Induction of cross-reactive cellular response against rhinovirus antigens

09937252 ยท 2018-04-10

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention concerns: a) an isolated peptide comprising an amino acid sequence which is at least 90% identical to the VP4 amino acid sequence of a rhinovirus, or an isolated polynucleotide comprising a nucleic acid sequence encoding said peptide, placed under the control of the elements necessary for its expression in a mammalian cell; and/or b) an isolated peptide comprising an amino acid sequence of at least 100 amino acids which is at least 90% identical to an amino acid sequence located in the last 363 C-terminal amino acids of the RNA polymerase of a rhinovirus, or an isolated polynucleotide comprising a nucleic acid sequence encoding said peptide, placed under the control of the elements necessary for its expression in a mammalian cell; and c) a Th1 adjuvant when said immunogenic composition comprises one or more of said isolated peptides.

    Claims

    1. An immunogenic composition comprising: a) an isolated peptide consisting of an amino acid sequence which is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or is at least 80% identical to an amino acid sequence located in SEQ ID NO: 5, 6, 8, 17, or 20, or an isolated polynucleotide comprising a nucleic acid sequence encoding said peptide, placed under the control of the elements necessary for its expression in a mammalian cell; and/or b) an isolated peptide comprising an amino acid sequence of at least 100 amino acids which is at least 90% identical to SEQ ID NO: 13 or SEQ ID NO: 14, or an isolated polynucleotide comprising a nucleic acid sequence encoding said peptide, placed under the control of the elements necessary for its expression in a mammalian cell; c) a pharmaceutically acceptable Th1 adjuvant when said immunogenic composition comprises one or more of said isolated peptides; and a pharmaceutically acceptable vehicle comprising one or more buffering agents.

    2. The immunogenic composition according to claim 1, wherein the isolated peptide a) is a fusion peptide consisting of the amino acid sequence that is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2 further linked by a covalent linkage to an amino acid sequence which is at least 90% identical to an amino acid sequence located in SEQ ID NO: 3 or SEQ ID NO: 4.

    3. The immunogenic composition according to claim 1, wherein the isolated peptide is a fusion peptide consisting of the amino acid sequence that is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or is at least 80% identical to an amino acid sequence located in SEQ ID NO: 5, 6, 8, 17, or 20, as defined in claim 1 or claim 2, further linked by covalent linkage to an amino acid sequence which is at least 90% identical to SEQ ID NO: 13 or SEQ ID NO: 14.

    4. The immunogenic composition according to claim 3, wherein the amino acid sequence is within the last 105 C-terminal amino acids of SEQ ID NO: 13 or SEQ ID NO: 14.

    5. The immunogenic composition according to claim 1, wherein the pharmaceutically acceptable Th1 adjuvant comprises a TLR9 agonist.

    6. A method for inducing a specific cross-reactive cell-mediated immune response against at least two serotypes of rhinoviruses in a mammal, the method comprising administering the immunogenic composition according to claim 1 to a mammal in need of such treatment.

    7. The method according to claim 6, wherein the at least two serotypes of rhinoviruses belong to type A and/or B rhinoviruses, or wherein said cell-mediated immune response is Th1-oriented, or wherein said cell-mediated immune response is boosted after infection by a rhinovirus, or wherein a specific neutralizing antibody response is further induced when said mammal is infected by a rhinovirus.

    8. A method for: (a) inducing a specific neutralizing antibody response in a mammal infected by a rhinovirus; or (b) shortening or preventing an infection in a mammal by a rhinovirus and/or reducing or preventing the clinical symptoms associated with an infection by a rhinovirus; the method comprising administering the immunogenic composition according to claim 1 to a mammal in need of such treatment.

    9. An immunogenic composition according to claim 1 for use as a vaccine.

    10. The composition of claim 1, further comprising one or more tonicity adjusting agents.

    11. The composition of claim 1, further comprising one or more wetting agents.

    12. The composition of claim 1, further comprising one or more detergents.

    13. The composition of claim 1, further comprising one or more pH adjusting agents.

    14. A vaccine composition comprising: a) an isolated peptide consisting of an immunogenic amino acid sequence which is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or is at least 80% identical to an amino acid sequence located in SEQ ID NO: 5, 6, 8, 17, or 20; and/or b) an isolated peptide consisting of an immunogenic amino acid sequence of at least 100 amino acids which is at least 90% identical to SEQ ID NO: 13 or SEQ ID NO: 14; and c) a pharmaceutically acceptable Th1 adjuvant; and d) a pharmaceutically acceptable vehicle comprising one or more buffering agents.

    15. A composition comprising: a) an isolated polynucleotide consisting of a deoxyribonucleic acid sequence encoding an isolated peptide comprising an immunogenic amino acid sequence which is at least 90% identical to SEQ ID NO: 1 or SEQ ID NO: 2 or is at least 80% identical to an amino acid sequence located in SEQ ID NO: 5, 6, 8, 17, or 20, placed under the control of elements necessary for its expression in a mammalian cell; and/or b) an isolated polynucleotide comprising a deoxyribonucleic acid sequence encoding an isolated peptide comprising an immunogenic amino acid sequence of at least 100 amino acids which is at least 90% identical to SEQ ID NO: 13 or SEQ ID NO: 14, placed under the control of elements necessary for its expression in a mammalian cell; and c) a pharmaceutically acceptable vehicle comprising one or more buffering agents.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    (1) FIG. 1 is a set of histograms representing the number of IFN-? (panel A) and IL-5 (panel B) producing cells (/10.sup.6 cells), enumerated by ELISPOT in splenocytes of mice immunized subcutaneously with HRV16 VP0 protein (RV16 VP0) or buffer, with or without IFA/CpG adjuvant (IFA/Cpg), after stimulation of splenocytes with VP0 from HRV1B (VP0 RV1B) or from HRV14 (VP0 RV14) or with 3Pol peptide pools from HRV1B (3Pol RV1B) or from HRV14 (3Pol RV14), the splenocytes being harvested 28 days post-immunization.

    (2) n=10 mice/group. ***: p<0.001, **: p<0.01.

    (3) FIG. 2 is a set of histograms representing the supernatant IFN-? (panel A) and IL-5 (panel B) level (pg/ml), measured by cytometric bead array in splenocytes of mice immunized subcutaneously with HRV16 VP0 protein (RV16 VP0) or buffer, with or without IFA/CpG adjuvant (IFA/Cpg), after stimulation of splenocytes with VP0 from HRV1B (VP0 RV1B) or from HRV14 (VP0 RV14) or 3Pol peptide pools from HRV1B (3Pol RV1B) or from HRV14 (3Pol RV14), the splenocytes being harvested 28 days post-immunization.

    (4) n=10 mice/group. ***: p<0.001, **: p<0.01.

    (5) FIG. 3 is a graph representing the number of lymphocytes (?10.sup.5) in bronchoalveolar lavage (BAL), in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG adjuvant (immunized), or with IFA/CpG adjuvant only (adjuvant), and challenged intranasally with HRV1B (group RV-immunized (?) and group RV-adjuvant (?)) or mock challenged with PBS (group PBS-immunized (?)), the lymphocytes being counted by cytospin assay. ***: p<0.001.

    (6) FIG. 4 is a set of graphs representing the number of CD4+ T cells (panel A) (?10.sup.4) or CD8+ T cells (panel B) (?10.sup.6) in BAL or lung, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG adjuvant (immunized), or with IFA/CpG adjuvant only (adjuvant), and challenged intranasally with HRV1B (group RV-immunized (?) and group RV-adjuvant (?)) or mock challenged with PBS (group PBS-immunized (o)). ***: p<0.001; **: p<0.01.

    (7) FIG. 5 is a set of histograms representing the percentage of CD4+ T cells (panel A) or CD8+ T cells (panel B) in BAL or lung expressing the early activation marker CD69, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG adjuvant (immunized), or with IFA/CpG adjuvant only (adjuvant), and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). ***: p<0.001; **: p<0.01; *: p<0.05.

    (8) FIG. 6 is a set of histograms representing the level of CXCL10/IP-10 protein (ng/ml) in BAL, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG adjuvant (immunized), or with IFA/CpG adjuvant only (adjuvant), and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). ***: p<0.001.

