual TASA or TAA peptides (1 ?M for 4 h at 37? C.) at a CD8.sup.+ T cell-to-T2 cell ratio of 5:1 for 24 h. Harvested cell-free supernatants were consequently assessed for hIFN-? content using a specific ELISA (BD Biosciences, San Diego, Calif.) with a lower detection limit of 4.7 pg/ml.
(248) Statistical analysis. Student's two-sided t-test and one-way ANOVA were used to test for overall differences between groups (StatMate III, ATMS Co., Tokyo, Japan), with a p value<0.05 taken as significant.
(249) Results
(250) Analysis of TASA expression in the TME. TASA are expressed by pericytes and/or activated VEC (Komita et al., Cancer Res., 68:8076-8084, 2008; Hatano et al., J Transl Med., 2:40, 2004; Maciag et al., Cancer Res., 68:8066-8075, 2008; Ishizaki et al., Clin Cancer Res., 12:5841-5849, 2006; Wada et al., Cancer Res., 65:4939-4946, 2005; Kaplan et al., Vaccine, 24: 6994-7002, 2006; Liu et al., Cytokine, 32:206-212, 2005; Silver et al., Clin Cancer Res., 3:81-85, 1997; Harada et al., Oncol Rep., 12:601-607, 2004; Bondjers et al., Am J Pathol., 162:721-729, 2003; Boss et al., Clin Cancer Res.; 13:3347-3355, 2007; Christian et al., Am J Pathol., 172:486-494, 2008). An initial panel of 12 antigens was selected for evaluation in the current studies (Table 4). To show that the chosen TASA were indeed expressed in situ by stromal cells in the TME, immunohistochemistry analyses were performed using specific antibodies on tissue sections isolated from day 14 (HLA-A2.sup.neg) B16 melanomas growing progressively in untreated HLA-A2 Tg (HHD) mice. Using immunofluorescence microscopy, co-expression patterns of specific stromal target antigens were determined with NG2.sup.+ pericytes and/or CD31.sup.+ VEC within the TME. The resulting images are depicted in
(251) TABLE-US-00005 TABLE 3 Cells expressing TASA in the B16 TME.* Cells Expressing TASA Cells Expressing TASA Protein (IHC) TASA mRNA (RT-PCR) DLK1 P P (Hi) > VEC (2.1) EphA2 VEC VEC (3.3) HBB P P (Hi) > VEC (Hi) NG2 P P NRP1 P, VEC, T/S P (2.0), T > VEC (Pericyte/VEC interface) NRP2 P, VEC P (1.6) (Intracellular) PDGFR? P > T/S P (2.3), T PSMA VEC, P (Vesiculated, punctuate) VEC RGS5 P > T/S P (1.7) (Cytoplasmic) TEM1 T/S, VEC, P P (1.5), VEC (1.6) VEGFR1 VEC, P, T/S (Intracellular/Nuclear) VEC (1.8) > P (2.6), T VEGFR2 P > VEC, T/S P (1.6) > VEC (4.5), T *Progressor B16 tumors (day 14) in untreated HHD mice were surgically-resected, then fixed, sectioned and stained using TASA-specific Abs, as described in FIG. 1A and the Materials and Methods. Based on co-localization of TASA with the NG2 and/or CD31 markers in fluorescence microscopy analyses, a pericyte (P)- and/or VEC-association was assigned with a given marker, respectively. In some cases, TASA were also expressed by NG2.sup.neg, CD31.sup.neg cells (designated as T/S = tumor/stromal) in the TME, which could reflect either tumor cells or alternate stromal cell populations. RT-PCR analyses were performed on flow-sorted tumor-derived pericytes and VEC and tumor cells as described in FIG. 1B and the Materials and Methods. Numbers in parentheses reflect the fold increase in expression of transcripts in tumor versus normal kidney pericytes or VEC, as indicated, after first normalizing densitometry signals against ?-actin in each case. (Hi) indicates the TASA transcript is expressed by tumor pericytes/VEC, but not normal kidney pericytes/VEC.
(252) Selection of TASA peptides for immunologic analyses. Of the selected TASA, HLA-A2-presented epitopes recognized by CD8.sup.+ T cells have been previously reported for human EphA2, NG2, PSMA, RGS5, VEGFR1 and VEGFR2 (Table 4). Notably, these defined human epitopes share 100% sequence identity with their murine homologues. To identify novel HLA-A2-presented epitopes in the alternate 6 selected TASA, a prediction algorithm (see, e.g., .bimas.cit.nih.gov/molbio/hla_bind/) was applied to each protein, and nonameric (9-mer) and/or decameric (10-mer) peptides were preferentially chosen for synthesis and corollary analyses based on 2 priority criteria: i.) a high algorithm predicted binding score to the HLA-A2.1 class I molecule, and ii.) identity in the human versus murine peptide sequences. This latter restriction was adopted for translational purposes; i.e. to insure that specific therapy-induced T cell responses would need to break operational tolerance in HLA-A2 Tg (HHD) recipient mice in order to provide anti-tumor protection (i.e. as would also need to occur for protection in HLA-A2.sup.+ patients with solid cancers). After selection, each of the chosen synthetic peptides was shown to be competent (to a varying degree) to bind and stabilize HLA-A2 complexes expressed by T2 cells (
(253) TABLE-US-00006 TABLE4 Summaryofinvitroresults regardingTASApeptides.* SpecificCD8.sup.+T CellResponse.sup.a HHDMice Treated HLA-A2+ HLA-A2+ Immunogenic SEQ HLA-A2 With Normal Melanoma AA Peptide ID Binding i.t. Donors Patients TASA Positions Sequence NO: Score.sup.b DC.IL12 (of8) (of10) DLK1 269-277 RLTPGVHEL 68 49 + 1 4 310-318 ILGVLTSLV 2 118 + 2 6 326-334 FLNKCETWV 3 1760 + 2 4 EphA2.sup.c 883-891 TLADFDPRV 10 1084 + 2 6 HBB 31-39 RLLVVYPWT 70 227 + 2 6 105-114 RLLGNVLVCV 72 592 + 1 1 NG2.sup.d 770-778 TLSNLSFPV 83 403 - 0 4 2238-2246 LILPLLFYL 14 1356 - 0 4 NRP1 331-339 GLLRFVTAV 6 2249 + 2 7 433-441 GMLGMVSGL 75 131 + 2 7 869-877 VLLGAVCGV 8 1006 + 2 1 NRP2 214-222 DIWDGIPHV 15 56 + 0 4 328-336 YLQVDLRFL 16 249 + 0 4 436-444 NMLGMLSGL 17 131 - 0 0 PDGFR? 890-898 ILLWEIFTL 81 1792 + 2 1 PSMA.sup.e 441-450 LLQERGVAYI 18 920 + 0 2 RGS5.sup.f 5-13 LAALPHSCL 79 1 + 0 5 TEM1 691-700 LLVPTCVFLV 76 1577 + 4 4 VEGFR1.sup.g 770-778 TLFWLLLTL 19 182 + 1 3 VEGFR2.sup.h 773-781 VIAMFFWLL 20 270 + 0 0 *.sup.aCD8.sup.+ T cell response data is summarized for i.) HHD mice treated with DC.IL-12 gene therapy (as in FIG. 2C) or ii.) HLA-A2.sup.+ normal human donors and HLA-A2.sup.+ patients with melanoma as displayed pictorially in FIG. 4. Human (ELISA) responses were designated as + if CD8.sup.+ T cell reactivity against T2 cells presenting the indicated peptide (IFN-?) was >30 pg/ml and more than 2 fold higher than reactivity versus T2 cells pulsed with the negative control HIV-nef.sub.190-198 peptide (p < 0.05). .sup.bPeptide sequences were submitted to an algorithm predicting binding to HLA-A2, with the deduced scores provided. A higher number reflects the prediction of a more stable HLA-A2-peptide complex. .sup.c(see Tatsumi et al., Cancer Res; 63: 4481-4489, 2003). .sup.d(see Maciag et al., Cancer Res. ,68: 8066-8075, 2008). .sup.e(see Harada et al., Oncol. Rep., 12: 601-607, 2004). .sup.f(see Boss et al.,Clin. Cancer Res., 13: 3347-3355, 2007). .sup.g(see Ishizaki et al., Clin. Cancer Res., 12: 5841-5849, 2006). .sup.h(see Wada et al., Cancer Res., 65: 4939-4946, 2005).
(254) Delivery of DC.IL12 into HLA-A2.sup.neg B16 tumors promotes the cross priming of CD.sup.8+ T cells reactive against tumor pericytes, VEC and an array of TASA-derived peptide epitopes in HHD mice. DC.IL12 were prepared and injected directly into subcutaneous (HLA-A2.sup.neg) B16 melanomas growing progressively in HLA-A2 Tg HHD mice on days 7 and 14 post-tumor inoculation. On day 19 post-tumor inoculation, the mice were euthanized and CD8.sup.+ splenic T cells were analyzed for their ability to secrete IFN-? in response to stimulation with TASA-derived peptides presented by the HLA-A2.sup.+ T2 cell line.
(255) Intratumoral delivery of DC.IL12 resulted in dramatically reduced tumor growth (
(256) The impact of therapy on the ability of CD8.sup.+ tumor-infiltrating lymphocytes (TIL) freshly-isolated from day 17 tumors to recognize flow-sorted pericytes and VEC, as well as, TASA peptides presented by T2 cells was assayed. Using both intracellular IFN-? staining (
(257) CD8.sup.+ T cells from HLA-A2.sup.+ normal donors or HLA-A2.sup.+ melanoma patients recognize TASA-derived peptides in vitro. To assess whether the TASA-derived peptides identified in the HHD tumor model were also capable of being recognized by human CD8.sup.+ T cells, IVS was performed using T cells isolated from the peripheral blood of HLA-A2.sup.+ donors or HLA-A2.sup.+ patients with melanoma. DC were pulsed with peptides derived from a given TASA for 4 h at 37? C., then washed and used as stimulator cells for autologous CD8.sup.+ T cells. In cases where more than one peptide existed for a given protein, DC were pulsed with an equimolar (10 ?M) mixture of each peptide. Two rounds of IVS using TASA for normal donors and a single-round of IVS using TASA for melanoma patients was applied. HLA-A2.sup.+ normal donors (
(258) As shown in
(259) TABLE-US-00007 TABLE 5A Normal donor and melanoma patient demographics and responsiveness to TASA.* Donor Age Sex Stage Prior Therapy ND1 51 M N/A N/A ND2 62 F N/A N/A ND3 37 M N/A N/A ND4 28 M N/A N/A ND5 50 F N/A N/A ND6 32 F N/A N/A ND7 26 M N/A N/A ND8 38 F N/A N/A Mel1 62 F IIA S Mel2 69 M IV Anti-CTLA4 Mel3 55 F IIC C Mel4 87 F IIC MAA-VAC, IL-2 Mel5 65 M IV C, R Mel6 71 M IV GM2-KLH Mel7 56 F IV C Mel8 64 F IV C, IFN Mel9 62 F IV C, IFN Mel10 56 M IV C, IFN, IL-2 *Abbreviations used in Table 5A: AD, Active disease; C, Chemotherapy; CTLA-4, Cytototoxic T lymphocyte antigen-4; DC, dendritic cell, F, Female; IFN, Interferon-?, IL-2, Interleukin-2; GM2, Ganglioside M2; KLH, Keyhole limpet hemocyanin; M, Male; NED, No evidence of disease; R, Radiotherapy; S, Surgery; MAA, Melanoma-associated antigen; VAC, Vaccine.