    (9) FIG. 7 is a set of histograms representing the levels (copies/?l) of lung tissue IFN-? (panel A), and IL-4 (panel B) mRNA, measured by Taqman qPCR, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG only (adjuvant) and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). ***: p<0.001; **: p<0.01.

    (10) FIG. 8 is a set of histograms representing the levels (pg/ml) of BAL IFN-? measured by ELISA, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG only (adjuvant) and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). ***: p<0.001.

    (11) FIG. 9 is a set of histograms representing the number of IFN-? producing cells (/10.sup.4 cells), enumerated by ELISPOT, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG only (adjuvant) and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), after incubation of lung cells (harvested 6 days after infection) from the 3 distinct groups of mice with the indicated stimuli. ***: p<0.001.

    (12) FIG. 10 is a graph representing the number of BAL lymphocytes (?10.sup.5), counted by cytospin assay, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized (?) and group RV-adjuvant (?)) or mock challenged with PBS (group PBS-immunized (?)). ***: p<0.001; **: p<0.01.

    (13) FIG. 11 is a set of graphs representing the number of total CD3+CD4+ T cells (?10.sup.6) (panel A) and of CD69 expressing CD3+CD4+ T cells (?10.sup.6) (panel B) in lung tissue, counted by flow cytometry, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). ***: p<0.001; *: p<0.05.

    (14) FIG. 12 is a set of graphs representing the number of total CD3+CD4+ T cells (?10.sup.6) (panel A) and of CD69 expressing CD3+CD4+ T cells (?10.sup.5) (panel B) in BAL, counted by flow cytometry, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized (?) and group RV-adjuvant (?)) or mock challenged with PBS (group PBS-immunized (?)). ***: p<0.001; *: p<0.05.

    (15) FIG. 13 is a set of histograms representing the number of IFN-? producing cells (/10.sup.5 cells), enumerated by ELISPOT, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), after incubation of lung cells (harvested 6 days after infection) from the 3 distinct groups of mice with the indicated stimuli. ***: p<0.001; *: p<0.05.

    (16) FIG. 14 is a set of histograms representing the percentage of IFN-? producing CD4+(panel A) or CD8+(panel B) T cells, measured by flow cytometry, in lung cells, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant (adjuvant) only and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), after stimulation of lung cells with PMA and ionomycin. ***: p<0.001; **: p<0.01.

    (17) FIG. 15 is a set of histograms representing the percentage of CD44+CD62L low or CD62L? lung CD4+ T cells (panel A) or the number of CD44+CD62L low or CD62L? lung CD4+ T cells (?10.sup.6) (panel B), measured by flow cytometry, on day 14 post-infection, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). *: p<0.05.

    (18) FIG. 16 is a set of histograms representing the percentage of CD44+CD62+ lung CD4+ T cells (panel A) or the number of CD44+CD62+ lung CD4+ T cells (?10.sup.6) (panel B), measured by flow cytometry, on day 14 post-infection, in mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with a more distant HRV, HRV29 (group RV-immunized RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized). *: p<0.05.

    (19) FIG. 17 is a set of graphs representing the levels of IgG2c (upper panel) and IgG1 (lower panel) that bind specifically to HRV1B in the serum of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant alone (adjuvant) and challenged with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), measured by ELISA 6 days (left panel) and 14 days (right panel) after the challenge (OD at 450 nm).

    (20) FIG. 18 is a set of graphs representing the levels of IgG2c (upper panel) and IgA (lower panel) that bind specifically to HRV1B in the BAL of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant alone (adjuvant) and challenged with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), measured by ELISA 6 days (left panel) and 14 days (right panel) after the challenge (OD at 450 nm).

    (21) FIG. 19 is a set of graphs representing the levels of IgG2c (upper panel) and IgG1 (lower panel) that bind specifically to HRV29 in the serum of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant alone (adjuvant) and challenged with HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), measured by ELISA 6 days (left panel) and 14 days (right panel) after the challenge (OD at 450 nm).

    (22) FIG. 20 is a set of graphs representing the levels of IgG2c (upper panel) and IgA (lower panel) that bind specifically to HRV29 binding in the BAL of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant alone (adjuvant) and challenged with HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), measured by ELISA 6 days (left panel) and 14 days (right panel) after the challenge (OD at 450 nm).

    (23) FIG. 21 is a set of graphs representing the level of neutralizing antibodies against HRV1B in pooled sera of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), measured by using a crystal violet cell viability assay 6 days (left panel) and 14 days (right panel) after the challenge.

    (24) Top dotted line: cell viability of the non-infected control cells in presence of serum only.

    (25) Bottom dotted lines: cell viability of the infected control cells without serum.

    (26) ATCC control: guinea pig serum containing neutralizing antibodies against HRV1B (positive reference).

    (27) Data points represent sera pooled from 4 mice/treatment group.

    (28) FIG. 22 is a set of graphs representing the level of neutralizing antibodies against HRV29 in pooled sera of mice immunized subcutaneously with HRV16 VP0 protein plus IFA/CpG (immunized), or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with HRV29 (group RV-immunized and group RV-adjuvant) or mock challenged with PBS (group PBS-immunized), 6 days (left panel) and 14 days (right panel) after the challenge.

    (29) Top dotted line: cell viability of the non infected control cells in presence of serum only.

    (30) Bottom dotted lines: cell viability of the infected control cells without serum.

    (31) ATCC control: guinea pig serum containing neutralizing antibodies against HRV29 (positive reference).

    (32) Data points represent sera pooled from 4 mice/treatment group.

    (33) FIG. 23 is a set of histograms representing the number of HRV RNA copies in the lung tissue (/?l cDNA) of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with HRV1B (group RV-immunized and group RV-adjuvant) on days 1, 4 and 6 after infection. n.d.: not detected.

    (34) FIG. 24 is a set of histograms representing the number of HRV RNA copies in the lung tissue (/?l cDNA) of mice immunized subcutaneously either with HRV16 VP0 protein plus IFA/CpG (immunized) or with IFA/CpG adjuvant only (adjuvant) and challenged intranasally with HRV29 (group RV-immunized and group RV-adjuvant) on days 1, 4 and 6 after infection. n.d.: not detected. *: p<0.05.

    (35) FIG. 25 is a set of histograms representing the supernatant IFN-? (panel A) and IL-5 (panel B) level (pg/ml), measured by cytometric bead array in splenocytes of mice immunized subcutaneously with HRV16 3Pol protein (3Pol protein 16) or buffer, with or without IFA/CpG adjuvant (IFA/CpG), after stimulation of splenocytes with 3Pol peptide pools from HRV1B (pool A and pool B) or VP0 peptide pools from HRV1B (pool C and pool D) the splenocytes being harvested on day 28.

    (36) FIG. 26 is a set of histograms representing the number of IFN-? producing cells (/10.sup.5 cells), enumerated by ELISPOT, in splenocytes of mice immunized subcutaneously with HRV16 3Pol protein (3Pol protein 16) or buffer, with or without IFA/CpG adjuvant (IFA/CpG), after stimulation of splenocytes with 3Pol peptide pools from HRV1B (pool A and pool B) or 3Pol peptide pool from HRV14 (pool F), the splenocytes being harvested on day 28.

    (37) FIG. 27 is a set of histograms representing the supernatant IFN-? (panel A) and IL-5 (panel B) level (pg/ml), measured by cytometric bead array in splenocytes of mice immunized subcutaneously with HRV1B VP-Pol (VP-Pol protein 1B) or buffer, with or without IFA/CpG adjuvant (IFA/CpG), after stimulation of splenocytes with 3Pol peptide pools from HRV1B (pool A and pool B) or VP0 peptide pools from HRV1B (pool C and pool D) the splenocytes being harvested on day 28.

    (38) FIG. 28 is a set of histograms representing the number of IFN-? producing cells (/10.sup.5 cells), enumerated by ELISPOT in splenocytes of mice immunized subcutaneously either with HRV14 3Pol DNA (3Pol DNA 14), or with HRV16 VP0 DNA (VP0 DNA 16) or with buffer, after stimulation of splenocytes with 3Pol peptide pools from HRV1B (pool A and pool B) or with 3Pol peptide pool from HRV14 (pool F), or with VP0 peptide pools from HRV1B (pool C and pool D) the splenocytes being harvested on day 28.

    (39) FIG. 29 is a scheme representing, at the top, the nucleic acid encoding the different domains of the HRV polyprotein, in particular the VP0 peptide, and, at the bottom, the pET-SUMO plasmid encoding the HRV16 VP0 gene.

    EXAMPLES

    Example 1: Identification of the Conserved Sequences

    (40) This example describes the methodology developed by the inventors to identify the conserved sequences from rhinovirus polyproteins suitable as antigens inducing a cross-reactive immune response when administered to a mammal.

    (41) Material and Methods

    (42) The design was essentially based on linear sequence conservation among HRVs. It was possible to find within each group of rhinoviruses, in particular type A rhinoviruses and type B rhinoviruses, two regions which were identified as candidate antigens: VP0 (VP4+VP2) and the C-terminus domain of the RNA polymerase. A fusion protein including the most conserved part from these two regions was also designed, attempting to minimize the number of antigens to be used in the vaccine.

    (43) A few HRV strains were selected to assess the immune response of the candidate antigens in mice. They were selected as representative of the different rhinovirus groups, as representative of the different serotypes existing in a given group of rhinoviruses, and as representative of the different receptor usage by the rhinovirus, to assess the cross-reactivity degree of the immune response.

    (44) The features of the serotypes selected are indicated in table 1 below:

    (45) TABLE-US-00017 TABLE 1 Features of the serotypes used Receptor group Minor Major A 1B, 29 16 B 14

    (46) All sequences were retrieved from the National Center for Biotechnology Information (NCBI) Genbank database on Aug. 23, 2007 (http://www.ncbi.nlm.nih.gov). All available complete polyprotein sequences were retrieved at that time.

    (47) All sequences were aligned using the MUSCLE algorithm (Edgar (2004) Nucleic Acids Res. 32:1792-7). A phylogenetic tree was elaborated using the maximum likelihood method from the Seaview application (Galtier et al. (1996) Comput Appl Biosci. 12:543-8). Bootstrap values were calculated to assess the robustness of the nodes. A global consensus sequence was generated from the alignments using the Jalview application (Clamp et al. (2004) Bioinformatics 20:426-7). The frequency of variation was calculated on each amino acid position so as to determine the conservation level all along the polyprotein. A secondary design was elaborated aiming at minimizing the size and number of antigen candidates to be used in the project. The available 3D structures of structural proteins (VP) and polymerase 3D (P3D) were used to define the most appropriate fusion location between VP and P3D, taking into account both the conservation level and the structural conformation of the two subunits.

    (48) Sequence alignments were launched for all available complete polyproteins from HRV-A, HRV-B and HRV-A and -B together.

    (49) Global consensus sequences were extracted from each alignment and frequency of occurrence for each major amino acid was calculated. The results were presented as a linear sequence of the global consensus under which the frequency of each position was indicated and coloured according to its frequency. That representation provided an easy way to visualize the most conserved regions along consensus polyproteins.

    (50) The goal of the present study was to identify the most conserved domains among human rhinoviruses to select subregions to be subcloned for recombinant expression. As only a T-cell cross-reactive response is targeted, any part of the polyprotein can be considered equally.

    (51) As T-cell peptides must have at least 8 amino acids (aa) in length (for CD8 responses), selected regions should present identity stretches of at least the same length. CD4 peptides are in the 15 aa long range.

    (52) Starting first from the global sequence alignment including both type A and type B viruses, the present inventors demonstrated that variable and conserved domains were almost the same in the two virus types. Accordingly, the selected regions were located in the same regions in both virus types.

    (53) Results

    (54) Type A Conserved Amino Acid Sequences

    (55) HRV-A VPo

    (56) The first selected region was the N-terminus part of the large polyprotein. The amino acids [1-191] and amino acids [243-297] in the amino acid sequence of the large polyprotein appeared especially well conserved among type A rhinoviruses. As the polyprotein VP0 (including VP4 and VP2), consisting of the amino acid sequence [1-339], includes these two domains, the domain encoding VP0 was selected as a first antigen candidate.
    HRV-A 3pol
    The C-terminus end of the large polyprotein also showed large portions of very well conserved sequences among type A rhinoviruses. The last 363 amino acids were retained as a second recombinant antigen candidate. They consisted of the C-terminus part of the RNA polymerase of the virus.
    HRV-A VP-Pol Fusion Antigen
    Aiming at reducing the number of antigens, a second design was elaborated as a fusion between VP0 and 3pol candidates. Both parts were shortened to maintain a global antigen size easy to express, and the junction between the two parts was designed so as to preserve independent folding of the two regions to be fused.

    (57) The VP4 protein was entirely included in the new design. The sequence of VP2 was shortened by its C-terminus part. Considering the 3D structure, the selected part of VP2 corresponds to a domain relatively independent from the rest of the VPs, avoiding so major folding constraints that could potentially impair with the recombinant expression and/or folding. The stop in a flexible loop was also selected to facilitate the fusion with the 3pol domain to be added in C-terminus of the VP sequence.

    (58) The designed VP4-2 sequence represented the first N-terminal 135 amino acids of the VP0 polyprotein. Exactly the same region could be selected for type B HRVs.

    (59) Considering the 3pol domain, the same approach was used. Available 3D structures were identified from HRV-1B (type A) and HRV-14 (type B). As for VPs, the 3D structures of the 3pol domain of HRV-1B and HRV-14 were similar, and led to the design of peptides corresponding to the same region in the RNA polymerase of both serotypes.

    (60) From the initial design, the selected C-terminus part of 3pol was truncated from its N-terminus. Looking at both 3D structure and conservation level, the last 105 C-terminal amino acids were selected.

    (61) HRV-A (1B, 16, 29) Sequences Used for Further Cloning and Expression

    (62) Practically, sequences corresponding to each design were retrieved from target strains. Additional sequences were added to build the proper open reading frame including all elements required in the selected recombinant expression system (N-terminus methionine, stop codon when needed, tag and SUMO).

    (63) The sequences expressed are listed in Table 2 below. Actual cloned sequences were artificially synthesized introducing several modifications in nucleotide sequences such as codon use optimization for recombinant expression in Escherichia coli.

    (64) TABLE-US-00018 TABLE 2 Sequences expressed Strain Name SEQ ID HRV-1B VPo 17 HRV-1B 3pol 18 HRV-1B VP-pol 19 HRV-16 VPo 6 HRV-16 3pol 13 HRV-16 VP-pol 11 HRV-29 VPo 20 HRV-29 3pol 21 HRV-29 VP-pol 22
    Type B Conserved Amino Acid Sequences
    HRV-B VPo
    As observed for type A HRV alignment, the N-terminus region of the large polyprotein of HRV-B is also very well conserved. Following the same strategy, the complete VP0 sequence was selected as the first HRV-B antigen candidate.
    HRV-B 3pol
    As observed for type A HRVs, the C-terminus end of the large polyprotein showed large portions of very well conserved sequences. The last 365 amino acids were retained as a second recombinant antigen candidate. They consist of the C-terminus part of the RNA polymerase of the virus.
    HRV-B VP-Pol Fusion Antigen
    Similarly to the design of the HRV-A VP-Pol fusion antigen, both parts of VP0 and 3pol candidates were shortened to maintain a global antigen size easy to express, and the junction between the two parts was designed so as to preserve independent folding of the two regions to be fused.

    (65) The designed VP4-2 sequence represented the first N-terminal 135 amino acids of the VP0 polyprotein and the last C-terminal 105 amino acids of 3pol were selected.

    (66) HRV-B (14) Sequences Used for Further Cloning and Expression

    (67) The B strain selected in the present study was HRV-14.

    (68) The sequences to be expressed are listed in Table 3 below.

    (69) TABLE-US-00019 TABLE 3 Sequences expressed Strain Name SEQ ID HRV-14 VPo 8 HRV-14 3pol 14 HRV-14 VP-pol 12

    Example 2: Expression and Purification of the Conserved Antigens

    (70) This example describes the protocol used to express and purify the antigens designed in Example 1.

    (71) Cloning and Expression

    (72) The same cloning strategy has been applied for all recombinant proteins. Briefly, each respective nucleotide sequence was optimized for E. coli expression and synthesized (Geneart). Several antigens were also engineered to be expressed as a recombinant fused peptide to the SUMO tag: the synthetic gene cloned in frame with the SUMO sequence in the T/A cloning site of the pET-SUMO vector was then expressed using the pET-SUMO expression system form Invitrogen.