(260) TABLE-US-00008 TABLE 5B Normal donor and melanoma patient demographics and responsiveness to TASA: Specific CD8.sup.+ T cell Production of IFN-? in Response to TASA. Donor DLK1 EphA2 HBB NG2 NRP1 NRP2 PFGFR? PSMA RGS5 TEM1 VEGFR1 VEGFR2 ND1 + ? ? ? + ? ? ? ? + ? ? ND2 + ? + ? + ? + ? ? + ? ? ND3 + + ? ? ? ? ? ? ? + ? ? ND4 ? ? ? ? ? ? + ? ? ? ? ? ND5 ? + ? ? + ? ? ? ? + + ? ND6 ? ? ? ? + ? ? ? ? ? ? ? ND7 ? ? ? ? ? ? ? ? ? ? ? ? ND8 + ? + ? ? ? ? ? ? ? ? ? Mel1 + + + ? + + ? ? + + ? ? Mel2 + + + ? + + ? ? + ? ? ? Mel3 ? + + ? + ? ? ? ? ? ? ? Mel4 + + + + + + ? + + + + ? Mel5 ? ? ? ? + + ? ? ? ? ? ? Mel6 + + + + + ? ? + + ? + ? Mel7 ? ? + ? + ? ? ? ? + + ? Mel8 + ? ? + + ? + ? + + ? ? Mel9 + + ? + ? ? ? ? ? ? ? ? Mel10 ? ? ? ? ? ? ? ? ? ? ? ? Human responses were designated as + if T cell reactivity against T2 cells presenting the indicated peptide (IFN-? ELISA) was >30 pg/ml and more than 2 fold higher than reactivity versus T2 cells pulsed with the negative control HIV-nef.sub.190-198 peptide (with p < 0.05 versus T2 + HIV-nef.sub.190-198).
(261) Without being bound by theory, this data suggests the translational utility of TASA peptides in the context of active vaccination protocols and/or clinical trials implementing immunotherapeutic/anti-angiogenic approaches (including IL-12p70 gene therapy, tyrosine kinase inhibitors (TKI) or VEGFR antagonists) for the treatment of solid cancers, such as melanoma.
Example 2
Vaccines Targeting Tumor Blood Vessel Antigens Promote CD8+ T Cell-Dependent Tumor Eradication or Dormancy in HLA-A2 Transgenic Mice
(262) This example illustrates that therapeutic vaccination of HHD mice with TBVA-peptides results in CD8.sup.+ T cell-dependent regression of colon carcinoma and melanoma and long-term protection against disease relapse.
(263) Materials and Methods
(264) Mice. HHD mice are D.sup.b??.sub.2-microglobulin (?.sub.2M) null, transgenic for the modified HLA-A*0201-h?.sub.2-microglobulin single chain (HHD gene; Firat et al., 1999, Eur. J. Immunol. 29: 3112-3121) and exhibit CD8.sup.+ T cell responses that recapitulate those observed in HLA-A2.sup.+ human donors (28-30). C57BL/6 wild-type mice were purchased from The Jackson Laboratory (Bar Harbor, Me.). Female 6-8 week old mice were used in all experiments and were handled in accordance with an Institutional Animal Care and Use Committee (IACUC)-approved protocol.
(265) Cell Lines. MC38, a methylcholanthrene-induced (HLA-A2.sup.neg) murine colon carcinoma cell line and B16 an HLA-A2.sup.neg melanoma cell line (syngenic to the H-2.sup.b background of HHD mice) have been described previously (Yamaguchi et al., 2007, Cancer 110: 1469-1477, Hatano et al., 2004, J. Transl. Med. 2: 40). The T2 cell line is a TAP-deficient T-cell/B-cell hybridoma that constitutively expresses HLA-A2 (Stuber et al., 1994, Eur. J. Immunol. 24: 765-768). All cell lines were free of mycoplasma contamination.
(266) Peptides. All peptides were synthesized using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. Peptides were >96% pure based on high performance liquid chromatography profile and mass spectrometric analysis.
(267) Production of Murine Bone Marrow (BM)-derived DCs and DC.IL12. DC were generated from BM precursors isolated from the tibias/femurs of HHD mice, as previously described (28). The Ad.mIL-12p70 and Ad.?5 (empty) recombinant adenoviral vectors were produced as reported previously (34). Five million (day 5 cultured) DCs were infected at MOI=50 with Ad.mIL-12p70 or the control, empty vector Ad.?5. While control DC produced <62.5 pg IL-12p70/ml/48 h/10.sup.6 cells, DC.IL12 cells produced 1-10 ng IL-12p70/ml/48 h/10.sup.6 cells (Komita et al., Cancer Res., 68:8076-8084, 2008).
(268) Vaccine Experiments. For prophylactic experiments, HHD mice were immunized subcutaneously on the right flank with 100 ?l PBS or PBS containing 10.sup.6 syngenic DC.IL12 cells that had been untreated or pre-pulsed for 4 h at 37? C. with 10 ?M synthetic peptide(s). Immunizations occurred on days ?14 and ?7, with mice subsequently receiving injections of MC38 (2?10.sup.6) tumor cells in the left flank on d0. In all cases, treatment groups contained 5 mice per cohort. For analysis of tumor cellular composition in repeat experiments, MC38 tumors were isolated by surgical resection 10 days after tumor inoculation and prepared for fluorescence imaging, as described below. For therapeutic experiments, MC38 (2?10.sup.6) or B16 melanoma cells (1?10.sup.5) were injected subcutaneously in the right flank and allowed to establish/progress for 7 days, at which time, the mice were randomized into cohorts of 5 mice each, with each group exhibiting an approximate mean tumor size of 50-75 mm.sup.2. Mice were then untreated or treated with control, syngenic DC.IL12 or DC.IL12 (10.sup.6 cells injected subcutaneously in the left flank on days 7 and 14) pulsed with synthetic TBVA peptides. In some assays, as indicated, in vivo antibody depletions (on days 6, 13 and 20 post-tumor inoculation to assess early involvement or on days 60 and 67 or 180 and 187 to assess late involvement) of protective CD4.sup.+ T cells or CD8.sup.+ T cells were performed and monitored as previously described (Zhao et al., Mol Ther., 19:805-814, 2011). In all cases, tumor size (area) was monitored every 3-4 days and is reported as mean+/?SD in mm.sup.2.
(269) Evaluation of Specific CD8.sup.+ T Cell Responses in HHD Mice. MACS (Miltenyi Biotec) CD8.sup.+ splenocytes were harvested (from 3 mice/group) 7 days after the second round of DC-based vaccination (i.e. day 21 after tumor inoculation) and analyzed for reactivity against unpulsed T2 cells, TBVA peptide-pulsed T2 cells, or day 19 (flow-sorted) B16-derived PDGFR?.sup.+CD31.sup.negH-2K.sup.b(neg) pericytes or PDGFR?.sup.negCD31.sup.+H-2K.sup.b(neg) VEC isolated as previously described (Zhao et al., Mol Ther., 19:805-814, 2011). Where indicated, 10 ?g of anti-HLA-A2 mAb BB7.2 or control anti-class II mAb L243 (both from ATCC, Manassas, Va.) were added to replicate co-culture wells. After 48 h, supernatants were analyzed for mIFN-? content by specific ELISA (BD-Biosciences; lower detection limit=31.3 pg/ml). Data are reported as the mean?SD of triplicate determinations.
(270) RT-PCR. Reverse transcriptase-PCR (RT-PCR) was performed using primer pairs as described in Example 1.
(271) Fluorescence Imaging of Tumor Sections. Tumor tissue samples were prepared and 6 micron sections prepared as previously reported (Komita et al., Cancer Res., 68:8076-8084, 2008). The following Abs were used: (for T cell analyses), rabbit anti-mouse NG2 (Millipore, Bedford, Mass.) and alexa488-conjugated anti-CD4 or -CD8? antibodies or matching isotype controls (all from BD-Biosciences); (for vascular analyses), rat anti-mouse CD31 (BD-Biosciences) and rabbit anti-mouse NG2 (Millipore) Abs; (for TBVA), rat anti-mouse CD31 (BD-Biosciences) and guinea pig anti-mouse NG2 Abs, along with anti-TBVA as described in Example 1. Imaging was performed using an Olympus Fluoview 500 Confocal microscope (Olympus America, Center Valley, Pa.).
(272) Cutaneous wound healing assays. Wound healing analyses were performed in HHD mice as described by Maciag et al. (Maciag et al., Cancer Res., 68:8066-8075, 2008).
(273) Statistical analysis. Two-tailed Student's t-test or two-way ANOVA were used to test overall differences between groups (StatMate III, ATMS Co., Tokyo, Japan), with p-values<0.05 considered significant.
(274) Results
(275) Vaccines incorporating peptide epitopes derived from TBVA are immunogenic and protect HHD mice against HLA-A2.sup.neg MC38 tumor challenge. To assess the immunogenicity of TBVA-derived peptides, female HLA-A2 Tg (HHD; lacking murine H-2.sup.b class I molecules) mice were vaccinated twice on a weekly schedule with 10.sup.6 peptide-pulsed, (HHD) DC.IL12 cells. One week after the booster immunization, CD8.sup.+ splenocytes were isolated and analyzed for their ability to secrete IFN-? in response to peptide-pulsed HLA-A2.sup.+ T2 cells in vitro. As shown in
(276) The DLK1, EphA2, HBB, NG2, NRP1, NRP2, PDGFR?, PSMA, RGS5, TEM1, VEGFR1 and VEGFR2 antigens were expressed in situ by blood vessel cells in the MC38 colon carcinoma TME (
(277) Protective vaccines incorporating TBVA peptides promote enhanced infiltration of the TME by CD8.sup.+ T cells in association with an inhibition of tumor vascularity. MC38 tumor lesions from all cohorts of animals with evidence of disease on day 14 (post-tumor inoculation) were isolated and immunofluorescence microscopy on tumor sections was performed. Although control (untreated or vaccinated with DC.IL12/no peptide) mice contained few CD8.sup.+ T cells in the TME, the majority of the peptide vaccinated cohorts exhibited a variable, but significantly elevated number of CD8.sup.+ TILs (
(278) Therapeutic vaccines incorporating TBVA-derived peptide epitopes are effective against established HLA-A2.sup.neg MC38 colon carcinomas and HLA-A2.sup.neg B16 melanomas in HHD mice. Given the robust anti-tumor activity noted for vaccines based on a subset of TBVA in the prophylactic model, the efficacy of these vaccines as immunotherapies in mice bearing established day 7 subcutaneous MC38 or B16 tumors was assayed. In the MC38 model, HHD mice were treated with DC.IL12 cells pulsed with (an equimolar mixture of) peptides derived from TBVA shown most capable of regulating tumor growth under prophylactic conditions (
(279) Therapeutic vaccines applied to mice bearing B16 melanomas were also effective in suppressing tumor growth if: i) the vaccine-incorporated peptides derived from the stromal antigens DLK1, EphA2, HBB, NRP1, RGS5 (and to a lesser extent TEM1) and ii) recipient mice were competent to respond to these peptides in an HLA-A2-restricted manner (
(280) HHD mice cured of B16 tumors by TBVA peptide-based therapeutic vaccines exhibit extended survival and durable Tc1 responses against tumor-associated pericytes and/or VEC, and spreading in anti-TBVA CD8.sup.+ T cell repertoire. Mice treated as in
(281) TABLE-US-00009 TABLE6 Invivoimmunogenicityandanti-tumor efficacyofTBVA-basedvaccines inHHDmodels.* Tc1 Anti-tumor Response Anti-tumor efficacyin to efficacy B16therapy Peptide inMC38 model AA Peptide SEQ Vaccine protection (survival: TASA Positions Sequence IDNO (HHD).sup.a model.sup.b pvalue).sup.c DLK1 269-277 RLTPGVHEL 68 + + .0013 310-318 ILGVLTSLV 2 + 326-334 FLNKCETWV 3 + EphA2 883-891 TLADFDPRV 10 + + .0012 HBB 31-39 RLLVVYPWT 70 + + .0012 105-114 RLLGNVLVCV 72 + NG2 770-778 TLSNLSFPV 83 - + NS 2238-2246 LILPLLFYL 14 + NRP1 331-339 GLLRFVTAV 6 + + .0013 433-441 GMLGMVSGL 75 + 869-877 VLLGAVCGV 8 + NRP2 214-222 DIWDGIPHV 15 + - NT 328-336 YLQVDLRFL 16 - 436-444 NMLGMLSGL 17 - PDGFR? 890-898 ILLWEIFTL 81 + + NS PSMA 441-450 LLQERGVAYI 18 + - NT RGS5 5-13 LAALPHSCL 79 + + .0012 TEM1 691-700 LLVPTCVFLV 76 + + .0102 VEGFR1 770-778 TLFWLLLTL 19 + +/- NS VEGFR2 773-781 VIAMFFWLL 20 + +/- NS *Data are summarized from FIG. 9 and FIG. 11. .sup.a+, p < 0.05 versus DC only. .sup.bVaccines consisted of DC.IL12 pulsed with a pool of 1 or more peptides derived from the indicated TBVA. +/-, p < 0.05 versus DC only for 2 consecutive time points; - not significant at any time point analyzed. .sup.cp-value versus mice treated with DC only vaccine (from FIG. 11C). NS, not significant; NT, not tested.