    (73) As an example, VP0 peptide of HRV16 was expressed by BL21?DE3 E. coli transfected by the pET-SUMO plasmid encoding the HRV-16 VP0 gene. Optimal growth condition for the recombinant protein expression was obtained at 25? C. under agitation (220 rpm) with the Overnight Express Autoinduction System 1 from Novagen (FIG. 29).

    (74) For DNA immunization, each respective nucleotide sequence as described in tables 2 and 3 were cloned into the pcDNA3.1 plasmid commercialized by Invitrogen. Protein expression was checked by transfection in CHO cells and analyzed by western blot using an anti-histidin antibody before injection in mice.

    (75) Purification

    (76) Despite the presence of the SUMO tag located at the N-terminus, the different recombinant peptides were still expressed into the insoluble fractions as inclusion bodies. Their purification was performed according the manufacturer recommendations (Invitrogen) adapted for insoluble peptides.

    (77) Briefly, SUMO-fused peptides extracted with Tris/NaCl buffer containing 8M urea were loaded onto Nickel sepharose column (Pharmacia) for Immobilized Metal Affinity chromatography (IMAC). Purification was performed by applying an imidazole gradient to the column. Recombinant peptides eluted into the 250 mM of imidazole fractions were further dialysed against a digestion buffer (Tris 20 mM, NaCl 150 mM pH 8.0 containing 2M Urea) in order to cleave the SUMO moiety by the SUMO ULP-1 protease.

    (78) The HRV 16 VP0 obtained after digestion by the SUMO ULP-1 protease was further applied onto a second Nickel sepharose column in order to remove the SUMO moiety, the non-cleaved protein and the protease containing His tag.

    (79) The cleaved HRV 16 VP0 obtained after the second purification step was further dialysed against Tris/NaCl buffer (Tris 20 mM, NaCl 150 mM, Arginine 0.5 M, pH 8.0) compatible with animal experimentation.

    (80) The purity degree of the isolated peptide measured by monitoring on SDS-PAGE was about 90%

    Example 3: Immunogenicity of the Designed Antigens in Mice

    (81) This example demonstrates the immunogenicity of the peptides and fusion peptides of the invention in mice.

    (82) Materials and Methods

    (83) Immunization

    (84) 7-week-old C57BL/6 mice were immunized by subcutaneous (SC) route in the scapular belt on Day 0 and 21.

    (85) Each mouse was given 10 ?g of HRV16 VP0 protein (VP16) in a total volume of 200 ?l in presence or absence of IFA/CpG adjuvant (10 ?g CpG 1826 (MWG Eurofins, Ebersberg, Germany)+100 ?L Incomplete Freund's Adjuvant (IFA) per dose injected).

    (86) Protein Buffer (Tris 20 mM, NaCl 150 mM, Arginine 0.5 M pH 8.0) in presence or absence of IFA/CpG adjuvant was used as a negative control and administered in control groups of mice according to the same procedure.

    (87) Sampling Processing

    (88) Blood and spleens were collected on day 49 in Vacutainer Vials (BD Vacutainer SST II Nus plastic serum tube BD, Le Pont-De-Claix, France), kept overnight at 4? C. and centrifuged 20 min at 1660 g in order to separate serum from cells. Sera were conserved at ?20? C.

    (89) Spleens were collected under sterile conditions after sacrifice.

    (90) Western Blots

    (91) Anti-HRV16 VP0 IgG responses were analyzed by Western Blot from pooled sera.

    (92) HRV16 VP0 protein was mixed with a denaturation buffer containing NUPAGE LDS Sample Buffer at 2? (Invitrogen, Carlsbad, Calif.), 100 mM of Dithiothreitol (DTT) (SIGMA, St. Louis, Mo.) and water; and kept for 20 min at 95? C.

    (93) 2 ?g of protein were loaded on a polyacrylamide SDS gel (NuPAGE Novex 4-12% Bis-Tris Gel 1.0 mm, 12 well (Invitrogen), in NuPAGE MES SDS Running Buffer (Invitrogen)). Migration was performed for 30 min at 200 V. Molecular weight SeeBluePlus2 Pre-Stained Standard (Invitrogen) was used as a marker.

    (94) Protein was transferred onto a nitrocellulose membrane (Bio-Rad Laboratories, Hercules, Calif.) by semi-dry blotting in a NuPAGE transfer buffer (Invitrogen) for 1 h at 65 mA and constant voltage. The non-specific sites were blocked with phosphate-buffer saline (PBS, Eurobio, Courtaboeuf, France), 0.05% Tween 20 (VWR Prolabo Fontenay-sous-Bois, France) and 5% of powdered skim milk (DIFCO, Becton Dickinson, Sparks, USA), 1 h at room temperature under gentle agitation. The nitrocellulose membrane was incubated with pooled mouse sera diluted 1:200 in PBS-Tween 0.05% for 1 h under agitation. Horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, Suffolk, UK) diluted 1:2000 in PBS-Tween 0.05% were added for 1 h under agitation.

    (95) Membranes were washed 3 times (5 min) with PBS Tween 0.05% between each incubation.

    (96) Colorimetric revelation was performed with HRP substrate, 4-chloro-1-naphthol Opti-4CN (Bio-Rad) and acquired on GBox (Syngene).

    (97) ELISA

    (98) Anti-HRV16 VP0 IgG1 and IgG2a (or IgG2c responses in C57Bl/6 mice) responses were measured by ELISA.

    (99) Dynex 96-well microplates (Dynex Technologies, Berlin, Germany) were coated with 100 ng per well of VP16 in 0.05 M sodium carbonate buffer, pH 9.6 (SIGMA, Saint Louis, Mo.), overnight at 4? C. Non-specific sites were blocked with 150 ?l per well of PBS pH 7.1, 0.05% Tween 20, 1% of powdered skim milk (DIFCO) 1 h at 37? C.

    (100) Sera diluted in PBS-Tween 0.05%, milk 1%, were dispensed at 1:100 or 1:1000 in the first well of plates followed by two fold dilutions in the following wells.

    (101) After 1 h 30 of incubation at 37? C., plates were washed 3 times with PBS-Tween 0.05%.

    (102) HRV16 VP0-specific IgG1 and IgG2a were detected using Goat anti-Mouse IgG1-HRP, Human absorbed (Southern Biotech, Birmingham, Ala.) and Goat anti-Mouse IgG2a- or 2c-HRP, Human absorbed, (Southern Biotech, Birmingham, Ala.) diluted 1:4000 in PBS-Tween 0.05%, milk 1%, 1 h 30 at 37? C.

    (103) Nates were washed and incubated with TetraMethylBenzidine TMB (Tebu-bio laboratories, Le Perray-en-Yvelines, France) 30 min in the dark at room temperature. Colorimetric reaction was stopped with 100 ?l per well of HCl 1M (VWR Prolabo Fontenay-sous-Bois, France) and measured at 450 and 650 nm on a plate reader Versamax (Molecular Devices).

    (104) Blank values (mean negative controls values) were subtracted from the raw data (optical density (OD) 450-650 nm).

    (105) Titers were calculated with tendency function and expressed in arbitrary ELISA units (EU), which correspond to the inverse of the serum dilution giving an OD of 1.0.

    (106) Peptide Pools Used for Splenocytes Stimulation

    (107) Splenocytes were stimulated by peptide pools to monitor cytokines secretion by CBA or ELISPOTs assays. The peptides correspond to the identified cross-reactive domains of HRV1B and HRV14.

    (108) Peptides were synthesized and purified by JPT (Berlin, Germany). The peptides were 15mers overlapping on 11 amino acids. Each peptide was solubilized in DMSO (PIERCE, Thermo Fisher Scientific, Rockford, USA). The DMSO concentration had to be adjusted in such a way the final percentage of DMSO in cell cultures was always less than 1% in order to avoid DMSO toxicity on cells. Pools of about 40 peptides were constituted and kept frozen at ?80? C. until use.

    (109) The content of the respective peptide pools are presented below:

    (110) Pool C was composed of 15mers peptides (peptides 1 to 40), overlapping on 11 amino acids, covering amino acids 1 to 171 of the HRV1B VP0 protein of sequence SEQ ID NO: 17, at a concentration of 50 ?g/ml/peptide.

    (111) Pool D was composed of 15mers peptides (peptides 41 to 81), overlapping on 11 amino acids, covering amino acids 172 to 332 of the HRV1B VP0 protein of sequence SEQ ID NO: 17, at a concentration of 48.8 ?g/ml/peptide.

    (112) Pool A was composed of 15mers peptides (peptides 1 to 44), overlapping on 11 amino acids, covering amino acids 1 to 187 of the HRV1B 3pol peptide of sequence SEQ ID NO: 18, at a concentration of 45.5 ?g/ml/peptide.

    (113) Pool B was composed of 15mers peptides (peptides 45 to 89), overlapping on 11 amino acids, covering amino acids 188 to 365 of the HRV1B 3pol peptide of sequence SEQ ID NO: 18, at a concentration of 44.4 ?g/ml/peptide.

    (114) Pool E was composed of 15mers peptides (peptides 41 to 80), overlapping on 11 amino acids, covering amino acids 1 to 171 of the HRV14 VP0 protein of sequence SEQ ID NO: 8, at a concentration of 500 ?g/ml/peptide.

    (115) Pool F was composed of 15mers peptides (peptides 123 to 164), overlapping on 11 amino acids, covering amino acids 186 to 363 of the HRV14 3pol peptide of sequence SEQ ID NO: 14, at a concentration of 476.2 ?g/ml/peptide.

    (116) Measurement of Cytokines by Cytometric Bead Array (CBA)

    (117) Spleens were homogenized manually with a syringe plunger through a cell strainer (BD Biosciences, San Jose, Calif.) and treated with Red Blood Cell Lysing Buffer Hybri Max (SIGMA, Saint Louis, Mo.) to lyse red cells. Cells were washed 2 times with RPMI 1640 medium with HEPES (Gibco, Paisley, UK), supplemented with 2% of decomplemented foetal calf serum (FCS) (HYCLONE Hyclone, Logan, Utah), 50 ?M of 2-mercaptoethanol (Gibco), 2 mM of L-Glutamine (Gibco) and 100 units/mL of Penicillin-Streptomycin (Gibco). Cells were counted on a Multisizer and resuspended in complete medium with RPMI 1640 medium (Gibco), supplemented with 10% of decomplemented FCS (HYCLONE), 50 ?M of 2-mercaptoethanol (Gibco), 2 mM of L-Glutamine (Gibco) and 100 units/mL of Penicillin-Streptomycin (Gibco). 4?10.sup.5 cells per well were distributed in Flat-bottom 96 well plate (BD Biosciences, San Jose, Calif.) and stimulated with the pools of peptides corresponding to the different HRV1B or HRV14 antigens tested: HRV1B 3Pol, HRV14 3Pol, HRV1B VP0 and HRV14 VP0. Peptide pools were used at 1 ?g/ml for each peptide. Concanavalin A (SIGMA) was used at 2.5 ?g/mL as a positive stimulation control.

    (118) After 3 days of stimulation at 37? C., 5% CO.sub.2, supernatants were harvested and frozen at ?80? C. until analysis.

    (119) IL-2, IL-4, IL-5, TNF-? and IFN-? concentrations were measured using the cytometric bead array (CBA) mouse Th1/Th2 cytokine kit (BD Biosciences, San Diego, Calif.). The samples were analyzed using Facscalibur (Becton Dickinson) FACS. Data were analyzed using FCAP Array software (Becton Dickinson).

    (120) Cytokine ELISPOTs

    (121) Splenocytes were collected and prepared as described above.

    (122) 2?10.sup.5 cells per well were distributed and stimulated with the pools of peptides as described above, and murine IL-2 at 20 U/ml in 96-well multiscreenHTS HA plates Cellulose ester, 0.45 ?M (Millipore, Bedford, Mass.). Concanavalin A (SIGMA) was used at 2.5 ?g/mL as a positive stimulation control. Nates had been previously coated overnight at 4? C. either with rat anti-mouse IFN-? antibody (BD Pharmingen, San Diego, Calif.) or with rat anti-mouse IL-5 antibody (BD Pharmingen) at 1 ?g per well in sterile PBS 1?, and blocked 1 h at 37? C. in complete medium. Stimulation of splenocytes was performed 18 h at 37? C., 5% of CO.sub.2.

    (123) Plates were washed 3 times with PBS 1? and then 3 times with PBS-Tween 0.05%. Biotinylated rat anti-mouse IFN-? or IL-5 antibody (BD PharMingen) were distributed at 100 ng per well in PBS-Tween 0.05%, 2 h at 20? C., in the dark.

    (124) Plates were washed 3 times with PBS-Tween 0.05% and incubated with streptavidin-horseradish peroxydase (Southern Biotech) in PBS-Tween 0.05%, 1 h at 20? C., in the dark.

    (125) Plates were then washed 3 times with PBS Tween 0.05%, and then 3 times with PBS 1?.

    (126) Substrate solution (3-amino-9-ethylcarbazole, AEC) was added 15 min at 20? C. in the dark to reveal spots. Reaction was stopped with water. AEC substrate solution was prepared by mixing 9 ml distilled water, 1 ml acetate buffer, 0.250 ml AEC (SIGMA) and 5 ?l H.sub.2O.sub.2 then filtering the solution at 0.22 ?m. Each spot corresponding to an IFN-? or IL-5 secreting cell was enumerated with an automatic ELISPOT reader. Negative controls background values were subtracted. Results were expressed as number of IFN-? or IL-5 spots per 10.sup.6 splenocytes.

    (127) Results

    (128) Antibody Response Against HRV16 VP0

    (129) The inventors first assessed the immunogenicity of subcutaneously delivered HRV16 VP0 protein. Analysis of antibody responses by Western Blot showed that IgG specific for HRV16 VP0 was detectable in serum 28 days post-immunization. In mice treated with VP0 protein alone, VP0-specific IgG1 and IgG2c, Th2 and Th1 associated IgG isotypes respectively, were detected.

    (130) Hypothesizing a Th1 oriented immune response might be beneficial to the outcome of rhinovirus infection, the inventors attempted to induce a Th1 skewed response to HRV16 VP0 using a combination of incomplete freund's (IFA) and CpG adjuvants (IFA/CpG). The addition of IFA/CpG to the immunogen switched the antibody response towards a substantially more prominent IgG2c response.

    (131) Cellular Responses Against HRV16 VP0

    (132) Having established that HRV16 VP0 is immunogenic in mice, the inventors next assessed the T cell response to immunization by measuring splenocyte cytokine production in response to stimulation with VP0 (or control polymerase) peptides.

    (133) Stimulation with control viral polymerase peptides did not induce cytokine production. In both ELISPOT (FIG. 1) and cytometric bead array (FIG. 2) assays VP0 peptide pool stimulation induced IL-5, or both IL-5 and IFN-? production respectively, in cells from mice immunized with VP0 protein alone, indicating a Th2 or mixed Th1/Th2 orientated response. The addition of IFA/CpG adjuvant to the immunogen caused a near complete suppression of IL-5 and substantial increase in IFN-? responses. Importantly, splenocytes from major group HRV16 VP0 protein immunized mice produced cytokines when stimulated with a pool of VP0 peptides from a heterologous strain (HRV1B) of the same species (Type A rhinovirus) but belonging to the minor group and with a pool of VP0 peptides from a strain (HRV14) belonging to an another species (Type B rhinovirus), indicating cross-serotype and inter-group reactivity.

    (134) This example thus demonstrates the immunization induces a peptide specific, cross-serotype immune response.

    Example 4: Outcome of HRV Challenge in Immunized Mice

    (135) This example demonstrates the potency of the immunogenic compositions of the invention to protect against rhinovirus infection in mice challenged with rhinovirus.

    (136) Materials and Methods

    (137) Rhinovirus Production

    (138) Rhinovirus (HRV) serotypes 1B and 29 (ATCC ref VR-1366 and VR-1139) were propagated in H1 HeLa cells (ATCC ref CRL-1958) that are highly permissive to rhinovirus infection. Cells were infected for 1 h at room temperature with shaking and incubated at 37? C. until approximately 90% cytopathic effect (CPE) was observed. Harvested cells were then washed, re-suspended in sterile PBS and lysed by repeated freeze-thawing. Cell debris was pelletted by centrifugation. Virus was precipitated with 0.5 M NaCl and 7% (w/v) polyethylene glycol 6000 (Fluka, Germany). After further PBS washes and filtration with a 0.2 ?M syringe filter, virus was concentrated using Amicon ultra centrifugal filtration devices (Millipore, USA).