(282) HHD mice cured of B16 tumors by TBVA peptide-based therapeutic vaccines either exhibit true molecular cures or a state of CD8.sup.+ T cell-mediated tumor dormancy. Effectively-treated HHD mice with no evidence of (macroscopic) disease were depleted of CD8.sup.+ or CD4.sup.+ T cells on days 60 and 67, or 180 and 187 by injection of specific antibodies in vivo. As shown in
(283) To show that that prior vaccination against TASA does not inhibit wound-healing in HHD mice, female HHD mice (5 animals/cohort) were vaccinated in the right flank on d-14 and d-7 with saline, 106 DC.IL12 alone or 106 DC.IL12 pulsed with peptides derived from the indicated TASA. In cases where more than one peptide is identified for a given TASA, an equimolar pool of the indicated peptides (each 10 ?M) was pulsed onto DC.IL12 and used for vaccination in the relevant cohort. On d0, mice were anesthetized, with skin on the upper back shaved and sterilized topically, before placement of two 3-mm diameter wounds using a sterilized punch biopsy instrument. Wounds were not treated consequently and no infections were observed in any animals. The time to closure for the 10 wounds/cohort (2 sites/animal?5 mice/group) was assessed daily and is reported as the mean number of days+/?SD for complete wound closure (
(284) To determine expression of selected TASA in tissue, RT-PCR analysis of stromal antigen expression by pericytes, VEC and tumor cells in MC38 tumor-bearing mice was examined (
(285) Thus, a subset of TBVA-derived peptides elicit protective/therapeutic immunity against HLA-A2.sup.neg (MC38 or B16) transplantable tumors in HHD mice due to the apparent CD8.sup.+ T cell targeting of HLA-A2.sup.+ pericytes or VEC in the TME. Without being bound by theory, because similar peptide-based vaccines applied to CD8-depleted HHD mice or HLA-A2.sup.neg recipient (C57BL/6) mice failed to yield treatment benefit, indicating involvement of CD8.sup.+ T cells and the need for these effector cells to target HLA-A2.sup.+ stromal cells in vivo. Additionally, many responders in the therapeutic vaccine models retained occult disease, since CD8.sup.+, but not CD4.sup.+, T cell depletion of such animals resulted in the rapid recurrence of tumors selectively at the site of the original primary lesion in many cases. While in most instances, recurrent tumors grew quickly and proved lethal, in some cases (i.e. 2/10), tumors grew slowly and subsequently underwent spontaneous regression presumably after the Ab-depleted CD8.sup.+ T cell repertoire had recovered. Without being bound by theory, these data indicate that TBVA peptide-based vaccines can promote either complete eradication of tumors or the establishment of a state of (occult) tumor dormancy over extended periods of time which is regulated by vaccine-instigated CD8.sup.+ T cells.
Example 3
Therapeutic Vaccination Against Tumor Pericyte-Associated Antigen DLK1
(286) This example provides evidence that the NOTCH antagonist delta-like kinase-1 (DLK1) peptides can be used therapeutically, such as, but not limited to, in treatments for renal cell carcinoma.
(287) Renal cell carcinoma is highly-vascularized and refractory to conventional chemo-/radio-therapy (Motzer and Bukowski, J Clin Oncol. 2006; 24:5601-5608). Current first-line therapeutic agents for RCC patients include anti-angiogenic drugs (such as tyrosine kinase inhibitors (TKI) or anti-VEGF antibodies) have yielded high rates of objective clinical response (Escudier et al., J Clin Oncol. 2009; 27:4068-4075; Naijar and Rini, Ther Adv Med Oncol. 2012; 4:183-194). However, responder patients typically relapse quickly based on the evolution of treatment-refractory disease (Helfrich et al., J Exp Med. 2010; 207:491-503). Given such limitations in durable clinical benefits associated with existing treatment options, there remains a great need to develop alternative and/or improved therapies for patients with RCC. In this regard, RCC is considered an immunogenic cancer as patients may exhibit immune-associated spontaneous or therapeutic tumor regression (Finke et al., Ann NY Acad Sci. 1988; 532:387-394; Muul et al., J Immunol. 1987; 138:989-995; Lokich, Am J Clin Oncol. 1997; 20:416-418). Hence, novel therapies capable of improving the magnitude and recruitment of protective immunity into the TME could expand and prolong clinical benefits, and their development remains a mandate.
(288) High-dose cytokine therapy promotes durable complete responses in a minority of treated RCC patients, however, off-target toxicities have limited general use of this approach (Biswas and Eisen, Nat Rev Clin Oncol. 2009; 6:478-487), and more specific/focused immunotherapy approaches are warranted. Vaccines targeting cancer cell-associated antigens are safe and immunogenic in the clinical setting, but they have limited curative value (Vjuanovic and Butterfield, J Cell Biochem. 2007; 102:301-310). While many factors could limit the effectiveness of current cancer vaccines, major obstacles to success include poor delivery and/or functional stability of vaccine-induced tumor infiltrating lymphocytes (TIL) and phenotypic heterogeneity of tumor cell populations permitting immune evasion in vivo (Ahmed et al., Curr Cancer Drug Targets. 2008; 8:447-453, Zhao et al., J Immunol. 2012; 188:1782-1788). To circumvent such limitations to treatment success, vaccines promoting specific Tc1 recognition of tumor vascular cell (i.e. pericytes, VEC) populations can be used (see, for example, Komita et al., 2008, Cancer Res. 2008; 68:8076-8084).
(289) As disclosed below, pericytes isolated from RCC, but not normal kidney tissue, express the DLK1 antigen in vivo. Using immunofluorescence microscopy and real-time PCR the NOTCH antagonist delta-like kinase-1 (DLK1) was identified as an antigen differentially expressed by blood vessel pericytes in highly-vascularized renal cell carcinoma (RCC) tumors, but not in normal kidney tissue. DLK1 peptide- and gene-based vaccines applied to mice bearing established RCC tumors provided therapeutic benefits in association with tumor blood vessel normalization (based on decreased vascular permeability and intratumoral hypoxia) and the activation and recruitment of CD8.sup.+ T cells into the tumor microenvironment (TME). Post DLK1-based vaccination, the TME was characterized by increased expression of VCAM1.sup.+CD31.sup.+ vascular endothelial cells and the CXCL10 (IP-10) chemokine associated with superior recruitment of Type-1 (IFN-? producing) proinflammatory T effector cells and a dramatic reduction in Jarid1B.sup.+, CD133.sup.+ and CD44.sup.+ stem cell populations.
(290) DLK1 peptide- or gene-based vaccines are both immunogenic and therapeutic in the RENCA model of RCC. Effectively treated RCC tumors displayed vascular normalization based on reduced vascular leak and tissue hypoxia, and were highly-infiltrated by CD8.sup.+ TIL in the perivascular space. Residual pericytes in the TME were tightly-approximated to CD31.sup.+ VEC and were deficient in expression of DLK1, supportive of vaccine-induced immunoselection of mature mural cell populations in vivo. The results support that vaccines targeting tumor-associated vascular antigens can be used for RCC therapy, and for the treatment of other vascularized solid cancers. Vaccines promoting immune targeting of tumor-associated vascular cells are a therapeutic modality permitting durable normalization of blood vessels in solid cancers, including RCC
(291) Material and Methods
(292) Mice. Female 6-8 week old BALB/c mice were purchased from The Jackson Laboratory (Bar Harbor, Me.) and maintained in a pathogen-free animal facility.
(293) Tumor cells. The mouse renal cell carcinoma cell line RENCA was purchased from the American Type Culture Collection (ATCC, Manassas, Va.) and cultured in complete media as previously reported (Komita et al. Cancer Res. 2008; 68:8076-8084). The cell line was negative for known mouse pathogens, including mycoplasma.
(294) Stromal cell isolation. Human RCC tumor and adjacent (patient-matched) normal kidney specimens were analyzed. Murine RCC tumors and tumor uninvolved kidneys were harvested surgically after euthanasia, 21 days after s.c. injection of 10.sup.6 RENCA cells into syngenic BALB/c recipient animals. Human and murine tissues were then minced manually, enzymatically digested, and pericytes and VEC isolated by flow sorting, as previously described (Crisan et al., Cell Stem Cell. 2008; 3:301-313). Murine cells were labeled with anti-mouse CD34-FITC (eBioscience, San Diego, Calif.), anti-mouseCD146-PE (BD-Biosciences, San Diego, Calif.), and anti-mouse CD45-APC (BD-Biosciences) prior to sorting into pericyte (CD146.sup.+CD34.sup.negCD45.sup.neg) and VEC (CD146.sup.+CD34.sup.+CD45.sup.neg) populations using a multi-color fluorescence-activated cell sorter (FACSAria; BD Biosciences). In all cases, cells were >95% pure for the stated phenotype.
(295) Real-time PCR. Messenger RNA was isolated from pericytes and VEC using the RNeasy? Plus Micro kit (Qiagen, Valencia, Calif.) according to manufacturer's instructions. cDNA was then generated using High Capacity RNA-to-cDNA kit (Applied Biosystems, Carlsbad, Calif.) according to manufacturer's instructions. Real-time PCR was performed using Fast SYBR? Green Master Mix (Applied Biosystems) with primer pairs for human or mouse HPRT1 (Qiagen), human DLK1 (Applied Biosystems) or mouse DLK1 (forward primer: TGTGACCCCCAGTATGGATT, SEQ ID NO: 63, reverse primer: CCAGGGGCAGTTACACACTT, SEQ ID NO: 64). Reactions were performed in duplicate in a 96-well reaction plate on a StepOnePlus real-time PCR thermocycler (Applied Biosystems). Cycling conditions were 95? C. for 20 min., then 35 cycles of 95? C. for 3 min. and 60? C. for 30 min.
(296) In vitro generation of bone marrow-derived dendritic cells (DC) and DC.IL12. DC were generated in 5-day rIL-4+rGM-CSF-supplemented cultures from bone marrow precursors isolated from the tibias/femurs of BALB/c mice infected with recombinant adenovirus encoding mouse IL-12p70 (yielding DC.IL12), as previously described (Zhao et al., Mol Ther. 2012; 19:805-814).