    (139) HRV stocks were originally obtained from the American Type Tissue Culture Collection (ATCC) and were periodically neutralised with ATCC reference antisera to confirm serotype.

    (140) A purified HeLa lysate preparation was generated as a control for virus binding ELISA assays. Purification was performed using the same protocol as described for RV stocks, but from uninfected H1 HeLa cells.

    (141) Virus was titrated in Ohio HeLa cells (UK Health Protection Agency catalogue ref 84121901) prior to use and tissue culture infectious dose 50% (TCID50) was calculated using the Spearman-Karber method.

    (142) In Vivo Protocols

    (143) Mice

    (144) Wild type (w/t), specific pathogen free, female C57BL/6 mice were purchased from Harlan or Charles River UK and housed in individually ventilated cages.

    (145) C57BL/6 Immunisation and Infection Studies

    (146) On days 0 and 21 w/t C57BL/6 mice were immunised subcutaneously with either 100 ?l of emulsion containing: 10 ?g HRV16 VP0 protein, 10 ?l CpG oligonucleotide (100 ?M ODN 1826; Invivogen, USA), and 40 ?l incomplete freund's adjuvant (IFA) (Sigma-Aldrich) in sterile PBS (PAA laboratories), or IFA/CpG adjuvant alone, or PBS alone. On day 51, mice were challenged intranasally with 5?10.sup.6 TCID50 of HRV1B or HRV29, or mock challenged with 50 ?l PBS. The protocols carried out in the different groups of mice are summarised in Table 4.

    (147) TABLE-US-00020 TABLE 4 Protocols Group Immunisation 1 Immunisation 2 Challenge RV-Immunised HRV16 VPo + HRV16 VPo + HRV1B or HRV29 IFA/CpG IFA/CpG RV-Adjuvant IFA/CpG IFA/CpG HRV1B or HRV29 RV-PBS PBS PBS HRV1B or HRV29 PBS-Immunised HRV16 VPo + HRV16 VPo + PBS IFA/CpG IFA/CpG

    (148) Mice were killed by terminal anaesthesia with pentobarbitone at various time-points during the 14 days following intranasal challenge. In an initial experiment, mice were immunised with PBS as a control (RV-PBS group in table 4) to assess the effects of adjuvant treatment alone (RV-adjuvant in table 4). No differences in the results were observed between the RV-adjuvant and the RV-PBS groups in any endpoint analyses. The RV-PBS group was therefore not included in subsequent studies and no data are displayed for this group of mice.

    (149) Tissue Harvesting and Processing

    (150) Bronchoalveolar Lavage (BAL)

    (151) Lungs were lavaged via the trachea with 1.5 ml BAL fluid (PBS, 55 mM disodium EDTA (Gibco), 12 mM lidocaine hydrochloride monohydrate (Sigma-Aldrich)) and cells were separated by centrifugation according to the method described by Bartlett & Walton (2008) Nature Medicine 14:199-204.

    (152) Red cells were lysed using ACK buffer (0.15 M NH.sub.4Cl, 1.0 mM KHCO.sub.3, 0.1 mM Na.sub.2EDTA in dH.sub.2O) and cells stored in RPMI 1640 medium (PAA laboratories) (containing 10% FCS, 100 U/ml penicillin, 100 ?g/ml streptomycin (P/S)).

    (153) Lung Tissue Cells for Flow Cytometry Assays

    (154) Lung tissue was incorporated in a digestion buffer (RPMI 1640 medium, P/S, 1 mg/ml collagenase type XI (Sigma-Aldrich), 80 U/ml bovine pancreatic DNase type I (Sigma-Aldrich)), crudely homogenised using the gentleMACS tissue dissociator (Miltenyi Biotech) and incubated at 37? C. for 45 min. After homogenisation to generate a single cell suspension, red cells were lysed by addition of ACK buffer. Cells were then filtered through a 100 ?m cell strainer, washed with PBS and re-suspended in RPMI 1640 medium supplemented with 10% FCS, P/S.
    Lung Tissue for RNA Extraction
    A small upper lobe of the right lung was excised and stored in RNA later RNA stabilisation buffer (Qiagen) at ?80? C.
    Blood
    Blood was collected from the carotid arteries into microtainer serum separation tubes (BD biosciences). Serum was separated by centrifugation and stored at ?80? C. until analysis.
    BAL Cell Cytospin Assay

    (155) BAL cells were spun onto slides using the cytospin 3 system (Shandon, USA) and stained with the Reastain Quick-diff kit (Reagena, Finland). At least 300 cells per slide were counted blind to experimental conditions.

    (156) Flow Cytometry

    (157) Surface Marker Staining

    (158) Surface marker staining of lung and BAL lymphocytes was performed using standard protocols. Briefly, 1-10?10.sup.5 lung or BAL cells were stained with live/dead fixable dead cell stain kit (Invitrogen) for 30 min at 4? C. Cells were then washed and incubated with 5 ?g/ml anti-mouse CD16/CD32 to block non-specific binding to FC receptors. Directly fluorochrome-conjugated antibodies specific for CD3 (CD3-Pacific Blue; clone 500A2), CD4 (CD4-APC; clone RM4-5), CD8 (CD8-PE; clone 53-6.7), CD69 (CD69-FITC; clone H1.2F3), CD62L (CD62L-PE; clone MEL-14), CD44 (CD44-FITC; clone IM7) T cell markers, all purchased from BD biosciences, were added directly and cells incubated for a further 30 min period at 4? C. After several washes, cells were fixed with 2% formaldehyde for 20 min at room temperature, again washed, re-suspended in PBS 1% BSA and stored at 4? C.
    Intracellular Cytokine Staining
    For intracellular cytokine staining, lung cells were stained for dead cells and surface markers, and fixed as described. After washing, cells were permeablised with 0.5% (w/v) saponin (Fluka) for 10 min at room temperature. Fluorochrome conjugated anti-cytokine antibodies in PBS 0.5% saponin were added directly and cells incubated for a further 30 min at 4? C. Cells were again washed, re-suspended in PBS 1% BSA and data acquired immediately.
    Data Acquisition
    Flow cytometry data was acquired using CyanADP (Dako, USA) or FACSCanto (BD biosciences) cytometers and analysed using Summit v4.3 software (Dako, USA).
    Enzyme Linked Immunospot (ELISPOT) Assay
    IFN-? and IL-4
    96 well Multiscreen HA ELISPOT plates (Millipore) were coated overnight at 4? C. with 5 ?g/ml purified anti-mouse IFN-? or IL-4 antibody (both BD biosciences) in PBS. The following day, plates were washed and blocked with RPMI 1640 medium supplemented with 10% FCS, P/S for 3 h at 37? C. 5?10.sup.4 or 1?10.sup.5 lung cells in 100 ?l RPMI 1640 medium supplemented with 10% FCS, P/S were added to each well, followed by 100 ?l medium containing various stimuli, as described in table 5.

    (159) TABLE-US-00021 TABLE 5 ELISPOT stimuli Stimulus Details Final concentration PMA/Ionomycin n/a 50/500 ng/ml Ovalbumin n/a 500 ?g/ml HRV1Bor HRV29 Purified virus preparations 1 ? 10.sup.6TCID.sub.50/ml as used for infections Peptide pool C RV1B VPO region 4 ?g/ml overlapping peptides Peptide pool E RV14 VPO region 4 ?g/ml overlapping peptides RV16 VPO protein Peptide as used for 25 ?g/ml immunisation DMSO Control for peptide pools 0.8% (v/v) Unstimulated Control for virus, OVA and RPMI 1640 medium. PMA/ionomycin stimuli 10% FCS P/S n/a: not applicable

    (160) Nates were incubated for 3 days at 37? C. Nates were then washed with PBS 0.05% Tween 20 (PBS-T; Sigma-Aldrich) and subsequently with sterile water to lyse cells. Biotinylated secondary antibodies, at 2 ?g/ml in PBS 0.5% BSA, were then added and incubated for 2 h at 37? C. After washes, plates were incubated with Extravidin alkaline phosphatase (Sigma-Aldrich) for 45 min at room temperature and washed with PBS-T followed by sterile PBS. NBT/BCIP substrate (Sigma-Aldrich) was added and incubated for a further 5 min period. Reactions were stopped by extensive washing with tap water.

    (161) Data Acquisition

    (162) All ELISPOT data were acquired using an AID version 3.5 EliSpot Reader (AID GmbH, Germany).

    (163) Enzyme Linked Immunosorbant (ELISA)

    (164) Cytokines

    (165) All cytokine and chemokine proteins were assayed using protocols and reagents from Duoset ELISA kits (R&D systems) and Nunc Maxisorp Immunoplates (Thermo-Fisher). All samples were measured in duplicate and protein levels were quantified by comparison with an 8 point standard curve of recombinant protein.

    (166) RV-Specific Immunoglobulins

    (167) RV-specific IgG's and IgA were measured using in-house assays. For all assays, Nunc Maxisorp Immunoplates (Thermo-Fisher) were coated with purified RV innoculum or HeLa lysate control to a protein concentration of 5 ?g/ml and incubated overnight at 4? C. Nates were then washed with PBS and blocked by adding PBS containing 0.05% Tween 20 and 5% milk powder (PBST-milk). Serum or BAL, diluted in PBS 5% milk were then added and plates incubated overnight at 4? C. Each dilution was analysed in duplicate. Nates were washed with PBST and bound immunoglobulins were detected using biotinylated rat anti-mouse IgG1, IgG2a or IgA (all BD biosciences) diluted 1/1000 before the addition of streptavidin-peroxydase (Invitrogen, Paisley UK). Finally, TMB substrate (Invitrogen) was added and reactions were stopped by addition of an equal volume of H.sub.2SO.sub.4.

    (168) For analysis of IgA in BAL, samples were allowed to mix with protein G sepharose beads (Sigma-Aldrich) overnight at 4? C. After centrifugation to remove the sepharose beads and bound IgG, the unbound fraction containing IgA was retained and used in ELISA experiments. Depletion of IgG in the samples was confirmed by showing loss of binding to HRV by ELISA.

    (169) In all assays, antibody binding to a HeLa lysate control was assessed on the same plate as binding to virus innoculum. HeLa lysate values were subtracted during analysis to show virus-specific antibody binding.

    (170) Data Acquisition

    (171) In all ELISA assays absorbance was measured at 450 nm using a Spectramax Nus plate reader and analysed with Softmax Pro v50.2 software (Molecular Devices).

    (172) Neutralisation Assays

    (173) Neutralisation of HRV serotypes was measured in infected HeLa cells. Sera of a given treatment group and time point post-challenge were pooled and serial dilutions in DMEM medium supplemented with 4% FCS, P/S were made. 50 ?l of the serial dilutions to be tested were introduced (in duplicate) into wells of 96 well flat bottom cell culture plates, before the addition of 50 ?l from the purified stock of HRV in DMEM medium. The appropriate titer of HRV serotype introduced in the wells was defined as the dilution of the stock of HRV which produced a cytopathic effect (CPE) of 90% in 3 days. Nates were incubated at room temperature with shaking to form Antibody-Antigen complexes. After 1 h, 1.5?10.sup.5 Ohio HeLa cells were added to each well and plates were further incubated for 48-96 h at 37? C.

    (174) CPE of HRV was measured by crystal violet cell viability assay. Nates were washed with PBS and 100 ?l of 0.1% crystal violet solution was added to each well and incubated for 10 min at room temperature. Nates were then washed with distilled H.sub.2O and air dried. 100 ?l/well of 1% sodium dodecyl sulfate (SDS) was added and plates were incubated at room temperature with shaking for 15 min or until all crystal violet had dissolved. Optical Density was measured at 560 nm.

    (175) Taqman Quantitative PCR

    (176) RNA Extraction

    (177) Lung tissue was placed in RLT buffer (Qiagen, USA) and homogenised using a rotor-stator homogenizer. RNA was then extracted using reagents and protocols from the RNeasy Mini Kit (Qiagen), including on-column Dnase digestion step.

    (178) Reverse Transcription

    (179) cDNA was generated in 20 ?l reactions using the Omniscript RT kit (Qiagen) and random hexamer primers (Promega, USA). All reactions comprised 1 ?M random primers, 0.5 mM (each) dNTPs and 0.2 U/?l reverse transcriptase. Reactions were performed at 37? C. for 1 h.

    (180) PCR

    (181) Quantitative PCR (qPCR) reactions were carried out using Quantitect Probe PCR Mastermix (Qiagen) and primers and FAM/TAMRA labelled probes specific for the gene of interest, 18S ribosomal RNA, or the 5 untranslated region of RV. Primers and probes are described in table 6.

    (182) TABLE-US-00022 TABLE6 TaqmanqPCRprimersandprobes Concen- SEQ tration Assay Primer Sequence5-3 ID (nM) IL-4 IL-4 ACAGGAGAAGGGACGCCAT 23 900 Forward IL-4 GAAGCCCTACAGACGAGCTCA 24 900 Reverse IL-4 FAM-TCCTCACAGCAACGAAGA- 25 100 Probe TAMRA IFN-? IFN-? TCAAGTGGCATAGATGTGGAAGAA 26 900 Forward IFN-? TGGCTCTGCAGGATTTTCATG 27 900 Reverse IFN-? FAM-TCACCATCCTTTTGCCAGTT- 28 100 Probe TAMRA IL- IL-17a TCAGACTACCTCAACCGTTCCA 29 900 17a Forward IL-17a AGCTTCCCAGATCACAGAGGG 30 900 Reverse IL-17a FAM- 31 100 Probe TCACCCTGGACTCTCCACCGCA- TAMRA HRV HRV GTGAAGAGCCSCRTGTGCT 32 50 Forward HRV GCTSCAGGGTTAAGGTTAGCC 33 300 Reverse HRV FAM- 34 100 Probe TGAGTCCTCCGGCCCCTGAATG- TAMRA 18S 18S CGCCGCTAGAGGTGAAATTCT 35 300 Forward 18S CATTCTTGGCAAATGCTTTCG 36 300 Reverse 18S FAM- 37 100 Probe ACCGGCGCAAGACGGACCAGA- TAMRA

    (183) Cycling conditions were as follows: 2 min at 50? C., 10 min at 95? C. and 45 cycles of 95? C. for 15 seconds and 60? C. for 1 minute. For the 18S assay, cDNA was diluted 1 in 100 in nuclease free water before addition to the reaction.

    (184) Reactions were performed on a 7500 fast real time PCR system (ABI).

    (185) Results

    (186) Following immunogenicity experiments, the effect of immunization with HRV16 VP0 protein adjuvanted with IFA/CpG on HRV-induced disease was assessed in the mouse infection model. These experiments were carried out to determine if prior immunization could induce a similar Th1/Tc1 response in the airways of infected mice as found systemically and to determine the effect of this on disease markers and virus load.

    (187) Immunization Enhances Airway T Cell Responses to Infection with a Heterologous RV Strain

    (188) The inventors assessed the impact of immunization with HRV16 VP0 in the presence of IFA/CpG on the immune responses observed after intranasal challenge with a heterologous serotype of HRV (HRV1B).

    (189) Differential staining of bronchoalveolar lavage (BAL) leukocytes by cytospin assay showed that immunization significantly increased the magnitude of the lymphocyte response to infection when compared to adjuvant treated and infected mice (group RV-Adjuvant) (FIG. 3).

    (190) To characterize this lymphocyte response further, T cells in BAL and lung were analyzed by flow cytometry. CD4+ T cell number was increased in both BAL and lung, and CD8+ T cell number was increased in BAL of mice immunized and infected (group RV-immunized) vs mice treated with adjuvant and infected (group RV-adjuvant) on day 6 post-infection (FIG. 4). This response was dominated by CD4+ T cells. In infected mice the proportion of BAL and lung T cells expressing the early activation marker CD69 was also significantly increased by immunization (FIG. 5). Enhanced levels of T cell chemokine CXCL10 in BAL were also observed in immunized and infected vs adjuvant treated and infected mice (FIG. 6).