(297) Synthetic peptides. The H-2.sup.d class I-presented DLK1.sub.158-166 (CPPGFSGNF; presented by H-2L.sup.d), DLK1.sub.161-169 (GFSGNFCEI; presented by H-2K.sup.d), DLK1.sub.259-270 (TILGVLTSLVVL; containing overlapping DLK1.sub.259-267 and DLK1.sub.262-270 sequences presented by H-2K.sup.d) peptide were synthesized as previously described (Zhao et al., J Immunol. 2012; 188:1782-1788).
(298) Recombinant lentiviral vector production. Genes encoding mDLK1 and the reverse sequence of mRGS5 (as a negative control) were cloned into the pLenti6/V5 D-TOPO vector downstream of the CMV promoter using the Lentiviral Directional TOPO? Expression Kit (Invitrogen, Grand Island, N.Y.). To determine insert presence in the plasmid, expression of the V5 tag was detected by immunofluorescence using an anti-V5 FITC antibody (Invitrogen) and by Western blot using an anti-V5 HRP antibody (Invitrogen). In the initial production of the lentiviruses, 293FT cells (Invitrogen) were transfected with plasmid DNA pLenti-DLK1 (or pLenti-NEG) using VIRAPOWER? Packaging Mix (Invitrogen) combined with Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. After 48 hours, lentivirus was collected and concentrated using a Fast-Trap Virus Purification and Concentration kit (Millipore). Lentiviral (lvDLK1 and lvNEG) titers, reported in transduction units (TU), were determined by quantitating blasticidin (Invitrogen)-resistance in HT-1080 cells according to the manufacturer's instructions. Expanded lentiviral production was performed by the University of Pittsburgh Cancer Institute Lentiviral Vector Core Facility. Lentivirus quality was assessed by infecting HT-1080 cells for 24 h and monitoring cells for coordinate V5 protein expression (Western blot) and cell-surface expression of DLK1 (flow cytometry using an anti-DLK1-PE antibody; Adipogen, San Diego, Calif.).
(299) Animal therapy experiments. BALB/c mice received s.c. injection of 10.sup.6 RENCA tumor cells (right flank) on day 0. Six days later, the animals were randomized into cohorts of 5 mice with comparable mean tumor sizes. On days 7 and 14 after tumor implantation, mice were treated with 100 ?l s.c. injections (left flank) of PBS, 10.sup.6 DC.IL12 or 10.sup.6 DC.IL12 that had been pre-pulsed for 2 h at 37? C. with an equimolar (10 ?M) mixture of the DLK1.sub.158-166, DLK1.sub.161-169 and DLK1.sub.259-270 peptides. For lentivirus vaccination experiments, randomized BALB/c mice bearing established (day 10; right flank) s.c. RENCA tumors received a single left flank intradermal injection of lvDLK1 or negative control lvNEG at a dose of 40 TU or 200 TU in a total volume of 50 ?l PBS. For all animal experiments, tumor size was assessed every 3 to 4 days and recorded in mm.sup.2, as determined by the product of orthogonal measurements taken using vernier calipers. Data are reported as mean tumor area?SD.
(300) Evaluation of specific CD8.sup.+ T cell responses in vitro. Spleens were harvested from 3 mice per group 7 days after the second DC injection. Splenocytes were then stimulated in vitro for 5 days with syngenic DC pulsed with an equimolar (10 ?M) mix of the 3 DLK1 peptides applied in the vaccine. Responder CD8.sup.+ T cells were then isolated using magnetic bead cell sorting (Miltenyi Biotec) and co-cultured with DC pulsed with individual DLK1 peptides for 72 h, 37? C. and 5% CO.sub.2, at which time cell-free supernatants were analyzed for IFN-? content using a cytokine-specific ELISA (BD-Biosciences).
(301) Fluorescent imaging of tumors. Tumor tissue samples were prepared and sectioned as previously reported (Komita et al., Cancer Res. 2008; 68:8076-8084). Six-micron tissue sections were analyzed for expression of CD31 (BD-Biosciences), VCAM1 (R & D Systems, Minneapolis, Minn.), CXCL10 (R & D Systems), NG2 (Millipore, Billerica, Mass.), DLK1 (Santa Cruz), RGS5, Jarid1b (all from Abcam; Cambridge, Mass.), CD133 (BD-Biosciences), CD44 (Abcam) by immunofluorescence microscopy. For analysis of cellular apoptosis, tissue sections were labeled using TUNEL kit (Roche; Indianapolis, Ind.) as per manufacturer's instructions, followed by incubation with secondary anti-streptavidin Cy3 antibody (Jackson Immunoresearch, West Grove, Pa.). Some sections were analyzed by confocal microscopy to generate 30 ?m 3-dimensional reconstructions of images. For the vascular permeability imaging, animals received retro-orbital intravenous injections of FITC-labeled tomato lectin (Sigma) and red 20 nm FLUOSPHERES? (Invitrogen), followed by cardiac perfusion of PBS and 4% paraformaldehyde. Tumors were then immediately resected and imaged by confocal microscopy to generate 17 ?m 3-dimensional reconstructions.
(302) Hemoglobin quantitation. The amount of hemoglobin contained in tissues was quantitated using the Drabkin method (Klungsoyr et al., Scand J Clin Lab Invest. 1954; 6:270-276). Hemoglobin content is reported as ?g Hb per mg wet weight of tissue.
(303) Measurement of tumor hypoxia using pimonidazole. BALB/c mice bearing established (treated or untreated) day 21 s.c. RENCA tumors were injected intraperitoneally (i.p.) with 60 mg/kg pimonidazole hydrochloride (HYPOXYPROBE?; HPI Inc., Burlington, Mass.) 30 min prior to euthanasia and tumor harvest and 6 ?m tissue sections prepared and analyzed by immunohistochemistry as previously reported (Komita et al., Cancer Res. 2008; 68:8076-8084).
(304) Statistical analysis. Comparisons between groups were performed using a two-tailed Student's t test or one-way Analysis of Variance (ANOVA) with Tukey post-hoc analysis, as indicated. All data were analyzed using SigmaStat software, version 3.5 (Systat Software, Chicago, Ill.). Differences between groups with a p-value<0.05 were considered significant.
(305) Results
(306) RCC-associated pericytes differentially express the DLK1 antigen. In the previous analysis of the therapeutic vaccines incorporating peptides derived from each of twelve individual tumor blood vessel-associated antigens, it was noted that vaccines targeting delta-like kinase-1 (DLK1) were most effective in HLA-A2 transgenic recipient mice. To apply DLK1 peptide and gene-based vaccines to the only available transplantable murine model of RCC, RENCA, the pattern of DLK1 expression by cells within the TME was first investigated. RENCA tumors and tumor-uninvolved normal kidneys were removed from syngenic BALB/c mice and processed into single cell suspensions. Pericytes and VEC were then isolated via flow sorting (
(307) Therapeutic treatment of RENCA tumor-bearing mice with a DLK1 peptide-based vaccine is effective and associated with specific Tc1 activation and recruitment into the TME. The superior immunogenicity of a vaccine formulation composed of DC.IL12 pulsed with MHC class I-presented peptides to promote T helper-independent priming of specific CD8.sup.+ T cells (see above and Zhao et al., J Immunol. 2012; 188:1782-1788, Zhao et al., Mol Ther. 2012; 19:805-814). Using H-2.sup.d class I-presented peptide epitopes derived from the murine DLK1 protein (i.e. DLK1.sub.158-166, DLK1.sub.161-169 and DLK1.sub.259-270), the impact of treating BALB/c mice bearing established RENCA tumors with a DLK1 peptide-based vaccine was analyzed. As depicted in
(308) A coordinate fluorescence microscopy analysis if tumor sections revealed that RENCA-bearing mice treated with the DLK1 peptide-based vaccine had fewer CD31.sup.+ blood vessels in the TME than control treatment cohorts, and these vessels contained VEC with an activated, VCAM1.sup.+ phenotype (
(309) Vaccination with a recombinant lentivirus encoding murine DLK1 cDNA is therapeutic in the RENCA model. Clinical trials implementing synthetic peptide-based vaccines are only applicable to subsets of cancer patients given the need to restrict accrual to individuals expressing relevant HLA class I (peptide-presenting) allotypes. The anti-tumor efficacy of a genetic vaccine was evaluated that would allow host antigen-presenting cells to process and present DLK1 peptides in a manner conducive to activate a broad anti-DLK1 (CD8.sup.+ and CD4.sup.+) T cell repertoire in any individual, regardless of their HLA type. Lentiviral-based vaccines promote prolonged antigen-specific CD8.sup.+ T cell responses after a single administration in vivo (He et al. Immunity. 2006; 24:643-656). Thus, a recombinant lentivirus encoding full-length murine DLK1 (lvDLK1) and a negative control virus (lvNEG) was engineered.
(310) To assess the therapeutic efficacy of specific genetic vaccination against the DLK1 antigen, RENCA-bearing mice were injected s.c. at a distal site with 40 TU or 200 TU of lvDLK1 or lvNEG in PBS. Animals injected with lvDLK1 at either dose exhibited significant reductions in tumor growth compared to animals treated with lvNEG (
(311) Vaccination with a lvDLK1 normalizes the RENCA vasculature. It has been suggested that in the absence of pericytes, the tumor vasculature appears normalized, with lower densities of blood vessels and reduced vascular permeability in the TME (24), supporting therapeutic strategies designed to selectively reduce or eradicate vascular pericytes within sites of tumor. Given the ability of the lvDLK1-based genetic vaccine to reduce the content of DLK1.sup.+ cells in the tumor stroma, further evidence was sought supporting therapeutic vascular normalization as a consequence of treatment with the lvDLK1 genetic vaccine. It was initially noted that RENCA tumors harvested from mice treated with lvDLK1 appeared anemic when compared to control tumors (
(312) Tumors were analyzed for expression of NG2 (a general pericyte marker in both normal and tumor tissues; Stallcup, J Neurocytol. 2002; 31:423-435) using immunofluorescence microscopy, it was observed that animals receiving injections of lvDLK1 displayed tumors with significant reductions in NG2.sup.+ pericytes versus tumors from animals vaccinated with lvNEG (
(313) Therapeutic vaccination with lvDLK1 results in reduced hypoxia and a lower incidence of hypoxia-responsive cell populations in the TME. Hypoxia frequently occurs in solid tumors as a consequence of their aberrant blood vessels inefficiently perfusing oxygen into the TME (Matsumoto et al., Proc Natl Acad Sci USA. 2009; 106:17898-17903; Jain, Semin Oncol. 2002; 29:3-9), resulting in reduced effector T cell (i.e. TIL) function, increased production of immunosuppressive modulators, dysregulated angiogenesis, and an accumulation of cancer stem cells (Wilson and Hay, Nat Rev Cancer. 2012; 11:393-410). To investigate changes in hypoxia within tumors after vaccination with lvDK1 versus lvNEG, mice were injected i.p. with pimonidazole, which detects low [<1.3%] O.sub.2 tension (Levesque et al., Stem Cells. 2007; 25:1954-1965), and performed immunohistochemical analysis. Tumors isolated from mice receiving lvDLK1 vaccines had a very low hypoxic index when compared to tumors culled from control animals (
(314) Therapeutic vaccination with lvDLK1 results in increased apoptosis of tumor cells distal to residual blood vessels in the treated TME. Given the trimming of vascular branches in the RENCA TME and reduction in vascular permeability after vaccination with lvDLK1 (but not lvNEG), it was hypothesized that plasma nutrients required for sustaining tumor cell viability would be limited to regions proximal to the residual, normalized blood vessel network. TUNEL analyses revealed that indeed, the level of cellular apoptosis in the TME of lvDLK1-treated mice was substantially increased when compared with tumors isolated from control treated animals (
(315) Thus, it has been documented that DLK1 is a tumor pericyte-associated antigen that can be immunologically targeted via specific peptide- or gene-based vaccination in vivo, leading to the effective normalization of the tumor vasculature and the TME. Effective therapeutic vaccination resulted in the activation of Type-1 (IFN-? producing) DLK1-specific CD8.sup.+ T cells in the periphery (spleen) and the improved recruitment of CD8.sup.+ T cells into the TME with a focused localization around residual tumor blood vessels. After treatment with DLK1-based vaccines, the therapeutically-normalized blood vessels in RENCA tumors exhibited a simple conduit design with tightly-approximated (abluminal) DLK1-deficient pericyte populations and activated VCAM1.sup.+ VEC that appeared improved in their structural integrity based on reductions in vascular leakiness/permeability. As a consequence, progressively-growing RENCA tumors became normoxic after treatment with DLK1-based vaccines, with regions of the tumor mass that were distal to the residual normalized blood vessel network undergoing apoptotic death. Concomitantly, the CXCL10 chemokine responsible for recruiting Type 1 proinflammatory effector cells was dramatically upregulated only in DLK1-vaccinated mice, which coincided with improved accumulation of CD8.sup.+ TIL. These findings support a paradigm in which specific immune effector T cells may serve as regulators of the angiogenic switch by monitoring and controlling the status of DLK1.sup.+ pericytes within the TME.