    (191) Immunization Induces Antigen-Specific Lung Th1 Responses to Infection

    (192) The inventors also examined the effect of immunization on the polarity and antigen specificity of T cell responses after a heterologous challenge with the HRV1B serotype. Immunization significantly increased the levels of Th1 (IFN-?), and Th2 (IL-4) cytokine mRNAs in lung tissue of HRV1B challenged mice (FIG. 7). Consistent with the use of the Th1-promoting adjuvants, this response was dominated by IFN-? in the group of RV-immunized mice. At the protein level, IL-4 was undetectable in BAL of all groups whereas increased IFN-? were detected at 24 and 48 h post-infection only in immunized and challenged mice (group RV-immunized) (FIG. 8).

    (193) Since immunization generated cross-reactive, VP0-specific cells in the spleen, the inventors determined if cross-reactive memory cells were recruited to the airways after infection by measuring IFN-? production by lung cells stimulated with different stimuli using ELISPOT assays. The frequency of IFN-? producing lung cells was greatest in mice which were both immunized and RV challenged (group RV-immunized) (FIG. 9). Stimulation with the same protein as the one used for immunization (HRV16 VP0), with a live heterologous serotype (HRV1B), or with heterologous HRV1B or HRV14 VP0 peptide pools induced similar IFN-? responses. With the exception of HRV16 VP0 stimulation in RV-adjuvant treated mouse cells, IFN-? producing cell frequency was not significant above unstimulated controls in other treatment groups. HRV16 VP0 immunization therefore induced cross-reactive Th1/Tc1 responses in the lung in response to HRV1B challenge that were of significantly greater magnitude than with HRV infection alone.

    (194) Immunization Increases T Cell Responses to Infection with a More Distantly Related HRV Serotype

    (195) HRV16 and HRV1B belong to different receptor binding groups, but are highly related at the amino acid level within VP0. To establish if immunization induces more broadly cross-reactive responses among type A rhinoviruses, the inventors therefore determined the effects on responses to challenge with the more distantly related serotype, HRV29.

    (196) BAL cell analysis by cytospin assay revealed increased lymphocyte numbers in RV-immunized vs RV-adjuvant treated mice (Figure to). Total and activated CD4+ T cell number in lung tissue (FIG. 11) and BAL (FIG. 12) were also significantly increased compared to infection or immunization treatments alone. When lung leukocytes were stimulated with HRV antigens in ELISPOT assays, IFN-? producing cell frequency was significantly greater after stimulation with the challenge serotype (HRV29) in RV-immunized vs RV-adjuvant treated mice (FIG. 13). Similar increases were apparent upon stimulation with heterologous HRV1B and HRV14 VP0 derived peptide pools, again indicating the presence of cross-serotype cell mediated immune responses. It was also shown by intracellular flow cytometry a significant increase of IFN-? producing CD8+ T cells in the lungs of infected and immunized mice (1 day after infection) followed by an increase of IFN-? producing CD4+ T cells (6 days after infection) while nothing significant was observed in the other groups of mice (RV-adjuvant or PBS-immunized groups) (FIG. 14). This suggests that the cell mediated immune response induced by the composition of the invention is dominated by a Th1 response but a Tc1 immune response is also involved to a lesser extent.

    (197) Immunization Enhances Generation of Lung Effector Memory T Cells

    (198) Activated CD4+ T cells persisted in the lungs of immunized and challenged mice on day 14 post-infection (FIG. 11). To determine if this represented enhanced generation of local memory T cells the inventors analyzed by flow cytometry the expression of memory markers on lung CD4+ T cells. The proportion of CD4+ T cells expressing the CD44+CD62L.sup.low (effector memory marker) phenotype was significantly higher in the group of RV-immunized mice compared to the other groups (RV-adjuvant or PBS-immunized groups). On the other hand, the proportion of lung CD4+ T cells expressing a central memory phenotype, CD44+CD62L.sup.high, was not increased in the group of RV-immunized mice (FIGS. 15 and 16).
    Immunization Enhances Neutralizing Antibody Responses to Heterologous Virus Infection

    (199) The inventors also studied the effect of immunization on the generation of humoral immune responses by measuring the ability of serum and BAL immunoglobulins to bind and neutralize the activity of rhinovirus.

    (200) ELISA binding assays showed that immunization with HRV16 VP0 in the absence of challenge induced cross-reactive HRV29 and HRV1B binding antibodies observed in the serum but not in the BAL (FIGS. 17-20).

    (201) When followed by HRV1B or HRV29 challenge, immunization generated a faster and greater cross-reactive antibody response observed both in the serum and in the BAL.

    (202) While immunization with HRV16 VP0 without a rhinovirus challenge did not induce neutralizing antibodies, a faster and greater induction of neutralizing antibodies was observed when immunization with HRV16 VP0 was followed by a rhinovirus challenge. The induction of neutralizing antibodies against the infecting rhinovirus strain/serotype was consistently observed in the group of immunized mice (RV-immunized) while it was inconsistently observed in the group of adjuvant-treated mice (RV-adjuvant). Furthermore, the production of neutralizing antibodies was slower and of weaker magnitude in the RV-adjuvant group. (See FIGS. 21 and 22). The neutralizing antibodies titers in each group of mice (RV-immunized and RV-adjuvant) were measured in an in vitro neutralization assay on Ohio Hela cells using the same strain of rhinovirus that the one used in the challenge test (table 7).

    (203) TABLE-US-00023 TABLE 7 ID50 values Infection RV- RV- PBS- serotype Day immunized adjuvant immunized HRV1B 6 326.9 14 3218 160.2 HRV29 6 150.1 14 309.2

    (204) As mentioned in table 7, the mean inverse dilution of sera from HRV1B-immunized group that produces a 50% reduction of CPE on Ohio hela cells is 1328 vs 160.2 in the HRV1B-adjuvant group.

    (205) Collectively, these data indicate that immunization with HRV16 VP0 in the presence of IFA/CpG is capable of substantially enhancing neutralizing antibody responses to infection with heterologous viruses.

    (206) Immunization Accelerates Virus Clearance

    (207) Finally, the inventors determined whether Th1 and neutralizing antibody responses induced by immunization conferred any benefit on control of virus replication. When immunized mice were challenged with HRV1B or HRV29 (RV-immunized), the clearance of the virus from the lung was observed on day 4 and on day 6 after the challenge respectively and was greatly accelerated by comparison to the one observed in the adjuvant-treated group (RV-Adjuvant) (see FIGS. 23 and 24).

    Example 5: Immunogenicity of 3Pol and VP-Pol Proteins in Mice

    (208) 7 week-old C56BL/6 or BalB/cByJ mice were immunized with either the last 105 amino acids of the RNA polymerase of HRV16 (3Pol RV16) or with the fusion protein comprising the first 135 amino acids of VP0 of HRV1B coupled to the last 105 amino acids of the RNA polymerase of HRV1B (VP-Pol RV1B) according to the protocol described in example 3.

    (209) The results displayed in FIGS. 25 to 27 show that the addition of IFA/CpG to the immunogen switched the cellular immune response towards a Th1 cellular immune response. As shown for HRV16 VP0 in the previous examples, the cell mediated immune response observed is a specific cross-reactive cell mediated immune response. In the case of immunization with 3Pol RV16, IFN-? responses were induced only against the peptide pool B of 3Pol (this peptide pool encompasses the last 105 amino acids of the C-terminal end of the RNA polymerase protein) of heterologous serotypes of rhinoviruses (HRV1B and HRV14). In the case of immunization with VP-Pol RV1B, IFN-? responses were induced only against the peptide pool B of 3Pol (this peptide pool encompasses the last 105 amino acids of the C-terminal end of the RNA polymerase protein) and the peptide pool C of VP0 (this peptide pool encompasses the first 135 amino acids of VP0) of HRV1B.

    Example 6: Immunization with DNA Constructs

    (210) 7 week-old C56 BL/6 or BalB/cByJ mice were given by intramuscular route in the legs on days 0 and 21 100 ?g of the pcDNA3.1 plasmid encoding either the last 105 amino acids of the RNA polymerase of HRV14 (3Pol DNA RV14) or the VP0 amino acid sequence of HRV16 (VP0 DNA RV16). The splenocytes were harvested on day 28 and stimulated with different pools of peptides and analyzed for their IFN-? responses.

    (211) The results presented in FIG. 28 show that DNA immunization with plasmids encoding the last 105 amino acids of the RNA polymerase of a rhinovirus or the VP0 protein of a rhinovirus are able to induce a specific cross-reactive cell mediated immune response.