(316) Conditional activation of the Wnt/?-catenin/NOTCH signaling pathway leads to vascular normalization (Reis et al. J Exp Med. 2012; 209:1611-1627), as indicated by reduced vascular density and improved mural cell attachment, in intracranial murine gliomas. Without being bound by theory, since DLK1 serves as a functional antagonist to NOTCH signaling (Falix et al., Biochim Biophys Acta. 2012; 1822:988-995), its therapeutic removal from the TME as a consequence of DLK1-based vaccination in the present studies would be expected to lead to the de-repression of NOTCH signaling in RENCA tumors. As such, immune-mediated inhibition of DLK1 expression in the TME may represent a protector of NOTCH signaling, thereby maintaining the tumor angiogenic-switch in the off position (Leslie et al., Development. 2007; 134:839-844, Siekmann and Lawson, Cell Adh Migr. 2007; 1:104-106).
(317) The therapeutically normalized TME post-vaccination with lvDLK1 was largely devoid of cell populations harboring stem-like phenotypes, regardless of whether such cells represented bona fide cancer stem cells or mesenchymal stem cells or alternate stem cell populations recruited into the TME. Without being bound by theory, the treatment-associated difference in tumor-associated stem cells could reflect the ability of vaccine-induced T cells to: i.) alter the supportive TME thereby limiting the recruitment, accumulation or expansion of such stem cell populations in the TME; ii.) promote the loss of hypoxia in the TME, leading to transcriptional silencing of stem cell markers, many of which have hypoxia-responsive elements (HRE) in their promoter regions (Liang et al., BMC Cancer. 2012; 12:201; Mathieu et al., Cancer Res. 2011; 71:4640-4652); iii.) promote the corollary cross-priming (Mathieu et al., supra) of specific immune responses against alternate tumor-associated stromal antigens (including stem cell antigens like Jarid1B, CD133 and CD44 among others) leading to specific stem cell regulation/eradication in vivo. Additionally, without being bound by theory, it is possible that stem cells are directly targeted by anti-DLK1 Tc1, since cells expressing DLK1 may also co-express stem cell markers, including CD133, c-kit, and SOX2 (Metsyanim et al., PLoS One. 2009; 4:e6709). Cancer stem cells employ many of the same signaling pathways as normal stem cells, including NOTCH (Takebe et al., Nat Rev Clin Oncol. 2011; 8:97-106); therefore, it is also feasible that effective silencing of DLK1 leads to a maturation event (and altered phenotypes) in stem cell populations within the TME. These mechanisms are clearly not mutually-exclusive and a combination of these may be involved in the biologic outcomes disclosed herein.
(318) The anti-angiogenic action mediated by the DLK1 vaccine-induced CD8.sup.+ T cell repertoire would differ, and likely complement, that of alternative anti-angiogenic treatment modalities such as anti-VEGF antibodies (i.e. bevacizumab) and small molecule tyrosine kinase inhibitors (i.e. sunitinib) (Helfrich et al., J Exp Med. 2010; 207:491-503; Rini and Atkins, Lancet Oncol. 2009; 10:992-1000; Faivre et al., Nat Rev Drug Discov. 2007; 6:734-745). DLK1-based vaccines could represent a logical second-line approach in the many cases of developed resistance to bevacizumab or sunitinib. Pericytes freshly-isolated from human RCC (but not patient-matched normal adjacent kidney tissue) display differential DLK1 expression. DLK1-based vaccines can be used as treatment of patients with vascularized forms of cancer.
Example 4
Clinical Trial
(319) This example provides a clinical trial to study intradermal administration of ?DC1s loaded with a mixture of six TBVA-derived peptides at the time of, or a cycle prior to, starting study treatment with the TKI dasatinib. Current therapeutic approaches available for patients with advanced-stage melanoma remain inadequate, and existing approaches including those involving immunotherapy with cytokines and/or targeted strategies have resulted in disappointingly low rates of durable and complete responses. Correcting immune dysfunction in advanced-stage melanoma patients using TKI such as dasatinib is proposed to relicense the patient's immune system to respond optimally to specific immunization. The integration of antigens expressed by tumor-associated blood vessel cells provides a means to selectively target the genetically-/antigenically-heterogeneous population of tumor cells in the advanced-stage melanoma patient.
(320) CD8.sup.+ T cell responses are analyzed against the TBVA DLK1, EphA2, HBB, NRP1, RGS5, and TEM1 in peripheral blood of HLA-A2.sup.+ melanoma patients prior to, during the course of, and one month after the last dose of dasatinib. Based on the strong Type-1 polarizing potential of ?DC1 in vitro, these vaccines enhance Type-1 CD8.sup.+ T cell responses against at least 3 of the 6 peptides included in the vaccine (particularly when patients receive concurrent dasatinib administration, as this removes the regulatory action of MDSC/Treg suppressor cells).
(321) A mixture of six TBVA-derived epitopes is evaluated to be applied to ?DC1s as an intradermal vaccine injection into 28 HLA-A2.sup.+ patients with advanced-stage melanoma. This choice is based on the finding of superior anti-tumor efficacy in HLA-A2 transgenic tumor models for the pooled peptide vaccine approach and the relevance of the TBVA-derived peptides (which share sequence identity in both human and mouse TBVA) in the HLA-A2.sup.+ human patient setting. The combinational vaccine+dasatinib modeling suggest that optimal therapeutic benefit against established M05 melanoma occurred when sunitinib administration was initiated at the time of initial vaccination or at the time of boosting.
(322) Systemic review and meta-analysis of previous DC-based vaccine trials in cancer patients suggests that: i.) vaccine-induced T cell responses are associated with beneficial clinical outcome; ii.) mature DC (such as ?DC1) were superior activators of specific immunity and a better clinical prognosis when compared to immature DC; iii.) while a threshold dose of DC is required in the vaccine in order to promote specific immunity, a vast increase in DC number over that threshold did not generally yield superior efficacy (Eggert et al., Cancer Res. 1999; 59: 3340-3345; Linette et al., Clin Cancer Res. 2005; 11: 7692-7699; Verdijk et al., Clin Cancer Res. 2009; 15: 2531-2540; Lesterhuis et al., Clin Cancer Res. 2011; July 19 [Epub ahead of print]; Castiglione and Piccoli, J Theor Biol. 2007; 247: 723-732; Draube et al., PLoS One. 2011; 6: e18801). A recent study by Verdijk et al. suggests that intradermal delivery of DC-based vaccines in patients with advanced stage melanoma was clinically equitable to the delivery of these cells directly into lymph nodes (Verdijk et al, op. cit.), while a report from Lesterhuis and colleagues argues that intradermal delivered DC-based vaccines were superior to intranodal delivered vaccines in promoting melanoma-specific T cell activation in vivo (Lesterhuis et al., op cit.). In vivo tracking of intradermal injected DC in melanoma patients suggests that approximately 4% of the administered DC actually migrate to tissue-draining lymph nodes and that the delivery of approximately 5?10.sup.5 (vaccine) DC are needed to promote clinically-meaningful levels of antigen-specific T cells (Verdijk et al., op. cit.). By extrapolation, these figures indicate that intradermal injection of a vaccine containing approximately 10.sup.7 mature antigen-loaded ?DC1 would be anticipated to provide a quasi-optimal degree of immune stimulation that may be associated with clinical benefit. Pre-clinical, clinical, and mathematical modeling all suggest that optimal vaccine-induced immunity and benefit to the tumor-bearing host can be best achieved through repeated immunization (3-5 vaccines) provided over a regular-interval schedule. Since there is no consensus in the literature for an optimal time interval between the individual vaccinations, a protocol was adopted involving 4 intradermal vaccines every 2 weeks, which is a commonly employed schedule for DC-based vaccines (Lesterhus et al., op cit.).
(323) A single-center, prospective randomized, pilot, Phase 2 trial is conducted evaluating the activity, safety and immune effects of dasatinib given in combination with an autologous type-1 polarized DC vaccine. Dasatinib is administered at the standard dose and schedule recommended by the FDA (70 mg BID). The autologous type-I DC vaccine is administered either prior to, or concomitant with, the initiation of dasatinib administration. Patients are vaccinated intradermally with the ?DC1/peptide mixture on days 1 and 15 of every cycle on an outpatient basis. For those patients starting therapy with vaccine alone, dasatinib is initiated on day 29 after receiving the first immunization. Unless patients are removed from study, they are treated for at least 6 cycles or disease progression. In cases where there is continued clinical benefit and no additional vaccine product is available, patients can continue to be treated on single agent dasatinib.
(324) Leukapheresis
(325) Leukapheresis (90 minutes) is a minimal risk procedure. Prior to the procedure each subject's venous access is evaluated. If a subject does not have acceptable venous access a pheresis catheter is put in place. All selected patients undergo a single 90 minute-long limited leukapheresis once they have been deemed eligible and prior to the first course of vaccination. One time of the subject's blood volume is processed per procedure.
(326) Leukapheresed product is immediately, and a part of it is used for the first vaccination course (Week 1). The remainder of the product is cryopreserved as described. If cytopenia (WBC<2000/mm.sup.3 or platelets<40,000/mm.sup.3) develops during, or as a result of, leukapheresis, the procedure is postponed until recovery. This will not be considered an adverse event. Samples from each cell product are obtained for hemoglobin, hematocrit, total WBC, and differential and platelet count.
(327) Vaccine
(328) Formulation
(329) Dendritic cells (DC) are derived from autologous (the subject's own) adherent mononuclear cells (monocytes) in the peripheral blood obtained from leukapheresis. In this case, biologic product and biologic substance are the same.
(330) Storage and Preparation
(331) The final product is placed in vials with labels identifying each unique vaccine lot and cryopreserved. DCs used in the vaccine are suspended in 5% human serum albumin (HSA) and delivered to the clinic for administration. For preparation of the vaccines, the labeled vials of cryopreserved ?DC1 are removed from storage in liquid nitrogen and quickly thawed in a 37? C. water bath. After 3 washes in sterile medium, thawed ?DC1 are suspended in saline with 5% human serum albumin (HSA), placed in sterile syringes for administration to the subject and delivered to the clinic for administration. Each syringe is labeled with a custom-designed label, identifying the subject and the vaccine. Both saline and HSA are clinical grade.
(332) Administration
(333) The autologous type-I DC vaccine are administered intradermally either prior to, or concomitant with, the initiation of dasatinib administration. The injections are performed on an outpatient basis.
(334) Dendritic cell-based vaccines have been extensively evaluated in thousands of cancer patients over the past 15 years) and found to be safe and extremely well-tolerated.
(335) Study Treatment Plan
(336) No investigational or commercial agents or therapies other than those described below are administered with the intent to treat the patient's malignancy.
(337) Dasatinib Administration
(338) All patients receive dasatinib at a starting dose of 70 mg twice daily by mouth in the outpatient setting. Dasatinib is supplied as 50 mg and 20 mg tablets. Patients take 1 of the 50 mg tablets and 1 of the 20 mg tablets twice daily, approximately every 12 hours, at the same time each day. Dasatinib may be taken with or without food. Patients swallow the tablets whole.
(339) Patients on Arm A start dasatinib administration on cycle 2, day 1 (week 5), while those patients in Arm B start dasatinib administration on cycle 1, day 1 (week 1). Study treatment continues for at least 6 cycles or disease progression. In case of vaccine depletion patients may continue on dasatinib alone and there is evidence of clinical benefit.
(340) The dosing time is adjusted as required for subject convenience. If doses are missed for toxicity, they are not replaced. If a dose is not taken due to an error, it may be taken up to 12 hours later. If vomiting occurs within 30 minutes of intake, that dose is repeated.
(341) TABLE-US-00010 REGIMEN DESCRIPTION Premedications/ Cycle Agent Precautions Dose Route Schedule Length ?DC1 Vaccine None 10.sup.7 cells Intradermal Arms A and B: every 2 weeks 28 days injection starting on Cycle 1, day1 (4 weeks) Dasatinib Take with or 70 mg Orally, Arm A: Daily starting on without food twice a day Cycle 2, day 1 Arm B: daily starting on Cycle 1, day 1
Vaccine Administration
(342) The DC vaccine is administered by a single intradermal injection of approximately 10.sup.7 cells (a minimum of 5?10.sup.6 cells is allowable due to manufacturing limitations), with all the DCs being administered on days 1 and 15 of each cycle. The intradermal administration is in the vicinity of the four nodal drainage groups of the four extremities and performed on an outpatient basis. Study treatment will continue for at least 6 cycles or disease progression.
(343) Duration of Study Treatment
(344) In the absence of treatment delays due to adverse events, treatment continues for at least 6 cycles until one of the following criteria applies: Disease progression, Intercurrent illness that prevents further administration of treatment, Unacceptable adverse event(s), Patient decides to withdraw from the study, or General or specific changes in the patient's condition render the patient unacceptable for further treatment in the judgment of the investigator/sub-investigator, Study is terminated, or Loss of ability to freely provide consent
(345) Duration of Follow Up
(346) Patients are followed for 1 year after removal from study or until death, whichever occurs first.
(347) Study Calendar
(348) Schedules Shown in the Study Calendar Below are Provided as an Example and Should be Modified as Appropriate.
(349) Baseline evaluations are conducted within 1 week prior to start of protocol therapy. Scans and x-rays are done ?4 weeks prior to the start of therapy. In the event that the patient's condition is deteriorating, laboratory evaluations are repeated within 48 hours prior to initiation of the next cycle of therapy.
(350) TABLE-US-00011 Week Up to - Off Study 4.sup.d 1 2 3 4 5 6 7 8 Treatment.sup.f Informed consent X HLA-A2 Screening.sup.a X BRAF, c-KIT X mutation.sup.a Demographics X Medical history X Physical exam X X X X X Vital signs X X X X X Height X Weight X X X X X Performance status X X X X X CBC w/diff, platelets X X X X X X X X X X Serum chemistry.sup.b X X X X X X X X X X B-HCG.sup.c X EKG (as indicated) X Leukapheresis X Dasatinib Arm A X X X X Arm B X X X X X X X X DC Vaccine X X X X Immune monitoring- X X X X X X PBMC Tumor Biopsy X X AE evaluation ? X .fwdarw. X Tumor measurements X Tumor measurements are repeated every 8 weeks. X Documentation (radiologic) must be provided for patients removed from study for progressive disease. Radiologic evaluation X Radiologic measurements should be performed every 8 weeks. .sup.X.sup.g .sup.aNot necessary if already known; .sup.bAlbumin, alkaline phosphatase, total bilirubin, bicarbonate, BUN, calcium, chloride, creatinine, glucose, LDH, phosphorus, potassium, total protein, SGOT [AST], SGPT [ALT], sodium, magnesium; .sup.cSerum pregnancy test (women of childbearing potential); .sup.dScreening is to be performed in the UPCI-CTRC; e: Treatment with DC vaccine and dasatinib will continue for at least 6 cycles (or until disease progression), the weeks of those cycles will follow the tests and procedures listed for weeks 5 through 8 above for each subsequent cycle; .sup.fFour weeks after the last dasatinib administration; .sup.gIf removed from the study for reasons other than DP.
Dose-Limiting Toxicities
Definition of Dose-Limiting Toxicity
(351) Toxicities are scored according to the NCI Common Terminology Criteria for Adverse Events (NCI CTCAE) v4.0.
(352) Dose-limiting toxicity (DLT) is defined as the following study drug-related events experienced during Cycle 1: Grade 4 neutropenia or thrombocytopenia which lasts more than 7 days; Grade 3 or 4 febrile neutropenia; or Grade 3 or greater non-hematological toxicities; this includes grade 3 or greater diarrhea, nausea or vomiting which last more than 7 days despite adequate treatment (with loperamide for diarrhea, 5HT3 antagonists, steroids and dopamine antagonist for N/V).
Dasatinib Dosing Delays/Modifications
(353) TABLE-US-00012 Dose Level Dasatinib Dose 0 70 mg BID ?1 50 mg BID ?2 100 mg QD
(354) The study uses the CTCAE (Common Terminology Criteria for Adverse Events) version 4.0 for toxicity and serious adverse event reporting.
(355) Patient Selection
(356) Inclusion Criteria
(357) Patients are HLA-A2.sup.+ and have histologically confirmed melanoma that is metastatic (Stage IV) or unresectable Stage IIIB/C and for which standard curative or palliative measures do not exist or are no longer effective. Patients have measurable disease by RECIST 1.1, defined as at least one lesion that can be accurately measured in at least one dimension (longest diameter to be recorded for non-nodal lesions and short axis for nodal lesions) as ?20 mm with conventional techniques or as ?10 mm with spiral CT scan, MRI, or calipers by clinical exam. Patients have at least 2 subcutaneous, intracutaneous, and accessible tumor deposits, lymph node or other site available for biopsy purposes. Prior chemotherapy, immunotherapy, or targeted therapy is allowed as long as it did not include dasatinib. Age?18 years. Because no dosing or adverse event data are currently available on the use of dasatinib in patients<18 years of age, children are excluded. ECOG performance status?2 (Karnofsky?60%) Life expectancy of greater than 12 weeks. Patients have normal organ and marrow function as defined below: Leukocytes?3,000/?L absolute neutrophil count?1,500/?L absolute lymphocyte count?500/?L platelets?100,000/?L total bilirubin within normal institutional limits AST(SGOT)/ALT(SGPT)?2.5?institutional upper limit of normal Creatinine?2.0?institutional upper limit of normal Serum magnesium, potassium and adjusted (or ionized) calcium?the institutional lower limit of normal. (Supplementation of electrolytes prior to screening is allowed). Sexually active women and men of childbearing potential agree to use an effective method of birth control during the course of the study and for up to 3 months following the last dose of the study drug, in a manner such that risk of pregnancy is minimized. Surgical sterilization, intrauterine device or barrier method (e.g. condom and/or diaphragm with spermicidal agents) are acceptable forms of birth control. Women of childbearing potential have a negative pregnancy test (serum) within 7 days prior to treatment. A pregnancy test is not required for registration. Women who have not menstruated for more than 2 years are considered postmenopausal, thus not of childbearing potential.
Exclusion Criteria Patients who have had chemotherapy or radiotherapy within 4 weeks (6 weeks for nitrosoureas or mitomycin C) prior to entering the study or those who have not recovered from adverse events due to agents administered more than 4 weeks earlier. Patients with documented c-KIT mutations. Patients who are receiving any other investigational agents. Patients with known brain metastases should be excluded from this clinical trial because of their poor prognosis and because they often develop progressive neurologic dysfunction that would confound the evaluation of neurologic and other adverse events. History of allergic reactions attributed to compounds of similar chemical or biologic composition to dasatinib or any of the components of the vaccine being administered as part of this study. Women who are pregnant or nursing/breastfeeding. History of significant bleeding disorder unrelated to cancer, including: Diagnosed congenital bleeding disorders (e.g., von Willebrand's disease) Diagnosed acquired bleeding disorder within one year (e.g., acquired anti-factor VIII antibodies) Patients currently taking medications that inhibit platelet function (i.e., aspirin, dipyridamole, epoprostenol, eptifibatide, clopidogrel, cilostazol, abciximab, ticlopidine, and any non-steroidal anti-inflammatory drug) because of a potential increased risk of bleeding from dasatinib. Patients currently taking anticoagulants (warfarin, heparin/low molecular weight heparin [e.g., danaparoid, dalteparin, tinzaparin, enoxaparin]) because of a potential increased risk of bleeding from dasatinib. Diagnosis of unstable angina or myocardial infarction within 6 months of study entry. Patients currently taking one or more of the following drugs that are generally accepted to have a risk of causing Torsades de Pointes: quinidine, procainamide, disopyramide amiodarone, sotalol, ibutilide, dofetilide erythromycins, clarithromycin chlorpromazine, haloperidol, mesoridazine, thioridazine, pimozide cisapride, bepridil, droperidol, methadone, arsenic, chloroquine, domperidone, halofantrine, levomethadyl, pentamidine, sparfloxacin, lidoflazine. Diagnosed or suspected congenital long QT syndrome. Prolonged QTc interval on pre-entry electrocardiogram (>450 msec) within 30 days prior to study registration. Any history of clinically significant ventricular arrhythmias (such as ventricular tachycardia, ventricular fibrillation, or Torsades de pointes) Uncontrolled intercurrent illness including, but not limited to, ongoing or active infection, symptomatic congestive heart failure, unstable angina pectoris, cardiac arrhythmia, or psychiatric illness/social situations that would limit compliance with study requirements. HIV-positive patients on combination antiretroviral therapy are ineligible because of the potential for pharmacokinetic interactions with dasatinib. In addition, these patients are at increased risk of lethal infections when treated with marrow-suppressive therapy. Appropriate studies are undertaken in patients receiving combination antiretroviral therapy when indicated.
Research Samples
(358) Patient peripheral blood and tumor biopsies are obtained at various time points prior to, and after, the initiation of therapy. If the patient is determined to express the HLA-A2 antigen on their peripheral blood cells, to express a wild-type phenotype, and they pass all additional inclusion/exclusion criteria, after written consent, they are entered on trial. Those patients determined to express c-KIT mutations are excluded from study, while BRAF mutational status is used to stratify patients during randomization to ensure a balanced proportion of patients with the mutation on both arms.
(359) Biopsy Tissue.
(360) Melanoma biopsies are obtained prior to the first vaccination (baseline) and week 5 (date of the third vaccination). Patients should have at least 2 subcutaneous, intracutaneous, and accessible tumor deposits, lymph node or other site available for biopsy purposes.
(361) Blood Samples
(362) At least 3 weeks prior to study treatment, peripheral blood is obtained for the screening of patient HLA-A2 expression status and for baseline testing. Peripheral blood is obtained every 2 weeks on trial beginning week 2.
(363) Correlative Studies
(364) HLA-A2/TBVA peptide dextramer.sup.+CD8.sup.+ T cells (i.e. CD8.sup.+ T cells imaged by flow cytometry using a fluorescently-labeled, antigen-specific probe) exhibits higher frequencies in the peripheral blood and a greater propensity to produce IFN-? after the initiation of ?DC1-based vaccines. Since dasatinib alters the recruiting capacity of the tumor microenvironment based on activation of VCAM-1 expression on the tumor-associated vascular endothelial cells and locoregional production of CXCR3 ligand chemokines, the frequency of TBVA-specific CD8.sup.+ T cells selectively declines in the patients peripheral blood if the combined therapy performs as expected. Circulating levels of the CXCR3 ligand CXCL10 (aka IP-10), become elevated under treatment conditions in patients that are more prone to exhibit objective clinical response to effective immunotherapy. As a consequence, levels of serum CXCL10 are analyzed before, during and after combined vaccine+dasatinib therapy to determine correlation with TBVA-specific CD8.sup.+ T cells in the blood versus tumor over time post-treatment.
(365) Immune Monitoring Analysis of TBVA-Specific CD8.sup.+ T Cell Responses (Primary Endpoint).
(366) Rationale and Hypothesis: Translation and clinical vaccine trials have demonstrated that DC/peptide-based vaccines effectively activate specific CD8.sup.+ T cells in tumor-bearing hosts that may be detected in peripheral blood, and that individuals that exhibit objective clinical response to such vaccine therapies tend to derive from the cohort of patients that display detectable increases in T cell responses post-vaccination (see, for example, Keiholz, Recent Results Cancer Res. 2007; 176: 213-218). The effectiveness of DC1/peptide vaccination to elicit protective/therapeutic T cell-mediated immunity in melanoma models in vivo (see above), support the hypothesis that ?DC1/peptide vaccination of advanced stage melanoma patients results in increased quantities of specific CD8.sup.+ T cells in patient peripheral blood and that those individuals in which improved response to many peptides can be observed are those that are more likely to demonstrate clinical benefit.
(367) Method: Using fluorescently-labeled HLA-A2/peptide dextramer probes and intracellular staining for the Type-1 cytokine IFN-?, how the frequency of CD8.sup.+ T cells specific for TBVA peptides changes over time post-vaccination and how many of these T cells are Type-1 effector T cells is determined.
(368) Quantitation of CD8.sup.+ T Cells, Treg, MDSC and Blood Vessels in Melanoma Biopsy Tissue
(369) Rationale and Hypothesis: Without being bond by theory, tumor progression is believed to be linked to the accumulation of suppressor cell populations (both MDSC and Treg) and strong pro-angiogenic signals, as well as, prevention of Type-1 T cell recruitment within the tumor microenvironment (see, for example, Wolf et al., Clin Cancer Res. 2005; 11: 8326-8331). The data in murine melanoma models support the ability of dasatinib (particularly when combined with DC1/peptide vaccines) to counteract these biologic endpoints in vivo. These changes may also be evidenced in effectively treated melanoma patients by analyzing melanoma biopsies taken post- versus pre-treatment and that the greatest normalization of the tumor microenvironment is observed after treatment with combined dasatinib+vaccine therapy.
(370) Method: Immunofluorescence microscopy is used to analyze tumor sections of melanoma biopsies for expression of the markers CD8? (T effector cells), CD11b+CD33+lack of HLA-DR (lineage-negative MDSC), CD11b+CD15+lack of CD14 (neutrophilic MDSC), CD11b+CD14+lack of CD15 (myeloid MDSC), CD4+Foxp3 (Treg cells) and CD31+NG2 (blood vessels). After staining and washing, sections are covered in Gelvatol (Monsanto, St. Louis, Mo.) and a coverslip applied. Positively-stained cells are quantitated by analyzing the images at a final magnification of ?20 using Metamorph Imaging software (Molecular Devices, Sunnyvale, Calif.).
(371) Treg Analysis in PBMC
(372) Rationale and Hypothesis: Cancer patients have commonly also been shown to have elevated populational frequencies of Treg (based on the CD4.sup.+Foxp3.sup.+ phenotype) circulating in theory peripheral blood. Alternate TKI, such as sunitinib, have been shown capable of reducing peripheral blood Treg levels within the first 4 week cycle of drug administration, in concert with a rebound in Type-1 T cell numbers and function in PBMC (Finke et al., Clin Cancer Res. 2008; 14: 6674-6682). Dasatinib provides a similar effect in melanoma patients and that those patients exhibiting the greatest degree of Treg reduction post-therapy respond favorably against the peptide epitopes contained in the vaccine formulation.
(373) Method: Peripheral blood cells are analyzed by flow cytometry using specifc antibodies against CD3 (all T cells), CD4+Foxp3 (Treg), CD4+CD25.sup.hi (Treg) Results are expressed as percentage of CD25.sup.+hi/Foxp3.sup.+ cells out of total CD3.sup.+/CD4.sup.+ viable cells.
(374) MDSC Analysis in PBMC
(375) Rationale and Hypothesis: Similar to Treg, levels of cells expressing an MDSC phenotype have been reported to be elevated in the peripheral blood of cancer patients, including patients with advanced-stage melanoma (see, for example, Ko et al., Clin Cancer Res. 2009; 15: 2148-2157). TKI, such as sunitinib and dasatinib can reduce the frequency of such suppressor cells to a variable degree when used as a therapy, Melanoma patients treated with dasatinib exhibit reduction in MDSC frequencies in PBMC, with the degree of loss correlating with the patient's ability to respond favorably against the peptide epitopes contained in the vaccine formulation.
(376) Method: Analysis of MDSC percentages in patient PBMC is performed using flow cytometry and anti-human antibodies against CD11b, CD11c, CD14, CD15, CD33 and HLA-DR.
(377) EphA2 Protein Levels in Tumor Biopsies
(378) Rationale and Hypothesis: Drug treatments (including dasatinib in vitro) that promote the proteasome-dependent degradation of the tumor (and tumor vascular endothelial) cell-associated protein EphA2 lead to improved recognition by specific CD8.sup.+ T cells (see, for example, Kawabe et al., Cancer Res. 2009; 69: 6995-7003). Administration of dasatinib to melanoma patients promotes the loss of EphA2 protein within the tumor lesion, leading to an enhancement in the sensitivity of EphA2.sup.+ cells in the tumor microenvironment to EphA2-specific CD8.sup.+ T cells that have been activated as a consequence of ?DC1/peptide-based vaccination.
(379) Method: Western blotting and immunofluorescence microscopy are used to quantitate EphA2 protein expression in melanoma biopsies pre- versus post-vaccination.
(380) CXCL10 Levels in Patient Serum
(381) Rationale and Hypothesis: Therapeutic CD8.sup.+ T cells require the production of CXCR3 ligand chemokines within the tumor microenvironment in order to effectively home to these disease sites. Two recent clinical trials, including a ?DC1/glioma peptide vaccination trial in patients with brain tumors strongly support CXCL10 (aka IP-10) as a chemokine associated with superior clinical outcome to immune-based therapy (see, for example, Schwaab et al., Clin Cancer Res. 2009; 15: 4986-4992). This will also be the case in the ?DC1/TBVA peptide vaccinated patients with melanoma where Type-1 CXCR3.sup.+ responder T cells require a gradient of CXCL10/IP-10 (as detected in serum) in order to traffick to tumor sites in vivo.
(382) Method: Patient serum levels of CXCL10 are monitored using Luminex fluorescent bead technology according to manufacturer's protocol.
(383) Measurement of Effect
(384) Patients with measurable disease are assessed by standard criteria. Patients are re-evaluated every 8 weeks. In addition to a baseline scan, confirmatory scans are obtained ?4 weeks following initial documentation of an objective response.
(385) Antitumor Effect
(386) Patients are re-evaluated for response every 8 weeks. In addition to a baseline scan, confirmatory scans are obtained no less than 4 weeks following initial documentation of objective response.
(387) Response and progression are evaluated using the new international criteria proposed by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guideline (version 1.1; ref. 104). Changes in the largest diameter (uni-dimensional measurement) of the tumor lesions and the shortest diameter in the case of malignant lymph nodes are used in the RECIST criteria.
(388) Definitions
(389) Evaluable for toxicity. All patients are evaluable for toxicity from the time of their first treatment.
(390) Evaluable for objective response. Only those patients who have measurable disease present at baseline, have received at least one cycle of therapy, and have had their disease re-evaluated are considered evaluable for response. These patients have their response classified according to the definitions stated below. (Note: Patients who exhibit objective disease progression prior to the end of cycle 1 will also be considered evaluable.)
(391) Evaluable Non-Target Disease Response. Patients who have lesions present at baseline that are evaluable but do not meet the definitions of measurable disease, have received at least one cycle of therapy, and have had their disease re-evaluated are considered evaluable for non-target disease. The response assessment is based on the presence, absence, or unequivocal progression of the lesions.
(392) Disease Parameters
(393) Measurable disease. Measurable lesions are defined as those that can be accurately measured in at least one dimension (longest diameter to be recorded) as ?20 mm by chest x-ray or as ?10 mm with CT scan, MRI, or calipers by clinical exam. All tumor measurements must be recorded in millimeters (or decimal fractions of centimeters). Tumor lesions that are situated in a previously irradiated area might or might not be considered measurable.
(394) Malignant lymph nodes. To be considered pathologically enlarged and measurable, a lymph node must be ?15 mm in short axis when assessed by CT scan (CT scan slice thickness recommended to be no greater than 5 mm). At baseline and in follow-up, only the short axis is measured and followed.
(395) Non-measurable disease. All other lesions (or sites of disease), including small lesions (longest diameter<10 mm or pathological lymph nodes with ?10 to <15 mm short axis), are considered non-measurable disease. Bone lesions, leptomeningeal disease, ascites, pleural/pericardial effusions, lymphangitis cutis/pulmonitis, inflammatory breast disease, and abdominal masses (not followed by CT or MRI), are considered as non-measurable. Cystic lesions that meet the criteria for radiographically defined simple cysts are not be considered as malignant lesions (neither measurable nor non-measurable) since they are, by definition, simple cysts. Cystic lesions thought to represent cystic metastases can be considered as measurable lesions, if they meet the definition of measurability described above. However, if non-cystic lesions are present in the same patient, these are preferred for selection as target lesions.
(396) Target lesions. All measurable lesions up to a maximum of 2 lesions per organ and 5 lesions in total, representative of all involved organs, should be identified as target lesions and recorded and measured at baseline. Target lesions are selected on the basis of their size (lesions with the longest diameter), are representative of all involved organs, but in addition lend themselves to reproducible repeated measurements. It may be the case that, on occasion, the largest lesion does not lend itself to reproducible measurement in which circumstance the next largest lesion which can be measured reproducibly is selected. A sum of the diameters (longest for non-nodal lesions, short axis for nodal lesions) for all target lesions is calculated and reported as the baseline sum diameters. If lymph nodes are included in the sum, then only the short axis is added into the sum. The baseline sum diameters are used as reference to further characterize any objective tumor regression in the measurable dimension of the disease.
(397) Non-target lesions. All other lesions (or sites of disease) including any measurable lesions over and above the 5 target lesions are identified as non-target lesions and are recorded at baseline. Measurements of these lesions are not required, but the presence, absence, or in rare cases unequivocal progression of each is noted throughout follow-up.
(398) Methods for Evaluation of Measurable Disease
(399) All measurements are taken and recorded in metric notation using a ruler or calipers. All baseline evaluations are performed as closely as possible to the beginning of treatment and never more than 4 weeks before the beginning of the treatment.
(400) The same method of assessment and the same technique is used to characterize each identified and reported lesion at baseline and during follow-up. Imaging-based evaluation is preferred to evaluation by clinical examination unless the lesion(s) being followed cannot be imaged but are assessable by clinical exam.
(401) Clinical lesions. Clinical lesions are only considered measurable when they are superficial (e.g., skin nodules and palpable lymph nodes) and 10 mm diameter as assessed using calipers (e.g., skin nodules). In the case of skin lesions they are documented by color photography, including a ruler to estimate the size of the lesion.
(402) Chest x-ray. Lesions on chest x-ray are measurable lesions when they are clearly defined and surrounded by aerated lung, but CT is preferable.
(403) Conventional CT and MRI. This guideline has defined measurability of lesions on CT scan based on the assumption that CT slice thickness is 5 mm or less. If CT scans have slice thickness greater than 5 mm, the minimum size for a measurable lesion should be twice the slice thickness. MRI is also acceptable in certain situations (e.g. for body scans). MRI has excellent contrast, spatial, and temporal resolution. As with CT, if an MRI is performed, the technical specifications of the scanning sequences used are optimized for the evaluation of the type and site of disease. Furthermore, as with CT, the modality used at follow-up is the same as was used at baseline and the lesions are measured/assessed on the same pulse sequence.
(404) PET-CT. The low dose or attenuation correction CT portion of a combined PET-CT is not always of optimal diagnostic CT quality for use with RECIST measurements. However, if the CT performed as part of a PET-CT is of identical diagnostic quality to a diagnostic CT (with IV and oral contrast), then the CT portion of the PET-CT can be used for RECIST measurements and can be used interchangeably with conventional CT in accurately measuring cancer lesions over time.
(405) Endoscopy, Laparoscopy. Such techniques are used to confirm complete pathological response when biopsies are obtained or to determine relapse in trials where recurrence following complete response (CR) or surgical resection is an endpoint.
(406) Cytology, Histology. These techniques can be used to differentiate between partial responses (PR) and complete responses (CR) in rare cases (e.g., residual lesions in tumor types, such as germ cell tumors, where known residual benign tumors can remain). The cytological confirmation of the neoplastic origin of any effusion that appears or worsens during treatment when the measurable tumor has met criteria for response or stable disease is mandatory to differentiate between response or stable disease (an effusion may be a side effect of the treatment) and progressive disease.
(407) FDG-PET. FDG-PET response assessments can be incorporated to complement CT scanning in assessment of progression (particularly possible new disease). New lesions on the basis of FDG-PET imaging are identified according to the following algorithm: Negative FDG-PET at baseline, with a positive FDG-PET at follow-up is a sign of PD based on a new lesion. No FDG-PET at baseline and a positive FDG-PET at follow-up: If the positive FDG-PET at follow-up corresponds to a new site of disease confirmed by CT, this is PD. If the positive FDG-PET at follow-up is not confirmed as a new site of disease on CT, additional follow-up CT scans are needed to determine if there is truly progression occurring at that site (if so, the date of PD is the date of the initial abnormal FDG-PET scan). If the positive FDG-PET at follow-up corresponds to a pre-existing site of disease on CT that is not progressing on the basis of the anatomic images, this is not PD. FDG-PET may be used to upgrade a response to a CR in a manner similar to a biopsy in cases where a residual radiographic abnormality is thought to represent fibrosis or scarring. The use of FDG-PET in this circumstance should be prospectively described in the protocol and supported by disease-specific medical literature for the indication. However, it must be acknowledged that both approaches may lead to false positive CR due to limitations of FDG-PET and biopsy resolution/sensitivity.
(408) Note: A positive FDG-PET scan lesion means one which is FDG avid with an uptake greater than twice that of the surrounding tissue on the attenuation corrected image.
(409) Response Criteria
(410) Evaluation of Target Lesions
(411) Complete Response (CR): Disappearance of all target lesions. Any pathological lymph nodes (whether target or non-target) must have reduction in short axis to <10 mm.
(412) Partial Response (PR): At least a 30% decrease in the sum of the diameters of target lesions, taking as reference the baseline sum diameters.
(413) Progressive Disease (PD): At least a 20% increase in the sum of the diameters of target lesions, taking as reference the smallest sum on study (this includes the baseline sum if that is the smallest on study). In addition to the relative increase of 20%, the sum must also demonstrate an absolute increase of at least 5 mm. (Note: the appearance of one or more new lesions is also considered progressions).
(414) Stable Disease (SD): Neither sufficient shrinkage to qualify for PR nor sufficient increase to qualify for PD, taking as reference the smallest sum diameters while on study.
(415) Evaluation of Non-Target Lesions
(416) Complete Response (CR): Disappearance of all non-target lesions and normalization of tumor marker level. All lymph nodes must be non-pathological in size (<10 mm short axis).
(417) Note: If tumor markers are initially above the upper normal limit, they must normalize for a patient to be considered in complete clinical response.
(418) Non-CR/Non-PD: Persistence of one or more non-target lesion(s) and/or maintenance of tumor marker level above the normal limits.
(419) Progressive Disease (PD): Appearance of one or more new lesions and/or unequivocal progression of existing non-target lesions. Unequivocal progression should not normally trump target lesion status. It must be representative of overall disease status change, not a single lesion increase.
(420) Evaluation of Best Overall Response
(421) The best overall response is the best response recorded from the start of the treatment until disease progression/recurrence (taking as reference for progressive disease the smallest measurements recorded since the treatment started). The patient's best response assignment depends on the achievement of both measurement and confirmation criteria.
(422) For Patients with Measurable Disease (i.e., Target Disease)
(423) TABLE-US-00013 Best Overall Response Target Non-Target New Overall when Confirmation Lesions Lesions Lesions Response is Required* CR CR No CR ?4 wks. Confirmation** CR Non-CR/Non-PD No PR ?4 wks. CR Not evaluated No PR Confirmation** PR Non-CR/Non-PD/ No PR not evaluated SD Non-CR/Non- No SD Documented at least PD/not evaluated once ?4 wks. from baseline** PD Any Yes or No PD no prior SD, PR or Any PD*** Yes or No PD CR Any Any Yes PD *See RECIST 1.1 manuscript for further details on what is evidence of a new lesion. **Only for non-randomized trials with response as primary endpoint. ***In exceptional circumstances, unequivocal progression in non-target lesions may be accepted as disease progression. Note: Patients with a global deterioration of health status requiring discontinuation of treatment without objective evidence of disease progression at that time should be reported as symptomatic deterioration. Every effort should be made to document the objective progression even after discontinuation of treatment.
For Patients with Non-Measurable Disease (i.e., Non-Target Disease)
(424) TABLE-US-00014 Non-Target Lesions New Lesions Overall Response CR No CR Non-CR/non-PD No Non-CR/non-PD* Not all evaluated No not evaluated Unequivocal PD Yes or No PD Any Yes PD *Non-CR/non-PD is preferred over stable disease for non-target disease since SD is increasingly used as an endpoint for assessment of efficacy in some trials so to assign this category when no lesions can be measured is not advised
Duration of Response
(425) Duration of overall response: The duration of overall response is measured from the time measurement criteria are met for CR or PR (whichever is first recorded) until the first date that recurrent or progressive disease is objectively documented (taking as reference for progressive disease the smallest measurements recorded since the treatment started).
(426) The duration of overall CR is measured from the time measurement criteria are first met for CR until the first date that progressive disease is objectively documented.
(427) Duration of stable disease: Stable disease is measured from the start of the treatment until the criteria for progression are met, taking as reference the smallest measurements recorded since the treatment started, including the baseline measurements.
(428) Progression-Free Survival
(429) Progression-free survival (PFS) is defined as the duration of time from start of treatment to time of progression or death, whichever occurs first.
(430) Statistical Considerations
(431) Study Design
(432) The effects of combination therapy of dasatinib and vaccine on immune response rate are evaluated. A patient who responded to at least 3 of the 6 peptides is considered to have a positive immune response. The secondary objectives include evaluation of clinical response rate, overall survival (OS), progression free survival (PFS), and immunological endpoints, which include number of CD8.sup.+ T cells, MDSC/Treg regulatory cells and blood vessels in tumor lesions, level of EphA2 protein expressed within the tumor lesion and the level of the CXCL10/IP-10 chemokine in patient serum pre- versus post-treatment.
(433) Up to 28 evaluable patients are randomized in 1:1 ratio to receive either: A. Vaccine alone starting in the first 28-day cycle followed by vaccine combined with daily dasatinib starting on the first day of the second cycle (Arm A) B. Vaccine combined with daily dasatinib starting on the first day of cycle 1 (Arm B)
(434) Patients not evaluable for immune response are replaced. Randomization is stratified by BRAF mutation status.
(435) Data Analysis
(436) Analysis Sets.
(437) Evaluable Patients are patients who meet all of the protocol inclusion/exclusion criteria and begin treatment with the protocol assigned regimen. All evaluable patients are used in the analysis of safety, immune response, clinical response, OS and PFS.
(438) Baseline Characteristics
(439) Baseline characteristics on all evaluable patients are provided on demographic variables (age, sex, race/ethnicity), performance status, laboratory parameters, prior treatments, and disease characteristics, including tumor size, number of nodes involved, and metastatic sites.
(440) Safety Profile
(441) NCI CTCAE version 4.0 is used to evaluate the serious adverse events (SAEs) in each cycle of the treatment, and for 30 days beyond the last protocol specified treatment. Sever AEs rate for each treatment arm are calculated and the corresponding exact 95% confidence interval (CI) are provided. All adverse events that are determined to be possibly, probably or definitely related to treatment are tabulated according to grade and type (according to the NCI CTCAE, Version 4.0). For each adverse event category, frequencies are tabulated by treatment group according to the highest grade per patient within 30 days after any study treatment.
(442) Efficacy Analysis
(443) The immune response rate, defined as proportion of patients that responded to ?3 out of the 6 peptides, for each study arm is calculated with 95% exact CI. The clinical response rate for each study arm is estimated by the percentage of patients achieving CR or PR by RECIST criteria, with corresponding exact 95% CI. Both immune response rate and clinical response rate of the two treatment groups are compared using Fisher exact test. The immune response for the B-raf mutant carrier and non-carrier in is also evaluated.
(444) The Kaplan-Meier estimate of PFS and OS with corresponding 95% confidence band is provided for each dose level. The corresponding median survival time (with 95% confidence limits) is determined, along with OS and PFS estimates at selected time points. The exact log rank test is used to compare the PFS and OS between the two study arms.
(445) The association between the positive immune response and: a. Objective clinical response. b. CD8+ T cell infiltration in tumor after cycle 1. c. Reduction in suppressor cells in the tumor and blood. d. Reduction in blood vessel density in the tumor after cycle 1. e. Reduction in EphA2 protein expression in tumor after cycle 1. f. Increased level of the CXCR3 ligand chemokine CXCL 10/IP-10 in patient serum after cycle 1 is evaluated.
(446) Chi-square (or Fisher exact) test is used to test the association between immune response and the categorical outcomes (e.g. objective clinical response). Wilcoxon test is used to compare the continuous outcomes (e.g. CD8.sup.+ T cell infiltration, suppressor cell populations, tumor blood vessel density, EphA2 protein expression, chemokine level) between the immune responders and non-responders. It will be apparent that the precise details of the methods or compositions described may be varied or modified without departing from the spirit of the described invention. We claim all such modifications and variations fall within the scope and spirit of the claims below.